>Feature sequence001 1774 719 gene locus_tag LOCUS_00010 1774 719 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954183.1 protein_id gnl|my_center|LOCUS_00010 3606 1771 gene locus_tag LOCUS_00020 3606 1771 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_00020 4391 3603 gene locus_tag LOCUS_00030 gene hisN 4391 3603 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_00030 5329 4400 gene locus_tag LOCUS_00040 5329 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5458 6165 gene locus_tag LOCUS_00050 5458 6165 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626528.1 protein_id gnl|my_center|LOCUS_00050 6177 7013 gene locus_tag LOCUS_00060 6177 7013 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_00060 8796 8005 gene locus_tag LOCUS_00070 8796 8005 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388722.1 protein_id gnl|my_center|LOCUS_00070 11195 8814 gene locus_tag LOCUS_00080 11195 8814 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_00080 11770 11273 gene locus_tag LOCUS_00090 11770 11273 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531265.1 protein_id gnl|my_center|LOCUS_00090 11919 12347 gene locus_tag LOCUS_00100 11919 12347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12434 13858 gene locus_tag LOCUS_00110 12434 13858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13908 14852 gene locus_tag LOCUS_00120 13908 14852 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_00120 14852 15832 gene locus_tag LOCUS_00130 14852 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15936 16121 gene locus_tag LOCUS_00140 15936 16121 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035328.1 protein_id gnl|my_center|LOCUS_00140 16309 16569 gene locus_tag LOCUS_00150 16309 16569 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919553.1 protein_id gnl|my_center|LOCUS_00150 16737 17591 gene locus_tag LOCUS_00160 16737 17591 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626403.1 protein_id gnl|my_center|LOCUS_00160 17872 18666 gene locus_tag LOCUS_00170 17872 18666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18749 18840 gene locus_tag LOCUS_t00010 18749 18840 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19584 20135 gene locus_tag LOCUS_00180 19584 20135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21030 20335 gene locus_tag LOCUS_00190 21030 20335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21662 21111 gene locus_tag LOCUS_00200 21662 21111 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_00200 21842 22321 gene locus_tag LOCUS_00210 21842 22321 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_00210 22323 23423 gene locus_tag LOCUS_00220 22323 23423 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_00220 23378 24829 gene locus_tag LOCUS_00230 23378 24829 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_00230 24829 25812 gene locus_tag LOCUS_00240 24829 25812 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388405.1 protein_id gnl|my_center|LOCUS_00240 25881 26954 gene locus_tag LOCUS_00250 25881 26954 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389596.1 protein_id gnl|my_center|LOCUS_00250 26968 27837 gene locus_tag LOCUS_00260 gene motA 26968 27837 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918636.1 protein_id gnl|my_center|LOCUS_00260 28377 27853 gene locus_tag LOCUS_00270 28377 27853 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104495.1 protein_id gnl|my_center|LOCUS_00270 28659 30944 gene locus_tag LOCUS_00280 28659 30944 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_00280 30907 32343 gene locus_tag LOCUS_00290 30907 32343 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836186.1 protein_id gnl|my_center|LOCUS_00290 32397 32540 gene locus_tag LOCUS_00300 32397 32540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 32655 34178 gene locus_tag LOCUS_00310 32655 34178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00310 34306 37269 gene locus_tag LOCUS_00320 34306 37269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37256 38098 gene locus_tag LOCUS_00330 37256 38098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38124 39440 gene locus_tag LOCUS_00340 38124 39440 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268208.1 protein_id gnl|my_center|LOCUS_00340 40349 39507 gene locus_tag LOCUS_00350 40349 39507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40992 40552 gene locus_tag LOCUS_00360 gene mntR 40992 40552 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398443.1 protein_id gnl|my_center|LOCUS_00360 41084 41293 gene locus_tag LOCUS_00370 41084 41293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 41290 42627 gene locus_tag LOCUS_00380 41290 42627 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550958.1 protein_id gnl|my_center|LOCUS_00380 42782 43672 gene locus_tag LOCUS_00390 42782 43672 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526233.1 protein_id gnl|my_center|LOCUS_00390 43669 44445 gene locus_tag LOCUS_00400 43669 44445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522663.1 protein_id gnl|my_center|LOCUS_00400 44442 45260 gene locus_tag LOCUS_00410 44442 45260 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200770.1 protein_id gnl|my_center|LOCUS_00410 45692 45225 gene locus_tag LOCUS_00420 gene zur 45692 45225 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 protein_id gnl|my_center|LOCUS_00420 45796 46053 gene locus_tag LOCUS_00430 45796 46053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 46222 46749 gene locus_tag LOCUS_00440 gene grpE 46222 46749 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313642.1 protein_id gnl|my_center|LOCUS_00440 46887 48800 gene locus_tag LOCUS_00450 gene dnaK 46887 48800 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391302.1 protein_id gnl|my_center|LOCUS_00450 48877 50013 gene locus_tag LOCUS_00460 gene dnaJ 48877 50013 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626618.1 protein_id gnl|my_center|LOCUS_00460 50540 50040 gene locus_tag LOCUS_00470 50540 50040 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148772447.1 protein_id gnl|my_center|LOCUS_00470 50666 51223 gene locus_tag LOCUS_00480 50666 51223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51318 52076 gene locus_tag LOCUS_00490 51318 52076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 53508 52069 gene locus_tag LOCUS_00500 gene nuoN 53508 52069 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090482.1 protein_id gnl|my_center|LOCUS_00500 54998 53505 gene locus_tag LOCUS_00510 gene nuoM 54998 53505 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097684.1 protein_id gnl|my_center|LOCUS_00510 56866 54995 gene locus_tag LOCUS_00520 gene nuoL 56866 54995 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405115.1 protein_id gnl|my_center|LOCUS_00520 57174 56869 gene locus_tag LOCUS_00530 gene nuoK 57174 56869 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090475.1 protein_id gnl|my_center|LOCUS_00530 57692 57174 gene locus_tag LOCUS_00540 gene nuoJ 57692 57174 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090473.1 protein_id gnl|my_center|LOCUS_00540 58207 57689 gene locus_tag LOCUS_00550 gene nuoI 58207 57689 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210273.1 protein_id gnl|my_center|LOCUS_00550 59185 58226 gene locus_tag LOCUS_00560 gene nuoH 59185 58226 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118519.1 protein_id gnl|my_center|LOCUS_00560 61859 59178 gene locus_tag LOCUS_00570 gene nuoG 61859 59178 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113377.1 protein_id gnl|my_center|LOCUS_00570 63088 61862 gene locus_tag LOCUS_00580 gene nuoF 63088 61862 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861487.1 protein_id gnl|my_center|LOCUS_00580 63634 63146 gene locus_tag LOCUS_00590 gene nuoE 63634 63146 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120040.1 protein_id gnl|my_center|LOCUS_00590 65393 63621 gene locus_tag LOCUS_00600 gene nuoC 65393 63621 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090458.1 protein_id gnl|my_center|LOCUS_00600 65986 65408 gene locus_tag LOCUS_00610 gene nuoB 65986 65408 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386733.1 protein_id gnl|my_center|LOCUS_00610 66396 65983 gene locus_tag LOCUS_00620 66396 65983 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705666.1 protein_id gnl|my_center|LOCUS_00620 67058 66393 gene locus_tag LOCUS_00630 gene rpe 67058 66393 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085374.1 protein_id gnl|my_center|LOCUS_00630 67257 67051 gene locus_tag LOCUS_00640 67257 67051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 68557 67478 gene locus_tag LOCUS_00650 gene fba 68557 67478 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532055.1 protein_id gnl|my_center|LOCUS_00650 69482 68607 gene locus_tag LOCUS_00660 69482 68607 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085368.1 protein_id gnl|my_center|LOCUS_00660 70561 69473 gene locus_tag LOCUS_00670 70561 69473 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969552.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence002 2423 1200 gene locus_tag LOCUS_00680 2423 1200 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965954.1 protein_id gnl|my_center|LOCUS_00680 3319 2489 gene locus_tag LOCUS_00690 3319 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 3578 3393 gene locus_tag LOCUS_00700 3578 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 4529 3750 gene locus_tag LOCUS_00710 4529 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 5019 4756 gene locus_tag LOCUS_00720 5019 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 5000 5566 gene locus_tag LOCUS_00730 5000 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 5729 7567 gene locus_tag LOCUS_00740 gene typA 5729 7567 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_00740 9225 7822 gene locus_tag LOCUS_00750 9225 7822 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532632.1 protein_id gnl|my_center|LOCUS_00750 9482 9225 gene locus_tag LOCUS_00760 9482 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 10618 9788 gene locus_tag LOCUS_00770 10618 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 11268 10615 gene locus_tag LOCUS_00780 11268 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 13625 11268 gene locus_tag LOCUS_00790 13625 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 14567 13647 gene locus_tag LOCUS_00800 14567 13647 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_00800 14891 14622 gene locus_tag LOCUS_00810 14891 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 15523 14888 gene locus_tag LOCUS_00820 gene parA 15523 14888 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202825640.1 protein_id gnl|my_center|LOCUS_00820 15795 15523 gene locus_tag LOCUS_00830 15795 15523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 16214 15792 gene locus_tag LOCUS_00840 gene bfr 16214 15792 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035731.1 protein_id gnl|my_center|LOCUS_00840 16564 16226 gene locus_tag LOCUS_00850 16564 16226 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_00850 16899 16603 gene locus_tag LOCUS_00860 16899 16603 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_00860 17339 17043 gene locus_tag LOCUS_00870 17339 17043 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_00870 17802 17557 gene locus_tag LOCUS_00880 17802 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 18049 17804 gene locus_tag LOCUS_00890 18049 17804 CDS product carboxysome peptide A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124708.1 protein_id gnl|my_center|LOCUS_00890 19404 18055 gene locus_tag LOCUS_00900 19404 18055 CDS product carboxysome shell carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124707.1 protein_id gnl|my_center|LOCUS_00900 22171 19616 gene locus_tag LOCUS_00910 22171 19616 CDS product CsoS2 family carboxysome shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124706.1 protein_id gnl|my_center|LOCUS_00910 22553 22227 gene locus_tag LOCUS_00920 22553 22227 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_00920 24049 22628 gene locus_tag LOCUS_00930 24049 22628 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_00930 24293 25306 gene locus_tag LOCUS_00940 24293 25306 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_00940 25458 27131 gene locus_tag LOCUS_00950 25458 27131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 27133 27888 gene locus_tag LOCUS_00960 27133 27888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 27925 31050 gene locus_tag LOCUS_00970 27925 31050 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880525.1 protein_id gnl|my_center|LOCUS_00970 31047 31373 gene locus_tag LOCUS_00980 31047 31373 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880524.1 protein_id gnl|my_center|LOCUS_00980 31920 31441 gene locus_tag LOCUS_00990 31920 31441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 32075 32626 gene locus_tag LOCUS_01000 gene def 32075 32626 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090831.1 protein_id gnl|my_center|LOCUS_01000 32623 33528 gene locus_tag LOCUS_01010 gene fmt 32623 33528 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 protein_id gnl|my_center|LOCUS_01010 33528 34283 gene locus_tag LOCUS_01020 gene truA 33528 34283 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391099.1 protein_id gnl|my_center|LOCUS_01020 35407 34535 gene locus_tag LOCUS_01030 gene serB 35407 34535 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338897.1 protein_id gnl|my_center|LOCUS_01030 35406 36401 gene locus_tag LOCUS_01040 gene miaA 35406 36401 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388225.1 protein_id gnl|my_center|LOCUS_01040 36476 38272 gene locus_tag LOCUS_01050 36476 38272 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388226.1 protein_id gnl|my_center|LOCUS_01050 38272 38790 gene locus_tag LOCUS_01060 gene ilvN 38272 38790 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_01060 39798 38950 gene locus_tag LOCUS_01070 39798 38950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 40031 40855 gene locus_tag LOCUS_01080 40031 40855 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_01080 41998 40931 gene locus_tag LOCUS_01090 41998 40931 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613682.1 protein_id gnl|my_center|LOCUS_01090 43306 42116 gene locus_tag LOCUS_01100 43306 42116 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_01100 44181 43558 gene locus_tag LOCUS_01110 44181 43558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 44753 46324 gene locus_tag LOCUS_01120 gene cdrB 44753 46324 CDS product two-partner secretion system transporter CdrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895680.1 protein_id gnl|my_center|LOCUS_01120 46376 46591 gene locus_tag LOCUS_01130 46376 46591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 46619 56284 gene locus_tag LOCUS_01140 46619 56284 CDS product autotransporter-associated beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104543246.1 protein_id gnl|my_center|LOCUS_01140 56287 59406 gene locus_tag LOCUS_01150 56287 59406 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057863007.1 protein_id gnl|my_center|LOCUS_01150 59415 61229 gene locus_tag LOCUS_01160 59415 61229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 61345 62247 gene locus_tag LOCUS_01170 gene argB 61345 62247 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528489.1 protein_id gnl|my_center|LOCUS_01170 62298 62894 gene locus_tag LOCUS_01180 gene hisB 62298 62894 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 protein_id gnl|my_center|LOCUS_01180 62891 63526 gene locus_tag LOCUS_01190 gene hisH 62891 63526 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067466.1 protein_id gnl|my_center|LOCUS_01190 63526 64089 gene locus_tag LOCUS_01200 63526 64089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 64086 64820 gene locus_tag LOCUS_01210 gene hisA 64086 64820 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337342.1 protein_id gnl|my_center|LOCUS_01210 64820 65593 gene locus_tag LOCUS_01220 gene hisF 64820 65593 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391341.1 protein_id gnl|my_center|LOCUS_01220 65613 66080 gene locus_tag LOCUS_01230 65613 66080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 66161 66538 gene locus_tag LOCUS_01240 66161 66538 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_01240 66737 69754 gene locus_tag LOCUS_01250 66737 69754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 70893 69991 gene locus_tag LOCUS_01260 70893 69991 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974286.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence003 1498 50 gene locus_tag LOCUS_01270 gene murC 1498 50 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388704.1 protein_id gnl|my_center|LOCUS_01270 2604 1495 gene locus_tag LOCUS_01280 gene murG 2604 1495 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388705.1 protein_id gnl|my_center|LOCUS_01280 3722 2601 gene locus_tag LOCUS_01290 3722 2601 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_01290 5086 3722 gene locus_tag LOCUS_01300 gene murD 5086 3722 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920413.1 protein_id gnl|my_center|LOCUS_01300 6171 5083 gene locus_tag LOCUS_01310 gene mraY 6171 5083 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_01310 7541 6171 gene locus_tag LOCUS_01320 gene murF 7541 6171 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337237.1 protein_id gnl|my_center|LOCUS_01320 9025 7538 gene locus_tag LOCUS_01330 9025 7538 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920415.1 protein_id gnl|my_center|LOCUS_01330 11162 9030 gene locus_tag LOCUS_01340 11162 9030 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_01340 11827 11159 gene locus_tag LOCUS_01350 11827 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 12753 11824 gene locus_tag LOCUS_01360 gene rsmH 12753 11824 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388713.1 protein_id gnl|my_center|LOCUS_01360 13223 12750 gene locus_tag LOCUS_01370 13223 12750 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388714.1 protein_id gnl|my_center|LOCUS_01370 14575 13919 gene locus_tag LOCUS_01380 14575 13919 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388715.1 protein_id gnl|my_center|LOCUS_01380 15333 14575 gene locus_tag LOCUS_01390 15333 14575 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_01390 16509 15382 gene locus_tag LOCUS_01400 gene glf 16509 15382 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038781.1 protein_id gnl|my_center|LOCUS_01400 17896 16520 gene locus_tag LOCUS_01410 17896 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 18591 17893 gene locus_tag LOCUS_01420 18591 17893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 19650 18667 gene locus_tag LOCUS_01430 gene cysK 19650 18667 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921452.1 protein_id gnl|my_center|LOCUS_01430 19929 20558 gene locus_tag LOCUS_01440 19929 20558 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971879.1 protein_id gnl|my_center|LOCUS_01440 20732 22687 gene locus_tag LOCUS_01450 20732 22687 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_01450 23552 22824 gene locus_tag LOCUS_01460 23552 22824 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071993.1 protein_id gnl|my_center|LOCUS_01460 26536 23552 gene locus_tag LOCUS_01470 26536 23552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 27132 26674 gene locus_tag LOCUS_01480 27132 26674 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390043.1 protein_id gnl|my_center|LOCUS_01480 27700 27230 gene locus_tag LOCUS_01490 27700 27230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 28170 27697 gene locus_tag LOCUS_01500 28170 27697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 28988 28641 gene locus_tag LOCUS_01510 28988 28641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01510 29147 29554 gene locus_tag LOCUS_01520 29147 29554 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_01520 29796 31670 gene locus_tag LOCUS_01530 gene uvrC 29796 31670 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_01530 31716 32294 gene locus_tag LOCUS_01540 gene pgsA 31716 32294 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_01540 32653 33165 gene locus_tag LOCUS_01550 gene mobB 32653 33165 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_01550 33193 33858 gene locus_tag LOCUS_01560 33193 33858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 33866 34117 gene locus_tag LOCUS_01570 gene moaD 33866 34117 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090205.1 protein_id gnl|my_center|LOCUS_01570 34127 34591 gene locus_tag LOCUS_01580 34127 34591 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390442.1 protein_id gnl|my_center|LOCUS_01580 34821 35984 gene locus_tag LOCUS_01590 34821 35984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 37213 36212 gene locus_tag LOCUS_01600 gene trpS 37213 36212 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391282.1 protein_id gnl|my_center|LOCUS_01600 38986 37505 gene locus_tag LOCUS_01610 gene murJ 38986 37505 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_01610 39495 39019 gene locus_tag LOCUS_01620 39495 39019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 40406 39510 gene locus_tag LOCUS_01630 40406 39510 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388364.1 protein_id gnl|my_center|LOCUS_01630 40897 40403 gene locus_tag LOCUS_01640 40897 40403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 41396 40977 gene locus_tag LOCUS_01650 gene arfB 41396 40977 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_01650 42111 41674 gene locus_tag LOCUS_01660 42111 41674 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970109.1 protein_id gnl|my_center|LOCUS_01660 43112 42156 gene locus_tag LOCUS_01670 43112 42156 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100771272.1 protein_id gnl|my_center|LOCUS_01670 43902 43144 gene locus_tag LOCUS_01680 43902 43144 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090295.1 protein_id gnl|my_center|LOCUS_01680 44011 44937 gene locus_tag LOCUS_01690 44011 44937 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244318.1 protein_id gnl|my_center|LOCUS_01690 45306 45076 gene locus_tag LOCUS_01700 45306 45076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 46066 45362 gene locus_tag LOCUS_01710 46066 45362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 46168 46743 gene locus_tag LOCUS_01720 46168 46743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 49608 46822 gene locus_tag LOCUS_01730 49608 46822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 50702 49668 gene locus_tag LOCUS_01740 50702 49668 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919490.1 protein_id gnl|my_center|LOCUS_01740 51207 50734 gene locus_tag LOCUS_01750 51207 50734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 54683 51324 gene locus_tag LOCUS_01760 gene putA 54683 51324 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064076.1 protein_id gnl|my_center|LOCUS_01760 55565 55167 gene locus_tag LOCUS_01770 55565 55167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 55524 56597 gene locus_tag LOCUS_01780 55524 56597 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_01780 56668 57390 gene locus_tag LOCUS_01790 gene phbB 56668 57390 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_01790 58297 58073 gene locus_tag LOCUS_01800 58297 58073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 59722 58352 gene locus_tag LOCUS_01810 59722 58352 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391178.1 protein_id gnl|my_center|LOCUS_01810 60588 59719 gene locus_tag LOCUS_01820 gene accD 60588 59719 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626593.1 protein_id gnl|my_center|LOCUS_01820 61429 60599 gene locus_tag LOCUS_01830 gene trpA 61429 60599 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921372.1 protein_id gnl|my_center|LOCUS_01830 62643 61426 gene locus_tag LOCUS_01840 gene trpB 62643 61426 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265976.1 protein_id gnl|my_center|LOCUS_01840 >Feature sequence004 510 618 gene locus_tag LOCUS_r00010 510 618 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 689 765 gene locus_tag LOCUS_t00020 689 765 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1231 722 gene locus_tag LOCUS_01850 1231 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 2178 1273 gene locus_tag LOCUS_01860 2178 1273 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349104.1 protein_id gnl|my_center|LOCUS_01860 2501 2175 gene locus_tag LOCUS_01870 2501 2175 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165090.1 protein_id gnl|my_center|LOCUS_01870 2839 3540 gene locus_tag LOCUS_01880 2839 3540 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_01880 6477 3841 gene locus_tag LOCUS_01890 6477 3841 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_01890 7553 6474 gene locus_tag LOCUS_01900 7553 6474 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035337.1 protein_id gnl|my_center|LOCUS_01900 7747 7568 gene locus_tag LOCUS_01910 7747 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 8999 8316 gene locus_tag LOCUS_01920 8999 8316 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_01920 9702 9112 gene locus_tag LOCUS_01930 9702 9112 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086652.1 protein_id gnl|my_center|LOCUS_01930 9853 10440 gene locus_tag LOCUS_01940 9853 10440 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895526.1 protein_id gnl|my_center|LOCUS_01940 10682 10587 gene locus_tag LOCUS_t00030 10682 10587 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 11011 13407 gene locus_tag LOCUS_01950 11011 13407 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974204.1 protein_id gnl|my_center|LOCUS_01950 13573 14748 gene locus_tag LOCUS_01960 13573 14748 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_01960 14825 15691 gene locus_tag LOCUS_01970 14825 15691 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089982.1 protein_id gnl|my_center|LOCUS_01970 16169 16903 gene locus_tag LOCUS_01980 16169 16903 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812103.1 protein_id gnl|my_center|LOCUS_01980 16900 18033 gene locus_tag LOCUS_01990 16900 18033 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089089.1 protein_id gnl|my_center|LOCUS_01990 19005 18253 gene locus_tag LOCUS_02000 gene hpaI 19005 18253 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431692.1 protein_id gnl|my_center|LOCUS_02000 20756 19017 gene locus_tag LOCUS_02010 gene araD 20756 19017 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083210.1 protein_id gnl|my_center|LOCUS_02010 21817 20753 gene locus_tag LOCUS_02020 gene ugpC 21817 20753 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089092.1 protein_id gnl|my_center|LOCUS_02020 22661 21822 gene locus_tag LOCUS_02030 22661 21822 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089094.1 protein_id gnl|my_center|LOCUS_02030 23544 22669 gene locus_tag LOCUS_02040 23544 22669 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089095.1 protein_id gnl|my_center|LOCUS_02040 24299 23547 gene locus_tag LOCUS_02050 24299 23547 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089098.1 protein_id gnl|my_center|LOCUS_02050 25587 24289 gene locus_tag LOCUS_02060 25587 24289 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921636.1 protein_id gnl|my_center|LOCUS_02060 25754 26626 gene locus_tag LOCUS_02070 25754 26626 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724996.1 protein_id gnl|my_center|LOCUS_02070 26623 27585 gene locus_tag LOCUS_02080 26623 27585 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089093.1 protein_id gnl|my_center|LOCUS_02080 27573 28472 gene locus_tag LOCUS_02090 27573 28472 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331257.1 protein_id gnl|my_center|LOCUS_02090 28903 29319 gene locus_tag LOCUS_02100 28903 29319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02100 29294 29887 gene locus_tag LOCUS_02110 29294 29887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02110 30170 31090 gene locus_tag LOCUS_02120 30170 31090 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204927.1 protein_id gnl|my_center|LOCUS_02120 31138 32085 gene locus_tag LOCUS_02130 31138 32085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 32103 32936 gene locus_tag LOCUS_02140 32103 32936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 32958 33686 gene locus_tag LOCUS_02150 32958 33686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02150 33679 34416 gene locus_tag LOCUS_02160 33679 34416 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230770.1 protein_id gnl|my_center|LOCUS_02160 34441 35793 gene locus_tag LOCUS_02170 34441 35793 CDS product adenylosuccinate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034850905.1 protein_id gnl|my_center|LOCUS_02170 36808 35828 gene locus_tag LOCUS_02180 36808 35828 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840243.1 protein_id gnl|my_center|LOCUS_02180 38328 36805 gene locus_tag LOCUS_02190 38328 36805 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528520.1 protein_id gnl|my_center|LOCUS_02190 40713 38392 gene locus_tag LOCUS_02200 40713 38392 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086745.1 protein_id gnl|my_center|LOCUS_02200 41968 40715 gene locus_tag LOCUS_02210 41968 40715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966276.1 protein_id gnl|my_center|LOCUS_02210 42741 42109 gene locus_tag LOCUS_02220 42741 42109 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170932.1 protein_id gnl|my_center|LOCUS_02220 42885 43661 gene locus_tag LOCUS_02230 42885 43661 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966277.1 protein_id gnl|my_center|LOCUS_02230 43747 44568 gene locus_tag LOCUS_02240 43747 44568 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 protein_id gnl|my_center|LOCUS_02240 45600 44620 gene locus_tag LOCUS_02250 45600 44620 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810847.1 protein_id gnl|my_center|LOCUS_02250 46228 45629 gene locus_tag LOCUS_02260 46228 45629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 47229 46225 gene locus_tag LOCUS_02270 47229 46225 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930730.1 protein_id gnl|my_center|LOCUS_02270 47967 47230 gene locus_tag LOCUS_02280 47967 47230 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_02280 49049 47964 gene locus_tag LOCUS_02290 49049 47964 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454927.1 protein_id gnl|my_center|LOCUS_02290 49633 49046 gene locus_tag LOCUS_02300 49633 49046 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530075.1 protein_id gnl|my_center|LOCUS_02300 49911 49633 gene locus_tag LOCUS_02310 49911 49633 CDS product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909602.1 protein_id gnl|my_center|LOCUS_02310 50026 50766 gene locus_tag LOCUS_02320 50026 50766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_02320 50763 51563 gene locus_tag LOCUS_02330 50763 51563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_02330 51565 52194 gene locus_tag LOCUS_02340 51565 52194 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967049.1 protein_id gnl|my_center|LOCUS_02340 >Feature sequence005 1166 369 gene locus_tag LOCUS_02350 gene moeB 1166 369 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_02350 1434 2846 gene locus_tag LOCUS_02360 1434 2846 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_02360 3118 4251 gene locus_tag LOCUS_02370 3118 4251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887944.1 protein_id gnl|my_center|LOCUS_02370 4252 5190 gene locus_tag LOCUS_02380 4252 5190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887945.1 protein_id gnl|my_center|LOCUS_02380 5187 6032 gene locus_tag LOCUS_02390 5187 6032 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228542.1 protein_id gnl|my_center|LOCUS_02390 6064 7143 gene locus_tag LOCUS_02400 6064 7143 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974518.1 protein_id gnl|my_center|LOCUS_02400 7193 8533 gene locus_tag LOCUS_02410 7193 8533 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529984.1 protein_id gnl|my_center|LOCUS_02410 8542 9801 gene locus_tag LOCUS_02420 8542 9801 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037492.1 protein_id gnl|my_center|LOCUS_02420 9891 11426 gene locus_tag LOCUS_02430 9891 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 11604 11413 gene locus_tag LOCUS_02440 11604 11413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 11714 14194 gene locus_tag LOCUS_02450 11714 14194 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966489.1 protein_id gnl|my_center|LOCUS_02450 14255 14977 gene locus_tag LOCUS_02460 14255 14977 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_02460 15508 15230 gene locus_tag LOCUS_02470 15508 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 16212 15673 gene locus_tag LOCUS_02480 gene msrA 16212 15673 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_02480 16704 16288 gene locus_tag LOCUS_02490 16704 16288 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_02490 16994 16701 gene locus_tag LOCUS_02500 16994 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 17101 17871 gene locus_tag LOCUS_02510 17101 17871 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_02510 17868 18002 gene locus_tag LOCUS_02520 17868 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 17999 18508 gene locus_tag LOCUS_02530 gene ccmE 17999 18508 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971299.1 protein_id gnl|my_center|LOCUS_02530 18516 20489 gene locus_tag LOCUS_02540 18516 20489 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 protein_id gnl|my_center|LOCUS_02540 20491 21051 gene locus_tag LOCUS_02550 20491 21051 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310866.1 protein_id gnl|my_center|LOCUS_02550 21048 21524 gene locus_tag LOCUS_02560 21048 21524 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992253.1 protein_id gnl|my_center|LOCUS_02560 21521 22261 gene locus_tag LOCUS_02570 21521 22261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 22258 22407 gene locus_tag LOCUS_02580 22258 22407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 23217 22462 gene locus_tag LOCUS_02590 23217 22462 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228666.1 protein_id gnl|my_center|LOCUS_02590 23316 23771 gene locus_tag LOCUS_02600 23316 23771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 25764 23782 gene locus_tag LOCUS_02610 25764 23782 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_02610 26920 25781 gene locus_tag LOCUS_02620 26920 25781 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626386.1 protein_id gnl|my_center|LOCUS_02620 27021 29645 gene locus_tag LOCUS_02630 gene pepN 27021 29645 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920339.1 protein_id gnl|my_center|LOCUS_02630 30267 29803 gene locus_tag LOCUS_02640 30267 29803 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_02640 31769 30264 gene locus_tag LOCUS_02650 31769 30264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 31907 32086 gene locus_tag LOCUS_02660 31907 32086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 32394 32924 gene locus_tag LOCUS_02670 gene mlaD 32394 32924 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 protein_id gnl|my_center|LOCUS_02670 33913 34971 gene locus_tag LOCUS_02680 33913 34971 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_02680 35076 36275 gene locus_tag LOCUS_02690 35076 36275 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_02690 36280 37494 gene locus_tag LOCUS_02700 36280 37494 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086738.1 protein_id gnl|my_center|LOCUS_02700 38948 37542 gene locus_tag LOCUS_02710 38948 37542 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966495.1 protein_id gnl|my_center|LOCUS_02710 39868 38945 gene locus_tag LOCUS_02720 39868 38945 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089184.1 protein_id gnl|my_center|LOCUS_02720 40746 39871 gene locus_tag LOCUS_02730 40746 39871 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089183.1 protein_id gnl|my_center|LOCUS_02730 42109 40832 gene locus_tag LOCUS_02740 42109 40832 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089186.1 protein_id gnl|my_center|LOCUS_02740 43383 42196 gene locus_tag LOCUS_02750 43383 42196 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114048.1 protein_id gnl|my_center|LOCUS_02750 43993 43424 gene locus_tag LOCUS_02760 43993 43424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 44089 46242 gene locus_tag LOCUS_02770 44089 46242 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence006 564 319 gene locus_tag LOCUS_02780 564 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 966 1985 gene locus_tag LOCUS_02790 966 1985 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969398.1 protein_id gnl|my_center|LOCUS_02790 1994 3838 gene locus_tag LOCUS_02800 1994 3838 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087283.1 protein_id gnl|my_center|LOCUS_02800 5086 3863 gene locus_tag LOCUS_02810 5086 3863 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523407.1 protein_id gnl|my_center|LOCUS_02810 5222 6085 gene locus_tag LOCUS_02820 5222 6085 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533411.1 protein_id gnl|my_center|LOCUS_02820 6502 7665 gene locus_tag LOCUS_02830 6502 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 7734 9803 gene locus_tag LOCUS_02840 7734 9803 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466817.1 protein_id gnl|my_center|LOCUS_02840 9919 10233 gene locus_tag LOCUS_02850 9919 10233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 10250 10447 gene locus_tag LOCUS_02860 10250 10447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 11900 10671 gene locus_tag LOCUS_02870 gene efeB 11900 10671 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730522.1 protein_id gnl|my_center|LOCUS_02870 12907 11897 gene locus_tag LOCUS_02880 12907 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 14278 13208 gene locus_tag LOCUS_02890 14278 13208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704970.1 protein_id gnl|my_center|LOCUS_02890 15822 14281 gene locus_tag LOCUS_02900 15822 14281 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215840.1 protein_id gnl|my_center|LOCUS_02900 16898 15852 gene locus_tag LOCUS_02910 16898 15852 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211596.1 protein_id gnl|my_center|LOCUS_02910 17161 17451 gene locus_tag LOCUS_02920 17161 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 18238 17711 gene locus_tag LOCUS_02930 18238 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 19289 18312 gene locus_tag LOCUS_02940 19289 18312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 23840 19530 gene locus_tag LOCUS_02950 23840 19530 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389254.1 protein_id gnl|my_center|LOCUS_02950 24486 24851 gene locus_tag LOCUS_02960 24486 24851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 24893 25282 gene locus_tag LOCUS_02970 24893 25282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 25382 26746 gene locus_tag LOCUS_02980 25382 26746 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036845.1 protein_id gnl|my_center|LOCUS_02980 27197 26916 gene locus_tag LOCUS_02990 27197 26916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 27356 27778 gene locus_tag LOCUS_03000 27356 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 27921 27790 gene locus_tag LOCUS_03010 27921 27790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 28304 28092 gene locus_tag LOCUS_03020 28304 28092 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970295.1 protein_id gnl|my_center|LOCUS_03020 28591 29493 gene locus_tag LOCUS_03030 gene speB 28591 29493 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_03030 29490 31148 gene locus_tag LOCUS_03040 29490 31148 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341224.1 protein_id gnl|my_center|LOCUS_03040 31286 32104 gene locus_tag LOCUS_03050 31286 32104 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_03050 32108 33964 gene locus_tag LOCUS_03060 32108 33964 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186147.1 protein_id gnl|my_center|LOCUS_03060 33961 35532 gene locus_tag LOCUS_03070 33961 35532 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_03070 35529 35933 gene locus_tag LOCUS_03080 35529 35933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 35935 36369 gene locus_tag LOCUS_03090 35935 36369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038676.1 protein_id gnl|my_center|LOCUS_03090 36376 37281 gene locus_tag LOCUS_03100 36376 37281 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973511.1 protein_id gnl|my_center|LOCUS_03100 37295 38212 gene locus_tag LOCUS_03110 37295 38212 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141161.1 protein_id gnl|my_center|LOCUS_03110 38629 38931 gene locus_tag LOCUS_03120 38629 38931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 39072 44339 gene locus_tag LOCUS_03130 39072 44339 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625869.1 protein_id gnl|my_center|LOCUS_03130 44380 46326 gene locus_tag LOCUS_03140 gene pbpC 44380 46326 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387866.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence007 324 136 gene locus_tag LOCUS_03150 324 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 595 1863 gene locus_tag LOCUS_03160 595 1863 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531246.1 protein_id gnl|my_center|LOCUS_03160 1865 2842 gene locus_tag LOCUS_03170 1865 2842 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_03170 2948 3526 gene locus_tag LOCUS_03180 2948 3526 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918499.1 protein_id gnl|my_center|LOCUS_03180 3523 4530 gene locus_tag LOCUS_03190 3523 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4783 6015 gene locus_tag LOCUS_03200 4783 6015 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265576.1 protein_id gnl|my_center|LOCUS_03200 6129 8576 gene locus_tag LOCUS_03210 gene nirB 6129 8576 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918501.1 protein_id gnl|my_center|LOCUS_03210 8576 8914 gene locus_tag LOCUS_03220 gene nirD 8576 8914 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640019.1 protein_id gnl|my_center|LOCUS_03220 8911 11538 gene locus_tag LOCUS_03230 8911 11538 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975944.1 protein_id gnl|my_center|LOCUS_03230 11563 11874 gene locus_tag LOCUS_03240 11563 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 11871 12311 gene locus_tag LOCUS_03250 11871 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 12436 12861 gene locus_tag LOCUS_03260 12436 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 13500 12907 gene locus_tag LOCUS_03270 13500 12907 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967666.1 protein_id gnl|my_center|LOCUS_03270 13768 14985 gene locus_tag LOCUS_03280 gene phaZ 13768 14985 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089442.1 protein_id gnl|my_center|LOCUS_03280 15973 14975 gene locus_tag LOCUS_03290 15973 14975 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389726.1 protein_id gnl|my_center|LOCUS_03290 16163 18685 gene locus_tag LOCUS_03300 gene ptsP 16163 18685 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037513.1 protein_id gnl|my_center|LOCUS_03300 18694 19641 gene locus_tag LOCUS_03310 gene pfkB 18694 19641 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389724.1 protein_id gnl|my_center|LOCUS_03310 19676 21367 gene locus_tag LOCUS_03320 19676 21367 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389723.1 protein_id gnl|my_center|LOCUS_03320 21392 22729 gene locus_tag LOCUS_03330 21392 22729 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180707871.1 protein_id gnl|my_center|LOCUS_03330 22746 24224 gene locus_tag LOCUS_03340 gene zwf 22746 24224 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971003.1 protein_id gnl|my_center|LOCUS_03340 24322 26157 gene locus_tag LOCUS_03350 gene edd 24322 26157 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530234.1 protein_id gnl|my_center|LOCUS_03350 26154 26792 gene locus_tag LOCUS_03360 gene eda 26154 26792 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_03360 26785 28416 gene locus_tag LOCUS_03370 gene pgi 26785 28416 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527997.1 protein_id gnl|my_center|LOCUS_03370 30008 28404 gene locus_tag LOCUS_03380 30008 28404 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974195.1 protein_id gnl|my_center|LOCUS_03380 31174 30005 gene locus_tag LOCUS_03390 31174 30005 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975595.1 protein_id gnl|my_center|LOCUS_03390 31345 32352 gene locus_tag LOCUS_03400 31345 32352 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969398.1 protein_id gnl|my_center|LOCUS_03400 32363 34231 gene locus_tag LOCUS_03410 32363 34231 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084961.1 protein_id gnl|my_center|LOCUS_03410 34232 34999 gene locus_tag LOCUS_03420 34232 34999 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_03420 37404 35062 gene locus_tag LOCUS_03430 gene xdhB 37404 35062 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920472.1 protein_id gnl|my_center|LOCUS_03430 38846 37401 gene locus_tag LOCUS_03440 gene xdhA 38846 37401 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975646.1 protein_id gnl|my_center|LOCUS_03440 40088 38997 gene locus_tag LOCUS_03450 40088 38997 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975571.1 protein_id gnl|my_center|LOCUS_03450 41013 40132 gene locus_tag LOCUS_03460 41013 40132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112677.1 protein_id gnl|my_center|LOCUS_03460 41166 41354 gene locus_tag LOCUS_03470 41166 41354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 42713 41361 gene locus_tag LOCUS_03480 42713 41361 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385587.1 protein_id gnl|my_center|LOCUS_03480 42779 43726 gene locus_tag LOCUS_03490 42779 43726 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084073.1 protein_id gnl|my_center|LOCUS_03490 44524 43631 gene locus_tag LOCUS_03500 44524 43631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 44689 44874 gene locus_tag LOCUS_03510 44689 44874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 45069 44875 gene locus_tag LOCUS_03520 45069 44875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 45235 45062 gene locus_tag LOCUS_03530 45235 45062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 45767 45222 gene locus_tag LOCUS_03540 45767 45222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence008 1941 82 gene locus_tag LOCUS_03550 gene asnB 1941 82 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_03550 2949 1948 gene locus_tag LOCUS_03560 2949 1948 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388760.1 protein_id gnl|my_center|LOCUS_03560 4192 3026 gene locus_tag LOCUS_03570 4192 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 5963 4239 gene locus_tag LOCUS_03580 5963 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 6676 6011 gene locus_tag LOCUS_03590 6676 6011 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_03590 7028 7693 gene locus_tag LOCUS_03600 gene cysE 7028 7693 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389782.1 protein_id gnl|my_center|LOCUS_03600 7705 8832 gene locus_tag LOCUS_03610 7705 8832 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389780.1 protein_id gnl|my_center|LOCUS_03610 8857 9186 gene locus_tag LOCUS_03620 8857 9186 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_03620 9194 10267 gene locus_tag LOCUS_03630 gene mnmA 9194 10267 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384335.1 protein_id gnl|my_center|LOCUS_03630 10419 11948 gene locus_tag LOCUS_03640 10419 11948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 12026 13543 gene locus_tag LOCUS_03650 12026 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 14011 15606 gene locus_tag LOCUS_03660 14011 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 15908 16231 gene locus_tag LOCUS_03670 gene hfq 15908 16231 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389374.1 protein_id gnl|my_center|LOCUS_03670 16262 17524 gene locus_tag LOCUS_03680 gene hflX 16262 17524 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389375.1 protein_id gnl|my_center|LOCUS_03680 17521 18351 gene locus_tag LOCUS_03690 17521 18351 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446872.1 protein_id gnl|my_center|LOCUS_03690 19355 18357 gene locus_tag LOCUS_03700 gene bioB 19355 18357 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035642.1 protein_id gnl|my_center|LOCUS_03700 19492 20610 gene locus_tag LOCUS_03710 gene bioF 19492 20610 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640275.1 protein_id gnl|my_center|LOCUS_03710 20595 21272 gene locus_tag LOCUS_03720 gene bioD 20595 21272 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919449.1 protein_id gnl|my_center|LOCUS_03720 22664 21273 gene locus_tag LOCUS_03730 gene lpdA 22664 21273 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_03730 23162 24379 gene locus_tag LOCUS_03740 23162 24379 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039905.1 protein_id gnl|my_center|LOCUS_03740 24710 24441 gene locus_tag LOCUS_03750 gene rpsO 24710 24441 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_03750 25654 24722 gene locus_tag LOCUS_03760 gene truB 25654 24722 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391530.1 protein_id gnl|my_center|LOCUS_03760 26974 25721 gene locus_tag LOCUS_03770 26974 25721 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930773.1 protein_id gnl|my_center|LOCUS_03770 28978 27047 gene locus_tag LOCUS_03780 28978 27047 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728405.1 protein_id gnl|my_center|LOCUS_03780 29236 30654 gene locus_tag LOCUS_03790 29236 30654 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964170.1 protein_id gnl|my_center|LOCUS_03790 30657 31349 gene locus_tag LOCUS_03800 30657 31349 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974505.1 protein_id gnl|my_center|LOCUS_03800 33218 31611 gene locus_tag LOCUS_03810 33218 31611 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113025.1 protein_id gnl|my_center|LOCUS_03810 35231 33426 gene locus_tag LOCUS_03820 gene htpG 35231 33426 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090513.1 protein_id gnl|my_center|LOCUS_03820 37156 35300 gene locus_tag LOCUS_03830 37156 35300 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_03830 37254 37676 gene locus_tag LOCUS_03840 gene ndk 37254 37676 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384432.1 protein_id gnl|my_center|LOCUS_03840 38402 37902 gene locus_tag LOCUS_03850 38402 37902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 39073 38399 gene locus_tag LOCUS_03860 39073 38399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 40482 39070 gene locus_tag LOCUS_03870 40482 39070 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008116.1 protein_id gnl|my_center|LOCUS_03870 40650 40871 gene locus_tag LOCUS_03880 40650 40871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 41092 41496 gene locus_tag LOCUS_03890 41092 41496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 41921 41532 gene locus_tag LOCUS_03900 41921 41532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 42166 42849 gene locus_tag LOCUS_03910 42166 42849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 43584 42883 gene locus_tag LOCUS_03920 43584 42883 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence009 1301 255 gene locus_tag LOCUS_03930 1301 255 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066983.1 protein_id gnl|my_center|LOCUS_03930 2278 1301 gene locus_tag LOCUS_03940 2278 1301 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_03940 3566 2271 gene locus_tag LOCUS_03950 3566 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 4642 3563 gene locus_tag LOCUS_03960 4642 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5604 4639 gene locus_tag LOCUS_03970 5604 4639 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215352211.1 protein_id gnl|my_center|LOCUS_03970 6409 5597 gene locus_tag LOCUS_03980 gene rlmJ 6409 5597 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389691.1 protein_id gnl|my_center|LOCUS_03980 7506 6406 gene locus_tag LOCUS_03990 gene tsaD 7506 6406 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626621.1 protein_id gnl|my_center|LOCUS_03990 7578 8528 gene locus_tag LOCUS_04000 gene hemC 7578 8528 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391315.1 protein_id gnl|my_center|LOCUS_04000 8533 9228 gene locus_tag LOCUS_04010 8533 9228 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528909.1 protein_id gnl|my_center|LOCUS_04010 9225 10172 gene locus_tag LOCUS_04020 9225 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 10172 11446 gene locus_tag LOCUS_04030 10172 11446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 12534 11422 gene locus_tag LOCUS_04040 12534 11422 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971772.1 protein_id gnl|my_center|LOCUS_04040 13594 12689 gene locus_tag LOCUS_04050 13594 12689 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_04050 13710 14255 gene locus_tag LOCUS_04060 13710 14255 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_04060 14322 14957 gene locus_tag LOCUS_04070 14322 14957 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 protein_id gnl|my_center|LOCUS_04070 14950 15423 gene locus_tag LOCUS_04080 14950 15423 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_04080 15771 16340 gene locus_tag LOCUS_04090 15771 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 16400 17902 gene locus_tag LOCUS_04100 gene nusA 16400 17902 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_04100 17984 18553 gene locus_tag LOCUS_04110 17984 18553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 18608 21247 gene locus_tag LOCUS_04120 gene infB 18608 21247 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626661.1 protein_id gnl|my_center|LOCUS_04120 21286 21639 gene locus_tag LOCUS_04130 21286 21639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 21617 22633 gene locus_tag LOCUS_04140 21617 22633 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_04140 24022 22634 gene locus_tag LOCUS_04150 24022 22634 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_04150 26225 24015 gene locus_tag LOCUS_04160 26225 24015 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_04160 27676 26225 gene locus_tag LOCUS_04170 gene ntrC 27676 26225 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_04170 28824 27673 gene locus_tag LOCUS_04180 28824 27673 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389367.1 protein_id gnl|my_center|LOCUS_04180 29888 28821 gene locus_tag LOCUS_04190 gene dusB 29888 28821 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014411626.1 protein_id gnl|my_center|LOCUS_04190 29951 31090 gene locus_tag LOCUS_04200 29951 31090 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_04200 31149 31223 gene locus_tag LOCUS_t00040 31149 31223 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31297 32628 gene locus_tag LOCUS_04210 gene purB 31297 32628 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532121.1 protein_id gnl|my_center|LOCUS_04210 32635 33333 gene locus_tag LOCUS_04220 32635 33333 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_04220 34759 33323 gene locus_tag LOCUS_04230 34759 33323 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_04230 35678 34761 gene locus_tag LOCUS_04240 35678 34761 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112442.1 protein_id gnl|my_center|LOCUS_04240 35895 35698 gene locus_tag LOCUS_04250 35895 35698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 37991 35898 gene locus_tag LOCUS_04260 37991 35898 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112441.1 protein_id gnl|my_center|LOCUS_04260 38371 39699 gene locus_tag LOCUS_04270 38371 39699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 39666 39830 gene locus_tag LOCUS_04280 39666 39830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 39884 40858 gene locus_tag LOCUS_04290 39884 40858 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927097.1 protein_id gnl|my_center|LOCUS_04290 41921 41064 gene locus_tag LOCUS_04300 41921 41064 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_04300 <42605 42026 gene locus_tag LOCUS_04310 <42605 42026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973719.1:LysR substrate-binding domain-containing protein >Feature sequence010 472 1203 gene locus_tag LOCUS_04320 472 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2300 1209 gene locus_tag LOCUS_04330 2300 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217407.1 protein_id gnl|my_center|LOCUS_04330 2884 2297 gene locus_tag LOCUS_04340 2884 2297 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390793.1 protein_id gnl|my_center|LOCUS_04340 3567 2887 gene locus_tag LOCUS_04350 gene gntA 3567 2887 CDS product guanitoxin biosynthesis heme-dependent pre-guanitoxin N-hydroxylase GntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390792.1 protein_id gnl|my_center|LOCUS_04350 3812 4105 gene locus_tag LOCUS_04360 3812 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 5784 4165 gene locus_tag LOCUS_04370 5784 4165 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090321.1 protein_id gnl|my_center|LOCUS_04370 6906 5791 gene locus_tag LOCUS_04380 6906 5791 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090320.1 protein_id gnl|my_center|LOCUS_04380 7558 7007 gene locus_tag LOCUS_04390 gene nusG 7558 7007 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_04390 7742 7548 gene locus_tag LOCUS_04400 gene secE 7742 7548 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523719.1 protein_id gnl|my_center|LOCUS_04400 7860 7784 gene locus_tag LOCUS_t00050 7860 7784 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8033 7960 gene locus_tag LOCUS_t00060 8033 7960 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8182 8817 gene locus_tag LOCUS_04410 8182 8817 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532149.1 protein_id gnl|my_center|LOCUS_04410 9367 8912 gene locus_tag LOCUS_04420 9367 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 10371 9364 gene locus_tag LOCUS_04430 gene hemC 10371 9364 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391315.1 protein_id gnl|my_center|LOCUS_04430 11594 10374 gene locus_tag LOCUS_04440 gene hemA 11594 10374 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844889.1 protein_id gnl|my_center|LOCUS_04440 13416 11623 gene locus_tag LOCUS_04450 13416 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 14499 13432 gene locus_tag LOCUS_04460 gene acsF 14499 13432 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338129.1 protein_id gnl|my_center|LOCUS_04460 14791 14504 gene locus_tag LOCUS_04470 14791 14504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 15234 14788 gene locus_tag LOCUS_04480 gene puhC 15234 14788 CDS product photosynthetic complex assembly protein PuhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720457.1 protein_id gnl|my_center|LOCUS_04480 15869 15231 gene locus_tag LOCUS_04490 gene puhB 15869 15231 CDS product photosynthetic complex putative assembly protein PuhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388374.1 protein_id gnl|my_center|LOCUS_04490 16639 15866 gene locus_tag LOCUS_04500 gene puhA 16639 15866 CDS product photosynthetic reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388375.1 protein_id gnl|my_center|LOCUS_04500 18058 16655 gene locus_tag LOCUS_04510 18058 16655 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388376.1 protein_id gnl|my_center|LOCUS_04510 18753 18055 gene locus_tag LOCUS_04520 gene bchM 18753 18055 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388377.1 protein_id gnl|my_center|LOCUS_04520 19682 18753 gene locus_tag LOCUS_04530 gene bchL 19682 18753 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388378.1 protein_id gnl|my_center|LOCUS_04530 23266 19679 gene locus_tag LOCUS_04540 23266 19679 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338125.1 protein_id gnl|my_center|LOCUS_04540 24806 23268 gene locus_tag LOCUS_04550 gene bchB 24806 23268 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388380.1 protein_id gnl|my_center|LOCUS_04550 26097 24811 gene locus_tag LOCUS_04560 26097 24811 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388381.1 protein_id gnl|my_center|LOCUS_04560 26678 26094 gene locus_tag LOCUS_04570 gene bchF 26678 26094 CDS product 2-vinyl bacteriochlorophyllide hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388382.1 protein_id gnl|my_center|LOCUS_04570 26950 27915 gene locus_tag LOCUS_04580 26950 27915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 27989 29410 gene locus_tag LOCUS_04590 gene ppsR 27989 29410 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_04590 29441 30370 gene locus_tag LOCUS_04600 gene chlG 29441 30370 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388385.1 protein_id gnl|my_center|LOCUS_04600 30373 31557 gene locus_tag LOCUS_04610 30373 31557 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720441.1 protein_id gnl|my_center|LOCUS_04610 31554 32048 gene locus_tag LOCUS_04620 31554 32048 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626340.1 protein_id gnl|my_center|LOCUS_04620 32051 33067 gene locus_tag LOCUS_04630 gene bchI 32051 33067 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625950.1 protein_id gnl|my_center|LOCUS_04630 33067 34812 gene locus_tag LOCUS_04640 33067 34812 CDS product magnesium chelatase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388245.1 protein_id gnl|my_center|LOCUS_04640 34793 35752 gene locus_tag LOCUS_04650 34793 35752 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388246.1 protein_id gnl|my_center|LOCUS_04650 35749 37275 gene locus_tag LOCUS_04660 35749 37275 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388252.1 protein_id gnl|my_center|LOCUS_04660 37256 38287 gene locus_tag LOCUS_04670 37256 38287 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_04670 38284 38484 gene locus_tag LOCUS_04680 38284 38484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 39264 38449 gene locus_tag LOCUS_04690 39264 38449 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390733.1 protein_id gnl|my_center|LOCUS_04690 40814 39351 gene locus_tag LOCUS_04700 gene crtI 40814 39351 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390732.1 protein_id gnl|my_center|LOCUS_04700 >Feature sequence011 483 1319 gene locus_tag LOCUS_04710 gene ugpE 483 1319 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 protein_id gnl|my_center|LOCUS_04710 1319 2383 gene locus_tag LOCUS_04720 1319 2383 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176326.1 protein_id gnl|my_center|LOCUS_04720 3168 2380 gene locus_tag LOCUS_04730 3168 2380 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019565706.1 protein_id gnl|my_center|LOCUS_04730 4478 3192 gene locus_tag LOCUS_04740 4478 3192 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_04740 4897 4634 gene locus_tag LOCUS_04750 4897 4634 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136868.1 protein_id gnl|my_center|LOCUS_04750 5254 4949 gene locus_tag LOCUS_04760 5254 4949 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970194.1 protein_id gnl|my_center|LOCUS_04760 5353 6606 gene locus_tag LOCUS_04770 5353 6606 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257427.1 protein_id gnl|my_center|LOCUS_04770 6614 8038 gene locus_tag LOCUS_04780 gene pyk 6614 8038 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390218.1 protein_id gnl|my_center|LOCUS_04780 8187 10136 gene locus_tag LOCUS_04790 gene tkt 8187 10136 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085369.1 protein_id gnl|my_center|LOCUS_04790 10149 11162 gene locus_tag LOCUS_04800 gene gap 10149 11162 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387975.1 protein_id gnl|my_center|LOCUS_04800 11166 12359 gene locus_tag LOCUS_04810 11166 12359 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970179.1 protein_id gnl|my_center|LOCUS_04810 12377 13198 gene locus_tag LOCUS_04820 12377 13198 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164829992.1 protein_id gnl|my_center|LOCUS_04820 13534 14052 gene locus_tag LOCUS_04830 13534 14052 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_04830 14087 15265 gene locus_tag LOCUS_04840 14087 15265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 17340 15247 gene locus_tag LOCUS_04850 17340 15247 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918008.1 protein_id gnl|my_center|LOCUS_04850 17849 17373 gene locus_tag LOCUS_04860 17849 17373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 19608 18724 gene locus_tag LOCUS_04870 19608 18724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 19974 19615 gene locus_tag LOCUS_04880 19974 19615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 20444 19971 gene locus_tag LOCUS_04890 20444 19971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 21376 20519 gene locus_tag LOCUS_04900 21376 20519 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918679.1 protein_id gnl|my_center|LOCUS_04900 22559 21480 gene locus_tag LOCUS_04910 22559 21480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 24087 22564 gene locus_tag LOCUS_04920 24087 22564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 25418 24108 gene locus_tag LOCUS_04930 gene flgE 25418 24108 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086481.1 protein_id gnl|my_center|LOCUS_04930 26514 26212 gene locus_tag LOCUS_04940 26514 26212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 26794 26642 gene locus_tag LOCUS_04950 26794 26642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 26774 27106 gene locus_tag LOCUS_04960 26774 27106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 27138 27866 gene locus_tag LOCUS_04970 27138 27866 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388305.1 protein_id gnl|my_center|LOCUS_04970 28026 29669 gene locus_tag LOCUS_04980 gene fliF 28026 29669 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388303.1 protein_id gnl|my_center|LOCUS_04980 29666 30679 gene locus_tag LOCUS_04990 gene fliG 29666 30679 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388302.1 protein_id gnl|my_center|LOCUS_04990 30700 31041 gene locus_tag LOCUS_05000 gene fliN 30700 31041 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388300.1 protein_id gnl|my_center|LOCUS_05000 31055 32410 gene locus_tag LOCUS_05010 gene flbD 31055 32410 CDS product sigma-54-dependent transcriptional regulator FlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918793.1 protein_id gnl|my_center|LOCUS_05010 32417 34495 gene locus_tag LOCUS_05020 gene flhA 32417 34495 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388297.1 protein_id gnl|my_center|LOCUS_05020 34495 35409 gene locus_tag LOCUS_05030 34495 35409 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440034.1 protein_id gnl|my_center|LOCUS_05030 35406 36194 gene locus_tag LOCUS_05040 35406 36194 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440322.1 protein_id gnl|my_center|LOCUS_05040 37141 36329 gene locus_tag LOCUS_05050 37141 36329 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_05050 38327 37191 gene locus_tag LOCUS_05060 gene recF 38327 37191 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387764.1 protein_id gnl|my_center|LOCUS_05060 38773 38483 gene locus_tag LOCUS_05070 38773 38483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 39414 38974 gene locus_tag LOCUS_05080 39414 38974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083828.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence012 1918 482 gene locus_tag LOCUS_05090 1918 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 2061 2237 gene locus_tag LOCUS_05100 2061 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 3064 2372 gene locus_tag LOCUS_05110 3064 2372 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088802.1 protein_id gnl|my_center|LOCUS_05110 3487 3209 gene locus_tag LOCUS_05120 3487 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3938 3510 gene locus_tag LOCUS_05130 3938 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 4200 3940 gene locus_tag LOCUS_05140 gene pspB 4200 3940 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071929.1 protein_id gnl|my_center|LOCUS_05140 4878 4204 gene locus_tag LOCUS_05150 gene pspA 4878 4204 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388973.1 protein_id gnl|my_center|LOCUS_05150 5000 6058 gene locus_tag LOCUS_05160 gene pspF 5000 6058 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764157.1 protein_id gnl|my_center|LOCUS_05160 6596 6090 gene locus_tag LOCUS_05170 gene secB 6596 6090 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391357.1 protein_id gnl|my_center|LOCUS_05170 6746 7687 gene locus_tag LOCUS_05180 gene argC 6746 7687 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_05180 7680 8252 gene locus_tag LOCUS_05190 7680 8252 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_05190 8272 8850 gene locus_tag LOCUS_05200 8272 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 9715 9071 gene locus_tag LOCUS_05210 gene pcp 9715 9071 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209662.1 protein_id gnl|my_center|LOCUS_05210 10134 10985 gene locus_tag LOCUS_05220 10134 10985 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_05220 11600 10995 gene locus_tag LOCUS_05230 11600 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 12047 11619 gene locus_tag LOCUS_05240 12047 11619 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092308.1 protein_id gnl|my_center|LOCUS_05240 12796 12404 gene locus_tag LOCUS_05250 12796 12404 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389703.1 protein_id gnl|my_center|LOCUS_05250 12900 13805 gene locus_tag LOCUS_05260 12900 13805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 13806 14555 gene locus_tag LOCUS_05270 13806 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 14552 15547 gene locus_tag LOCUS_05280 14552 15547 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228140.1 protein_id gnl|my_center|LOCUS_05280 16689 15802 gene locus_tag LOCUS_05290 gene hflC 16689 15802 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_05290 17630 16686 gene locus_tag LOCUS_05300 gene hflK 17630 16686 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_05300 17914 18987 gene locus_tag LOCUS_05310 17914 18987 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170828.1 protein_id gnl|my_center|LOCUS_05310 18992 19441 gene locus_tag LOCUS_05320 18992 19441 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 protein_id gnl|my_center|LOCUS_05320 19467 19934 gene locus_tag LOCUS_05330 gene aroQ 19467 19934 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_05330 19931 20407 gene locus_tag LOCUS_05340 19931 20407 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390187.1 protein_id gnl|my_center|LOCUS_05340 20412 21773 gene locus_tag LOCUS_05350 gene accC 20412 21773 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390188.1 protein_id gnl|my_center|LOCUS_05350 25575 21967 gene locus_tag LOCUS_05360 25575 21967 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_05360 25734 26225 gene locus_tag LOCUS_05370 25734 26225 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395860.1 protein_id gnl|my_center|LOCUS_05370 26252 27367 gene locus_tag LOCUS_05380 26252 27367 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_05380 27772 27452 gene locus_tag LOCUS_05390 27772 27452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 28443 27769 gene locus_tag LOCUS_05400 28443 27769 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969827.1 protein_id gnl|my_center|LOCUS_05400 29327 28467 gene locus_tag LOCUS_05410 gene purU 29327 28467 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088696.1 protein_id gnl|my_center|LOCUS_05410 29807 29331 gene locus_tag LOCUS_05420 29807 29331 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085194.1 protein_id gnl|my_center|LOCUS_05420 30015 29812 gene locus_tag LOCUS_05430 30015 29812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 30215 30673 gene locus_tag LOCUS_05440 30215 30673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 30676 31734 gene locus_tag LOCUS_05450 30676 31734 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338626.1 protein_id gnl|my_center|LOCUS_05450 31731 32561 gene locus_tag LOCUS_05460 31731 32561 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388273.1 protein_id gnl|my_center|LOCUS_05460 33620 32757 gene locus_tag LOCUS_05470 33620 32757 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919612.1 protein_id gnl|my_center|LOCUS_05470 34667 33684 gene locus_tag LOCUS_05480 34667 33684 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_05480 35617 34835 gene locus_tag LOCUS_05490 35617 34835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086432.1 protein_id gnl|my_center|LOCUS_05490 36534 35623 gene locus_tag LOCUS_05500 36534 35623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086433.1 protein_id gnl|my_center|LOCUS_05500 37123 36632 gene locus_tag LOCUS_05510 37123 36632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 37339 38466 gene locus_tag LOCUS_05520 37339 38466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence013 700 392 gene locus_tag LOCUS_05530 700 392 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_05530 808 883 gene locus_tag LOCUS_t00070 808 883 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 909 2150 gene locus_tag LOCUS_05540 909 2150 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917991.1 protein_id gnl|my_center|LOCUS_05540 2256 3851 gene locus_tag LOCUS_05550 2256 3851 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_05550 3861 4865 gene locus_tag LOCUS_05560 gene galE 3861 4865 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_05560 4862 6025 gene locus_tag LOCUS_05570 4862 6025 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_05570 6035 6487 gene locus_tag LOCUS_05580 gene creA 6035 6487 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209232.1 protein_id gnl|my_center|LOCUS_05580 6499 8043 gene locus_tag LOCUS_05590 gene purH 6499 8043 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090756539.1 protein_id gnl|my_center|LOCUS_05590 8768 8313 gene locus_tag LOCUS_05600 8768 8313 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090847.1 protein_id gnl|my_center|LOCUS_05600 8880 10058 gene locus_tag LOCUS_05610 8880 10058 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_05610 10074 11660 gene locus_tag LOCUS_05620 gene serA 10074 11660 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090136.1 protein_id gnl|my_center|LOCUS_05620 12201 11833 gene locus_tag LOCUS_05630 12201 11833 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463761.1 protein_id gnl|my_center|LOCUS_05630 12683 12315 gene locus_tag LOCUS_05640 12683 12315 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919725.1 protein_id gnl|my_center|LOCUS_05640 13113 12676 gene locus_tag LOCUS_05650 13113 12676 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_05650 14357 13113 gene locus_tag LOCUS_05660 14357 13113 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390320.1 protein_id gnl|my_center|LOCUS_05660 15475 14354 gene locus_tag LOCUS_05670 gene sufD 15475 14354 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_05670 16215 15472 gene locus_tag LOCUS_05680 gene sufC 16215 15472 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720602.1 protein_id gnl|my_center|LOCUS_05680 17668 16217 gene locus_tag LOCUS_05690 gene sufB 17668 16217 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_05690 18132 17680 gene locus_tag LOCUS_05700 18132 17680 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_05700 18246 18845 gene locus_tag LOCUS_05710 18246 18845 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265812.1 protein_id gnl|my_center|LOCUS_05710 19479 18796 gene locus_tag LOCUS_05720 gene gph 19479 18796 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390779.1 protein_id gnl|my_center|LOCUS_05720 19552 20862 gene locus_tag LOCUS_05730 gene glmU 19552 20862 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 protein_id gnl|my_center|LOCUS_05730 20865 22688 gene locus_tag LOCUS_05740 gene glmS 20865 22688 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390777.1 protein_id gnl|my_center|LOCUS_05740 25211 22848 gene locus_tag LOCUS_05750 25211 22848 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_05750 25693 25196 gene locus_tag LOCUS_05760 25693 25196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 27058 26000 gene locus_tag LOCUS_05770 gene adhP 27058 26000 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088401.1 protein_id gnl|my_center|LOCUS_05770 28513 27077 gene locus_tag LOCUS_05780 28513 27077 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_05780 28847 28518 gene locus_tag LOCUS_05790 28847 28518 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770065.1 protein_id gnl|my_center|LOCUS_05790 29989 28844 gene locus_tag LOCUS_05800 29989 28844 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726703.1 protein_id gnl|my_center|LOCUS_05800 31532 30150 gene locus_tag LOCUS_05810 31532 30150 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385004.1 protein_id gnl|my_center|LOCUS_05810 31987 33024 gene locus_tag LOCUS_05820 31987 33024 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200942.1 protein_id gnl|my_center|LOCUS_05820 33535 33011 gene locus_tag LOCUS_05830 33535 33011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 34006 34479 gene locus_tag LOCUS_05840 34006 34479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 34748 35398 gene locus_tag LOCUS_05850 34748 35398 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833887.1 protein_id gnl|my_center|LOCUS_05850 35461 36000 gene locus_tag LOCUS_05860 35461 36000 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202950645.1 protein_id gnl|my_center|LOCUS_05860 36314 36562 gene locus_tag LOCUS_05870 36314 36562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 36846 36631 gene locus_tag LOCUS_05880 36846 36631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 36811 37563 gene locus_tag LOCUS_05890 36811 37563 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088811.1 protein_id gnl|my_center|LOCUS_05890 37751 37560 gene locus_tag LOCUS_05900 37751 37560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 37837 38679 gene locus_tag LOCUS_05910 37837 38679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence014 247 735 gene locus_tag LOCUS_05920 247 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 1522 764 gene locus_tag LOCUS_05930 1522 764 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919103.1 protein_id gnl|my_center|LOCUS_05930 2355 1519 gene locus_tag LOCUS_05940 2355 1519 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339275.1 protein_id gnl|my_center|LOCUS_05940 2533 2787 gene locus_tag LOCUS_05950 2533 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2809 3339 gene locus_tag LOCUS_05960 2809 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3336 4487 gene locus_tag LOCUS_05970 gene rlmN 3336 4487 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 protein_id gnl|my_center|LOCUS_05970 4598 5986 gene locus_tag LOCUS_05980 4598 5986 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849080.1 protein_id gnl|my_center|LOCUS_05980 6060 6698 gene locus_tag LOCUS_05990 6060 6698 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_05990 6698 7534 gene locus_tag LOCUS_06000 6698 7534 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338368.1 protein_id gnl|my_center|LOCUS_06000 7531 8667 gene locus_tag LOCUS_06010 gene lpxB 7531 8667 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337682.1 protein_id gnl|my_center|LOCUS_06010 8958 9455 gene locus_tag LOCUS_06020 8958 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 10012 9605 gene locus_tag LOCUS_06030 10012 9605 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265510.1 protein_id gnl|my_center|LOCUS_06030 10334 10017 gene locus_tag LOCUS_06040 gene trxA 10334 10017 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 protein_id gnl|my_center|LOCUS_06040 13812 10384 gene locus_tag LOCUS_06050 gene addA 13812 10384 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_06050 16730 13809 gene locus_tag LOCUS_06060 gene addB 16730 13809 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149141705.1 protein_id gnl|my_center|LOCUS_06060 17452 16727 gene locus_tag LOCUS_06070 17452 16727 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_06070 17889 17449 gene locus_tag LOCUS_06080 17889 17449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 17995 18996 gene locus_tag LOCUS_06090 17995 18996 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391186.1 protein_id gnl|my_center|LOCUS_06090 19464 19057 gene locus_tag LOCUS_06100 19464 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 20897 19467 gene locus_tag LOCUS_06110 gene atpD 20897 19467 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388981.1 protein_id gnl|my_center|LOCUS_06110 21798 20911 gene locus_tag LOCUS_06120 21798 20911 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389782.1 protein_id gnl|my_center|LOCUS_06120 23352 21820 gene locus_tag LOCUS_06130 gene atpA 23352 21820 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921278.1 protein_id gnl|my_center|LOCUS_06130 23981 23352 gene locus_tag LOCUS_06140 23981 23352 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169539095.1 protein_id gnl|my_center|LOCUS_06140 26240 24108 gene locus_tag LOCUS_06150 26240 24108 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972445.1 protein_id gnl|my_center|LOCUS_06150 26324 26980 gene locus_tag LOCUS_06160 gene fsa 26324 26980 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709604.1 protein_id gnl|my_center|LOCUS_06160 26977 27903 gene locus_tag LOCUS_06170 26977 27903 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388975.1 protein_id gnl|my_center|LOCUS_06170 28028 28531 gene locus_tag LOCUS_06180 28028 28531 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994099.1 protein_id gnl|my_center|LOCUS_06180 28969 28481 gene locus_tag LOCUS_06190 28969 28481 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 protein_id gnl|my_center|LOCUS_06190 30096 28966 gene locus_tag LOCUS_06200 gene ribA 30096 28966 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391384.1 protein_id gnl|my_center|LOCUS_06200 30252 30968 gene locus_tag LOCUS_06210 30252 30968 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266002.1 protein_id gnl|my_center|LOCUS_06210 31003 31079 gene locus_tag LOCUS_t00080 31003 31079 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 31457 31083 gene locus_tag LOCUS_06220 31457 31083 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_06220 32434 31544 gene locus_tag LOCUS_06230 32434 31544 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967190.1 protein_id gnl|my_center|LOCUS_06230 32568 33179 gene locus_tag LOCUS_06240 32568 33179 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206680.1 protein_id gnl|my_center|LOCUS_06240 33207 33827 gene locus_tag LOCUS_06250 33207 33827 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_06250 34017 34295 gene locus_tag LOCUS_06260 34017 34295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06260 34331 34714 gene locus_tag LOCUS_06270 34331 34714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06270 34708 35187 gene locus_tag LOCUS_06280 34708 35187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06280 35547 35359 gene locus_tag LOCUS_06290 35547 35359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 36002 35631 gene locus_tag LOCUS_06300 36002 35631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 36310 36537 gene locus_tag LOCUS_06310 36310 36537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 36543 37709 gene locus_tag LOCUS_06320 36543 37709 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233134.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence015 2105 1545 gene locus_tag LOCUS_06330 2105 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3557 2310 gene locus_tag LOCUS_06340 3557 2310 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173220.1 protein_id gnl|my_center|LOCUS_06340 3673 4281 gene locus_tag LOCUS_06350 3673 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 4895 4452 gene locus_tag LOCUS_06360 4895 4452 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085641.1 protein_id gnl|my_center|LOCUS_06360 4916 5521 gene locus_tag LOCUS_06370 4916 5521 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446818.1 protein_id gnl|my_center|LOCUS_06370 5831 5514 gene locus_tag LOCUS_06380 5831 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 6244 5828 gene locus_tag LOCUS_06390 6244 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 6888 6241 gene locus_tag LOCUS_06400 6888 6241 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197988.1 protein_id gnl|my_center|LOCUS_06400 8271 7240 gene locus_tag LOCUS_06410 gene cydB 8271 7240 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268936.1 protein_id gnl|my_center|LOCUS_06410 9691 8276 gene locus_tag LOCUS_06420 9691 8276 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188183.1 protein_id gnl|my_center|LOCUS_06420 9964 11187 gene locus_tag LOCUS_06430 9964 11187 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390177.1 protein_id gnl|my_center|LOCUS_06430 11194 12345 gene locus_tag LOCUS_06440 11194 12345 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626375.1 protein_id gnl|my_center|LOCUS_06440 13027 12362 gene locus_tag LOCUS_06450 13027 12362 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626629.1 protein_id gnl|my_center|LOCUS_06450 13026 13595 gene locus_tag LOCUS_06460 13026 13595 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626628.1 protein_id gnl|my_center|LOCUS_06460 13793 15103 gene locus_tag LOCUS_06470 13793 15103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 15253 15795 gene locus_tag LOCUS_06480 15253 15795 CDS product DUF3576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391379.1 protein_id gnl|my_center|LOCUS_06480 15801 18413 gene locus_tag LOCUS_06490 gene leuS 15801 18413 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391378.1 protein_id gnl|my_center|LOCUS_06490 18397 18933 gene locus_tag LOCUS_06500 18397 18933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 18943 19944 gene locus_tag LOCUS_06510 gene holA 18943 19944 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_06510 19959 21050 gene locus_tag LOCUS_06520 gene rsgA 19959 21050 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 protein_id gnl|my_center|LOCUS_06520 21975 21076 gene locus_tag LOCUS_06530 21975 21076 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135338848.1 protein_id gnl|my_center|LOCUS_06530 22072 23499 gene locus_tag LOCUS_06540 22072 23499 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_06540 23499 24557 gene locus_tag LOCUS_06550 23499 24557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 24792 24541 gene locus_tag LOCUS_06560 24792 24541 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531402.1 protein_id gnl|my_center|LOCUS_06560 25014 28331 gene locus_tag LOCUS_06570 25014 28331 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_06570 29076 28573 gene locus_tag LOCUS_06580 29076 28573 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626214.1 protein_id gnl|my_center|LOCUS_06580 30161 29079 gene locus_tag LOCUS_06590 30161 29079 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140150.1 protein_id gnl|my_center|LOCUS_06590 30247 31104 gene locus_tag LOCUS_06600 30247 31104 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968359.1 protein_id gnl|my_center|LOCUS_06600 31101 31640 gene locus_tag LOCUS_06610 gene greB 31101 31640 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_06610 31783 32076 gene locus_tag LOCUS_06620 31783 32076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 33978 32356 gene locus_tag LOCUS_06630 33978 32356 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389071.1 protein_id gnl|my_center|LOCUS_06630 34335 34054 gene locus_tag LOCUS_06640 34335 34054 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_06640 35185 34385 gene locus_tag LOCUS_06650 gene hutG 35185 34385 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391667.1 protein_id gnl|my_center|LOCUS_06650 36548 35178 gene locus_tag LOCUS_06660 36548 35178 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114467.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence016 955 257 gene locus_tag LOCUS_06670 955 257 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112306.1 protein_id gnl|my_center|LOCUS_06670 1569 955 gene locus_tag LOCUS_06680 1569 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 2275 1628 gene locus_tag LOCUS_06690 2275 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 2611 4146 gene locus_tag LOCUS_06700 2611 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 4333 5436 gene locus_tag LOCUS_06710 4333 5436 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085560.1 protein_id gnl|my_center|LOCUS_06710 5464 5916 gene locus_tag LOCUS_06720 5464 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06720 5977 6249 gene locus_tag LOCUS_06730 5977 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06730 8530 6323 gene locus_tag LOCUS_06740 8530 6323 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986774.1 protein_id gnl|my_center|LOCUS_06740 8841 11198 gene locus_tag LOCUS_06750 8841 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 11299 11727 gene locus_tag LOCUS_06760 11299 11727 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085175.1 protein_id gnl|my_center|LOCUS_06760 11863 12861 gene locus_tag LOCUS_06770 11863 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 12947 14095 gene locus_tag LOCUS_06780 12947 14095 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388860.1 protein_id gnl|my_center|LOCUS_06780 14097 15386 gene locus_tag LOCUS_06790 14097 15386 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 protein_id gnl|my_center|LOCUS_06790 15410 17404 gene locus_tag LOCUS_06800 15410 17404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 17408 17905 gene locus_tag LOCUS_06810 17408 17905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 18137 18715 gene locus_tag LOCUS_06820 18137 18715 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_06820 18755 19585 gene locus_tag LOCUS_06830 18755 19585 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109588.1 protein_id gnl|my_center|LOCUS_06830 20570 19575 gene locus_tag LOCUS_06840 gene mutY 20570 19575 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 protein_id gnl|my_center|LOCUS_06840 20615 21127 gene locus_tag LOCUS_06850 20615 21127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 21316 21921 gene locus_tag LOCUS_06860 21316 21921 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470666.1 protein_id gnl|my_center|LOCUS_06860 21929 25414 gene locus_tag LOCUS_06870 gene smc 21929 25414 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532753.1 protein_id gnl|my_center|LOCUS_06870 26309 25533 gene locus_tag LOCUS_06880 26309 25533 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387962.1 protein_id gnl|my_center|LOCUS_06880 26384 28069 gene locus_tag LOCUS_06890 26384 28069 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625965.1 protein_id gnl|my_center|LOCUS_06890 28253 29029 gene locus_tag LOCUS_06900 gene panB 28253 29029 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805473.1 protein_id gnl|my_center|LOCUS_06900 30093 29035 gene locus_tag LOCUS_06910 30093 29035 CDS product threonine aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967204.1 protein_id gnl|my_center|LOCUS_06910 30578 30099 gene locus_tag LOCUS_06920 30578 30099 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_06920 31523 30582 gene locus_tag LOCUS_06930 gene lipA 31523 30582 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919603.1 protein_id gnl|my_center|LOCUS_06930 32924 31527 gene locus_tag LOCUS_06940 gene lpdA 32924 31527 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670037.1 protein_id gnl|my_center|LOCUS_06940 33422 32937 gene locus_tag LOCUS_06950 33422 32937 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974618.1 protein_id gnl|my_center|LOCUS_06950 34750 33419 gene locus_tag LOCUS_06960 34750 33419 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_06960 36130 34763 gene locus_tag LOCUS_06970 36130 34763 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389633.1 protein_id gnl|my_center|LOCUS_06970 <37055 36134 gene locus_tag LOCUS_06980 <37055 36134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087551.1:pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha >Feature sequence017 2896 203 gene locus_tag LOCUS_06990 gene acnA 2896 203 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391258.1 protein_id gnl|my_center|LOCUS_06990 2994 3584 gene locus_tag LOCUS_07000 gene ccmA 2994 3584 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387801.1 protein_id gnl|my_center|LOCUS_07000 3581 4234 gene locus_tag LOCUS_07010 gene ccmB 3581 4234 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 protein_id gnl|my_center|LOCUS_07010 5882 4254 gene locus_tag LOCUS_07020 gene cydC 5882 4254 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097323.1 protein_id gnl|my_center|LOCUS_07020 7645 5879 gene locus_tag LOCUS_07030 gene cydD 7645 5879 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929714.1 protein_id gnl|my_center|LOCUS_07030 7719 8558 gene locus_tag LOCUS_07040 gene panC 7719 8558 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626566.1 protein_id gnl|my_center|LOCUS_07040 8686 8886 gene locus_tag LOCUS_07050 8686 8886 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719856.1 protein_id gnl|my_center|LOCUS_07050 8883 10343 gene locus_tag LOCUS_07060 8883 10343 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233134.1 protein_id gnl|my_center|LOCUS_07060 10370 11551 gene locus_tag LOCUS_07070 10370 11551 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920457.1 protein_id gnl|my_center|LOCUS_07070 12327 11623 gene locus_tag LOCUS_07080 gene phoB 12327 11623 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_07080 13051 12332 gene locus_tag LOCUS_07090 gene phoU 13051 12332 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_07090 13925 13122 gene locus_tag LOCUS_07100 gene pstB 13925 13122 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193614.1 protein_id gnl|my_center|LOCUS_07100 14796 14149 gene locus_tag LOCUS_07110 14796 14149 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_07110 14986 14912 gene locus_tag LOCUS_t00090 14986 14912 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 18478 15053 gene locus_tag LOCUS_07120 gene dnaE 18478 15053 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389457.1 protein_id gnl|my_center|LOCUS_07120 19277 18606 gene locus_tag LOCUS_07130 19277 18606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216122.1 protein_id gnl|my_center|LOCUS_07130 20427 19270 gene locus_tag LOCUS_07140 20427 19270 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_07140 21752 20430 gene locus_tag LOCUS_07150 21752 20430 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531107.1 protein_id gnl|my_center|LOCUS_07150 22910 21816 gene locus_tag LOCUS_07160 22910 21816 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918237.1 protein_id gnl|my_center|LOCUS_07160 24813 23167 gene locus_tag LOCUS_07170 24813 23167 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_07170 25642 24833 gene locus_tag LOCUS_07180 25642 24833 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389445.1 protein_id gnl|my_center|LOCUS_07180 26375 25626 gene locus_tag LOCUS_07190 26375 25626 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385012.1 protein_id gnl|my_center|LOCUS_07190 27823 26378 gene locus_tag LOCUS_07200 gene nuoN 27823 26378 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_07200 29355 27823 gene locus_tag LOCUS_07210 29355 27823 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_07210 31287 29359 gene locus_tag LOCUS_07220 gene nuoL 31287 29359 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389441.1 protein_id gnl|my_center|LOCUS_07220 31597 31289 gene locus_tag LOCUS_07230 gene nuoK 31597 31289 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_07230 32247 31594 gene locus_tag LOCUS_07240 32247 31594 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312704.1 protein_id gnl|my_center|LOCUS_07240 32732 32244 gene locus_tag LOCUS_07250 gene nuoI 32732 32244 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389438.1 protein_id gnl|my_center|LOCUS_07250 33778 32765 gene locus_tag LOCUS_07260 gene nuoH 33778 32765 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_07260 35838 33784 gene locus_tag LOCUS_07270 gene nuoG 35838 33784 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 protein_id gnl|my_center|LOCUS_07270 36224 35838 gene locus_tag LOCUS_07280 36224 35838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence018 <1 6307 gene locus_tag LOCUS_07290 <1 6307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205034.1:YadA-like family protein 6676 8745 gene locus_tag LOCUS_07300 6676 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 9044 10738 gene locus_tag LOCUS_07310 9044 10738 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144132.1 protein_id gnl|my_center|LOCUS_07310 10761 11252 gene locus_tag LOCUS_07320 10761 11252 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705368.1 protein_id gnl|my_center|LOCUS_07320 11305 12420 gene locus_tag LOCUS_07330 11305 12420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_07330 12417 12722 gene locus_tag LOCUS_07340 12417 12722 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 protein_id gnl|my_center|LOCUS_07340 14466 12736 gene locus_tag LOCUS_07350 14466 12736 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921647.1 protein_id gnl|my_center|LOCUS_07350 21575 14517 gene locus_tag LOCUS_07360 21575 14517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 22478 21732 gene locus_tag LOCUS_07370 22478 21732 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111548128.1 protein_id gnl|my_center|LOCUS_07370 22831 23787 gene locus_tag LOCUS_07380 gene cysD 22831 23787 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 protein_id gnl|my_center|LOCUS_07380 23790 25703 gene locus_tag LOCUS_07390 gene cysN 23790 25703 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385211.1 protein_id gnl|my_center|LOCUS_07390 25700 26440 gene locus_tag LOCUS_07400 25700 26440 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_07400 26937 26551 gene locus_tag LOCUS_07410 26937 26551 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252975.1 protein_id gnl|my_center|LOCUS_07410 27313 27020 gene locus_tag LOCUS_07420 27313 27020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 27648 29222 gene locus_tag LOCUS_07430 27648 29222 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919415.1 protein_id gnl|my_center|LOCUS_07430 29551 29300 gene locus_tag LOCUS_07440 29551 29300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 29942 29697 gene locus_tag LOCUS_07450 29942 29697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 30119 31159 gene locus_tag LOCUS_07460 30119 31159 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 protein_id gnl|my_center|LOCUS_07460 31302 32165 gene locus_tag LOCUS_07470 gene mreC 31302 32165 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 protein_id gnl|my_center|LOCUS_07470 32170 32709 gene locus_tag LOCUS_07480 gene mreD 32170 32709 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388231.1 protein_id gnl|my_center|LOCUS_07480 32720 34597 gene locus_tag LOCUS_07490 gene mrdA 32720 34597 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_07490 34594 35739 gene locus_tag LOCUS_07500 gene rodA 34594 35739 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391426.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence019 354 641 gene locus_tag LOCUS_07510 354 641 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_07510 658 1827 gene locus_tag LOCUS_07520 658 1827 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 protein_id gnl|my_center|LOCUS_07520 1833 2768 gene locus_tag LOCUS_07530 1833 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2765 3736 gene locus_tag LOCUS_07540 2765 3736 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_07540 3824 4570 gene locus_tag LOCUS_07550 3824 4570 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188685.1 protein_id gnl|my_center|LOCUS_07550 8066 4581 gene locus_tag LOCUS_07560 gene uca 8066 4581 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224505.1 protein_id gnl|my_center|LOCUS_07560 8677 8066 gene locus_tag LOCUS_07570 8677 8066 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140961.1 protein_id gnl|my_center|LOCUS_07570 9466 8690 gene locus_tag LOCUS_07580 9466 8690 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140962.1 protein_id gnl|my_center|LOCUS_07580 10289 9477 gene locus_tag LOCUS_07590 10289 9477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243173.1 protein_id gnl|my_center|LOCUS_07590 11104 10286 gene locus_tag LOCUS_07600 11104 10286 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413041.1 protein_id gnl|my_center|LOCUS_07600 12197 11106 gene locus_tag LOCUS_07610 12197 11106 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 protein_id gnl|my_center|LOCUS_07610 13718 12531 gene locus_tag LOCUS_07620 13718 12531 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061602.1 protein_id gnl|my_center|LOCUS_07620 14614 13715 gene locus_tag LOCUS_07630 14614 13715 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084956.1 protein_id gnl|my_center|LOCUS_07630 14728 15477 gene locus_tag LOCUS_07640 14728 15477 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084957.1 protein_id gnl|my_center|LOCUS_07640 15474 16310 gene locus_tag LOCUS_07650 15474 16310 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875269.1 protein_id gnl|my_center|LOCUS_07650 16307 17314 gene locus_tag LOCUS_07660 16307 17314 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092584911.1 protein_id gnl|my_center|LOCUS_07660 17382 18395 gene locus_tag LOCUS_07670 17382 18395 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497714.1 protein_id gnl|my_center|LOCUS_07670 18392 20290 gene locus_tag LOCUS_07680 18392 20290 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084961.1 protein_id gnl|my_center|LOCUS_07680 20300 21268 gene locus_tag LOCUS_07690 20300 21268 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974587.1 protein_id gnl|my_center|LOCUS_07690 21355 21627 gene locus_tag LOCUS_07700 21355 21627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 21617 22408 gene locus_tag LOCUS_07710 gene fabI 21617 22408 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338824.1 protein_id gnl|my_center|LOCUS_07710 22405 24093 gene locus_tag LOCUS_07720 22405 24093 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338825.1 protein_id gnl|my_center|LOCUS_07720 24101 25501 gene locus_tag LOCUS_07730 24101 25501 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524980.1 protein_id gnl|my_center|LOCUS_07730 25502 26683 gene locus_tag LOCUS_07740 25502 26683 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827568.1 protein_id gnl|my_center|LOCUS_07740 26951 28165 gene locus_tag LOCUS_07750 26951 28165 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113497.1 protein_id gnl|my_center|LOCUS_07750 29383 28181 gene locus_tag LOCUS_07760 gene pcaF 29383 28181 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 protein_id gnl|my_center|LOCUS_07760 29909 29658 gene locus_tag LOCUS_07770 29909 29658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 30385 29921 gene locus_tag LOCUS_07780 30385 29921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07780 30746 30564 gene locus_tag LOCUS_07790 30746 30564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07790 31003 30743 gene locus_tag LOCUS_07800 31003 30743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07800 34500 31387 gene locus_tag LOCUS_07810 34500 31387 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_07810 35202 34504 gene locus_tag LOCUS_07820 35202 34504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence020 <1 1255 gene locus_tag LOCUS_07830 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390869.1:amidotransferase 1, exosortase A system-associated 1252 2817 gene locus_tag LOCUS_07840 1252 2817 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_07840 2807 4855 gene locus_tag LOCUS_07850 2807 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 5974 4994 gene locus_tag LOCUS_07860 5974 4994 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388693.1 protein_id gnl|my_center|LOCUS_07860 6786 5971 gene locus_tag LOCUS_07870 6786 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07870 7095 6877 gene locus_tag LOCUS_07880 7095 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07880 11488 7409 gene locus_tag LOCUS_07890 11488 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 11877 12581 gene locus_tag LOCUS_07900 11877 12581 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419265.1 protein_id gnl|my_center|LOCUS_07900 13975 12587 gene locus_tag LOCUS_07910 13975 12587 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965836.1 protein_id gnl|my_center|LOCUS_07910 14426 14352 gene locus_tag LOCUS_t00100 14426 14352 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14564 15496 gene locus_tag LOCUS_07920 gene trxA 14564 15496 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083423.1 protein_id gnl|my_center|LOCUS_07920 15508 16173 gene locus_tag LOCUS_07930 15508 16173 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917998.1 protein_id gnl|my_center|LOCUS_07930 16177 16371 gene locus_tag LOCUS_07940 16177 16371 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083431.1 protein_id gnl|my_center|LOCUS_07940 17656 16487 gene locus_tag LOCUS_07950 17656 16487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 17889 18584 gene locus_tag LOCUS_07960 17889 18584 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446421.1 protein_id gnl|my_center|LOCUS_07960 19510 18641 gene locus_tag LOCUS_07970 19510 18641 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_07970 19837 20502 gene locus_tag LOCUS_07980 19837 20502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 20480 21571 gene locus_tag LOCUS_07990 20480 21571 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387894.1 protein_id gnl|my_center|LOCUS_07990 23024 21552 gene locus_tag LOCUS_08000 23024 21552 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_08000 23614 23045 gene locus_tag LOCUS_08010 gene rsmD 23614 23045 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388411.1 protein_id gnl|my_center|LOCUS_08010 24351 23611 gene locus_tag LOCUS_08020 24351 23611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 25061 24348 gene locus_tag LOCUS_08030 25061 24348 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_08030 25091 25549 gene locus_tag LOCUS_08040 25091 25549 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388408.1 protein_id gnl|my_center|LOCUS_08040 27034 25544 gene locus_tag LOCUS_08050 27034 25544 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_08050 27648 27031 gene locus_tag LOCUS_08060 27648 27031 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383578.1 protein_id gnl|my_center|LOCUS_08060 28600 27749 gene locus_tag LOCUS_08070 28600 27749 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 protein_id gnl|my_center|LOCUS_08070 29756 28794 gene locus_tag LOCUS_08080 29756 28794 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 protein_id gnl|my_center|LOCUS_08080 31357 29753 gene locus_tag LOCUS_08090 gene ctaD 31357 29753 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083990.1 protein_id gnl|my_center|LOCUS_08090 32242 31370 gene locus_tag LOCUS_08100 32242 31370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 33012 32356 gene locus_tag LOCUS_08110 33012 32356 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_08110 33804 33280 gene locus_tag LOCUS_08120 33804 33280 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241465.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence021 948 16 gene locus_tag LOCUS_08130 948 16 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_08130 1193 945 gene locus_tag LOCUS_08140 1193 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1255 2145 gene locus_tag LOCUS_08150 1255 2145 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_08150 2161 3432 gene locus_tag LOCUS_08160 2161 3432 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920324.1 protein_id gnl|my_center|LOCUS_08160 3932 3477 gene locus_tag LOCUS_08170 gene mscL 3932 3477 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383048.1 protein_id gnl|my_center|LOCUS_08170 4522 4052 gene locus_tag LOCUS_08180 4522 4052 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_08180 5050 6678 gene locus_tag LOCUS_08190 5050 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 6675 7955 gene locus_tag LOCUS_08200 6675 7955 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338730.1 protein_id gnl|my_center|LOCUS_08200 11171 8058 gene locus_tag LOCUS_08210 11171 8058 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090065.1 protein_id gnl|my_center|LOCUS_08210 12236 11175 gene locus_tag LOCUS_08220 12236 11175 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090064.1 protein_id gnl|my_center|LOCUS_08220 13301 12429 gene locus_tag LOCUS_08230 gene hemF 13301 12429 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918394.1 protein_id gnl|my_center|LOCUS_08230 14311 13403 gene locus_tag LOCUS_08240 14311 13403 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257737.1 protein_id gnl|my_center|LOCUS_08240 14456 15481 gene locus_tag LOCUS_08250 14456 15481 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092776.1 protein_id gnl|my_center|LOCUS_08250 15595 16017 gene locus_tag LOCUS_08260 15595 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 16127 16618 gene locus_tag LOCUS_08270 16127 16618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 16750 17877 gene locus_tag LOCUS_08280 16750 17877 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266608.1 protein_id gnl|my_center|LOCUS_08280 17874 18755 gene locus_tag LOCUS_08290 17874 18755 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388114.1 protein_id gnl|my_center|LOCUS_08290 19490 18744 gene locus_tag LOCUS_08300 19490 18744 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_08300 21153 19480 gene locus_tag LOCUS_08310 21153 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 22136 21165 gene locus_tag LOCUS_08320 22136 21165 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878166.1 protein_id gnl|my_center|LOCUS_08320 24576 22219 gene locus_tag LOCUS_08330 24576 22219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 24727 26004 gene locus_tag LOCUS_08340 gene gabT 24727 26004 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 protein_id gnl|my_center|LOCUS_08340 26372 26133 gene locus_tag LOCUS_08350 26372 26133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 27314 26409 gene locus_tag LOCUS_08360 27314 26409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 protein_id gnl|my_center|LOCUS_08360 28186 27311 gene locus_tag LOCUS_08370 28186 27311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_08370 28559 28188 gene locus_tag LOCUS_08380 28559 28188 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_08380 29561 28893 gene locus_tag LOCUS_08390 29561 28893 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640290.1 protein_id gnl|my_center|LOCUS_08390 30631 29567 gene locus_tag LOCUS_08400 30631 29567 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265726.1 protein_id gnl|my_center|LOCUS_08400 30772 30845 gene locus_tag LOCUS_t00110 30772 30845 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 30909 31406 gene locus_tag LOCUS_08410 30909 31406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 31632 33128 gene locus_tag LOCUS_08420 31632 33128 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339227.1 protein_id gnl|my_center|LOCUS_08420 <34086 33267 gene locus_tag LOCUS_08430 <34086 33267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087375.1:2-dehydropantoate 2-reductase >Feature sequence022 809 18 gene locus_tag LOCUS_08440 809 18 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_08440 1210 809 gene locus_tag LOCUS_08450 1210 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1875 1213 gene locus_tag LOCUS_08460 1875 1213 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_08460 2738 1878 gene locus_tag LOCUS_08470 2738 1878 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_08470 3798 2941 gene locus_tag LOCUS_08480 3798 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 4368 6302 gene locus_tag LOCUS_08490 4368 6302 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265609.1 protein_id gnl|my_center|LOCUS_08490 6686 6429 gene locus_tag LOCUS_08500 6686 6429 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919553.1 protein_id gnl|my_center|LOCUS_08500 7712 6729 gene locus_tag LOCUS_08510 7712 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 8629 7712 gene locus_tag LOCUS_08520 8629 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528731.1 protein_id gnl|my_center|LOCUS_08520 8736 9737 gene locus_tag LOCUS_08530 8736 9737 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_08530 9734 10831 gene locus_tag LOCUS_08540 9734 10831 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188250.1 protein_id gnl|my_center|LOCUS_08540 10828 11658 gene locus_tag LOCUS_08550 gene hpnC 10828 11658 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387826.1 protein_id gnl|my_center|LOCUS_08550 11655 12506 gene locus_tag LOCUS_08560 gene hpnD 11655 12506 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190675.1 protein_id gnl|my_center|LOCUS_08560 12506 13756 gene locus_tag LOCUS_08570 gene hpnE 12506 13756 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_08570 13764 15686 gene locus_tag LOCUS_08580 gene shc 13764 15686 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529547.1 protein_id gnl|my_center|LOCUS_08580 15887 20263 gene locus_tag LOCUS_08590 15887 20263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 22133 20217 gene locus_tag LOCUS_08600 22133 20217 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_08600 22261 22929 gene locus_tag LOCUS_08610 gene purQ 22261 22929 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532129.1 protein_id gnl|my_center|LOCUS_08610 22926 25100 gene locus_tag LOCUS_08620 gene purL 22926 25100 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_08620 25116 25349 gene locus_tag LOCUS_08630 25116 25349 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088461.1 protein_id gnl|my_center|LOCUS_08630 25360 25698 gene locus_tag LOCUS_08640 gene grxD 25360 25698 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548651.1 protein_id gnl|my_center|LOCUS_08640 25728 26918 gene locus_tag LOCUS_08650 25728 26918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 26915 27673 gene locus_tag LOCUS_08660 26915 27673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 27743 28927 gene locus_tag LOCUS_08670 27743 28927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551351.1 protein_id gnl|my_center|LOCUS_08670 29085 30179 gene locus_tag LOCUS_08680 29085 30179 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_08680 30341 31450 gene locus_tag LOCUS_08690 30341 31450 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence023 82 1020 gene locus_tag LOCUS_08700 82 1020 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103406.1 protein_id gnl|my_center|LOCUS_08700 1348 1079 gene locus_tag LOCUS_08710 1348 1079 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939083.1 protein_id gnl|my_center|LOCUS_08710 1573 1498 gene locus_tag LOCUS_t00120 1573 1498 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1700 1626 gene locus_tag LOCUS_t00130 1700 1626 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2010 2531 gene locus_tag LOCUS_08720 gene dcd 2010 2531 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554836.1 protein_id gnl|my_center|LOCUS_08720 2559 3806 gene locus_tag LOCUS_08730 gene murA 2559 3806 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390681.1 protein_id gnl|my_center|LOCUS_08730 3853 4779 gene locus_tag LOCUS_08740 3853 4779 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087859.1 protein_id gnl|my_center|LOCUS_08740 4776 6050 gene locus_tag LOCUS_08750 gene pyrC 4776 6050 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390939.1 protein_id gnl|my_center|LOCUS_08750 6047 6625 gene locus_tag LOCUS_08760 gene plsY 6047 6625 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563048.1 protein_id gnl|my_center|LOCUS_08760 6622 7740 gene locus_tag LOCUS_08770 gene dprA 6622 7740 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_08770 7771 10497 gene locus_tag LOCUS_08780 gene topA 7771 10497 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390950.1 protein_id gnl|my_center|LOCUS_08780 10494 12800 gene locus_tag LOCUS_08790 gene rnr 10494 12800 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390951.1 protein_id gnl|my_center|LOCUS_08790 12824 14362 gene locus_tag LOCUS_08800 12824 14362 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470630.1 protein_id gnl|my_center|LOCUS_08800 14425 14592 gene locus_tag LOCUS_08810 gene rpmG 14425 14592 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537640.1 protein_id gnl|my_center|LOCUS_08810 14617 15702 gene locus_tag LOCUS_08820 14617 15702 CDS product putative zinc-binding peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967100.1 protein_id gnl|my_center|LOCUS_08820 16563 15856 gene locus_tag LOCUS_08830 16563 15856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 17018 16560 gene locus_tag LOCUS_08840 17018 16560 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_08840 17709 17023 gene locus_tag LOCUS_08850 17709 17023 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_08850 20269 17870 gene locus_tag LOCUS_08860 20269 17870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 20506 21600 gene locus_tag LOCUS_08870 20506 21600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 21683 22507 gene locus_tag LOCUS_08880 21683 22507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 22549 23550 gene locus_tag LOCUS_08890 22549 23550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 23564 24037 gene locus_tag LOCUS_08900 23564 24037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 24037 25800 gene locus_tag LOCUS_08910 24037 25800 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_08910 26318 25797 gene locus_tag LOCUS_08920 26318 25797 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809303.1 protein_id gnl|my_center|LOCUS_08920 26866 26315 gene locus_tag LOCUS_08930 26866 26315 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809301.1 protein_id gnl|my_center|LOCUS_08930 27165 28244 gene locus_tag LOCUS_08940 gene pstS 27165 28244 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900236.1 protein_id gnl|my_center|LOCUS_08940 28322 29293 gene locus_tag LOCUS_08950 gene pstC 28322 29293 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404792.1 protein_id gnl|my_center|LOCUS_08950 29277 30155 gene locus_tag LOCUS_08960 gene pstA 29277 30155 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404794.1 protein_id gnl|my_center|LOCUS_08960 31350 30172 gene locus_tag LOCUS_08970 31350 30172 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence024 1557 1282 gene locus_tag LOCUS_08980 1557 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1984 1661 gene locus_tag LOCUS_08990 1984 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 3514 1997 gene locus_tag LOCUS_09000 3514 1997 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_09000 4233 3532 gene locus_tag LOCUS_09010 4233 3532 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383161.1 protein_id gnl|my_center|LOCUS_09010 4828 4286 gene locus_tag LOCUS_09020 gene folK 4828 4286 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_09020 4897 5475 gene locus_tag LOCUS_09030 4897 5475 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_09030 5472 6122 gene locus_tag LOCUS_09040 5472 6122 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_09040 6189 7805 gene locus_tag LOCUS_09050 6189 7805 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957525.1 protein_id gnl|my_center|LOCUS_09050 9530 8049 gene locus_tag LOCUS_09060 9530 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 9790 9530 gene locus_tag LOCUS_09070 9790 9530 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802828.1 protein_id gnl|my_center|LOCUS_09070 11688 9793 gene locus_tag LOCUS_09080 11688 9793 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336813.1 protein_id gnl|my_center|LOCUS_09080 13667 11691 gene locus_tag LOCUS_09090 13667 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 15974 13722 gene locus_tag LOCUS_09100 15974 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 16895 16269 gene locus_tag LOCUS_09110 gene radC 16895 16269 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388490.1 protein_id gnl|my_center|LOCUS_09110 20623 17204 gene locus_tag LOCUS_09120 gene mfd 20623 17204 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389416.1 protein_id gnl|my_center|LOCUS_09120 20889 20620 gene locus_tag LOCUS_09130 20889 20620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 20933 22897 gene locus_tag LOCUS_09140 gene recG 20933 22897 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337615.1 protein_id gnl|my_center|LOCUS_09140 24164 22977 gene locus_tag LOCUS_09150 24164 22977 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104245.1 protein_id gnl|my_center|LOCUS_09150 24243 24665 gene locus_tag LOCUS_09160 24243 24665 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_09160 25064 24651 gene locus_tag LOCUS_09170 25064 24651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 25825 25211 gene locus_tag LOCUS_09180 gene rpsD 25825 25211 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388459.1 protein_id gnl|my_center|LOCUS_09180 26388 25954 gene locus_tag LOCUS_09190 26388 25954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 30101 26409 gene locus_tag LOCUS_09200 30101 26409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 30274 31185 gene locus_tag LOCUS_09210 30274 31185 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927239.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence025 1284 352 gene locus_tag LOCUS_09220 1284 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1329 2555 gene locus_tag LOCUS_09230 gene tyrS 1329 2555 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389785.1 protein_id gnl|my_center|LOCUS_09230 2552 2980 gene locus_tag LOCUS_09240 2552 2980 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 protein_id gnl|my_center|LOCUS_09240 3676 3215 gene locus_tag LOCUS_09250 3676 3215 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268700.1 protein_id gnl|my_center|LOCUS_09250 4303 3677 gene locus_tag LOCUS_09260 gene parA 4303 3677 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202825640.1 protein_id gnl|my_center|LOCUS_09260 4372 5787 gene locus_tag LOCUS_09270 4372 5787 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389422.1 protein_id gnl|my_center|LOCUS_09270 5803 8163 gene locus_tag LOCUS_09280 5803 8163 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085599.1 protein_id gnl|my_center|LOCUS_09280 9643 8570 gene locus_tag LOCUS_09290 9643 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 10623 9844 gene locus_tag LOCUS_09300 10623 9844 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090581.1 protein_id gnl|my_center|LOCUS_09300 10909 10637 gene locus_tag LOCUS_09310 10909 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 10950 13109 gene locus_tag LOCUS_09320 gene pnp 10950 13109 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391532.1 protein_id gnl|my_center|LOCUS_09320 13236 13865 gene locus_tag LOCUS_09330 13236 13865 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545403.1 protein_id gnl|my_center|LOCUS_09330 15032 13917 gene locus_tag LOCUS_09340 gene hpnH 15032 13917 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187762.1 protein_id gnl|my_center|LOCUS_09340 16015 15044 gene locus_tag LOCUS_09350 gene ispH 16015 15044 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470638.1 protein_id gnl|my_center|LOCUS_09350 16356 18299 gene locus_tag LOCUS_09360 gene dxs 16356 18299 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175335.1 protein_id gnl|my_center|LOCUS_09360 18374 19018 gene locus_tag LOCUS_09370 18374 19018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 19122 20252 gene locus_tag LOCUS_09380 gene hpnI 19122 20252 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197829.1 protein_id gnl|my_center|LOCUS_09380 20249 21688 gene locus_tag LOCUS_09390 gene hpnJ 20249 21688 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_09390 21727 22527 gene locus_tag LOCUS_09400 gene hpnK 21727 22527 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552372.1 protein_id gnl|my_center|LOCUS_09400 22743 24590 gene locus_tag LOCUS_09410 22743 24590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 24945 25613 gene locus_tag LOCUS_09420 24945 25613 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640214.1 protein_id gnl|my_center|LOCUS_09420 26626 25625 gene locus_tag LOCUS_09430 gene prfB 26626 25625 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919740.1 protein_id gnl|my_center|LOCUS_09430 29308 26801 gene locus_tag LOCUS_09440 29308 26801 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_09440 30299 29778 gene locus_tag LOCUS_09450 30299 29778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 30193 30885 gene locus_tag LOCUS_09460 30193 30885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 31047 31124 gene locus_tag LOCUS_t00140 31047 31124 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence026 634 119 gene locus_tag LOCUS_09470 634 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1767 646 gene locus_tag LOCUS_09480 gene dapE 1767 646 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391227.1 protein_id gnl|my_center|LOCUS_09480 2599 1760 gene locus_tag LOCUS_09490 gene dapD 2599 1760 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 protein_id gnl|my_center|LOCUS_09490 2764 3876 gene locus_tag LOCUS_09500 2764 3876 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085973.1 protein_id gnl|my_center|LOCUS_09500 4720 3890 gene locus_tag LOCUS_09510 4720 3890 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814755.1 protein_id gnl|my_center|LOCUS_09510 4905 6032 gene locus_tag LOCUS_09520 4905 6032 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268098.1 protein_id gnl|my_center|LOCUS_09520 6412 7848 gene locus_tag LOCUS_09530 6412 7848 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401220.1 protein_id gnl|my_center|LOCUS_09530 7845 8999 gene locus_tag LOCUS_09540 gene glcE 7845 8999 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974600.1 protein_id gnl|my_center|LOCUS_09540 9001 10326 gene locus_tag LOCUS_09550 gene glcF 9001 10326 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971053.1 protein_id gnl|my_center|LOCUS_09550 11182 10397 gene locus_tag LOCUS_09560 gene paaG 11182 10397 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969784.1 protein_id gnl|my_center|LOCUS_09560 11256 12206 gene locus_tag LOCUS_09570 11256 12206 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_09570 12285 13316 gene locus_tag LOCUS_09580 12285 13316 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388951.1 protein_id gnl|my_center|LOCUS_09580 13705 13412 gene locus_tag LOCUS_09590 13705 13412 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338625.1 protein_id gnl|my_center|LOCUS_09590 14587 13862 gene locus_tag LOCUS_09600 14587 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 15150 14584 gene locus_tag LOCUS_09610 15150 14584 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391004.1 protein_id gnl|my_center|LOCUS_09610 16187 15216 gene locus_tag LOCUS_09620 16187 15216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 16875 16180 gene locus_tag LOCUS_09630 gene ftsE 16875 16180 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626546.1 protein_id gnl|my_center|LOCUS_09630 17054 17617 gene locus_tag LOCUS_09640 17054 17617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 17814 17620 gene locus_tag LOCUS_09650 17814 17620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 18053 19105 gene locus_tag LOCUS_09660 18053 19105 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_09660 19238 20314 gene locus_tag LOCUS_09670 19238 20314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 20319 21002 gene locus_tag LOCUS_09680 20319 21002 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_09680 21137 22597 gene locus_tag LOCUS_09690 21137 22597 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_09690 22948 22616 gene locus_tag LOCUS_09700 22948 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 24350 23064 gene locus_tag LOCUS_09710 24350 23064 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_09710 25776 24652 gene locus_tag LOCUS_09720 gene dnaN 25776 24652 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_09720 27398 25926 gene locus_tag LOCUS_09730 gene dnaA 27398 25926 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_09730 28146 27877 gene locus_tag LOCUS_09740 gene rpsT 28146 27877 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310170.1 protein_id gnl|my_center|LOCUS_09740 29027 28254 gene locus_tag LOCUS_09750 29027 28254 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_09750 29928 29101 gene locus_tag LOCUS_09760 gene mutM 29928 29101 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338891.1 protein_id gnl|my_center|LOCUS_09760 29958 30707 gene locus_tag LOCUS_09770 gene ubiE 29958 30707 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626664.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence027 842 1246 gene locus_tag LOCUS_09780 gene apaG 842 1246 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388023.1 protein_id gnl|my_center|LOCUS_09780 1246 2097 gene locus_tag LOCUS_09790 1246 2097 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060909735.1 protein_id gnl|my_center|LOCUS_09790 2190 2831 gene locus_tag LOCUS_09800 gene folE 2190 2831 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388024.1 protein_id gnl|my_center|LOCUS_09800 4555 3008 gene locus_tag LOCUS_09810 gene ppx 4555 3008 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_09810 6186 4753 gene locus_tag LOCUS_09820 gene tldD 6186 4753 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_09820 7250 6183 gene locus_tag LOCUS_09830 7250 6183 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165691202.1 protein_id gnl|my_center|LOCUS_09830 8341 7247 gene locus_tag LOCUS_09840 8341 7247 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919251.1 protein_id gnl|my_center|LOCUS_09840 8587 10263 gene locus_tag LOCUS_09850 8587 10263 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 protein_id gnl|my_center|LOCUS_09850 10357 10875 gene locus_tag LOCUS_09860 10357 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 10917 12053 gene locus_tag LOCUS_09870 10917 12053 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389065.1 protein_id gnl|my_center|LOCUS_09870 12057 14426 gene locus_tag LOCUS_09880 12057 14426 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389064.1 protein_id gnl|my_center|LOCUS_09880 14442 16232 gene locus_tag LOCUS_09890 14442 16232 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389063.1 protein_id gnl|my_center|LOCUS_09890 18255 16375 gene locus_tag LOCUS_09900 18255 16375 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038140.1 protein_id gnl|my_center|LOCUS_09900 19189 18422 gene locus_tag LOCUS_09910 19189 18422 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 protein_id gnl|my_center|LOCUS_09910 20315 19221 gene locus_tag LOCUS_09920 20315 19221 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338813.1 protein_id gnl|my_center|LOCUS_09920 20975 20319 gene locus_tag LOCUS_09930 20975 20319 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_09930 21066 21644 gene locus_tag LOCUS_09940 21066 21644 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350585.1 protein_id gnl|my_center|LOCUS_09940 22415 21660 gene locus_tag LOCUS_09950 22415 21660 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_09950 22531 25110 gene locus_tag LOCUS_09960 gene clpB 22531 25110 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388511.1 protein_id gnl|my_center|LOCUS_09960 26191 25250 gene locus_tag LOCUS_09970 26191 25250 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420184.1 protein_id gnl|my_center|LOCUS_09970 26404 27708 gene locus_tag LOCUS_09980 26404 27708 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966276.1 protein_id gnl|my_center|LOCUS_09980 27731 28864 gene locus_tag LOCUS_09990 27731 28864 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090631.1 protein_id gnl|my_center|LOCUS_09990 28861 29238 gene locus_tag LOCUS_10000 28861 29238 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967915.1 protein_id gnl|my_center|LOCUS_10000 29279 30160 gene locus_tag LOCUS_10010 29279 30160 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731590.1 protein_id gnl|my_center|LOCUS_10010 <30901 30209 gene locus_tag LOCUS_10020 <30901 30209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807822.1:hydroxymethylglutaryl-CoA lyase >Feature sequence028 131 55 gene locus_tag LOCUS_t00150 131 55 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1156 194 gene locus_tag LOCUS_10030 gene speB 1156 194 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187785.1 protein_id gnl|my_center|LOCUS_10030 1786 1166 gene locus_tag LOCUS_10040 gene upp 1786 1166 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729095.1 protein_id gnl|my_center|LOCUS_10040 3445 1817 gene locus_tag LOCUS_10050 3445 1817 CDS product stimulus-sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_10050 4188 3487 gene locus_tag LOCUS_10060 4188 3487 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_10060 4237 4974 gene locus_tag LOCUS_10070 4237 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 5061 6686 gene locus_tag LOCUS_10080 5061 6686 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090863.1 protein_id gnl|my_center|LOCUS_10080 7867 6695 gene locus_tag LOCUS_10090 7867 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 7993 8415 gene locus_tag LOCUS_10100 7993 8415 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_10100 8412 9326 gene locus_tag LOCUS_10110 gene rapZ 8412 9326 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470669.1 protein_id gnl|my_center|LOCUS_10110 9367 9789 gene locus_tag LOCUS_10120 9367 9789 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_10120 9786 10136 gene locus_tag LOCUS_10130 9786 10136 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626594.1 protein_id gnl|my_center|LOCUS_10130 10123 11913 gene locus_tag LOCUS_10140 gene ptsP 10123 11913 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391192.1 protein_id gnl|my_center|LOCUS_10140 13459 11924 gene locus_tag LOCUS_10150 13459 11924 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_10150 13589 14257 gene locus_tag LOCUS_10160 13589 14257 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 protein_id gnl|my_center|LOCUS_10160 14927 14433 gene locus_tag LOCUS_10170 gene smpB 14927 14433 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389617.1 protein_id gnl|my_center|LOCUS_10170 15810 14932 gene locus_tag LOCUS_10180 gene dapA 15810 14932 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389618.1 protein_id gnl|my_center|LOCUS_10180 15890 17668 gene locus_tag LOCUS_10190 15890 17668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 17668 18120 gene locus_tag LOCUS_10200 17668 18120 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537662.1 protein_id gnl|my_center|LOCUS_10200 18113 18583 gene locus_tag LOCUS_10210 18113 18583 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389623.1 protein_id gnl|my_center|LOCUS_10210 19277 18576 gene locus_tag LOCUS_10220 19277 18576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 19402 21567 gene locus_tag LOCUS_10230 19402 21567 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 protein_id gnl|my_center|LOCUS_10230 21669 22427 gene locus_tag LOCUS_10240 21669 22427 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067283.1 protein_id gnl|my_center|LOCUS_10240 24272 22632 gene locus_tag LOCUS_10250 24272 22632 CDS product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027581.1 protein_id gnl|my_center|LOCUS_10250 25647 24265 gene locus_tag LOCUS_10260 25647 24265 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920467.1 protein_id gnl|my_center|LOCUS_10260 25823 25644 gene locus_tag LOCUS_10270 25823 25644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 27379 25820 gene locus_tag LOCUS_10280 27379 25820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 protein_id gnl|my_center|LOCUS_10280 28059 27376 gene locus_tag LOCUS_10290 28059 27376 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 protein_id gnl|my_center|LOCUS_10290 29274 28198 gene locus_tag LOCUS_10300 gene flhB 29274 28198 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918961.1 protein_id gnl|my_center|LOCUS_10300 30053 29277 gene locus_tag LOCUS_10310 gene fliR 30053 29277 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088554.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence029 2002 668 gene locus_tag LOCUS_10320 gene ugpB 2002 668 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811264.1 protein_id gnl|my_center|LOCUS_10320 2214 2480 gene locus_tag LOCUS_10330 2214 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 3369 2458 gene locus_tag LOCUS_10340 3369 2458 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 protein_id gnl|my_center|LOCUS_10340 5588 3366 gene locus_tag LOCUS_10350 5588 3366 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929876.1 protein_id gnl|my_center|LOCUS_10350 5769 7223 gene locus_tag LOCUS_10360 5769 7223 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_10360 7228 8220 gene locus_tag LOCUS_10370 7228 8220 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_10370 8506 10050 gene locus_tag LOCUS_10380 8506 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 11695 11015 gene locus_tag LOCUS_10390 11695 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 12456 11692 gene locus_tag LOCUS_10400 12456 11692 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_10400 13594 12674 gene locus_tag LOCUS_10410 13594 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 14102 13749 gene locus_tag LOCUS_10420 14102 13749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 14401 14099 gene locus_tag LOCUS_10430 14401 14099 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390477.1 protein_id gnl|my_center|LOCUS_10430 15525 14398 gene locus_tag LOCUS_10440 15525 14398 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390476.1 protein_id gnl|my_center|LOCUS_10440 15731 16168 gene locus_tag LOCUS_10450 15731 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 16288 16704 gene locus_tag LOCUS_10460 gene dksA 16288 16704 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390474.1 protein_id gnl|my_center|LOCUS_10460 17549 16779 gene locus_tag LOCUS_10470 gene xth 17549 16779 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919877.1 protein_id gnl|my_center|LOCUS_10470 17897 17556 gene locus_tag LOCUS_10480 gene erpA 17897 17556 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534548.1 protein_id gnl|my_center|LOCUS_10480 17939 19285 gene locus_tag LOCUS_10490 17939 19285 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919351.1 protein_id gnl|my_center|LOCUS_10490 19327 20469 gene locus_tag LOCUS_10500 19327 20469 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389533.1 protein_id gnl|my_center|LOCUS_10500 20518 22290 gene locus_tag LOCUS_10510 gene argS 20518 22290 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140224.1 protein_id gnl|my_center|LOCUS_10510 22296 23015 gene locus_tag LOCUS_10520 22296 23015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 23015 23890 gene locus_tag LOCUS_10530 gene nagZ 23015 23890 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_10530 23887 24597 gene locus_tag LOCUS_10540 23887 24597 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389529.1 protein_id gnl|my_center|LOCUS_10540 24584 25339 gene locus_tag LOCUS_10550 24584 25339 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_10550 25329 25928 gene locus_tag LOCUS_10560 gene scpB 25329 25928 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537941.1 protein_id gnl|my_center|LOCUS_10560 27125 25920 gene locus_tag LOCUS_10570 27125 25920 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_10570 28409 27183 gene locus_tag LOCUS_10580 28409 27183 CDS product TCR/Tet family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615760.1 protein_id gnl|my_center|LOCUS_10580 28514 28439 gene locus_tag LOCUS_t00160 28514 28439 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 28653 28738 gene locus_tag LOCUS_t00170 28653 28738 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28869 29099 gene locus_tag LOCUS_10590 28869 29099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence030 1869 592 gene locus_tag LOCUS_10600 gene rho 1869 592 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391366.1 protein_id gnl|my_center|LOCUS_10600 2480 2031 gene locus_tag LOCUS_10610 gene hemJ 2480 2031 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338807.1 protein_id gnl|my_center|LOCUS_10610 3148 2477 gene locus_tag LOCUS_10620 3148 2477 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338579.1 protein_id gnl|my_center|LOCUS_10620 4257 3148 gene locus_tag LOCUS_10630 gene hemH 4257 3148 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391364.1 protein_id gnl|my_center|LOCUS_10630 5321 4263 gene locus_tag LOCUS_10640 gene hemE 5321 4263 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338412.1 protein_id gnl|my_center|LOCUS_10640 5596 6471 gene locus_tag LOCUS_10650 5596 6471 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330370.1 protein_id gnl|my_center|LOCUS_10650 6475 7074 gene locus_tag LOCUS_10660 6475 7074 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391361.1 protein_id gnl|my_center|LOCUS_10660 7614 7258 gene locus_tag LOCUS_10670 7614 7258 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242349.1 protein_id gnl|my_center|LOCUS_10670 7883 7611 gene locus_tag LOCUS_10680 7883 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 8802 8113 gene locus_tag LOCUS_10690 8802 8113 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391350.1 protein_id gnl|my_center|LOCUS_10690 10217 8799 gene locus_tag LOCUS_10700 10217 8799 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391352.1 protein_id gnl|my_center|LOCUS_10700 10687 10283 gene locus_tag LOCUS_10710 10687 10283 CDS product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 protein_id gnl|my_center|LOCUS_10710 11752 10691 gene locus_tag LOCUS_10720 11752 10691 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039520.1 protein_id gnl|my_center|LOCUS_10720 13168 11759 gene locus_tag LOCUS_10730 13168 11759 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528554.1 protein_id gnl|my_center|LOCUS_10730 14842 13256 gene locus_tag LOCUS_10740 14842 13256 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470643.1 protein_id gnl|my_center|LOCUS_10740 15032 15712 gene locus_tag LOCUS_10750 15032 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 15776 18550 gene locus_tag LOCUS_10760 15776 18550 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_10760 18632 18559 gene locus_tag LOCUS_t00180 18632 18559 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18694 19872 gene locus_tag LOCUS_10770 18694 19872 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530162.1 protein_id gnl|my_center|LOCUS_10770 20777 19878 gene locus_tag LOCUS_10780 20777 19878 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_10780 21724 20774 gene locus_tag LOCUS_10790 gene lpxK 21724 20774 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388340.1 protein_id gnl|my_center|LOCUS_10790 22002 21721 gene locus_tag LOCUS_10800 22002 21721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10800 23023 21983 gene locus_tag LOCUS_10810 23023 21983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10810 23673 23020 gene locus_tag LOCUS_10820 23673 23020 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_10820 28132 23705 gene locus_tag LOCUS_10830 28132 23705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 28561 28304 gene locus_tag LOCUS_10840 28561 28304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence031 1196 195 gene locus_tag LOCUS_10850 1196 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2352 1243 gene locus_tag LOCUS_10860 2352 1243 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064805.1 protein_id gnl|my_center|LOCUS_10860 2483 4288 gene locus_tag LOCUS_10870 2483 4288 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408474.1 protein_id gnl|my_center|LOCUS_10870 4749 4510 gene locus_tag LOCUS_10880 gene purS 4749 4510 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383889.1 protein_id gnl|my_center|LOCUS_10880 5510 4746 gene locus_tag LOCUS_10890 5510 4746 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388469.1 protein_id gnl|my_center|LOCUS_10890 5630 6814 gene locus_tag LOCUS_10900 5630 6814 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967043.1 protein_id gnl|my_center|LOCUS_10900 6937 7950 gene locus_tag LOCUS_10910 6937 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 7947 9506 gene locus_tag LOCUS_10920 7947 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 9503 10555 gene locus_tag LOCUS_10930 9503 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 10555 11268 gene locus_tag LOCUS_10940 10555 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 11265 11432 gene locus_tag LOCUS_10950 11265 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 11878 11414 gene locus_tag LOCUS_10960 gene ruvX 11878 11414 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390926.1 protein_id gnl|my_center|LOCUS_10960 11926 12213 gene locus_tag LOCUS_10970 gene gatC 11926 12213 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531787.1 protein_id gnl|my_center|LOCUS_10970 12213 13694 gene locus_tag LOCUS_10980 gene gatA 12213 13694 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920295.1 protein_id gnl|my_center|LOCUS_10980 13691 15142 gene locus_tag LOCUS_10990 gene gatB 13691 15142 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390923.1 protein_id gnl|my_center|LOCUS_10990 15179 16345 gene locus_tag LOCUS_11000 15179 16345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 16954 16346 gene locus_tag LOCUS_11010 16954 16346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 17039 17224 gene locus_tag LOCUS_11020 17039 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186307.1 protein_id gnl|my_center|LOCUS_11020 17770 17540 gene locus_tag LOCUS_11030 17770 17540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 18197 19483 gene locus_tag LOCUS_11040 18197 19483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 19480 20280 gene locus_tag LOCUS_11050 19480 20280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 20623 20324 gene locus_tag LOCUS_11060 20623 20324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 20513 21610 gene locus_tag LOCUS_11070 20513 21610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 21607 22341 gene locus_tag LOCUS_11080 21607 22341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 23039 23188 gene locus_tag LOCUS_11090 23039 23188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 24328 23582 gene locus_tag LOCUS_11100 24328 23582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 26150 27295 gene locus_tag LOCUS_11110 26150 27295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 27404 28006 gene locus_tag LOCUS_11120 27404 28006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence032 415 711 gene locus_tag LOCUS_11130 415 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2279 765 gene locus_tag LOCUS_11140 2279 765 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921551.1 protein_id gnl|my_center|LOCUS_11140 2538 3611 gene locus_tag LOCUS_11150 2538 3611 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762418.1 protein_id gnl|my_center|LOCUS_11150 3717 4382 gene locus_tag LOCUS_11160 3717 4382 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931025.1 protein_id gnl|my_center|LOCUS_11160 4393 5457 gene locus_tag LOCUS_11170 4393 5457 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931024.1 protein_id gnl|my_center|LOCUS_11170 5574 6317 gene locus_tag LOCUS_11180 5574 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6304 7710 gene locus_tag LOCUS_11190 6304 7710 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_11190 7766 8710 gene locus_tag LOCUS_11200 7766 8710 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 protein_id gnl|my_center|LOCUS_11200 8803 10182 gene locus_tag LOCUS_11210 8803 10182 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918418.1 protein_id gnl|my_center|LOCUS_11210 10204 12861 gene locus_tag LOCUS_11220 10204 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 14482 12836 gene locus_tag LOCUS_11230 14482 12836 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067718.1 protein_id gnl|my_center|LOCUS_11230 15876 14620 gene locus_tag LOCUS_11240 15876 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 17362 15992 gene locus_tag LOCUS_11250 17362 15992 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_11250 18403 17729 gene locus_tag LOCUS_11260 18403 17729 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_11260 19331 18549 gene locus_tag LOCUS_11270 19331 18549 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388960.1 protein_id gnl|my_center|LOCUS_11270 21161 19350 gene locus_tag LOCUS_11280 gene sdhA 21161 19350 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388959.1 protein_id gnl|my_center|LOCUS_11280 21582 21187 gene locus_tag LOCUS_11290 21582 21187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 22019 21588 gene locus_tag LOCUS_11300 gene sdhC 22019 21588 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531169.1 protein_id gnl|my_center|LOCUS_11300 22736 22095 gene locus_tag LOCUS_11310 22736 22095 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388331.1 protein_id gnl|my_center|LOCUS_11310 23656 22733 gene locus_tag LOCUS_11320 gene ubiA 23656 22733 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311953.1 protein_id gnl|my_center|LOCUS_11320 23655 24356 gene locus_tag LOCUS_11330 23655 24356 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388329.1 protein_id gnl|my_center|LOCUS_11330 24368 25732 gene locus_tag LOCUS_11340 24368 25732 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_11340 27153 26176 gene locus_tag LOCUS_11350 27153 26176 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531723.1 protein_id gnl|my_center|LOCUS_11350 27689 27150 gene locus_tag LOCUS_11360 27689 27150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence033 <1 618 gene locus_tag LOCUS_11370 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006311061.1:ParA family protein 619 1482 gene locus_tag LOCUS_11380 619 1482 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_11380 2949 1498 gene locus_tag LOCUS_11390 2949 1498 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028720319.1 protein_id gnl|my_center|LOCUS_11390 4812 3016 gene locus_tag LOCUS_11400 4812 3016 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_11400 5663 4902 gene locus_tag LOCUS_11410 5663 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 7091 5760 gene locus_tag LOCUS_11420 7091 5760 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_11420 8353 7088 gene locus_tag LOCUS_11430 8353 7088 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_11430 9753 8350 gene locus_tag LOCUS_11440 gene thrC 9753 8350 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_11440 10100 10642 gene locus_tag LOCUS_11450 10100 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 10672 11535 gene locus_tag LOCUS_11460 10672 11535 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966304.1 protein_id gnl|my_center|LOCUS_11460 12405 11551 gene locus_tag LOCUS_11470 12405 11551 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532367.1 protein_id gnl|my_center|LOCUS_11470 13179 12517 gene locus_tag LOCUS_11480 gene maiA 13179 12517 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_11480 13241 13849 gene locus_tag LOCUS_11490 13241 13849 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225422.1 protein_id gnl|my_center|LOCUS_11490 13873 14562 gene locus_tag LOCUS_11500 13873 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 16357 14588 gene locus_tag LOCUS_11510 16357 14588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 16476 17624 gene locus_tag LOCUS_11520 16476 17624 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_11520 18677 17634 gene locus_tag LOCUS_11530 18677 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 18965 19450 gene locus_tag LOCUS_11540 18965 19450 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 protein_id gnl|my_center|LOCUS_11540 19447 21738 gene locus_tag LOCUS_11550 19447 21738 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114258.1 protein_id gnl|my_center|LOCUS_11550 21877 22833 gene locus_tag LOCUS_11560 21877 22833 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973334.1 protein_id gnl|my_center|LOCUS_11560 23775 22885 gene locus_tag LOCUS_11570 23775 22885 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531399.1 protein_id gnl|my_center|LOCUS_11570 24560 23772 gene locus_tag LOCUS_11580 gene hyi 24560 23772 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085951.1 protein_id gnl|my_center|LOCUS_11580 26418 24628 gene locus_tag LOCUS_11590 gene gcl 26418 24628 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969935.1 protein_id gnl|my_center|LOCUS_11590 26676 27527 gene locus_tag LOCUS_11600 gene iclR 26676 27527 CDS product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226409.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence034 1526 333 gene locus_tag LOCUS_11610 1526 333 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550341.1 protein_id gnl|my_center|LOCUS_11610 2928 1540 gene locus_tag LOCUS_11620 2928 1540 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807718.1 protein_id gnl|my_center|LOCUS_11620 3762 3037 gene locus_tag LOCUS_11630 3762 3037 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087409.1 protein_id gnl|my_center|LOCUS_11630 3936 5252 gene locus_tag LOCUS_11640 3936 5252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227055.1 protein_id gnl|my_center|LOCUS_11640 5289 6698 gene locus_tag LOCUS_11650 gene tcuA 5289 6698 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_11650 6685 7800 gene locus_tag LOCUS_11660 gene tcuB 6685 7800 CDS product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085110.1 protein_id gnl|my_center|LOCUS_11660 8057 8791 gene locus_tag LOCUS_11670 8057 8791 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553610.1 protein_id gnl|my_center|LOCUS_11670 8793 10106 gene locus_tag LOCUS_11680 8793 10106 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_11680 10273 12105 gene locus_tag LOCUS_11690 gene recQ 10273 12105 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927009.1 protein_id gnl|my_center|LOCUS_11690 13211 12183 gene locus_tag LOCUS_11700 13211 12183 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169507384.1 protein_id gnl|my_center|LOCUS_11700 14289 16793 gene locus_tag LOCUS_11710 14289 16793 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967714.1 protein_id gnl|my_center|LOCUS_11710 16852 18123 gene locus_tag LOCUS_11720 gene glgC 16852 18123 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089198.1 protein_id gnl|my_center|LOCUS_11720 18124 19575 gene locus_tag LOCUS_11730 gene glgA 18124 19575 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089199.1 protein_id gnl|my_center|LOCUS_11730 19572 21569 gene locus_tag LOCUS_11740 gene glgX 19572 21569 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035667.1 protein_id gnl|my_center|LOCUS_11740 22268 21582 gene locus_tag LOCUS_11750 22268 21582 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 protein_id gnl|my_center|LOCUS_11750 23052 22282 gene locus_tag LOCUS_11760 23052 22282 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197963.1 protein_id gnl|my_center|LOCUS_11760 23705 23091 gene locus_tag LOCUS_11770 23705 23091 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391445.1 protein_id gnl|my_center|LOCUS_11770 24135 23755 gene locus_tag LOCUS_11780 24135 23755 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_11780 25716 24331 gene locus_tag LOCUS_11790 25716 24331 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084248.1 protein_id gnl|my_center|LOCUS_11790 26140 25793 gene locus_tag LOCUS_11800 26140 25793 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125616.1 protein_id gnl|my_center|LOCUS_11800 26793 26143 gene locus_tag LOCUS_11810 26793 26143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence035 <1 2383 gene locus_tag LOCUS_11820 <1 2383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_121650294.1:ligase-associated DNA damage response DEXH box helicase 2383 3078 gene locus_tag LOCUS_11830 gene pdeM 2383 3078 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000237.1 protein_id gnl|my_center|LOCUS_11830 3075 4481 gene locus_tag LOCUS_11840 3075 4481 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967081.1 protein_id gnl|my_center|LOCUS_11840 4486 5772 gene locus_tag LOCUS_11850 4486 5772 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_11850 5769 6545 gene locus_tag LOCUS_11860 5769 6545 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_11860 6542 7765 gene locus_tag LOCUS_11870 6542 7765 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388483.1 protein_id gnl|my_center|LOCUS_11870 7779 9092 gene locus_tag LOCUS_11880 7779 9092 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_11880 9100 9786 gene locus_tag LOCUS_11890 9100 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 9786 10322 gene locus_tag LOCUS_11900 9786 10322 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388485.1 protein_id gnl|my_center|LOCUS_11900 10306 10497 gene locus_tag LOCUS_11910 10306 10497 CDS product DUF3553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388277.1 protein_id gnl|my_center|LOCUS_11910 12521 10569 gene locus_tag LOCUS_11920 gene batA 12521 10569 CDS product autotransporter BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195901.1 protein_id gnl|my_center|LOCUS_11920 14275 12758 gene locus_tag LOCUS_11930 14275 12758 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 protein_id gnl|my_center|LOCUS_11930 14417 15031 gene locus_tag LOCUS_11940 14417 15031 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417082.1 protein_id gnl|my_center|LOCUS_11940 16336 15053 gene locus_tag LOCUS_11950 16336 15053 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327568.1 protein_id gnl|my_center|LOCUS_11950 17021 16329 gene locus_tag LOCUS_11960 17021 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 18294 17077 gene locus_tag LOCUS_11970 18294 17077 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_11970 19955 18291 gene locus_tag LOCUS_11980 19955 18291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 21775 20018 gene locus_tag LOCUS_11990 21775 20018 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086735.1 protein_id gnl|my_center|LOCUS_11990 22216 21806 gene locus_tag LOCUS_12000 22216 21806 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401921.1 protein_id gnl|my_center|LOCUS_12000 22327 23343 gene locus_tag LOCUS_12010 22327 23343 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389306.1 protein_id gnl|my_center|LOCUS_12010 23367 23999 gene locus_tag LOCUS_12020 23367 23999 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090583.1 protein_id gnl|my_center|LOCUS_12020 24331 24035 gene locus_tag LOCUS_12030 24331 24035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 24560 24348 gene locus_tag LOCUS_12040 24560 24348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 24805 24560 gene locus_tag LOCUS_12050 24805 24560 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141676.1 protein_id gnl|my_center|LOCUS_12050 25975 24893 gene locus_tag LOCUS_12060 25975 24893 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence036 <1 2157 gene locus_tag LOCUS_12070 <1 2157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521877.1:efflux RND transporter permease subunit 2154 3620 gene locus_tag LOCUS_12080 gene opmB 2154 3620 CDS product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_12080 4299 3622 gene locus_tag LOCUS_12090 4299 3622 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_12090 4416 5756 gene locus_tag LOCUS_12100 4416 5756 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065007.1 protein_id gnl|my_center|LOCUS_12100 5837 7240 gene locus_tag LOCUS_12110 5837 7240 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201008.1 protein_id gnl|my_center|LOCUS_12110 7275 8333 gene locus_tag LOCUS_12120 7275 8333 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 protein_id gnl|my_center|LOCUS_12120 8458 9492 gene locus_tag LOCUS_12130 8458 9492 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893096.1 protein_id gnl|my_center|LOCUS_12130 9589 10455 gene locus_tag LOCUS_12140 9589 10455 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115216.1 protein_id gnl|my_center|LOCUS_12140 10718 10939 gene locus_tag LOCUS_12150 10718 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 11076 13196 gene locus_tag LOCUS_12160 11076 13196 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876458.1 protein_id gnl|my_center|LOCUS_12160 13561 13367 gene locus_tag LOCUS_12170 13561 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 13988 14161 gene locus_tag LOCUS_12180 13988 14161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 14673 14182 gene locus_tag LOCUS_12190 14673 14182 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_12190 15493 14684 gene locus_tag LOCUS_12200 15493 14684 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313924.1 protein_id gnl|my_center|LOCUS_12200 15765 15980 gene locus_tag LOCUS_12210 15765 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 15973 16518 gene locus_tag LOCUS_12220 15973 16518 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329263.1 protein_id gnl|my_center|LOCUS_12220 16530 17195 gene locus_tag LOCUS_12230 16530 17195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 17347 18228 gene locus_tag LOCUS_12240 17347 18228 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_12240 18237 19973 gene locus_tag LOCUS_12250 18237 19973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12250 19961 21715 gene locus_tag LOCUS_12260 gene cydC 19961 21715 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941873.1 protein_id gnl|my_center|LOCUS_12260 21819 23435 gene locus_tag LOCUS_12270 gene appC 21819 23435 CDS product cytochrome bd-II oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263572.1 protein_id gnl|my_center|LOCUS_12270 23448 24587 gene locus_tag LOCUS_12280 gene cydB 23448 24587 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037378.1 protein_id gnl|my_center|LOCUS_12280 24601 24798 gene locus_tag LOCUS_12290 24601 24798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence037 <1 579 gene locus_tag LOCUS_12300 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972738.1:chromate efflux transporter 2876 594 gene locus_tag LOCUS_12310 2876 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3052 3474 gene locus_tag LOCUS_12320 3052 3474 CDS product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971846.1 protein_id gnl|my_center|LOCUS_12320 3551 4507 gene locus_tag LOCUS_12330 gene fabD 3551 4507 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388174.1 protein_id gnl|my_center|LOCUS_12330 4507 5244 gene locus_tag LOCUS_12340 gene fabG 4507 5244 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_12340 5327 5566 gene locus_tag LOCUS_12350 5327 5566 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_12350 5594 6856 gene locus_tag LOCUS_12360 gene fabF 5594 6856 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086859.1 protein_id gnl|my_center|LOCUS_12360 6888 7862 gene locus_tag LOCUS_12370 gene mltG 6888 7862 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919550.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12370 9682 7871 gene locus_tag LOCUS_12380 9682 7871 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992392.1 protein_id gnl|my_center|LOCUS_12380 11001 9766 gene locus_tag LOCUS_12390 11001 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 11143 12144 gene locus_tag LOCUS_12400 11143 12144 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992236.1 protein_id gnl|my_center|LOCUS_12400 12207 12704 gene locus_tag LOCUS_12410 12207 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 12701 13042 gene locus_tag LOCUS_12420 12701 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 13138 13488 gene locus_tag LOCUS_12430 13138 13488 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527133.1 protein_id gnl|my_center|LOCUS_12430 14073 13795 gene locus_tag LOCUS_12440 14073 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 14059 14607 gene locus_tag LOCUS_12450 14059 14607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 14839 15219 gene locus_tag LOCUS_12460 14839 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 15982 15206 gene locus_tag LOCUS_12470 gene rsmA 15982 15206 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265733.1 protein_id gnl|my_center|LOCUS_12470 17579 16281 gene locus_tag LOCUS_12480 17579 16281 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625938.1 protein_id gnl|my_center|LOCUS_12480 19804 17576 gene locus_tag LOCUS_12490 gene lptD 19804 17576 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 protein_id gnl|my_center|LOCUS_12490 20932 19808 gene locus_tag LOCUS_12500 gene lptG 20932 19808 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720056.1 protein_id gnl|my_center|LOCUS_12500 22062 20929 gene locus_tag LOCUS_12510 gene lptF 22062 20929 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390693.1 protein_id gnl|my_center|LOCUS_12510 22833 22120 gene locus_tag LOCUS_12520 22833 22120 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087825.1 protein_id gnl|my_center|LOCUS_12520 23795 22830 gene locus_tag LOCUS_12530 gene pdxA 23795 22830 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969073.1 protein_id gnl|my_center|LOCUS_12530 24475 23792 gene locus_tag LOCUS_12540 24475 23792 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 protein_id gnl|my_center|LOCUS_12540 <25116 24472 gene locus_tag LOCUS_12550 <25116 24472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089515.1:sensor histidine kinase KdpD >Feature sequence038 605 9 gene locus_tag LOCUS_12560 605 9 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531091.1 protein_id gnl|my_center|LOCUS_12560 1158 598 gene locus_tag LOCUS_12570 1158 598 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389431.1 protein_id gnl|my_center|LOCUS_12570 1580 1215 gene locus_tag LOCUS_12580 1580 1215 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_12580 1828 1752 gene locus_tag LOCUS_t00190 1828 1752 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2035 1961 gene locus_tag LOCUS_t00200 2035 1961 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2399 2127 gene locus_tag LOCUS_12590 2399 2127 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_12590 5031 2584 gene locus_tag LOCUS_12600 gene lon 5031 2584 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 protein_id gnl|my_center|LOCUS_12600 6439 5183 gene locus_tag LOCUS_12610 gene clpX 6439 5183 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389426.1 protein_id gnl|my_center|LOCUS_12610 7272 6586 gene locus_tag LOCUS_12620 gene clpP 7272 6586 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389425.1 protein_id gnl|my_center|LOCUS_12620 8117 7458 gene locus_tag LOCUS_12630 8117 7458 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338751.1 protein_id gnl|my_center|LOCUS_12630 8218 8132 gene locus_tag LOCUS_t00210 8218 8132 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8336 9274 gene locus_tag LOCUS_12640 8336 9274 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338750.1 protein_id gnl|my_center|LOCUS_12640 9457 10893 gene locus_tag LOCUS_12650 9457 10893 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387779.1 protein_id gnl|my_center|LOCUS_12650 10899 15431 gene locus_tag LOCUS_12660 gene gltB 10899 15431 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_12660 15470 16138 gene locus_tag LOCUS_12670 15470 16138 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_12670 16135 17007 gene locus_tag LOCUS_12680 16135 17007 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626584.1 protein_id gnl|my_center|LOCUS_12680 17703 16954 gene locus_tag LOCUS_12690 17703 16954 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128777536.1 protein_id gnl|my_center|LOCUS_12690 17747 18886 gene locus_tag LOCUS_12700 17747 18886 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211860579.1 protein_id gnl|my_center|LOCUS_12700 18883 19788 gene locus_tag LOCUS_12710 18883 19788 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_12710 19826 21757 gene locus_tag LOCUS_12720 gene thrS 19826 21757 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_12720 22035 22469 gene locus_tag LOCUS_12730 gene infC 22035 22469 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_12730 23682 22600 gene locus_tag LOCUS_12740 23682 22600 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_12740 23730 23936 gene locus_tag LOCUS_12750 23730 23936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 23933 24661 gene locus_tag LOCUS_12760 23933 24661 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338460.1 protein_id gnl|my_center|LOCUS_12760 25042 24713 gene locus_tag LOCUS_12770 25042 24713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence039 1416 79 gene locus_tag LOCUS_12780 gene gltX 1416 79 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388446.1 protein_id gnl|my_center|LOCUS_12780 1537 2775 gene locus_tag LOCUS_12790 1537 2775 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_12790 3383 2778 gene locus_tag LOCUS_12800 3383 2778 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_12800 3902 3453 gene locus_tag LOCUS_12810 3902 3453 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_12810 3954 4520 gene locus_tag LOCUS_12820 3954 4520 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089896.1 protein_id gnl|my_center|LOCUS_12820 4930 5154 gene locus_tag LOCUS_12830 4930 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7212 5548 gene locus_tag LOCUS_12840 7212 5548 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_12840 8397 7267 gene locus_tag LOCUS_12850 8397 7267 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440341.1 protein_id gnl|my_center|LOCUS_12850 9785 8394 gene locus_tag LOCUS_12860 9785 8394 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 protein_id gnl|my_center|LOCUS_12860 11223 9865 gene locus_tag LOCUS_12870 gene gor 11223 9865 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388440.1 protein_id gnl|my_center|LOCUS_12870 11955 11275 gene locus_tag LOCUS_12880 gene dnaQ 11955 11275 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_12880 12539 11952 gene locus_tag LOCUS_12890 gene coaE 12539 11952 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639852.1 protein_id gnl|my_center|LOCUS_12890 13366 12536 gene locus_tag LOCUS_12900 13366 12536 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391360.1 protein_id gnl|my_center|LOCUS_12900 13550 14746 gene locus_tag LOCUS_12910 13550 14746 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533643.1 protein_id gnl|my_center|LOCUS_12910 14743 15678 gene locus_tag LOCUS_12920 gene argF 14743 15678 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470667.1 protein_id gnl|my_center|LOCUS_12920 15803 16153 gene locus_tag LOCUS_12930 15803 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 16163 16594 gene locus_tag LOCUS_12940 16163 16594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 16682 17590 gene locus_tag LOCUS_12950 16682 17590 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389768.1 protein_id gnl|my_center|LOCUS_12950 17587 17916 gene locus_tag LOCUS_12960 17587 17916 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967061.1 protein_id gnl|my_center|LOCUS_12960 19104 17917 gene locus_tag LOCUS_12970 19104 17917 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968760.1 protein_id gnl|my_center|LOCUS_12970 19360 19284 gene locus_tag LOCUS_t00220 19360 19284 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20519 19410 gene locus_tag LOCUS_12980 gene leuB 20519 19410 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388946.1 protein_id gnl|my_center|LOCUS_12980 21152 20529 gene locus_tag LOCUS_12990 gene leuD 21152 20529 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388945.1 protein_id gnl|my_center|LOCUS_12990 22552 21152 gene locus_tag LOCUS_13000 gene leuC 22552 21152 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_13000 23162 22779 gene locus_tag LOCUS_13010 gene rplS 23162 22779 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388943.1 protein_id gnl|my_center|LOCUS_13010 23886 23188 gene locus_tag LOCUS_13020 gene trmD 23886 23188 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528859.1 protein_id gnl|my_center|LOCUS_13020 24416 23883 gene locus_tag LOCUS_13030 24416 23883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 24773 24426 gene locus_tag LOCUS_13040 24773 24426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence040 327 130 gene locus_tag LOCUS_13050 327 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 3302 324 gene locus_tag LOCUS_13060 3302 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3746 3333 gene locus_tag LOCUS_13070 3746 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 4061 5263 gene locus_tag LOCUS_13080 gene cfa1 4061 5263 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330709.1 protein_id gnl|my_center|LOCUS_13080 6469 5237 gene locus_tag LOCUS_13090 6469 5237 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_13090 7086 6562 gene locus_tag LOCUS_13100 7086 6562 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547661.1 protein_id gnl|my_center|LOCUS_13100 7311 7979 gene locus_tag LOCUS_13110 7311 7979 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054996466.1 protein_id gnl|my_center|LOCUS_13110 9658 8078 gene locus_tag LOCUS_13120 9658 8078 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090223.1 protein_id gnl|my_center|LOCUS_13120 10232 9678 gene locus_tag LOCUS_13130 10232 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090222.1 protein_id gnl|my_center|LOCUS_13130 10673 10281 gene locus_tag LOCUS_13140 10673 10281 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339147.1 protein_id gnl|my_center|LOCUS_13140 11087 10674 gene locus_tag LOCUS_13150 11087 10674 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174648.1 protein_id gnl|my_center|LOCUS_13150 11489 11178 gene locus_tag LOCUS_13160 11489 11178 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090224.1 protein_id gnl|my_center|LOCUS_13160 12721 11582 gene locus_tag LOCUS_13170 12721 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 14356 12773 gene locus_tag LOCUS_13180 14356 12773 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390250.1 protein_id gnl|my_center|LOCUS_13180 14428 17034 gene locus_tag LOCUS_13190 gene mutS 14428 17034 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 protein_id gnl|my_center|LOCUS_13190 17060 19831 gene locus_tag LOCUS_13200 17060 19831 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 protein_id gnl|my_center|LOCUS_13200 20731 19835 gene locus_tag LOCUS_13210 gene liuE 20731 19835 CDS product bifunctional 3-hydroxy-3-isohexenylglutaryl-CoA lyase/hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088593.1 protein_id gnl|my_center|LOCUS_13210 22722 20728 gene locus_tag LOCUS_13220 22722 20728 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973075.1 protein_id gnl|my_center|LOCUS_13220 23498 22719 gene locus_tag LOCUS_13230 23498 22719 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 protein_id gnl|my_center|LOCUS_13230 <24667 23506 gene locus_tag LOCUS_13240 <24667 23506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973074.1:carboxyl transferase domain-containing protein >Feature sequence041 1274 483 gene locus_tag LOCUS_13250 1274 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 3072 1420 gene locus_tag LOCUS_13260 gene groL 3072 1420 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530719.1 protein_id gnl|my_center|LOCUS_13260 3421 3104 gene locus_tag LOCUS_13270 gene groES 3421 3104 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441664.1 protein_id gnl|my_center|LOCUS_13270 3713 3970 gene locus_tag LOCUS_13280 3713 3970 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387921.1 protein_id gnl|my_center|LOCUS_13280 4028 4834 gene locus_tag LOCUS_13290 4028 4834 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528894.1 protein_id gnl|my_center|LOCUS_13290 5909 4836 gene locus_tag LOCUS_13300 gene hrcA 5909 4836 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391389.1 protein_id gnl|my_center|LOCUS_13300 5960 6679 gene locus_tag LOCUS_13310 gene rph 5960 6679 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918041.1 protein_id gnl|my_center|LOCUS_13310 6685 7281 gene locus_tag LOCUS_13320 gene rdgB 6685 7281 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639888.1 protein_id gnl|my_center|LOCUS_13320 8430 7246 gene locus_tag LOCUS_13330 gene argJ 8430 7246 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083038.1 protein_id gnl|my_center|LOCUS_13330 9305 8430 gene locus_tag LOCUS_13340 9305 8430 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529440.1 protein_id gnl|my_center|LOCUS_13340 9486 12236 gene locus_tag LOCUS_13350 gene secA 9486 12236 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387988.1 protein_id gnl|my_center|LOCUS_13350 12290 16384 gene locus_tag LOCUS_13360 12290 16384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 17263 16427 gene locus_tag LOCUS_13370 17263 16427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 17603 18028 gene locus_tag LOCUS_13380 17603 18028 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241082.1 protein_id gnl|my_center|LOCUS_13380 19266 18469 gene locus_tag LOCUS_13390 19266 18469 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312548.1 protein_id gnl|my_center|LOCUS_13390 21443 19263 gene locus_tag LOCUS_13400 gene uvrB 21443 19263 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470604.1 protein_id gnl|my_center|LOCUS_13400 21944 21450 gene locus_tag LOCUS_13410 21944 21450 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531247.1 protein_id gnl|my_center|LOCUS_13410 22665 22021 gene locus_tag LOCUS_13420 22665 22021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 23263 22718 gene locus_tag LOCUS_13430 23263 22718 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391245.1 protein_id gnl|my_center|LOCUS_13430 23739 23260 gene locus_tag LOCUS_13440 23739 23260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 24218 23736 gene locus_tag LOCUS_13450 24218 23736 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence042 1551 619 gene locus_tag LOCUS_13460 1551 619 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_13460 2964 1612 gene locus_tag LOCUS_13470 2964 1612 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103270.1 protein_id gnl|my_center|LOCUS_13470 3067 3600 gene locus_tag LOCUS_13480 gene uraD 3067 3600 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552526.1 protein_id gnl|my_center|LOCUS_13480 3597 5033 gene locus_tag LOCUS_13490 gene hpyO 3597 5033 CDS product FAD-dependent urate hydroxylase HpyO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035534.1 protein_id gnl|my_center|LOCUS_13490 5030 5365 gene locus_tag LOCUS_13500 gene uraH 5030 5365 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336831.1 protein_id gnl|my_center|LOCUS_13500 5442 6995 gene locus_tag LOCUS_13510 5442 6995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389658.1 protein_id gnl|my_center|LOCUS_13510 6979 8067 gene locus_tag LOCUS_13520 6979 8067 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_13520 8064 8987 gene locus_tag LOCUS_13530 8064 8987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_13530 9472 8993 gene locus_tag LOCUS_13540 9472 8993 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088894.1 protein_id gnl|my_center|LOCUS_13540 10200 9469 gene locus_tag LOCUS_13550 10200 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 10302 11795 gene locus_tag LOCUS_13560 10302 11795 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195382.1 protein_id gnl|my_center|LOCUS_13560 11927 12412 gene locus_tag LOCUS_13570 11927 12412 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_13570 14978 12675 gene locus_tag LOCUS_13580 gene metE 14978 12675 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918370.1 protein_id gnl|my_center|LOCUS_13580 15396 16031 gene locus_tag LOCUS_13590 15396 16031 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811973.1 protein_id gnl|my_center|LOCUS_13590 17777 16032 gene locus_tag LOCUS_13600 17777 16032 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391431.1 protein_id gnl|my_center|LOCUS_13600 19057 17912 gene locus_tag LOCUS_13610 19057 17912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217407.1 protein_id gnl|my_center|LOCUS_13610 19653 19054 gene locus_tag LOCUS_13620 19653 19054 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386919.1 protein_id gnl|my_center|LOCUS_13620 20297 19767 gene locus_tag LOCUS_13630 20297 19767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 20745 21980 gene locus_tag LOCUS_13640 20745 21980 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435814.1 protein_id gnl|my_center|LOCUS_13640 24160 22502 gene locus_tag LOCUS_13650 24160 22502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence043 <1 994 gene locus_tag LOCUS_13660 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338345.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC 991 1437 gene locus_tag LOCUS_13670 gene dut 991 1437 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_13670 1638 3362 gene locus_tag LOCUS_13680 1638 3362 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192556.1 protein_id gnl|my_center|LOCUS_13680 3375 4709 gene locus_tag LOCUS_13690 3375 4709 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192968.1 protein_id gnl|my_center|LOCUS_13690 6175 4793 gene locus_tag LOCUS_13700 6175 4793 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390238.1 protein_id gnl|my_center|LOCUS_13700 6888 6172 gene locus_tag LOCUS_13710 gene otsB 6888 6172 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329495.1 protein_id gnl|my_center|LOCUS_13710 7482 6940 gene locus_tag LOCUS_13720 gene moaB 7482 6940 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388021.1 protein_id gnl|my_center|LOCUS_13720 9318 7486 gene locus_tag LOCUS_13730 9318 7486 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_13730 10286 9447 gene locus_tag LOCUS_13740 10286 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 10383 12014 gene locus_tag LOCUS_13750 10383 12014 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_13750 12206 12925 gene locus_tag LOCUS_13760 gene dapB 12206 12925 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528616.1 protein_id gnl|my_center|LOCUS_13760 13042 14229 gene locus_tag LOCUS_13770 gene metK 13042 14229 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 protein_id gnl|my_center|LOCUS_13770 14233 14904 gene locus_tag LOCUS_13780 gene trmB 14233 14904 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 protein_id gnl|my_center|LOCUS_13780 15021 16448 gene locus_tag LOCUS_13790 15021 16448 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_13790 17374 16592 gene locus_tag LOCUS_13800 17374 16592 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267567.1 protein_id gnl|my_center|LOCUS_13800 17847 17428 gene locus_tag LOCUS_13810 17847 17428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 18046 18924 gene locus_tag LOCUS_13820 gene galU 18046 18924 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_13820 18917 20338 gene locus_tag LOCUS_13830 18917 20338 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_13830 21452 20556 gene locus_tag LOCUS_13840 gene rpoH 21452 20556 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_13840 22707 21715 gene locus_tag LOCUS_13850 22707 21715 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_13850 22707 23060 gene locus_tag LOCUS_13860 22707 23060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 23272 23347 gene locus_tag LOCUS_t00230 23272 23347 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence044 1755 190 gene locus_tag LOCUS_13870 gene guaA 1755 190 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067712.1 protein_id gnl|my_center|LOCUS_13870 2555 1797 gene locus_tag LOCUS_13880 2555 1797 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727197.1 protein_id gnl|my_center|LOCUS_13880 2755 2555 gene locus_tag LOCUS_13890 2755 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3870 2752 gene locus_tag LOCUS_13900 gene thiO 3870 2752 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_13900 5585 3876 gene locus_tag LOCUS_13910 gene thiC 5585 3876 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972409.1 protein_id gnl|my_center|LOCUS_13910 5877 5611 gene locus_tag LOCUS_13920 5877 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 6510 5881 gene locus_tag LOCUS_13930 6510 5881 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485785.1 protein_id gnl|my_center|LOCUS_13930 6597 7499 gene locus_tag LOCUS_13940 6597 7499 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530002.1 protein_id gnl|my_center|LOCUS_13940 7622 9703 gene locus_tag LOCUS_13950 gene fusA 7622 9703 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599757.1 protein_id gnl|my_center|LOCUS_13950 9795 11234 gene locus_tag LOCUS_13960 9795 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 11871 11200 gene locus_tag LOCUS_13970 11871 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 13107 11881 gene locus_tag LOCUS_13980 13107 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 13358 14344 gene locus_tag LOCUS_13990 gene moaA 13358 14344 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971804.1 protein_id gnl|my_center|LOCUS_13990 14341 15516 gene locus_tag LOCUS_14000 14341 15516 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079507.1 protein_id gnl|my_center|LOCUS_14000 15533 15970 gene locus_tag LOCUS_14010 15533 15970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 16138 17073 gene locus_tag LOCUS_14020 16138 17073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399936.1 protein_id gnl|my_center|LOCUS_14020 18106 17255 gene locus_tag LOCUS_14030 18106 17255 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113910.1 protein_id gnl|my_center|LOCUS_14030 19181 18372 gene locus_tag LOCUS_14040 19181 18372 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894626.1 protein_id gnl|my_center|LOCUS_14040 19945 19178 gene locus_tag LOCUS_14050 19945 19178 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727772.1 protein_id gnl|my_center|LOCUS_14050 20861 19953 gene locus_tag LOCUS_14060 20861 19953 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893017.1 protein_id gnl|my_center|LOCUS_14060 21175 21053 gene locus_tag LOCUS_14070 21175 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 21379 21741 gene locus_tag LOCUS_14080 gene arsC 21379 21741 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969944.1 protein_id gnl|my_center|LOCUS_14080 21747 23054 gene locus_tag LOCUS_14090 21747 23054 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040400.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence045 1073 1747 gene locus_tag LOCUS_14100 1073 1747 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528748.1 protein_id gnl|my_center|LOCUS_14100 1747 3084 gene locus_tag LOCUS_14110 1747 3084 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528747.1 protein_id gnl|my_center|LOCUS_14110 3413 3102 gene locus_tag LOCUS_14120 3413 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5476 3845 gene locus_tag LOCUS_14130 5476 3845 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_14130 7582 5660 gene locus_tag LOCUS_14140 gene ftsH 7582 5660 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388853.1 protein_id gnl|my_center|LOCUS_14140 9026 7755 gene locus_tag LOCUS_14150 gene tilS 9026 7755 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388852.1 protein_id gnl|my_center|LOCUS_14150 9921 8998 gene locus_tag LOCUS_14160 9921 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 10630 10127 gene locus_tag LOCUS_14170 gene pal 10630 10127 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921062.1 protein_id gnl|my_center|LOCUS_14170 11120 11887 gene locus_tag LOCUS_14180 11120 11887 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256184.1 protein_id gnl|my_center|LOCUS_14180 11937 13001 gene locus_tag LOCUS_14190 gene pheS 11937 13001 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391270.1 protein_id gnl|my_center|LOCUS_14190 13005 15461 gene locus_tag LOCUS_14200 gene pheT 13005 15461 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391271.1 protein_id gnl|my_center|LOCUS_14200 16158 15736 gene locus_tag LOCUS_14210 gene rplQ 16158 15736 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390413.1 protein_id gnl|my_center|LOCUS_14210 17208 16171 gene locus_tag LOCUS_14220 17208 16171 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919151.1 protein_id gnl|my_center|LOCUS_14220 17656 17264 gene locus_tag LOCUS_14230 gene rpsK 17656 17264 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390415.1 protein_id gnl|my_center|LOCUS_14230 18088 17711 gene locus_tag LOCUS_14240 gene rpsM 18088 17711 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_14240 18645 18292 gene locus_tag LOCUS_14250 gene yajC 18645 18292 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626242.1 protein_id gnl|my_center|LOCUS_14250 18723 19640 gene locus_tag LOCUS_14260 18723 19640 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975342.1 protein_id gnl|my_center|LOCUS_14260 19852 20568 gene locus_tag LOCUS_14270 19852 20568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 21372 23792 gene locus_tag LOCUS_14280 21372 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence046 1450 605 gene locus_tag LOCUS_14290 1450 605 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190287.1 protein_id gnl|my_center|LOCUS_14290 2240 1518 gene locus_tag LOCUS_14300 2240 1518 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_14300 2426 3148 gene locus_tag LOCUS_14310 2426 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 3066 4556 gene locus_tag LOCUS_14320 3066 4556 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921045.1 protein_id gnl|my_center|LOCUS_14320 4616 4690 gene locus_tag LOCUS_t00240 4616 4690 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5996 4908 gene locus_tag LOCUS_14330 5996 4908 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_14330 6911 6192 gene locus_tag LOCUS_14340 6911 6192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529095.1 protein_id gnl|my_center|LOCUS_14340 7741 6908 gene locus_tag LOCUS_14350 7741 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 9014 7734 gene locus_tag LOCUS_14360 gene livM 9014 7734 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088418.1 protein_id gnl|my_center|LOCUS_14360 9934 9020 gene locus_tag LOCUS_14370 9934 9020 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088417.1 protein_id gnl|my_center|LOCUS_14370 10204 10518 gene locus_tag LOCUS_14380 gene rplU 10204 10518 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003516451.1 protein_id gnl|my_center|LOCUS_14380 10534 10803 gene locus_tag LOCUS_14390 gene rpmA 10534 10803 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067214.1 protein_id gnl|my_center|LOCUS_14390 10923 11921 gene locus_tag LOCUS_14400 gene obgE 10923 11921 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388995.1 protein_id gnl|my_center|LOCUS_14400 11918 13045 gene locus_tag LOCUS_14410 gene proB 11918 13045 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970464.1 protein_id gnl|my_center|LOCUS_14410 15873 13252 gene locus_tag LOCUS_14420 15873 13252 CDS product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972107.1 protein_id gnl|my_center|LOCUS_14420 16474 15866 gene locus_tag LOCUS_14430 16474 15866 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108223520.1 protein_id gnl|my_center|LOCUS_14430 16750 18306 gene locus_tag LOCUS_14440 16750 18306 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228610.1 protein_id gnl|my_center|LOCUS_14440 18395 18320 gene locus_tag LOCUS_t00250 18395 18320 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18497 18586 gene locus_tag LOCUS_t00260 18497 18586 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20176 18548 gene locus_tag LOCUS_14450 20176 18548 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_14450 20422 20198 gene locus_tag LOCUS_14460 20422 20198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 20951 20556 gene locus_tag LOCUS_14470 20951 20556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 21349 21059 gene locus_tag LOCUS_14480 21349 21059 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141200.1 protein_id gnl|my_center|LOCUS_14480 <23281 21613 gene locus_tag LOCUS_14490 <23281 21613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538232.1:DUF3363 domain-containing protein >Feature sequence047 465 76 gene locus_tag LOCUS_14500 465 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 511 3195 gene locus_tag LOCUS_14510 511 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 3323 4051 gene locus_tag LOCUS_14520 3323 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14520 3936 5573 gene locus_tag LOCUS_14530 3936 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14530 5611 6048 gene locus_tag LOCUS_14540 5611 6048 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_14540 6328 6693 gene locus_tag LOCUS_14550 6328 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 7233 6706 gene locus_tag LOCUS_14560 7233 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 7658 7335 gene locus_tag LOCUS_14570 7658 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 7855 8196 gene locus_tag LOCUS_14580 7855 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 8856 8299 gene locus_tag LOCUS_14590 8856 8299 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389865.1 protein_id gnl|my_center|LOCUS_14590 9470 8853 gene locus_tag LOCUS_14600 gene gstA 9470 8853 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 protein_id gnl|my_center|LOCUS_14600 10422 9490 gene locus_tag LOCUS_14610 10422 9490 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388403.1 protein_id gnl|my_center|LOCUS_14610 11261 10509 gene locus_tag LOCUS_14620 gene proC 11261 10509 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391029.1 protein_id gnl|my_center|LOCUS_14620 11835 11332 gene locus_tag LOCUS_14630 11835 11332 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_14630 12058 11813 gene locus_tag LOCUS_14640 12058 11813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 13430 14881 gene locus_tag LOCUS_14650 13430 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 15843 14878 gene locus_tag LOCUS_14660 15843 14878 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013420942.1 protein_id gnl|my_center|LOCUS_14660 17387 15972 gene locus_tag LOCUS_14670 17387 15972 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528676.1 protein_id gnl|my_center|LOCUS_14670 18081 17542 gene locus_tag LOCUS_14680 18081 17542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 18195 18722 gene locus_tag LOCUS_14690 18195 18722 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529291.1 protein_id gnl|my_center|LOCUS_14690 18789 19040 gene locus_tag LOCUS_14700 18789 19040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 19083 20156 gene locus_tag LOCUS_14710 gene plsX 19083 20156 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389356.1 protein_id gnl|my_center|LOCUS_14710 20164 21132 gene locus_tag LOCUS_14720 20164 21132 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389357.1 protein_id gnl|my_center|LOCUS_14720 21204 21527 gene locus_tag LOCUS_14730 21204 21527 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389358.1 protein_id gnl|my_center|LOCUS_14730 21524 22093 gene locus_tag LOCUS_14740 21524 22093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 22151 22227 gene locus_tag LOCUS_t00270 22151 22227 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22439 22699 gene locus_tag LOCUS_14750 22439 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence048 381 1856 gene locus_tag LOCUS_14760 381 1856 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228743.1 protein_id gnl|my_center|LOCUS_14760 3593 2115 gene locus_tag LOCUS_14770 gene gabD 3593 2115 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_14770 6302 3660 gene locus_tag LOCUS_14780 6302 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 7820 6555 gene locus_tag LOCUS_14790 7820 6555 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193636.1 protein_id gnl|my_center|LOCUS_14790 7904 8530 gene locus_tag LOCUS_14800 7904 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 8530 9432 gene locus_tag LOCUS_14810 8530 9432 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088409.1 protein_id gnl|my_center|LOCUS_14810 9438 10661 gene locus_tag LOCUS_14820 9438 10661 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975639.1 protein_id gnl|my_center|LOCUS_14820 10658 10978 gene locus_tag LOCUS_14830 10658 10978 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088407.1 protein_id gnl|my_center|LOCUS_14830 10975 11673 gene locus_tag LOCUS_14840 10975 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14840 11670 13304 gene locus_tag LOCUS_14850 11670 13304 CDS product molybdopterin-binding/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388726.1 protein_id gnl|my_center|LOCUS_14850 14257 13484 gene locus_tag LOCUS_14860 14257 13484 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388288.1 protein_id gnl|my_center|LOCUS_14860 15632 14388 gene locus_tag LOCUS_14870 15632 14388 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084264.1 protein_id gnl|my_center|LOCUS_14870 17040 15835 gene locus_tag LOCUS_14880 17040 15835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 17111 17196 gene locus_tag LOCUS_t00280 17111 17196 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 18383 17202 gene locus_tag LOCUS_14890 18383 17202 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092086.1 protein_id gnl|my_center|LOCUS_14890 19938 18385 gene locus_tag LOCUS_14900 19938 18385 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225352.1 protein_id gnl|my_center|LOCUS_14900 21084 19963 gene locus_tag LOCUS_14910 21084 19963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 21911 21108 gene locus_tag LOCUS_14920 21911 21108 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877397.1 protein_id gnl|my_center|LOCUS_14920 22177 22827 gene locus_tag LOCUS_14930 22177 22827 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225351.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence049 19 783 gene locus_tag LOCUS_14940 19 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1364 804 gene locus_tag LOCUS_14950 1364 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2219 1509 gene locus_tag LOCUS_14960 2219 1509 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084166.1 protein_id gnl|my_center|LOCUS_14960 2560 2219 gene locus_tag LOCUS_14970 2560 2219 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339218.1 protein_id gnl|my_center|LOCUS_14970 2724 3509 gene locus_tag LOCUS_14980 gene paaX 2724 3509 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085674.1 protein_id gnl|my_center|LOCUS_14980 4402 3551 gene locus_tag LOCUS_14990 gene nadC 4402 3551 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 protein_id gnl|my_center|LOCUS_14990 5808 4399 gene locus_tag LOCUS_15000 5808 4399 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533322.1 protein_id gnl|my_center|LOCUS_15000 6776 5805 gene locus_tag LOCUS_15010 gene nadA 6776 5805 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206696170.1 protein_id gnl|my_center|LOCUS_15010 7802 6888 gene locus_tag LOCUS_15020 7802 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814748.1 protein_id gnl|my_center|LOCUS_15020 10228 7847 gene locus_tag LOCUS_15030 10228 7847 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153439072.1 protein_id gnl|my_center|LOCUS_15030 10738 11760 gene locus_tag LOCUS_15040 10738 11760 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530315.1 protein_id gnl|my_center|LOCUS_15040 11887 14082 gene locus_tag LOCUS_15050 gene katG 11887 14082 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142765.1 protein_id gnl|my_center|LOCUS_15050 14307 15299 gene locus_tag LOCUS_15060 14307 15299 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339018.1 protein_id gnl|my_center|LOCUS_15060 15447 17069 gene locus_tag LOCUS_15070 15447 17069 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530640.1 protein_id gnl|my_center|LOCUS_15070 17253 18470 gene locus_tag LOCUS_15080 17253 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 18490 21573 gene locus_tag LOCUS_15090 18490 21573 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204974.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence050 511 4194 gene locus_tag LOCUS_15100 511 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 5032 4184 gene locus_tag LOCUS_15110 5032 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 6227 5052 gene locus_tag LOCUS_15120 6227 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 7108 6230 gene locus_tag LOCUS_15130 7108 6230 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337088.1 protein_id gnl|my_center|LOCUS_15130 9542 7113 gene locus_tag LOCUS_15140 9542 7113 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_15140 10039 9539 gene locus_tag LOCUS_15150 gene cutC 10039 9539 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_15150 10922 10056 gene locus_tag LOCUS_15160 10922 10056 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_15160 12235 11081 gene locus_tag LOCUS_15170 12235 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 12550 12699 gene locus_tag LOCUS_15180 12550 12699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 12830 12741 gene locus_tag LOCUS_t00290 12830 12741 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13279 12878 gene locus_tag LOCUS_15190 13279 12878 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_15190 13975 13283 gene locus_tag LOCUS_15200 13975 13283 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_15200 15883 14021 gene locus_tag LOCUS_15210 15883 14021 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_15210 16761 15880 gene locus_tag LOCUS_15220 16761 15880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_15220 17711 16758 gene locus_tag LOCUS_15230 17711 16758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810637.1 protein_id gnl|my_center|LOCUS_15230 19389 17683 gene locus_tag LOCUS_15240 19389 17683 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681422.1 protein_id gnl|my_center|LOCUS_15240 21945 19477 gene locus_tag LOCUS_15250 21945 19477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 22069 21881 gene locus_tag LOCUS_15260 22069 21881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence051 1442 2356 gene locus_tag LOCUS_15270 1442 2356 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_15270 2353 3228 gene locus_tag LOCUS_15280 2353 3228 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_15280 3246 4295 gene locus_tag LOCUS_15290 3246 4295 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_15290 4299 5495 gene locus_tag LOCUS_15300 4299 5495 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_15300 5492 6973 gene locus_tag LOCUS_15310 5492 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 9008 7044 gene locus_tag LOCUS_15320 9008 7044 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086466.1 protein_id gnl|my_center|LOCUS_15320 10783 9149 gene locus_tag LOCUS_15330 10783 9149 CDS product molecular chaperone GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086464.1 protein_id gnl|my_center|LOCUS_15330 11240 10875 gene locus_tag LOCUS_15340 11240 10875 CDS product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720016.1 protein_id gnl|my_center|LOCUS_15340 12370 11288 gene locus_tag LOCUS_15350 12370 11288 CDS product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966207.1 protein_id gnl|my_center|LOCUS_15350 13472 12432 gene locus_tag LOCUS_15360 13472 12432 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086459.1 protein_id gnl|my_center|LOCUS_15360 15218 13548 gene locus_tag LOCUS_15370 15218 13548 CDS product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966206.1 protein_id gnl|my_center|LOCUS_15370 15654 15478 gene locus_tag LOCUS_15380 15654 15478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720023.1 protein_id gnl|my_center|LOCUS_15380 16736 15651 gene locus_tag LOCUS_15390 16736 15651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 17527 16733 gene locus_tag LOCUS_15400 17527 16733 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337801.1 protein_id gnl|my_center|LOCUS_15400 18540 17524 gene locus_tag LOCUS_15410 18540 17524 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086462.1 protein_id gnl|my_center|LOCUS_15410 19627 18584 gene locus_tag LOCUS_15420 19627 18584 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966229.1 protein_id gnl|my_center|LOCUS_15420 19878 21734 gene locus_tag LOCUS_15430 19878 21734 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388687.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence052 39 398 gene locus_tag LOCUS_15440 gene rplT 39 398 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528310.1 protein_id gnl|my_center|LOCUS_15440 536 1072 gene locus_tag LOCUS_15450 536 1072 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_15450 2038 1172 gene locus_tag LOCUS_15460 2038 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2517 2035 gene locus_tag LOCUS_15470 2517 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2862 2557 gene locus_tag LOCUS_15480 2862 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3090 3836 gene locus_tag LOCUS_15490 3090 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 4439 5443 gene locus_tag LOCUS_15500 4439 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 5498 6970 gene locus_tag LOCUS_15510 5498 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 6967 7362 gene locus_tag LOCUS_15520 6967 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 7454 8776 gene locus_tag LOCUS_15530 7454 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 8789 9097 gene locus_tag LOCUS_15540 8789 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 9099 9497 gene locus_tag LOCUS_15550 9099 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 10151 10999 gene locus_tag LOCUS_15560 10151 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 11428 12777 gene locus_tag LOCUS_15570 11428 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 12806 13234 gene locus_tag LOCUS_15580 12806 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 13234 13536 gene locus_tag LOCUS_15590 13234 13536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 14609 15307 gene locus_tag LOCUS_15600 14609 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 15304 15486 gene locus_tag LOCUS_15610 15304 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 16241 16504 gene locus_tag LOCUS_15620 16241 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 16505 17050 gene locus_tag LOCUS_15630 16505 17050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 17050 17412 gene locus_tag LOCUS_15640 17050 17412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 17419 18543 gene locus_tag LOCUS_15650 17419 18543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 18548 19222 gene locus_tag LOCUS_15660 18548 19222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 19256 20509 gene locus_tag LOCUS_15670 19256 20509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 20522 20785 gene locus_tag LOCUS_15680 20522 20785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 20801 21283 gene locus_tag LOCUS_15690 20801 21283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence053 765 58 gene locus_tag LOCUS_15700 765 58 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089830.1 protein_id gnl|my_center|LOCUS_15700 1979 807 gene locus_tag LOCUS_15710 1979 807 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970528.1 protein_id gnl|my_center|LOCUS_15710 3209 2040 gene locus_tag LOCUS_15720 3209 2040 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 protein_id gnl|my_center|LOCUS_15720 3468 3121 gene locus_tag LOCUS_15730 3468 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3593 4198 gene locus_tag LOCUS_15740 gene phaR 3593 4198 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_15740 5447 4170 gene locus_tag LOCUS_15750 5447 4170 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_15750 5935 5465 gene locus_tag LOCUS_15760 gene gpt 5935 5465 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 protein_id gnl|my_center|LOCUS_15760 6279 5935 gene locus_tag LOCUS_15770 6279 5935 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969865.1 protein_id gnl|my_center|LOCUS_15770 6385 7983 gene locus_tag LOCUS_15780 gene ggt 6385 7983 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 protein_id gnl|my_center|LOCUS_15780 8478 10421 gene locus_tag LOCUS_15790 8478 10421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 10418 10954 gene locus_tag LOCUS_15800 10418 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 11753 11037 gene locus_tag LOCUS_15810 gene urtE 11753 11037 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889583.1 protein_id gnl|my_center|LOCUS_15810 12504 11731 gene locus_tag LOCUS_15820 gene urtD 12504 11731 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889582.1 protein_id gnl|my_center|LOCUS_15820 13586 12501 gene locus_tag LOCUS_15830 gene urtC 13586 12501 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889581.1 protein_id gnl|my_center|LOCUS_15830 14498 13590 gene locus_tag LOCUS_15840 gene urtB 14498 13590 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889580.1 protein_id gnl|my_center|LOCUS_15840 15788 14595 gene locus_tag LOCUS_15850 gene urtA 15788 14595 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889579.1 protein_id gnl|my_center|LOCUS_15850 16486 15848 gene locus_tag LOCUS_15860 gene ureG 16486 15848 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084276.1 protein_id gnl|my_center|LOCUS_15860 17148 16483 gene locus_tag LOCUS_15870 17148 16483 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035255866.1 protein_id gnl|my_center|LOCUS_15870 17575 17141 gene locus_tag LOCUS_15880 17575 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 19281 17575 gene locus_tag LOCUS_15890 gene ureC 19281 17575 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969961.1 protein_id gnl|my_center|LOCUS_15890 19589 19284 gene locus_tag LOCUS_15900 19589 19284 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525615.1 protein_id gnl|my_center|LOCUS_15900 19888 19586 gene locus_tag LOCUS_15910 19888 19586 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525618.1 protein_id gnl|my_center|LOCUS_15910 20794 19901 gene locus_tag LOCUS_15920 20794 19901 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084270.1 protein_id gnl|my_center|LOCUS_15920 20878 22092 gene locus_tag LOCUS_15930 20878 22092 CDS product TCR/Tet family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494218.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence054 2201 705 gene locus_tag LOCUS_15940 gene tssC 2201 705 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315895.1 protein_id gnl|my_center|LOCUS_15940 2714 2205 gene locus_tag LOCUS_15950 gene tssB 2714 2205 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973761.1 protein_id gnl|my_center|LOCUS_15950 3977 2880 gene locus_tag LOCUS_15960 gene tssA 3977 2880 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480330.1 protein_id gnl|my_center|LOCUS_15960 4250 6913 gene locus_tag LOCUS_15970 gene tssH 4250 6913 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549921.1 protein_id gnl|my_center|LOCUS_15970 6948 7433 gene locus_tag LOCUS_15980 6948 7433 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527837.1 protein_id gnl|my_center|LOCUS_15980 8288 7566 gene locus_tag LOCUS_15990 gene pppA 8288 7566 CDS product serine/threonine phosphatase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_15990 8863 8285 gene locus_tag LOCUS_16000 gene tagF 8863 8285 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106966.1 protein_id gnl|my_center|LOCUS_16000 12405 8860 gene locus_tag LOCUS_16010 gene tssM 12405 8860 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086382.1 protein_id gnl|my_center|LOCUS_16010 13792 12413 gene locus_tag LOCUS_16020 13792 12413 CDS product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115051.1 protein_id gnl|my_center|LOCUS_16020 15128 13797 gene locus_tag LOCUS_16030 gene tssK 15128 13797 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115052.1 protein_id gnl|my_center|LOCUS_16030 15597 15157 gene locus_tag LOCUS_16040 gene tssJ 15597 15157 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083660.1 protein_id gnl|my_center|LOCUS_16040 17105 15690 gene locus_tag LOCUS_16050 gene tagH 17105 15690 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147054.1 protein_id gnl|my_center|LOCUS_16050 17695 17102 gene locus_tag LOCUS_16060 17695 17102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 19547 17700 gene locus_tag LOCUS_16070 19547 17700 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_16070 20273 19746 gene locus_tag LOCUS_16080 20273 19746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 21647 20277 gene locus_tag LOCUS_16090 21647 20277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence055 120 488 gene locus_tag LOCUS_16100 120 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 606 1040 gene locus_tag LOCUS_16110 606 1040 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300228.1 protein_id gnl|my_center|LOCUS_16110 1037 1747 gene locus_tag LOCUS_16120 1037 1747 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_16120 2036 1833 gene locus_tag LOCUS_16130 2036 1833 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019285.1 protein_id gnl|my_center|LOCUS_16130 2408 3469 gene locus_tag LOCUS_16140 2408 3469 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267673.1 protein_id gnl|my_center|LOCUS_16140 3738 4076 gene locus_tag LOCUS_16150 3738 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 4094 6028 gene locus_tag LOCUS_16160 gene acs 4094 6028 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_16160 6025 6861 gene locus_tag LOCUS_16170 6025 6861 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222388.1 protein_id gnl|my_center|LOCUS_16170 8731 6956 gene locus_tag LOCUS_16180 8731 6956 CDS product glucan ABC transporter ATP-binding protein/ permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084139.1 protein_id gnl|my_center|LOCUS_16180 9573 8728 gene locus_tag LOCUS_16190 gene pdxY 9573 8728 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_16190 9676 10770 gene locus_tag LOCUS_16200 9676 10770 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256728.1 protein_id gnl|my_center|LOCUS_16200 10901 11398 gene locus_tag LOCUS_16210 10901 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 13172 11526 gene locus_tag LOCUS_16220 13172 11526 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027792.1 protein_id gnl|my_center|LOCUS_16220 13984 13169 gene locus_tag LOCUS_16230 13984 13169 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269161.1 protein_id gnl|my_center|LOCUS_16230 15103 14009 gene locus_tag LOCUS_16240 gene ychF 15103 14009 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391495.1 protein_id gnl|my_center|LOCUS_16240 15677 15093 gene locus_tag LOCUS_16250 gene pth 15677 15093 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090174.1 protein_id gnl|my_center|LOCUS_16250 16424 15702 gene locus_tag LOCUS_16260 16424 15702 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391493.1 protein_id gnl|my_center|LOCUS_16260 16911 19730 gene locus_tag LOCUS_16270 16911 19730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 21495 19804 gene locus_tag LOCUS_16280 21495 19804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence056 1413 442 gene locus_tag LOCUS_16290 1413 442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531725.1 protein_id gnl|my_center|LOCUS_16290 2674 1676 gene locus_tag LOCUS_16300 2674 1676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470617.1 protein_id gnl|my_center|LOCUS_16300 4323 2671 gene locus_tag LOCUS_16310 4323 2671 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531727.1 protein_id gnl|my_center|LOCUS_16310 4888 4325 gene locus_tag LOCUS_16320 4888 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 5397 4885 gene locus_tag LOCUS_16330 gene lspA 5397 4885 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174654.1 protein_id gnl|my_center|LOCUS_16330 8135 5397 gene locus_tag LOCUS_16340 gene ileS 8135 5397 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390714.1 protein_id gnl|my_center|LOCUS_16340 9197 8259 gene locus_tag LOCUS_16350 9197 8259 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_16350 9637 9197 gene locus_tag LOCUS_16360 9637 9197 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_16360 9739 12330 gene locus_tag LOCUS_16370 9739 12330 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_16370 12923 12387 gene locus_tag LOCUS_16380 gene thpR 12923 12387 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391396.1 protein_id gnl|my_center|LOCUS_16380 14123 13191 gene locus_tag LOCUS_16390 14123 13191 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366683.1 protein_id gnl|my_center|LOCUS_16390 14875 14126 gene locus_tag LOCUS_16400 14875 14126 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390825.1 protein_id gnl|my_center|LOCUS_16400 18168 15031 gene locus_tag LOCUS_16410 18168 15031 CDS product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence057 1572 97 gene locus_tag LOCUS_16420 1572 97 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084906.1 protein_id gnl|my_center|LOCUS_16420 2321 1569 gene locus_tag LOCUS_16430 2321 1569 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338766.1 protein_id gnl|my_center|LOCUS_16430 2799 2509 gene locus_tag LOCUS_16440 2799 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2680 3690 gene locus_tag LOCUS_16450 2680 3690 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388501.1 protein_id gnl|my_center|LOCUS_16450 3683 4744 gene locus_tag LOCUS_16460 3683 4744 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_16460 4674 6968 gene locus_tag LOCUS_16470 gene ptsP 4674 6968 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918734.1 protein_id gnl|my_center|LOCUS_16470 6996 7886 gene locus_tag LOCUS_16480 6996 7886 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268899.1 protein_id gnl|my_center|LOCUS_16480 7957 9030 gene locus_tag LOCUS_16490 7957 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 9060 10172 gene locus_tag LOCUS_16500 gene ispG 9060 10172 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918736.1 protein_id gnl|my_center|LOCUS_16500 10247 11491 gene locus_tag LOCUS_16510 gene hisS 10247 11491 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388506.1 protein_id gnl|my_center|LOCUS_16510 11488 12543 gene locus_tag LOCUS_16520 gene prfA 11488 12543 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388508.1 protein_id gnl|my_center|LOCUS_16520 12540 13397 gene locus_tag LOCUS_16530 gene prmC 12540 13397 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_16530 13594 14106 gene locus_tag LOCUS_16540 13594 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 15309 14224 gene locus_tag LOCUS_16550 15309 14224 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_16550 15408 16103 gene locus_tag LOCUS_16560 15408 16103 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 protein_id gnl|my_center|LOCUS_16560 16109 16711 gene locus_tag LOCUS_16570 16109 16711 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_16570 17603 16671 gene locus_tag LOCUS_16580 gene prpB 17603 16671 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390073.1 protein_id gnl|my_center|LOCUS_16580 18458 17616 gene locus_tag LOCUS_16590 18458 17616 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_16590 18522 20369 gene locus_tag LOCUS_16600 18522 20369 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852913.1 protein_id gnl|my_center|LOCUS_16600 20441 20680 gene locus_tag LOCUS_16610 20441 20680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence058 819 106 gene locus_tag LOCUS_16620 gene yihA 819 106 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090821.1 protein_id gnl|my_center|LOCUS_16620 2534 765 gene locus_tag LOCUS_16630 gene yidC 2534 765 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391086.1 protein_id gnl|my_center|LOCUS_16630 3123 2764 gene locus_tag LOCUS_16640 3123 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 3547 3473 gene locus_tag LOCUS_t00300 3547 3473 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3660 3735 gene locus_tag LOCUS_t00310 3660 3735 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3888 4433 gene locus_tag LOCUS_16650 gene satP 3888 4433 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209246.1 protein_id gnl|my_center|LOCUS_16650 4607 6484 gene locus_tag LOCUS_16660 4607 6484 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_16660 6670 6924 gene locus_tag LOCUS_16670 6670 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 6939 7586 gene locus_tag LOCUS_16680 6939 7586 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405783.1 protein_id gnl|my_center|LOCUS_16680 7583 8122 gene locus_tag LOCUS_16690 7583 8122 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087656.1 protein_id gnl|my_center|LOCUS_16690 8119 8811 gene locus_tag LOCUS_16700 gene mtnC 8119 8811 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704722.1 protein_id gnl|my_center|LOCUS_16700 8808 10316 gene locus_tag LOCUS_16710 gene lnt 8808 10316 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339441.1 protein_id gnl|my_center|LOCUS_16710 10551 11027 gene locus_tag LOCUS_16720 10551 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 11142 11657 gene locus_tag LOCUS_16730 11142 11657 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388365.1 protein_id gnl|my_center|LOCUS_16730 11673 12746 gene locus_tag LOCUS_16740 11673 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 12892 14208 gene locus_tag LOCUS_16750 gene radA 12892 14208 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 protein_id gnl|my_center|LOCUS_16750 14195 14860 gene locus_tag LOCUS_16760 14195 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 15037 16488 gene locus_tag LOCUS_16770 gene purF 15037 16488 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388163.1 protein_id gnl|my_center|LOCUS_16770 16744 16505 gene locus_tag LOCUS_16780 16744 16505 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528075.1 protein_id gnl|my_center|LOCUS_16780 17219 17626 gene locus_tag LOCUS_16790 gene crcB 17219 17626 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_16790 17623 18426 gene locus_tag LOCUS_16800 17623 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 18858 18400 gene locus_tag LOCUS_16810 18858 18400 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 protein_id gnl|my_center|LOCUS_16810 18904 20523 gene locus_tag LOCUS_16820 18904 20523 CDS product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 protein_id gnl|my_center|LOCUS_16820 <20984 20466 gene locus_tag LOCUS_16830 <20984 20466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388877.1:MBL fold metallo-hydrolase >Feature sequence059 2 127 gene locus_tag LOCUS_16840 2 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 131 823 gene locus_tag LOCUS_16850 gene rplA 131 823 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088163.1 protein_id gnl|my_center|LOCUS_16850 1076 1621 gene locus_tag LOCUS_16860 gene rplJ 1076 1621 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402238.1 protein_id gnl|my_center|LOCUS_16860 1717 2100 gene locus_tag LOCUS_16870 gene rplL 1717 2100 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390506.1 protein_id gnl|my_center|LOCUS_16870 2253 6437 gene locus_tag LOCUS_16880 gene rpoB 2253 6437 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390505.1 protein_id gnl|my_center|LOCUS_16880 6518 10681 gene locus_tag LOCUS_16890 gene rpoC 6518 10681 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390504.1 protein_id gnl|my_center|LOCUS_16890 11210 11581 gene locus_tag LOCUS_16900 gene rpsL 11210 11581 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004624021.1 protein_id gnl|my_center|LOCUS_16900 11594 12070 gene locus_tag LOCUS_16910 gene rpsG 11594 12070 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004624018.1 protein_id gnl|my_center|LOCUS_16910 12128 13315 gene locus_tag LOCUS_16920 gene tuf 12128 13315 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088152.1 protein_id gnl|my_center|LOCUS_16920 13395 13703 gene locus_tag LOCUS_16930 gene rpsJ 13395 13703 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_16930 13713 14387 gene locus_tag LOCUS_16940 gene rplC 13713 14387 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919127.1 protein_id gnl|my_center|LOCUS_16940 14393 15007 gene locus_tag LOCUS_16950 gene rplD 14393 15007 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390437.1 protein_id gnl|my_center|LOCUS_16950 15004 15315 gene locus_tag LOCUS_16960 15004 15315 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440457.1 protein_id gnl|my_center|LOCUS_16960 15332 16165 gene locus_tag LOCUS_16970 gene rplB 15332 16165 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390435.1 protein_id gnl|my_center|LOCUS_16970 16170 16448 gene locus_tag LOCUS_16980 gene rpsS 16170 16448 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390434.1 protein_id gnl|my_center|LOCUS_16980 16450 16857 gene locus_tag LOCUS_16990 gene rplV 16450 16857 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707758.1 protein_id gnl|my_center|LOCUS_16990 16857 17534 gene locus_tag LOCUS_17000 gene rpsC 16857 17534 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_17000 17547 17963 gene locus_tag LOCUS_17010 gene rplP 17547 17963 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 protein_id gnl|my_center|LOCUS_17010 17983 18171 gene locus_tag LOCUS_17020 gene rpmC 17983 18171 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722500.1 protein_id gnl|my_center|LOCUS_17020 18181 18450 gene locus_tag LOCUS_17030 gene rpsQ 18181 18450 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390429.1 protein_id gnl|my_center|LOCUS_17030 18461 18829 gene locus_tag LOCUS_17040 gene rplN 18461 18829 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390428.1 protein_id gnl|my_center|LOCUS_17040 18832 19152 gene locus_tag LOCUS_17050 gene rplX 18832 19152 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_17050 19145 19723 gene locus_tag LOCUS_17060 gene rplE 19145 19723 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336952.1 protein_id gnl|my_center|LOCUS_17060 19790 20095 gene locus_tag LOCUS_17070 gene rpsN 19790 20095 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390425.1 protein_id gnl|my_center|LOCUS_17070 20108 20506 gene locus_tag LOCUS_17080 gene rpsH 20108 20506 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390424.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence060 870 97 gene locus_tag LOCUS_17090 870 97 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437127.1 protein_id gnl|my_center|LOCUS_17090 1256 2803 gene locus_tag LOCUS_17100 gene glpD 1256 2803 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526148.1 protein_id gnl|my_center|LOCUS_17100 2847 4346 gene locus_tag LOCUS_17110 gene glpK 2847 4346 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_17110 4508 5209 gene locus_tag LOCUS_17120 4508 5209 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259136.1 protein_id gnl|my_center|LOCUS_17120 5293 6294 gene locus_tag LOCUS_17130 gene dhaK 5293 6294 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259135.1 protein_id gnl|my_center|LOCUS_17130 6291 6908 gene locus_tag LOCUS_17140 gene dhaL 6291 6908 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728173.1 protein_id gnl|my_center|LOCUS_17140 6912 9170 gene locus_tag LOCUS_17150 gene ptsP 6912 9170 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225786.1 protein_id gnl|my_center|LOCUS_17150 9454 10074 gene locus_tag LOCUS_17160 9454 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 10067 10699 gene locus_tag LOCUS_17170 10067 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 10747 13314 gene locus_tag LOCUS_17180 10747 13314 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928965.1 protein_id gnl|my_center|LOCUS_17180 13440 15245 gene locus_tag LOCUS_17190 13440 15245 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389868.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence061 1451 477 gene locus_tag LOCUS_17200 1451 477 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479781.1 protein_id gnl|my_center|LOCUS_17200 2734 1451 gene locus_tag LOCUS_17210 2734 1451 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086636.1 protein_id gnl|my_center|LOCUS_17210 2884 3660 gene locus_tag LOCUS_17220 2884 3660 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921388.1 protein_id gnl|my_center|LOCUS_17220 3657 4718 gene locus_tag LOCUS_17230 3657 4718 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_17230 5661 4993 gene locus_tag LOCUS_17240 5661 4993 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_17240 6143 5658 gene locus_tag LOCUS_17250 6143 5658 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388985.1 protein_id gnl|my_center|LOCUS_17250 7249 6140 gene locus_tag LOCUS_17260 7249 6140 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972556.1 protein_id gnl|my_center|LOCUS_17260 8741 7362 gene locus_tag LOCUS_17270 8741 7362 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_17270 10028 8793 gene locus_tag LOCUS_17280 10028 8793 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083265.1 protein_id gnl|my_center|LOCUS_17280 11535 10000 gene locus_tag LOCUS_17290 gene gpmI 11535 10000 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388989.1 protein_id gnl|my_center|LOCUS_17290 11668 12831 gene locus_tag LOCUS_17300 gene tarD 11668 12831 CDS product D(-)-tartrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089469.1 protein_id gnl|my_center|LOCUS_17300 12956 13600 gene locus_tag LOCUS_17310 12956 13600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 14182 13730 gene locus_tag LOCUS_17320 gene rlmH 14182 13730 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388990.1 protein_id gnl|my_center|LOCUS_17320 14502 14179 gene locus_tag LOCUS_17330 14502 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 15266 14685 gene locus_tag LOCUS_17340 15266 14685 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388992.1 protein_id gnl|my_center|LOCUS_17340 16570 15308 gene locus_tag LOCUS_17350 16570 15308 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388993.1 protein_id gnl|my_center|LOCUS_17350 16699 17727 gene locus_tag LOCUS_17360 16699 17727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 17735 18493 gene locus_tag LOCUS_17370 17735 18493 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence062 1 771 gene locus_tag LOCUS_17380 1 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 768 1931 gene locus_tag LOCUS_17390 768 1931 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_17390 2608 1955 gene locus_tag LOCUS_17400 2608 1955 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_17400 4167 2605 gene locus_tag LOCUS_17410 4167 2605 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_17410 5698 4157 gene locus_tag LOCUS_17420 5698 4157 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827567.1 protein_id gnl|my_center|LOCUS_17420 6804 5701 gene locus_tag LOCUS_17430 6804 5701 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097455.1 protein_id gnl|my_center|LOCUS_17430 6878 7519 gene locus_tag LOCUS_17440 6878 7519 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940085.1 protein_id gnl|my_center|LOCUS_17440 8782 7562 gene locus_tag LOCUS_17450 8782 7562 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388109.1 protein_id gnl|my_center|LOCUS_17450 8938 9675 gene locus_tag LOCUS_17460 8938 9675 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390260.1 protein_id gnl|my_center|LOCUS_17460 11229 9841 gene locus_tag LOCUS_17470 11229 9841 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529548.1 protein_id gnl|my_center|LOCUS_17470 12225 11362 gene locus_tag LOCUS_17480 12225 11362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 13619 12225 gene locus_tag LOCUS_17490 gene aspA 13619 12225 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096822.1 protein_id gnl|my_center|LOCUS_17490 14299 13664 gene locus_tag LOCUS_17500 14299 13664 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_17500 15092 14301 gene locus_tag LOCUS_17510 15092 14301 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_17510 16450 15089 gene locus_tag LOCUS_17520 gene cysS 16450 15089 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388447.1 protein_id gnl|my_center|LOCUS_17520 16909 16508 gene locus_tag LOCUS_17530 16909 16508 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038658.1 protein_id gnl|my_center|LOCUS_17530 17176 18387 gene locus_tag LOCUS_17540 17176 18387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 19199 18501 gene locus_tag LOCUS_17550 19199 18501 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence063 1786 476 gene locus_tag LOCUS_17560 1786 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2934 1783 gene locus_tag LOCUS_17570 2934 1783 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965860.1 protein_id gnl|my_center|LOCUS_17570 4186 3263 gene locus_tag LOCUS_17580 gene era 4186 3263 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722420.1 protein_id gnl|my_center|LOCUS_17580 4851 4183 gene locus_tag LOCUS_17590 gene rnc 4851 4183 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389605.1 protein_id gnl|my_center|LOCUS_17590 5636 4869 gene locus_tag LOCUS_17600 gene lepB 5636 4869 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087823.1 protein_id gnl|my_center|LOCUS_17600 5800 7077 gene locus_tag LOCUS_17610 5800 7077 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_17610 7665 7267 gene locus_tag LOCUS_17620 gene acpS 7665 7267 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919432.1 protein_id gnl|my_center|LOCUS_17620 9930 7678 gene locus_tag LOCUS_17630 9930 7678 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385014.1 protein_id gnl|my_center|LOCUS_17630 10343 9936 gene locus_tag LOCUS_17640 10343 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 10462 10535 gene locus_tag LOCUS_t00320 10462 10535 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10628 10927 gene locus_tag LOCUS_17650 10628 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 10972 12129 gene locus_tag LOCUS_17660 10972 12129 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384178.1 protein_id gnl|my_center|LOCUS_17660 12126 12791 gene locus_tag LOCUS_17670 12126 12791 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919535.1 protein_id gnl|my_center|LOCUS_17670 12846 13325 gene locus_tag LOCUS_17680 12846 13325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 13325 14446 gene locus_tag LOCUS_17690 13325 14446 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528501.1 protein_id gnl|my_center|LOCUS_17690 14450 16012 gene locus_tag LOCUS_17700 14450 16012 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528502.1 protein_id gnl|my_center|LOCUS_17700 16087 17727 gene locus_tag LOCUS_17710 16087 17727 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence064 233 1225 gene locus_tag LOCUS_17720 233 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 2063 1377 gene locus_tag LOCUS_17730 2063 1377 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194030.1 protein_id gnl|my_center|LOCUS_17730 2249 3691 gene locus_tag LOCUS_17740 2249 3691 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086748.1 protein_id gnl|my_center|LOCUS_17740 3770 5503 gene locus_tag LOCUS_17750 3770 5503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390692.1 protein_id gnl|my_center|LOCUS_17750 6440 5547 gene locus_tag LOCUS_17760 6440 5547 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_17760 7536 6442 gene locus_tag LOCUS_17770 gene hisC 7536 6442 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391012.1 protein_id gnl|my_center|LOCUS_17770 8404 7547 gene locus_tag LOCUS_17780 8404 7547 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_17780 8518 9660 gene locus_tag LOCUS_17790 8518 9660 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391014.1 protein_id gnl|my_center|LOCUS_17790 9657 10295 gene locus_tag LOCUS_17800 gene metW 9657 10295 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_17800 10360 11205 gene locus_tag LOCUS_17810 gene dapF 10360 11205 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 protein_id gnl|my_center|LOCUS_17810 11202 12437 gene locus_tag LOCUS_17820 gene mtaB 11202 12437 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 protein_id gnl|my_center|LOCUS_17820 12441 13373 gene locus_tag LOCUS_17830 12441 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 13743 14939 gene locus_tag LOCUS_17840 gene sucC 13743 14939 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_17840 14939 15814 gene locus_tag LOCUS_17850 gene sucD 14939 15814 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_17850 15986 18847 gene locus_tag LOCUS_17860 15986 18847 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388968.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence065 3032 165 gene locus_tag LOCUS_17870 3032 165 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950392.1 protein_id gnl|my_center|LOCUS_17870 3866 3258 gene locus_tag LOCUS_17880 3866 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 3880 5265 gene locus_tag LOCUS_17890 gene argH 3880 5265 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338440.1 protein_id gnl|my_center|LOCUS_17890 5262 5432 gene locus_tag LOCUS_17900 5262 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 5433 6755 gene locus_tag LOCUS_17910 gene lysA 5433 6755 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388155.1 protein_id gnl|my_center|LOCUS_17910 7137 9083 gene locus_tag LOCUS_17920 7137 9083 CDS product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970102.1 protein_id gnl|my_center|LOCUS_17920 9177 9827 gene locus_tag LOCUS_17930 9177 9827 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390534.1 protein_id gnl|my_center|LOCUS_17930 9976 10551 gene locus_tag LOCUS_17940 9976 10551 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329530.1 protein_id gnl|my_center|LOCUS_17940 10720 11142 gene locus_tag LOCUS_17950 10720 11142 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088783.1 protein_id gnl|my_center|LOCUS_17950 12513 11173 gene locus_tag LOCUS_17960 gene xseA 12513 11173 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387920.1 protein_id gnl|my_center|LOCUS_17960 12563 13867 gene locus_tag LOCUS_17970 gene purD 12563 13867 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388404.1 protein_id gnl|my_center|LOCUS_17970 13983 14462 gene locus_tag LOCUS_17980 13983 14462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 14468 14971 gene locus_tag LOCUS_17990 14468 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 15584 15012 gene locus_tag LOCUS_18000 15584 15012 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197907.1 protein_id gnl|my_center|LOCUS_18000 15800 16039 gene locus_tag LOCUS_18010 15800 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 16285 17610 gene locus_tag LOCUS_18020 16285 17610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence066 <1 683 gene locus_tag LOCUS_18030 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162470590.1:DMT family transporter 667 1503 gene locus_tag LOCUS_18040 667 1503 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532737.1 protein_id gnl|my_center|LOCUS_18040 2052 1603 gene locus_tag LOCUS_18050 2052 1603 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957536.1 protein_id gnl|my_center|LOCUS_18050 2944 2285 gene locus_tag LOCUS_18060 2944 2285 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 protein_id gnl|my_center|LOCUS_18060 3528 2944 gene locus_tag LOCUS_18070 3528 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 5619 3685 gene locus_tag LOCUS_18080 5619 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 7434 5650 gene locus_tag LOCUS_18090 gene dnaG 7434 5650 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390633.1 protein_id gnl|my_center|LOCUS_18090 7892 7434 gene locus_tag LOCUS_18100 7892 7434 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383803.1 protein_id gnl|my_center|LOCUS_18100 7997 9349 gene locus_tag LOCUS_18110 gene carA 7997 9349 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 protein_id gnl|my_center|LOCUS_18110 9440 12682 gene locus_tag LOCUS_18120 gene carB 9440 12682 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390636.1 protein_id gnl|my_center|LOCUS_18120 12756 13232 gene locus_tag LOCUS_18130 gene greA 12756 13232 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 protein_id gnl|my_center|LOCUS_18130 13240 14436 gene locus_tag LOCUS_18140 13240 14436 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_18140 14800 14486 gene locus_tag LOCUS_18150 14800 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 14699 15376 gene locus_tag LOCUS_18160 14699 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 16823 15432 gene locus_tag LOCUS_18170 gene tolB 16823 15432 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388849.1 protein_id gnl|my_center|LOCUS_18170 17874 16912 gene locus_tag LOCUS_18180 17874 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 18330 17893 gene locus_tag LOCUS_18190 gene tolR 18330 17893 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529146.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence067 568 1728 gene locus_tag LOCUS_18200 568 1728 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967037.1 protein_id gnl|my_center|LOCUS_18200 1715 2665 gene locus_tag LOCUS_18210 gene pip 1715 2665 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_18210 2817 3812 gene locus_tag LOCUS_18220 2817 3812 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053693.1 protein_id gnl|my_center|LOCUS_18220 3883 6486 gene locus_tag LOCUS_18230 3883 6486 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529541.1 protein_id gnl|my_center|LOCUS_18230 6476 6715 gene locus_tag LOCUS_18240 6476 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 7342 6671 gene locus_tag LOCUS_18250 7342 6671 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339438.1 protein_id gnl|my_center|LOCUS_18250 8571 7339 gene locus_tag LOCUS_18260 gene aroA 8571 7339 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388048.1 protein_id gnl|my_center|LOCUS_18260 8783 9106 gene locus_tag LOCUS_18270 8783 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 10111 9167 gene locus_tag LOCUS_18280 10111 9167 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191283.1 protein_id gnl|my_center|LOCUS_18280 10587 10108 gene locus_tag LOCUS_18290 10587 10108 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_18290 10762 11727 gene locus_tag LOCUS_18300 gene trxB 10762 11727 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090115.1 protein_id gnl|my_center|LOCUS_18300 11800 12684 gene locus_tag LOCUS_18310 11800 12684 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_18310 13745 13116 gene locus_tag LOCUS_18320 13745 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 14581 13805 gene locus_tag LOCUS_18330 14581 13805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 14785 15717 gene locus_tag LOCUS_18340 gene metF 14785 15717 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389283.1 protein_id gnl|my_center|LOCUS_18340 15717 15992 gene locus_tag LOCUS_18350 15717 15992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 15989 18175 gene locus_tag LOCUS_18360 15989 18175 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389289.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence068 670 194 gene locus_tag LOCUS_18370 gene rpsI 670 194 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_18370 1137 673 gene locus_tag LOCUS_18380 gene rplM 1137 673 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532205.1 protein_id gnl|my_center|LOCUS_18380 1584 1294 gene locus_tag LOCUS_18390 1584 1294 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_18390 2399 1596 gene locus_tag LOCUS_18400 gene gluQRS 2399 1596 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920066.1 protein_id gnl|my_center|LOCUS_18400 3361 2486 gene locus_tag LOCUS_18410 3361 2486 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722439.1 protein_id gnl|my_center|LOCUS_18410 4249 3425 gene locus_tag LOCUS_18420 4249 3425 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_18420 6495 4330 gene locus_tag LOCUS_18430 6495 4330 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390010.1 protein_id gnl|my_center|LOCUS_18430 7348 6653 gene locus_tag LOCUS_18440 7348 6653 CDS product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 protein_id gnl|my_center|LOCUS_18440 8460 7345 gene locus_tag LOCUS_18450 8460 7345 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390013.1 protein_id gnl|my_center|LOCUS_18450 8579 9625 gene locus_tag LOCUS_18460 gene purM 8579 9625 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626325.1 protein_id gnl|my_center|LOCUS_18460 9622 10257 gene locus_tag LOCUS_18470 gene purN 9622 10257 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919571.1 protein_id gnl|my_center|LOCUS_18470 10285 10452 gene locus_tag LOCUS_18480 10285 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 11636 10488 gene locus_tag LOCUS_18490 gene hemW 11636 10488 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310172.1 protein_id gnl|my_center|LOCUS_18490 11745 13100 gene locus_tag LOCUS_18500 11745 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 13793 13083 gene locus_tag LOCUS_18510 13793 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 14842 13796 gene locus_tag LOCUS_18520 14842 13796 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868082.1 protein_id gnl|my_center|LOCUS_18520 16233 14839 gene locus_tag LOCUS_18530 16233 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 16979 16233 gene locus_tag LOCUS_18540 16979 16233 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_18540 17776 16976 gene locus_tag LOCUS_18550 17776 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 <18345 17782 gene locus_tag LOCUS_18560 <18345 17782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526525.1:molybdopterin-dependent oxidoreductase >Feature sequence069 <1 1033 gene locus_tag LOCUS_18570 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920485.1:ABC transporter substrate-binding protein 1034 1762 gene locus_tag LOCUS_18580 1034 1762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_18580 1773 2534 gene locus_tag LOCUS_18590 1773 2534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384595.1 protein_id gnl|my_center|LOCUS_18590 2559 2756 gene locus_tag LOCUS_18600 2559 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2767 3708 gene locus_tag LOCUS_18610 2767 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 5958 3691 gene locus_tag LOCUS_18620 5958 3691 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 protein_id gnl|my_center|LOCUS_18620 6332 6096 gene locus_tag LOCUS_18630 6332 6096 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330009.1 protein_id gnl|my_center|LOCUS_18630 7149 6322 gene locus_tag LOCUS_18640 gene fdhD 7149 6322 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085919.1 protein_id gnl|my_center|LOCUS_18640 7325 7146 gene locus_tag LOCUS_18650 7325 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18650 10014 7261 gene locus_tag LOCUS_18660 gene fdhF 10014 7261 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398020.1 protein_id gnl|my_center|LOCUS_18660 11638 10082 gene locus_tag LOCUS_18670 11638 10082 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970350.1 protein_id gnl|my_center|LOCUS_18670 12105 11635 gene locus_tag LOCUS_18680 12105 11635 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528011.1 protein_id gnl|my_center|LOCUS_18680 13097 12207 gene locus_tag LOCUS_18690 13097 12207 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085923.1 protein_id gnl|my_center|LOCUS_18690 14394 13336 gene locus_tag LOCUS_18700 14394 13336 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_18700 14278 14484 gene locus_tag LOCUS_18710 14278 14484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 14491 15693 gene locus_tag LOCUS_18720 14491 15693 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092150.1 protein_id gnl|my_center|LOCUS_18720 15699 16442 gene locus_tag LOCUS_18730 15699 16442 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 protein_id gnl|my_center|LOCUS_18730 16485 16943 gene locus_tag LOCUS_18740 16485 16943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence070 1093 1018 gene locus_tag LOCUS_t00330 1093 1018 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1673 1176 gene locus_tag LOCUS_18750 1673 1176 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389495.1 protein_id gnl|my_center|LOCUS_18750 2248 1730 gene locus_tag LOCUS_18760 gene coaD 2248 1730 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389496.1 protein_id gnl|my_center|LOCUS_18760 4970 2238 gene locus_tag LOCUS_18770 gene gyrA 4970 2238 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087464.1 protein_id gnl|my_center|LOCUS_18770 5474 4998 gene locus_tag LOCUS_18780 5474 4998 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087466.1 protein_id gnl|my_center|LOCUS_18780 5610 8498 gene locus_tag LOCUS_18790 gene uvrA 5610 8498 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_18790 9236 8634 gene locus_tag LOCUS_18800 9236 8634 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083331.1 protein_id gnl|my_center|LOCUS_18800 10160 9255 gene locus_tag LOCUS_18810 10160 9255 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142342.1 protein_id gnl|my_center|LOCUS_18810 10388 10224 gene locus_tag LOCUS_18820 10388 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 10667 10894 gene locus_tag LOCUS_18830 10667 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 11060 13402 gene locus_tag LOCUS_18840 gene clpA 11060 13402 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_18840 14328 13426 gene locus_tag LOCUS_18850 14328 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 15071 14325 gene locus_tag LOCUS_18860 gene pgeF 15071 14325 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388401.1 protein_id gnl|my_center|LOCUS_18860 16045 15068 gene locus_tag LOCUS_18870 16045 15068 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388400.1 protein_id gnl|my_center|LOCUS_18870 16863 16042 gene locus_tag LOCUS_18880 gene lgt 16863 16042 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_18880 17840 16860 gene locus_tag LOCUS_18890 gene rfaD 17840 16860 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088669.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence071 <1 891 gene locus_tag LOCUS_18900 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388169.1:replicative DNA helicase 891 1982 gene locus_tag LOCUS_18910 gene alr 891 1982 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388168.1 protein_id gnl|my_center|LOCUS_18910 1979 2764 gene locus_tag LOCUS_18920 1979 2764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_18920 2761 3534 gene locus_tag LOCUS_18930 2761 3534 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_18930 3675 3872 gene locus_tag LOCUS_18940 3675 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3933 4655 gene locus_tag LOCUS_18950 3933 4655 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088801.1 protein_id gnl|my_center|LOCUS_18950 5333 4692 gene locus_tag LOCUS_18960 5333 4692 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948051.1 protein_id gnl|my_center|LOCUS_18960 6328 5333 gene locus_tag LOCUS_18970 6328 5333 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_18970 6379 7818 gene locus_tag LOCUS_18980 6379 7818 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 protein_id gnl|my_center|LOCUS_18980 12315 8695 gene locus_tag LOCUS_18990 12315 8695 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338773.1 protein_id gnl|my_center|LOCUS_18990 14096 12315 gene locus_tag LOCUS_19000 14096 12315 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530880.1 protein_id gnl|my_center|LOCUS_19000 15159 14179 gene locus_tag LOCUS_19010 15159 14179 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390409.1 protein_id gnl|my_center|LOCUS_19010 16511 15156 gene locus_tag LOCUS_19020 16511 15156 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_19020 17210 16518 gene locus_tag LOCUS_19030 17210 16518 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090537.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence072 928 302 gene locus_tag LOCUS_19040 gene rsmG 928 302 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338804.1 protein_id gnl|my_center|LOCUS_19040 2793 925 gene locus_tag LOCUS_19050 gene mnmG 2793 925 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067409.1 protein_id gnl|my_center|LOCUS_19050 4097 2805 gene locus_tag LOCUS_19060 gene mnmE 4097 2805 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398690.1 protein_id gnl|my_center|LOCUS_19060 4437 4087 gene locus_tag LOCUS_19070 4437 4087 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_19070 4499 6550 gene locus_tag LOCUS_19080 4499 6550 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_19080 6568 7032 gene locus_tag LOCUS_19090 6568 7032 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391368.1 protein_id gnl|my_center|LOCUS_19090 7029 8003 gene locus_tag LOCUS_19100 7029 8003 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_19100 8263 11472 gene locus_tag LOCUS_19110 8263 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 11469 14774 gene locus_tag LOCUS_19120 gene treS 11469 14774 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035392.1 protein_id gnl|my_center|LOCUS_19120 14771 16939 gene locus_tag LOCUS_19130 gene glgB 14771 16939 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104179.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence073 441 839 gene locus_tag LOCUS_19140 441 839 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036811.1 protein_id gnl|my_center|LOCUS_19140 980 2155 gene locus_tag LOCUS_19150 980 2155 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 protein_id gnl|my_center|LOCUS_19150 2376 3749 gene locus_tag LOCUS_19160 2376 3749 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528841.1 protein_id gnl|my_center|LOCUS_19160 4499 3750 gene locus_tag LOCUS_19170 4499 3750 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028252.1 protein_id gnl|my_center|LOCUS_19170 5862 4540 gene locus_tag LOCUS_19180 5862 4540 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039185890.1 protein_id gnl|my_center|LOCUS_19180 6641 5910 gene locus_tag LOCUS_19190 6641 5910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_19190 8601 6634 gene locus_tag LOCUS_19200 8601 6634 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815513.1 protein_id gnl|my_center|LOCUS_19200 9530 8598 gene locus_tag LOCUS_19210 9530 8598 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525177.1 protein_id gnl|my_center|LOCUS_19210 10762 9527 gene locus_tag LOCUS_19220 10762 9527 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227931.1 protein_id gnl|my_center|LOCUS_19220 10863 11636 gene locus_tag LOCUS_19230 10863 11636 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_19230 13366 12479 gene locus_tag LOCUS_19240 13366 12479 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020543.1 protein_id gnl|my_center|LOCUS_19240 14119 13430 gene locus_tag LOCUS_19250 14119 13430 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976287.1 protein_id gnl|my_center|LOCUS_19250 15792 14149 gene locus_tag LOCUS_19260 15792 14149 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence074 1238 408 gene locus_tag LOCUS_19270 1238 408 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_19270 3553 1310 gene locus_tag LOCUS_19280 3553 1310 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530703.1 protein_id gnl|my_center|LOCUS_19280 4602 3550 gene locus_tag LOCUS_19290 4602 3550 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530704.1 protein_id gnl|my_center|LOCUS_19290 5099 4599 gene locus_tag LOCUS_19300 5099 4599 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085005.1 protein_id gnl|my_center|LOCUS_19300 5286 5882 gene locus_tag LOCUS_19310 5286 5882 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974547.1 protein_id gnl|my_center|LOCUS_19310 6561 5941 gene locus_tag LOCUS_19320 6561 5941 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_19320 6897 7982 gene locus_tag LOCUS_19330 6897 7982 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_19330 7979 8593 gene locus_tag LOCUS_19340 7979 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 8705 8944 gene locus_tag LOCUS_19350 8705 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 9007 10542 gene locus_tag LOCUS_19360 9007 10542 CDS product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035339735.1 protein_id gnl|my_center|LOCUS_19360 11048 11248 gene locus_tag LOCUS_19370 11048 11248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 11458 11369 gene locus_tag LOCUS_t00340 11458 11369 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13300 11495 gene locus_tag LOCUS_19380 gene lepA 13300 11495 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640125.1 protein_id gnl|my_center|LOCUS_19380 14449 13352 gene locus_tag LOCUS_19390 14449 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19390 16322 14436 gene locus_tag LOCUS_19400 16322 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19400 >Feature sequence075 259 657 gene locus_tag LOCUS_19410 259 657 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620296.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19410 1367 783 gene locus_tag LOCUS_19420 1367 783 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066751.1 protein_id gnl|my_center|LOCUS_19420 2144 1389 gene locus_tag LOCUS_19430 2144 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3028 2141 gene locus_tag LOCUS_19440 3028 2141 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338243.1 protein_id gnl|my_center|LOCUS_19440 3297 4259 gene locus_tag LOCUS_19450 3297 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 6510 4528 gene locus_tag LOCUS_19460 6510 4528 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_19460 8253 6811 gene locus_tag LOCUS_19470 8253 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 9460 8261 gene locus_tag LOCUS_19480 9460 8261 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000235.1 protein_id gnl|my_center|LOCUS_19480 9517 10431 gene locus_tag LOCUS_19490 gene rsmI 9517 10431 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918033.1 protein_id gnl|my_center|LOCUS_19490 12378 10420 gene locus_tag LOCUS_19500 12378 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 14379 12649 gene locus_tag LOCUS_19510 14379 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 16773 14632 gene locus_tag LOCUS_19520 16773 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence076 897 79 gene locus_tag LOCUS_19530 gene trpC 897 79 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389650.1 protein_id gnl|my_center|LOCUS_19530 1913 900 gene locus_tag LOCUS_19540 gene trpD 1913 900 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919764.1 protein_id gnl|my_center|LOCUS_19540 2524 1910 gene locus_tag LOCUS_19550 2524 1910 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_19550 4038 2521 gene locus_tag LOCUS_19560 gene trpE 4038 2521 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_19560 5945 4059 gene locus_tag LOCUS_19570 5945 4059 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919760.1 protein_id gnl|my_center|LOCUS_19570 6033 6737 gene locus_tag LOCUS_19580 gene tpiA 6033 6737 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337104.1 protein_id gnl|my_center|LOCUS_19580 7780 6968 gene locus_tag LOCUS_19590 7780 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 8237 7764 gene locus_tag LOCUS_19600 8237 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 8227 8475 gene locus_tag LOCUS_19610 8227 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 8489 9118 gene locus_tag LOCUS_19620 gene queE 8489 9118 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_19620 9129 9536 gene locus_tag LOCUS_19630 9129 9536 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085269.1 protein_id gnl|my_center|LOCUS_19630 9529 10227 gene locus_tag LOCUS_19640 gene queC 9529 10227 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174058.1 protein_id gnl|my_center|LOCUS_19640 10447 10884 gene locus_tag LOCUS_19650 10447 10884 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_19650 11845 10871 gene locus_tag LOCUS_19660 11845 10871 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_19660 12542 11856 gene locus_tag LOCUS_19670 12542 11856 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389675.1 protein_id gnl|my_center|LOCUS_19670 12589 13971 gene locus_tag LOCUS_19680 12589 13971 CDS product DUF1800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 protein_id gnl|my_center|LOCUS_19680 13974 15230 gene locus_tag LOCUS_19690 13974 15230 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972739.1 protein_id gnl|my_center|LOCUS_19690 15371 16309 gene locus_tag LOCUS_19700 15371 16309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 16294 16506 gene locus_tag LOCUS_19710 16294 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence077 994 512 gene locus_tag LOCUS_19720 994 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 2283 1069 gene locus_tag LOCUS_19730 2283 1069 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932130.1 protein_id gnl|my_center|LOCUS_19730 2408 3628 gene locus_tag LOCUS_19740 2408 3628 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204969.1 protein_id gnl|my_center|LOCUS_19740 3685 4521 gene locus_tag LOCUS_19750 3685 4521 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_19750 4605 5489 gene locus_tag LOCUS_19760 4605 5489 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061685.1 protein_id gnl|my_center|LOCUS_19760 6430 5723 gene locus_tag LOCUS_19770 6430 5723 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_19770 8988 6427 gene locus_tag LOCUS_19780 8988 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 9174 9258 gene locus_tag LOCUS_t00350 9174 9258 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9318 10646 gene locus_tag LOCUS_19790 gene tig 9318 10646 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922580.1 protein_id gnl|my_center|LOCUS_19790 10786 11781 gene locus_tag LOCUS_19800 10786 11781 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625856.1 protein_id gnl|my_center|LOCUS_19800 11781 12473 gene locus_tag LOCUS_19810 11781 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 12470 13453 gene locus_tag LOCUS_19820 12470 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387773.1 protein_id gnl|my_center|LOCUS_19820 13450 14202 gene locus_tag LOCUS_19830 gene lptB 13450 14202 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_19830 14412 15821 gene locus_tag LOCUS_19840 gene rpoN 14412 15821 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387771.1 protein_id gnl|my_center|LOCUS_19840 15862 16455 gene locus_tag LOCUS_19850 gene raiA 15862 16455 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385412.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence078 320 928 gene locus_tag LOCUS_19860 320 928 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943893.1 protein_id gnl|my_center|LOCUS_19860 921 2669 gene locus_tag LOCUS_19870 921 2669 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_19870 2669 3388 gene locus_tag LOCUS_19880 2669 3388 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919005.1 protein_id gnl|my_center|LOCUS_19880 3388 5049 gene locus_tag LOCUS_19890 gene cysI 3388 5049 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_19890 5867 5178 gene locus_tag LOCUS_19900 5867 5178 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537692.1 protein_id gnl|my_center|LOCUS_19900 6589 5867 gene locus_tag LOCUS_19910 6589 5867 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112308.1 protein_id gnl|my_center|LOCUS_19910 7218 6589 gene locus_tag LOCUS_19920 7218 6589 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083337.1 protein_id gnl|my_center|LOCUS_19920 7485 7769 gene locus_tag LOCUS_19930 7485 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 7969 8613 gene locus_tag LOCUS_19940 7969 8613 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085558.1 protein_id gnl|my_center|LOCUS_19940 8613 9482 gene locus_tag LOCUS_19950 8613 9482 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965825.1 protein_id gnl|my_center|LOCUS_19950 11240 9498 gene locus_tag LOCUS_19960 11240 9498 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_19960 12326 11313 gene locus_tag LOCUS_19970 12326 11313 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_19970 12298 12570 gene locus_tag LOCUS_19980 12298 12570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 12567 15284 gene locus_tag LOCUS_19990 gene polA 12567 15284 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_19990 <16493 15444 gene locus_tag LOCUS_20000 <16493 15444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192776.1:MFS transporter >Feature sequence079 65 934 gene locus_tag LOCUS_20010 65 934 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313872.1 protein_id gnl|my_center|LOCUS_20010 931 1917 gene locus_tag LOCUS_20020 931 1917 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_20020 1914 2663 gene locus_tag LOCUS_20030 1914 2663 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088973.1 protein_id gnl|my_center|LOCUS_20030 2660 3364 gene locus_tag LOCUS_20040 2660 3364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_20040 4226 3399 gene locus_tag LOCUS_20050 4226 3399 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389217.1 protein_id gnl|my_center|LOCUS_20050 4861 4274 gene locus_tag LOCUS_20060 gene flgH 4861 4274 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390472.1 protein_id gnl|my_center|LOCUS_20060 6024 5020 gene locus_tag LOCUS_20070 6024 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 6814 6029 gene locus_tag LOCUS_20080 gene flgG 6814 6029 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390470.1 protein_id gnl|my_center|LOCUS_20080 7591 6851 gene locus_tag LOCUS_20090 gene flgF 7591 6851 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390469.1 protein_id gnl|my_center|LOCUS_20090 7817 8350 gene locus_tag LOCUS_20100 7817 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 8347 9354 gene locus_tag LOCUS_20110 gene fliM 8347 9354 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390467.1 protein_id gnl|my_center|LOCUS_20110 9351 9770 gene locus_tag LOCUS_20120 9351 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 9767 10411 gene locus_tag LOCUS_20130 9767 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 10408 12774 gene locus_tag LOCUS_20140 10408 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 12911 13387 gene locus_tag LOCUS_20150 12911 13387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 13515 14408 gene locus_tag LOCUS_20160 gene speE 13515 14408 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389381.1 protein_id gnl|my_center|LOCUS_20160 <16143 14634 gene locus_tag LOCUS_20170 <16143 14634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189745032.1:chloride channel protein >Feature sequence080 <1 1449 gene locus_tag LOCUS_20180 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389284.1:methionine synthase 2461 2117 gene locus_tag LOCUS_20190 2461 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 3264 2458 gene locus_tag LOCUS_20200 3264 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 4542 3277 gene locus_tag LOCUS_20210 4542 3277 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784141.1 protein_id gnl|my_center|LOCUS_20210 5795 4542 gene locus_tag LOCUS_20220 5795 4542 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288985.1 protein_id gnl|my_center|LOCUS_20220 6633 5788 gene locus_tag LOCUS_20230 gene sseA 6633 5788 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_20230 7649 6768 gene locus_tag LOCUS_20240 7649 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 8030 9076 gene locus_tag LOCUS_20250 8030 9076 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038816.1 protein_id gnl|my_center|LOCUS_20250 9233 11068 gene locus_tag LOCUS_20260 9233 11068 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_20260 11078 12436 gene locus_tag LOCUS_20270 11078 12436 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_20270 14409 12742 gene locus_tag LOCUS_20280 14409 12742 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144132.1 protein_id gnl|my_center|LOCUS_20280 <15880 14420 gene locus_tag LOCUS_20290 <15880 14420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531894.1:ABC transporter ATP-binding protein >Feature sequence081 1843 386 gene locus_tag LOCUS_20300 1843 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 1951 2946 gene locus_tag LOCUS_20310 1951 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2963 3214 gene locus_tag LOCUS_20320 2963 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 3818 3222 gene locus_tag LOCUS_20330 gene recR 3818 3222 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639926.1 protein_id gnl|my_center|LOCUS_20330 4145 3822 gene locus_tag LOCUS_20340 4145 3822 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067631.1 protein_id gnl|my_center|LOCUS_20340 5945 4149 gene locus_tag LOCUS_20350 5945 4149 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383690.1 protein_id gnl|my_center|LOCUS_20350 6157 7068 gene locus_tag LOCUS_20360 gene nudC 6157 7068 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_20360 7737 7198 gene locus_tag LOCUS_20370 7737 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 9348 8194 gene locus_tag LOCUS_20380 gene prpC 9348 8194 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187967.1 protein_id gnl|my_center|LOCUS_20380 11035 9536 gene locus_tag LOCUS_20390 11035 9536 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390071.1 protein_id gnl|my_center|LOCUS_20390 11300 11662 gene locus_tag LOCUS_20400 11300 11662 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918905.1 protein_id gnl|my_center|LOCUS_20400 11652 12140 gene locus_tag LOCUS_20410 11652 12140 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084075.1 protein_id gnl|my_center|LOCUS_20410 12217 13305 gene locus_tag LOCUS_20420 gene mtnA 12217 13305 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083782.1 protein_id gnl|my_center|LOCUS_20420 13428 14075 gene locus_tag LOCUS_20430 13428 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 14091 14333 gene locus_tag LOCUS_20440 14091 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 14336 15244 gene locus_tag LOCUS_20450 14336 15244 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence082 1549 2856 gene locus_tag LOCUS_20460 1549 2856 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939425.1 protein_id gnl|my_center|LOCUS_20460 2943 4364 gene locus_tag LOCUS_20470 2943 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 5109 4558 gene locus_tag LOCUS_20480 5109 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 5208 5819 gene locus_tag LOCUS_20490 5208 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 6760 5810 gene locus_tag LOCUS_20500 6760 5810 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_20500 7700 6813 gene locus_tag LOCUS_20510 7700 6813 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_20510 8643 7792 gene locus_tag LOCUS_20520 8643 7792 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090078.1 protein_id gnl|my_center|LOCUS_20520 8781 9620 gene locus_tag LOCUS_20530 8781 9620 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939922.1 protein_id gnl|my_center|LOCUS_20530 9569 10819 gene locus_tag LOCUS_20540 9569 10819 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250942.1 protein_id gnl|my_center|LOCUS_20540 10819 11568 gene locus_tag LOCUS_20550 10819 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 12215 11592 gene locus_tag LOCUS_20560 12215 11592 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391172.1 protein_id gnl|my_center|LOCUS_20560 12892 12212 gene locus_tag LOCUS_20570 gene pyrF 12892 12212 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_20570 13188 12889 gene locus_tag LOCUS_20580 13188 12889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 13496 13185 gene locus_tag LOCUS_20590 13496 13185 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006200394.1 protein_id gnl|my_center|LOCUS_20590 13887 14654 gene locus_tag LOCUS_20600 13887 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 14720 15523 gene locus_tag LOCUS_20610 14720 15523 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence083 167 1342 gene locus_tag LOCUS_20620 167 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20620 1423 2016 gene locus_tag LOCUS_20630 1423 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2016 2648 gene locus_tag LOCUS_20640 2016 2648 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064359.1 protein_id gnl|my_center|LOCUS_20640 2971 3237 gene locus_tag LOCUS_20650 2971 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3976 3281 gene locus_tag LOCUS_20660 gene arsH 3976 3281 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919380.1 protein_id gnl|my_center|LOCUS_20660 4503 3976 gene locus_tag LOCUS_20670 4503 3976 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 protein_id gnl|my_center|LOCUS_20670 4867 4514 gene locus_tag LOCUS_20680 4867 4514 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971665.1 protein_id gnl|my_center|LOCUS_20680 5024 6919 gene locus_tag LOCUS_20690 5024 6919 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275308.1 protein_id gnl|my_center|LOCUS_20690 9433 6944 gene locus_tag LOCUS_20700 9433 6944 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513927.1 protein_id gnl|my_center|LOCUS_20700 9834 10133 gene locus_tag LOCUS_20710 9834 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 10178 10465 gene locus_tag LOCUS_20720 gene rpmE 10178 10465 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388827.1 protein_id gnl|my_center|LOCUS_20720 10543 12825 gene locus_tag LOCUS_20730 10543 12825 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083112.1 protein_id gnl|my_center|LOCUS_20730 12989 13441 gene locus_tag LOCUS_20740 12989 13441 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388825.1 protein_id gnl|my_center|LOCUS_20740 14406 13663 gene locus_tag LOCUS_20750 gene fliP 14406 13663 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390457.1 protein_id gnl|my_center|LOCUS_20750 14693 14403 gene locus_tag LOCUS_20760 14693 14403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 14898 15278 gene locus_tag LOCUS_20770 gene flgB 14898 15278 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640104.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence084 1082 420 gene locus_tag LOCUS_20780 1082 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 1625 4663 gene locus_tag LOCUS_20790 gene cas9 1625 4663 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_20790 4639 5535 gene locus_tag LOCUS_20800 gene cas1 4639 5535 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989953.1 protein_id gnl|my_center|LOCUS_20800 5532 5861 gene locus_tag LOCUS_20810 gene cas2 5532 5861 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 protein_id gnl|my_center|LOCUS_20810 5940 7098 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agcctagcagggggaaatcagtagggaaaccacggc 9290 7629 gene locus_tag LOCUS_20820 9290 7629 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921411.1 protein_id gnl|my_center|LOCUS_20820 9949 12663 gene locus_tag LOCUS_20830 9949 12663 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975146.1 protein_id gnl|my_center|LOCUS_20830 14125 12719 gene locus_tag LOCUS_20840 14125 12719 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966432.1 protein_id gnl|my_center|LOCUS_20840 14367 14104 gene locus_tag LOCUS_20850 14367 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 14520 14792 gene locus_tag LOCUS_20860 14520 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 <15403 14842 gene locus_tag LOCUS_20870 <15403 14842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390493.1:50S ribosomal protein L11 methyltransferase >Feature sequence085 <1 1705 gene locus_tag LOCUS_20880 <1 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001078432.1:class I SAM-dependent methyltransferase 1706 6019 gene locus_tag LOCUS_20890 1706 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 6016 7056 gene locus_tag LOCUS_20900 6016 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 7061 7846 gene locus_tag LOCUS_20910 7061 7846 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131615381.1 protein_id gnl|my_center|LOCUS_20910 8003 9382 gene locus_tag LOCUS_20920 gene miaB 8003 9382 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391517.1 protein_id gnl|my_center|LOCUS_20920 9379 10413 gene locus_tag LOCUS_20930 9379 10413 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391518.1 protein_id gnl|my_center|LOCUS_20930 10397 10852 gene locus_tag LOCUS_20940 gene ybeY 10397 10852 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965162.1 protein_id gnl|my_center|LOCUS_20940 10849 11706 gene locus_tag LOCUS_20950 10849 11706 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_20950 11790 14564 gene locus_tag LOCUS_20960 11790 14564 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038744192.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence086 108 989 gene locus_tag LOCUS_20970 108 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 986 1654 gene locus_tag LOCUS_20980 gene tmk 986 1654 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919690.1 protein_id gnl|my_center|LOCUS_20980 1651 2622 gene locus_tag LOCUS_20990 1651 2622 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 protein_id gnl|my_center|LOCUS_20990 2619 4148 gene locus_tag LOCUS_21000 gene metG 2619 4148 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389391.1 protein_id gnl|my_center|LOCUS_21000 4145 4615 gene locus_tag LOCUS_21010 4145 4615 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354908.1 protein_id gnl|my_center|LOCUS_21010 4625 5401 gene locus_tag LOCUS_21020 4625 5401 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_21020 5398 6189 gene locus_tag LOCUS_21030 5398 6189 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 protein_id gnl|my_center|LOCUS_21030 6265 7197 gene locus_tag LOCUS_21040 6265 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 7243 7788 gene locus_tag LOCUS_21050 7243 7788 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028183.1 protein_id gnl|my_center|LOCUS_21050 7854 9155 gene locus_tag LOCUS_21060 7854 9155 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_21060 9880 9188 gene locus_tag LOCUS_21070 9880 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 9950 10558 gene locus_tag LOCUS_21080 9950 10558 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014491764.1 protein_id gnl|my_center|LOCUS_21080 10786 11196 gene locus_tag LOCUS_21090 10786 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 11875 11213 gene locus_tag LOCUS_21100 11875 11213 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561944.1 protein_id gnl|my_center|LOCUS_21100 13215 11872 gene locus_tag LOCUS_21110 gene secY 13215 11872 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390418.1 protein_id gnl|my_center|LOCUS_21110 13817 13326 gene locus_tag LOCUS_21120 gene rplO 13817 13326 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563657.1 protein_id gnl|my_center|LOCUS_21120 14035 13841 gene locus_tag LOCUS_21130 gene rpmD 14035 13841 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390420.1 protein_id gnl|my_center|LOCUS_21130 14624 14028 gene locus_tag LOCUS_21140 gene rpsE 14624 14028 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390421.1 protein_id gnl|my_center|LOCUS_21140 14999 14637 gene locus_tag LOCUS_21150 gene rplR 14999 14637 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383041.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence087 2563 128 gene locus_tag LOCUS_21160 2563 128 CDS product DNA translocase FtsK 4TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391452.1 protein_id gnl|my_center|LOCUS_21160 4162 2795 gene locus_tag LOCUS_21170 4162 2795 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978643.1 protein_id gnl|my_center|LOCUS_21170 4411 5607 gene locus_tag LOCUS_21180 4411 5607 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_21180 6796 5777 gene locus_tag LOCUS_21190 gene ilvC 6796 5777 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089237.1 protein_id gnl|my_center|LOCUS_21190 7194 6928 gene locus_tag LOCUS_21200 7194 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 7670 7191 gene locus_tag LOCUS_21210 7670 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 8926 7817 gene locus_tag LOCUS_21220 8926 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 9900 8923 gene locus_tag LOCUS_21230 gene pufM 9900 8923 CDS product photosynthetic reaction center subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390722.1 protein_id gnl|my_center|LOCUS_21230 10785 9952 gene locus_tag LOCUS_21240 gene pufL 10785 9952 CDS product photosynthetic reaction center subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390723.1 protein_id gnl|my_center|LOCUS_21240 11055 10873 gene locus_tag LOCUS_21250 gene pufA 11055 10873 CDS product light-harvesting antenna LH1, alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390724.1 protein_id gnl|my_center|LOCUS_21250 11307 11068 gene locus_tag LOCUS_21260 11307 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 12873 11437 gene locus_tag LOCUS_21270 gene bchZ 12873 11437 CDS product chlorophyllide a reductase subunit Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390726.1 protein_id gnl|my_center|LOCUS_21270 14287 12875 gene locus_tag LOCUS_21280 gene bchY 14287 12875 CDS product chlorophyllide a reductase subunit Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338110.1 protein_id gnl|my_center|LOCUS_21280 <15110 14291 gene locus_tag LOCUS_21290 <15110 14291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720427.1:chlorophyllide a reductase iron protein subunit X >Feature sequence088 802 26 gene locus_tag LOCUS_21300 802 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1390 851 gene locus_tag LOCUS_21310 1390 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 3340 2690 gene locus_tag LOCUS_21320 3340 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 4669 3446 gene locus_tag LOCUS_21330 4669 3446 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_21330 3803 3713 gene locus_tag LOCUS_t00360 3803 3713 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4902 4669 gene locus_tag LOCUS_21340 4902 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 6257 4899 gene locus_tag LOCUS_21350 6257 4899 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_21350 8997 6232 gene locus_tag LOCUS_21360 8997 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 10385 8994 gene locus_tag LOCUS_21370 gene prsR 10385 8994 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_21370 12551 10434 gene locus_tag LOCUS_21380 gene prsK 12551 10434 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_21380 13953 12589 gene locus_tag LOCUS_21390 13953 12589 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence089 2093 714 gene locus_tag LOCUS_21400 2093 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2375 4699 gene locus_tag LOCUS_21410 gene bamA 2375 4699 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440405.1 protein_id gnl|my_center|LOCUS_21410 4703 5542 gene locus_tag LOCUS_21420 4703 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 5588 6622 gene locus_tag LOCUS_21430 gene lpxD 5588 6622 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393447.1 protein_id gnl|my_center|LOCUS_21430 6625 7158 gene locus_tag LOCUS_21440 gene fabZ 6625 7158 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 protein_id gnl|my_center|LOCUS_21440 7155 7961 gene locus_tag LOCUS_21450 gene lpxA 7155 7961 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 protein_id gnl|my_center|LOCUS_21450 7954 8787 gene locus_tag LOCUS_21460 gene lpxI 7954 8787 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389473.1 protein_id gnl|my_center|LOCUS_21460 8806 9198 gene locus_tag LOCUS_21470 gene gloA 8806 9198 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_21470 9895 9260 gene locus_tag LOCUS_21480 9895 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 10870 10259 gene locus_tag LOCUS_21490 10870 10259 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_21490 11376 10867 gene locus_tag LOCUS_21500 11376 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 12328 11387 gene locus_tag LOCUS_21510 12328 11387 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850619.1 protein_id gnl|my_center|LOCUS_21510 13739 12582 gene locus_tag LOCUS_21520 13739 12582 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529310.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence090 2945 1509 gene locus_tag LOCUS_21530 2945 1509 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142683.1 protein_id gnl|my_center|LOCUS_21530 3138 3722 gene locus_tag LOCUS_21540 3138 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21540 3739 4686 gene locus_tag LOCUS_21550 3739 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21550 4670 5215 gene locus_tag LOCUS_21560 4670 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 6783 5194 gene locus_tag LOCUS_21570 6783 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967750.1 protein_id gnl|my_center|LOCUS_21570 8051 6780 gene locus_tag LOCUS_21580 gene serS 8051 6780 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393416.1 protein_id gnl|my_center|LOCUS_21580 8836 8054 gene locus_tag LOCUS_21590 gene tatC 8836 8054 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389524.1 protein_id gnl|my_center|LOCUS_21590 9330 8848 gene locus_tag LOCUS_21600 gene tatB 9330 8848 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389525.1 protein_id gnl|my_center|LOCUS_21600 10181 9483 gene locus_tag LOCUS_21610 10181 9483 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216474.1 protein_id gnl|my_center|LOCUS_21610 10312 12093 gene locus_tag LOCUS_21620 gene atzF 10312 12093 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083864.1 protein_id gnl|my_center|LOCUS_21620 12775 12140 gene locus_tag LOCUS_21630 12775 12140 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269399.1 protein_id gnl|my_center|LOCUS_21630 13556 12780 gene locus_tag LOCUS_21640 13556 12780 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_21640 13888 13553 gene locus_tag LOCUS_21650 13888 13553 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence091 <1 1548 gene locus_tag LOCUS_21660 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973760.1:type VI secretion system baseplate subunit TssF 1562 2599 gene locus_tag LOCUS_21670 gene tssG 1562 2599 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269329.1 protein_id gnl|my_center|LOCUS_21670 2601 4148 gene locus_tag LOCUS_21680 2601 4148 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_21680 4263 4886 gene locus_tag LOCUS_21690 4263 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 5052 5840 gene locus_tag LOCUS_21700 5052 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 6212 5910 gene locus_tag LOCUS_21710 6212 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 6333 6518 gene locus_tag LOCUS_21720 6333 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 7189 6506 gene locus_tag LOCUS_21730 7189 6506 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114100.1 protein_id gnl|my_center|LOCUS_21730 8665 7196 gene locus_tag LOCUS_21740 gene rfaE1 8665 7196 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_21740 8744 9688 gene locus_tag LOCUS_21750 8744 9688 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391023.1 protein_id gnl|my_center|LOCUS_21750 9688 10314 gene locus_tag LOCUS_21760 9688 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 11412 10405 gene locus_tag LOCUS_21770 11412 10405 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_21770 11846 12274 gene locus_tag LOCUS_21780 11846 12274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 12291 12638 gene locus_tag LOCUS_21790 12291 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 12674 13618 gene locus_tag LOCUS_21800 gene gshB 12674 13618 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence092 2022 1873 gene locus_tag LOCUS_21810 2022 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2098 2799 gene locus_tag LOCUS_21820 gene msrA 2098 2799 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528688.1 protein_id gnl|my_center|LOCUS_21820 2869 3732 gene locus_tag LOCUS_21830 2869 3732 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112540.1 protein_id gnl|my_center|LOCUS_21830 3729 4409 gene locus_tag LOCUS_21840 3729 4409 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_21840 4420 5079 gene locus_tag LOCUS_21850 4420 5079 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194517.1 protein_id gnl|my_center|LOCUS_21850 5076 6110 gene locus_tag LOCUS_21860 5076 6110 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895534.1 protein_id gnl|my_center|LOCUS_21860 6120 7289 gene locus_tag LOCUS_21870 6120 7289 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112534.1 protein_id gnl|my_center|LOCUS_21870 8280 7306 gene locus_tag LOCUS_21880 8280 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 9470 8277 gene locus_tag LOCUS_21890 9470 8277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 9493 10242 gene locus_tag LOCUS_21900 9493 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 11668 10187 gene locus_tag LOCUS_21910 11668 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 11886 12869 gene locus_tag LOCUS_21920 gene gmd 11886 12869 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918894.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence093 925 314 gene locus_tag LOCUS_21930 925 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21930 1035 2039 gene locus_tag LOCUS_21940 1035 2039 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_21940 2615 2091 gene locus_tag LOCUS_21950 2615 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3208 2630 gene locus_tag LOCUS_21960 3208 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 3453 3220 gene locus_tag LOCUS_21970 3453 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 4233 3478 gene locus_tag LOCUS_21980 4233 3478 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252120.1 protein_id gnl|my_center|LOCUS_21980 4583 4281 gene locus_tag LOCUS_21990 4583 4281 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382936.1 protein_id gnl|my_center|LOCUS_21990 5062 4676 gene locus_tag LOCUS_22000 5062 4676 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 protein_id gnl|my_center|LOCUS_22000 5986 5087 gene locus_tag LOCUS_22010 5986 5087 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_22010 6117 6650 gene locus_tag LOCUS_22020 6117 6650 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 protein_id gnl|my_center|LOCUS_22020 6657 7352 gene locus_tag LOCUS_22030 6657 7352 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563182.1 protein_id gnl|my_center|LOCUS_22030 7381 8706 gene locus_tag LOCUS_22040 7381 8706 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_22040 9351 8707 gene locus_tag LOCUS_22050 9351 8707 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974351.1 protein_id gnl|my_center|LOCUS_22050 9501 10112 gene locus_tag LOCUS_22060 9501 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 10147 10380 gene locus_tag LOCUS_22070 10147 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 11895 10438 gene locus_tag LOCUS_22080 11895 10438 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_22080 12662 11892 gene locus_tag LOCUS_22090 12662 11892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence094 1667 3082 gene locus_tag LOCUS_22100 1667 3082 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_22100 4224 3322 gene locus_tag LOCUS_22110 4224 3322 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972311.1 protein_id gnl|my_center|LOCUS_22110 7582 4217 gene locus_tag LOCUS_22120 7582 4217 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 protein_id gnl|my_center|LOCUS_22120 9266 7635 gene locus_tag LOCUS_22130 9266 7635 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089646.1 protein_id gnl|my_center|LOCUS_22130 9621 9271 gene locus_tag LOCUS_22140 9621 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 9708 10490 gene locus_tag LOCUS_22150 9708 10490 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186027.1 protein_id gnl|my_center|LOCUS_22150 10507 11952 gene locus_tag LOCUS_22160 10507 11952 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086653.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence095 1767 499 gene locus_tag LOCUS_22170 1767 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2300 2599 gene locus_tag LOCUS_22180 2300 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 3981 2575 gene locus_tag LOCUS_22190 3981 2575 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 protein_id gnl|my_center|LOCUS_22190 4676 3978 gene locus_tag LOCUS_22200 4676 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 5700 4681 gene locus_tag LOCUS_22210 5700 4681 CDS product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206279.1 protein_id gnl|my_center|LOCUS_22210 8478 5722 gene locus_tag LOCUS_22220 8478 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 8726 9601 gene locus_tag LOCUS_22230 8726 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 9604 10179 gene locus_tag LOCUS_22240 9604 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 10335 11186 gene locus_tag LOCUS_22250 10335 11186 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 protein_id gnl|my_center|LOCUS_22250 11709 11362 gene locus_tag LOCUS_22260 11709 11362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22260 11905 11738 gene locus_tag LOCUS_22270 11905 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence096 <1 1417 gene locus_tag LOCUS_22280 <1 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930306.1:glycogen debranching protein GlgX 1417 3189 gene locus_tag LOCUS_22290 gene treZ 1417 3189 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268138.1 protein_id gnl|my_center|LOCUS_22290 3189 5147 gene locus_tag LOCUS_22300 gene malQ 3189 5147 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063846.1 protein_id gnl|my_center|LOCUS_22300 5144 7930 gene locus_tag LOCUS_22310 gene treY 5144 7930 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197691.1 protein_id gnl|my_center|LOCUS_22310 7977 8288 gene locus_tag LOCUS_22320 7977 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 8464 8389 gene locus_tag LOCUS_t00370 8464 8389 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10289 8517 gene locus_tag LOCUS_22330 gene recJ 10289 8517 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_22330 11248 10286 gene locus_tag LOCUS_22340 gene glpX 11248 10286 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022558.1 protein_id gnl|my_center|LOCUS_22340 <12424 11447 gene locus_tag LOCUS_22350 <12424 11447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390163.1:homoserine dehydrogenase >Feature sequence097 862 1851 gene locus_tag LOCUS_22360 862 1851 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551127.1 protein_id gnl|my_center|LOCUS_22360 2433 1969 gene locus_tag LOCUS_22370 2433 1969 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337454.1 protein_id gnl|my_center|LOCUS_22370 2697 2440 gene locus_tag LOCUS_22380 gene grxC 2697 2440 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388496.1 protein_id gnl|my_center|LOCUS_22380 3537 2755 gene locus_tag LOCUS_22390 3537 2755 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099097343.1 protein_id gnl|my_center|LOCUS_22390 3908 3537 gene locus_tag LOCUS_22400 3908 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3807 4349 gene locus_tag LOCUS_22410 3807 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 5000 4371 gene locus_tag LOCUS_22420 gene radC 5000 4371 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385427.1 protein_id gnl|my_center|LOCUS_22420 4965 5198 gene locus_tag LOCUS_22430 4965 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 6007 5207 gene locus_tag LOCUS_22440 gene map 6007 5207 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388491.1 protein_id gnl|my_center|LOCUS_22440 6102 6860 gene locus_tag LOCUS_22450 6102 6860 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808206.1 protein_id gnl|my_center|LOCUS_22450 6921 7697 gene locus_tag LOCUS_22460 6921 7697 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 protein_id gnl|my_center|LOCUS_22460 7707 9482 gene locus_tag LOCUS_22470 7707 9482 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206873.1 protein_id gnl|my_center|LOCUS_22470 9484 10227 gene locus_tag LOCUS_22480 9484 10227 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185690.1 protein_id gnl|my_center|LOCUS_22480 11595 10306 gene locus_tag LOCUS_22490 gene dmeF 11595 10306 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529212.1 protein_id gnl|my_center|LOCUS_22490 11882 11604 gene locus_tag LOCUS_22500 11882 11604 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886866.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence098 227 1051 gene locus_tag LOCUS_22510 gene kdsA 227 1051 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382951.1 protein_id gnl|my_center|LOCUS_22510 3534 1084 gene locus_tag LOCUS_22520 3534 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 3647 5416 gene locus_tag LOCUS_22530 gene mutL 3647 5416 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918581.1 protein_id gnl|my_center|LOCUS_22530 5665 5417 gene locus_tag LOCUS_22540 5665 5417 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240039.1 protein_id gnl|my_center|LOCUS_22540 5749 6342 gene locus_tag LOCUS_22550 5749 6342 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_22550 6445 7416 gene locus_tag LOCUS_22560 gene cobS 6445 7416 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_22560 7421 9295 gene locus_tag LOCUS_22570 gene cobT 7421 9295 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037388602.1 protein_id gnl|my_center|LOCUS_22570 9307 9699 gene locus_tag LOCUS_22580 9307 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22580 9701 11347 gene locus_tag LOCUS_22590 9701 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence099 281 102 gene locus_tag LOCUS_22600 281 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 777 607 gene locus_tag LOCUS_22610 777 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1441 1028 gene locus_tag LOCUS_22620 1441 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2748 1441 gene locus_tag LOCUS_22630 gene ahcY 2748 1441 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_22630 5264 2808 gene locus_tag LOCUS_22640 gene hrpB 5264 2808 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528074.1 protein_id gnl|my_center|LOCUS_22640 5325 7322 gene locus_tag LOCUS_22650 5325 7322 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_22650 7326 7724 gene locus_tag LOCUS_22660 7326 7724 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767545.1 protein_id gnl|my_center|LOCUS_22660 8995 7718 gene locus_tag LOCUS_22670 8995 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 10706 8982 gene locus_tag LOCUS_22680 10706 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 11334 10729 gene locus_tag LOCUS_22690 11334 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence100 550 858 gene locus_tag LOCUS_22700 550 858 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930852.1 protein_id gnl|my_center|LOCUS_22700 1308 859 gene locus_tag LOCUS_22710 1308 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1437 1934 gene locus_tag LOCUS_22720 1437 1934 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086962.1 protein_id gnl|my_center|LOCUS_22720 1931 3028 gene locus_tag LOCUS_22730 1931 3028 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090320.1 protein_id gnl|my_center|LOCUS_22730 3134 4738 gene locus_tag LOCUS_22740 3134 4738 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069405.1 protein_id gnl|my_center|LOCUS_22740 5246 4686 gene locus_tag LOCUS_22750 gene gmk 5246 4686 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388188.1 protein_id gnl|my_center|LOCUS_22750 6150 5263 gene locus_tag LOCUS_22760 6150 5263 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086861.1 protein_id gnl|my_center|LOCUS_22760 7293 6211 gene locus_tag LOCUS_22770 7293 6211 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385525.1 protein_id gnl|my_center|LOCUS_22770 7956 7348 gene locus_tag LOCUS_22780 7956 7348 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390957.1 protein_id gnl|my_center|LOCUS_22780 8544 7957 gene locus_tag LOCUS_22790 8544 7957 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_22790 8703 10103 gene locus_tag LOCUS_22800 8703 10103 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525350.1 protein_id gnl|my_center|LOCUS_22800 10439 11143 gene locus_tag LOCUS_22810 10439 11143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 11549 11370 gene locus_tag LOCUS_22820 11549 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence101 513 160 gene locus_tag LOCUS_22830 513 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 1438 635 gene locus_tag LOCUS_22840 gene thiD 1438 635 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 protein_id gnl|my_center|LOCUS_22840 3549 1435 gene locus_tag LOCUS_22850 3549 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 3802 4527 gene locus_tag LOCUS_22860 3802 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 4679 4437 gene locus_tag LOCUS_22870 4679 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 4852 5712 gene locus_tag LOCUS_22880 4852 5712 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552077.1 protein_id gnl|my_center|LOCUS_22880 5735 6394 gene locus_tag LOCUS_22890 5735 6394 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_22890 6391 6888 gene locus_tag LOCUS_22900 6391 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 6891 7178 gene locus_tag LOCUS_22910 6891 7178 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201313.1 protein_id gnl|my_center|LOCUS_22910 8615 7602 gene locus_tag LOCUS_22920 8615 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 9884 8730 gene locus_tag LOCUS_22930 9884 8730 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388806.1 protein_id gnl|my_center|LOCUS_22930 10381 9881 gene locus_tag LOCUS_22940 gene purE 10381 9881 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921116.1 protein_id gnl|my_center|LOCUS_22940 10581 10378 gene locus_tag LOCUS_22950 10581 10378 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_22950 10747 10926 gene locus_tag LOCUS_22960 10747 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence102 261 482 gene locus_tag LOCUS_22970 261 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 1072 1314 gene locus_tag LOCUS_22980 1072 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 4047 1543 gene locus_tag LOCUS_22990 4047 1543 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210762687.1 protein_id gnl|my_center|LOCUS_22990 4306 4049 gene locus_tag LOCUS_23000 4306 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 5899 4337 gene locus_tag LOCUS_23010 5899 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 7248 5968 gene locus_tag LOCUS_23020 7248 5968 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615166.1 protein_id gnl|my_center|LOCUS_23020 7539 7465 gene locus_tag LOCUS_t00380 7539 7465 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8856 7636 gene locus_tag LOCUS_23030 gene hemA 8856 7636 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084018.1 protein_id gnl|my_center|LOCUS_23030 9972 9046 gene locus_tag LOCUS_23040 gene thyX 9972 9046 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_23040 10887 10315 gene locus_tag LOCUS_23050 10887 10315 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529007.1 protein_id gnl|my_center|LOCUS_23050 10992 11297 gene locus_tag LOCUS_23060 10992 11297 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267914.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence103 2151 700 gene locus_tag LOCUS_23070 2151 700 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003668.1 protein_id gnl|my_center|LOCUS_23070 3290 2211 gene locus_tag LOCUS_23080 gene queG 3290 2211 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_23080 3726 3262 gene locus_tag LOCUS_23090 gene queF 3726 3262 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066516.1 protein_id gnl|my_center|LOCUS_23090 4837 3719 gene locus_tag LOCUS_23100 gene tgt 4837 3719 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388033.1 protein_id gnl|my_center|LOCUS_23100 5871 4834 gene locus_tag LOCUS_23110 gene queA 5871 4834 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388034.1 protein_id gnl|my_center|LOCUS_23110 6266 5871 gene locus_tag LOCUS_23120 6266 5871 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080756.1 protein_id gnl|my_center|LOCUS_23120 7912 6266 gene locus_tag LOCUS_23130 7912 6266 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_23130 8047 8604 gene locus_tag LOCUS_23140 8047 8604 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_23140 8623 9204 gene locus_tag LOCUS_23150 8623 9204 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972362.1 protein_id gnl|my_center|LOCUS_23150 9211 9855 gene locus_tag LOCUS_23160 gene tsaB 9211 9855 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_23160 9855 10289 gene locus_tag LOCUS_23170 9855 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 10566 10270 gene locus_tag LOCUS_23180 10566 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 10648 11061 gene locus_tag LOCUS_23190 10648 11061 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence104 1214 231 gene locus_tag LOCUS_23200 1214 231 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187735.1 protein_id gnl|my_center|LOCUS_23200 1297 1860 gene locus_tag LOCUS_23210 1297 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2028 2741 gene locus_tag LOCUS_23220 2028 2741 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252258.1 protein_id gnl|my_center|LOCUS_23220 2738 3040 gene locus_tag LOCUS_23230 2738 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 3304 3041 gene locus_tag LOCUS_23240 3304 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 3696 3301 gene locus_tag LOCUS_23250 3696 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 3919 3698 gene locus_tag LOCUS_23260 3919 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 4374 3916 gene locus_tag LOCUS_23270 4374 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4523 4371 gene locus_tag LOCUS_23280 4523 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 5006 4653 gene locus_tag LOCUS_23290 5006 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 7111 5030 gene locus_tag LOCUS_23300 7111 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 9331 7172 gene locus_tag LOCUS_23310 9331 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 11096 9510 gene locus_tag LOCUS_23320 11096 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence105 953 1912 gene locus_tag LOCUS_23330 953 1912 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625895.1 protein_id gnl|my_center|LOCUS_23330 2285 1884 gene locus_tag LOCUS_23340 2285 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2374 3246 gene locus_tag LOCUS_23350 2374 3246 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_23350 3246 5261 gene locus_tag LOCUS_23360 gene glyS 3246 5261 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390705.1 protein_id gnl|my_center|LOCUS_23360 5258 7927 gene locus_tag LOCUS_23370 gene ppdK 5258 7927 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_23370 7924 8391 gene locus_tag LOCUS_23380 7924 8391 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 protein_id gnl|my_center|LOCUS_23380 9994 8633 gene locus_tag LOCUS_23390 gene der 9994 8633 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086828.1 protein_id gnl|my_center|LOCUS_23390 <10844 10008 gene locus_tag LOCUS_23400 <10844 10008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014507731.1:outer membrane protein assembly factor BamB >Feature sequence106 8 943 gene locus_tag LOCUS_23410 gene lpxC 8 943 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388698.1 protein_id gnl|my_center|LOCUS_23410 3024 1243 gene locus_tag LOCUS_23420 gene aspS 3024 1243 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_23420 3109 4305 gene locus_tag LOCUS_23430 gene rnd 3109 4305 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_23430 4312 5310 gene locus_tag LOCUS_23440 4312 5310 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173775.1 protein_id gnl|my_center|LOCUS_23440 5994 5314 gene locus_tag LOCUS_23450 5994 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 6734 5991 gene locus_tag LOCUS_23460 6734 5991 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_23460 7362 6736 gene locus_tag LOCUS_23470 7362 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 7411 7809 gene locus_tag LOCUS_23480 7411 7809 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370306.1 protein_id gnl|my_center|LOCUS_23480 7862 9010 gene locus_tag LOCUS_23490 gene zapE 7862 9010 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972456.1 protein_id gnl|my_center|LOCUS_23490 9552 9046 gene locus_tag LOCUS_23500 9552 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 10556 9720 gene locus_tag LOCUS_23510 10556 9720 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence107 387 2609 gene locus_tag LOCUS_23520 gene parC 387 2609 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_23520 2646 4673 gene locus_tag LOCUS_23530 2646 4673 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222257.1 protein_id gnl|my_center|LOCUS_23530 4670 5188 gene locus_tag LOCUS_23540 4670 5188 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383720.1 protein_id gnl|my_center|LOCUS_23540 5194 5937 gene locus_tag LOCUS_23550 5194 5937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173716.1 protein_id gnl|my_center|LOCUS_23550 5934 7358 gene locus_tag LOCUS_23560 5934 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143411.1 protein_id gnl|my_center|LOCUS_23560 7471 10269 gene locus_tag LOCUS_23570 7471 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence108 661 149 gene locus_tag LOCUS_23580 661 149 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_23580 774 1499 gene locus_tag LOCUS_23590 774 1499 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_23590 1505 2170 gene locus_tag LOCUS_23600 1505 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2167 3693 gene locus_tag LOCUS_23610 2167 3693 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 protein_id gnl|my_center|LOCUS_23610 3690 4451 gene locus_tag LOCUS_23620 3690 4451 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_23620 7596 4564 gene locus_tag LOCUS_23630 7596 4564 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224450.1 protein_id gnl|my_center|LOCUS_23630 8695 7607 gene locus_tag LOCUS_23640 8695 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 9915 8773 gene locus_tag LOCUS_23650 9915 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence109 808 263 gene locus_tag LOCUS_23660 gene def 808 263 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388799.1 protein_id gnl|my_center|LOCUS_23660 970 1173 gene locus_tag LOCUS_23670 gene rpsU 970 1173 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388798.1 protein_id gnl|my_center|LOCUS_23670 2495 1242 gene locus_tag LOCUS_23680 2495 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 3635 2547 gene locus_tag LOCUS_23690 gene aroC 3635 2547 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_23690 4522 3641 gene locus_tag LOCUS_23700 gene fabI 4522 3641 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383908.1 protein_id gnl|my_center|LOCUS_23700 4595 5182 gene locus_tag LOCUS_23710 gene pdxH 4595 5182 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918802.1 protein_id gnl|my_center|LOCUS_23710 5224 6102 gene locus_tag LOCUS_23720 5224 6102 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_23720 6102 6548 gene locus_tag LOCUS_23730 6102 6548 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_23730 6608 6736 gene locus_tag LOCUS_23740 6608 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23740 6791 7327 gene locus_tag LOCUS_23750 6791 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23750 7516 9087 gene locus_tag LOCUS_23760 7516 9087 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528279.1 protein_id gnl|my_center|LOCUS_23760 9581 9255 gene locus_tag LOCUS_23770 9581 9255 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087569.1 protein_id gnl|my_center|LOCUS_23770 10176 9994 gene locus_tag LOCUS_23780 10176 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence110 1521 346 gene locus_tag LOCUS_23790 1521 346 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_23790 2201 1512 gene locus_tag LOCUS_23800 2201 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2929 2198 gene locus_tag LOCUS_23810 2929 2198 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389465.1 protein_id gnl|my_center|LOCUS_23810 3500 2934 gene locus_tag LOCUS_23820 gene frr 3500 2934 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389464.1 protein_id gnl|my_center|LOCUS_23820 4269 3511 gene locus_tag LOCUS_23830 gene pyrH 4269 3511 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389463.1 protein_id gnl|my_center|LOCUS_23830 5440 4535 gene locus_tag LOCUS_23840 gene tsf 5440 4535 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_23840 6222 5455 gene locus_tag LOCUS_23850 gene rpsB 6222 5455 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389461.1 protein_id gnl|my_center|LOCUS_23850 6446 6862 gene locus_tag LOCUS_23860 6446 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 6859 7689 gene locus_tag LOCUS_23870 6859 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 7686 8612 gene locus_tag LOCUS_23880 7686 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 8708 9145 gene locus_tag LOCUS_23890 8708 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 9153 9389 gene locus_tag LOCUS_23900 9153 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 9365 9616 gene locus_tag LOCUS_23910 9365 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence111 2115 886 gene locus_tag LOCUS_23920 gene soxC 2115 886 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_23920 2849 2247 gene locus_tag LOCUS_23930 2849 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 3077 3892 gene locus_tag LOCUS_23940 3077 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3903 4922 gene locus_tag LOCUS_23950 3903 4922 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978086.1 protein_id gnl|my_center|LOCUS_23950 5623 5009 gene locus_tag LOCUS_23960 5623 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 6533 5919 gene locus_tag LOCUS_23970 6533 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 7027 6563 gene locus_tag LOCUS_23980 7027 6563 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 protein_id gnl|my_center|LOCUS_23980 7458 7024 gene locus_tag LOCUS_23990 7458 7024 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_23990 7971 7477 gene locus_tag LOCUS_24000 7971 7477 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969210.1 protein_id gnl|my_center|LOCUS_24000 9740 8019 gene locus_tag LOCUS_24010 9740 8019 CDS product bifunctional protein tyrosine phosphatase family protein/NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence112 834 1115 gene locus_tag LOCUS_24020 834 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 1180 1512 gene locus_tag LOCUS_24030 1180 1512 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387838.1 protein_id gnl|my_center|LOCUS_24030 2047 1685 gene locus_tag LOCUS_24040 2047 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2082 2789 gene locus_tag LOCUS_24050 2082 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 4755 2860 gene locus_tag LOCUS_24060 4755 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 5530 5087 gene locus_tag LOCUS_24070 5530 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 6318 5527 gene locus_tag LOCUS_24080 6318 5527 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222083.1 protein_id gnl|my_center|LOCUS_24080 7695 6457 gene locus_tag LOCUS_24090 7695 6457 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 protein_id gnl|my_center|LOCUS_24090 8385 7831 gene locus_tag LOCUS_24100 gene rplI 8385 7831 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532521.1 protein_id gnl|my_center|LOCUS_24100 8671 8396 gene locus_tag LOCUS_24110 gene rpsR 8671 8396 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615089.1 protein_id gnl|my_center|LOCUS_24110 9144 8674 gene locus_tag LOCUS_24120 gene rpsF 9144 8674 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388173.1 protein_id gnl|my_center|LOCUS_24120 9620 9318 gene locus_tag LOCUS_24130 9620 9318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence113 2398 1262 gene locus_tag LOCUS_24140 2398 1262 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626518.1 protein_id gnl|my_center|LOCUS_24140 3498 2380 gene locus_tag LOCUS_24150 3498 2380 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216554.1 protein_id gnl|my_center|LOCUS_24150 4153 3500 gene locus_tag LOCUS_24160 4153 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 5411 4563 gene locus_tag LOCUS_24170 5411 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 6760 5789 gene locus_tag LOCUS_24180 6760 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 6827 7906 gene locus_tag LOCUS_24190 6827 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 8305 8937 gene locus_tag LOCUS_24200 8305 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence114 933 1277 gene locus_tag LOCUS_24210 933 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 1877 1377 gene locus_tag LOCUS_24220 1877 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 3460 2141 gene locus_tag LOCUS_24230 gene hslU 3460 2141 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083473.1 protein_id gnl|my_center|LOCUS_24230 4131 3457 gene locus_tag LOCUS_24240 gene hslV 4131 3457 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528351.1 protein_id gnl|my_center|LOCUS_24240 4166 5566 gene locus_tag LOCUS_24250 4166 5566 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201008.1 protein_id gnl|my_center|LOCUS_24250 6065 5556 gene locus_tag LOCUS_24260 6065 5556 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920136.1 protein_id gnl|my_center|LOCUS_24260 7585 6074 gene locus_tag LOCUS_24270 7585 6074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390917.1 protein_id gnl|my_center|LOCUS_24270 8610 7582 gene locus_tag LOCUS_24280 8610 7582 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_24280 9272 8607 gene locus_tag LOCUS_24290 gene nth 9272 8607 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036717.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence115 1089 151 gene locus_tag LOCUS_24300 gene egtD 1089 151 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967207.1 protein_id gnl|my_center|LOCUS_24300 2178 1102 gene locus_tag LOCUS_24310 gene egtB 2178 1102 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967201.1 protein_id gnl|my_center|LOCUS_24310 2442 3227 gene locus_tag LOCUS_24320 2442 3227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705574.1 protein_id gnl|my_center|LOCUS_24320 3397 5484 gene locus_tag LOCUS_24330 3397 5484 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918820.1 protein_id gnl|my_center|LOCUS_24330 6194 5490 gene locus_tag LOCUS_24340 6194 5490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193161.1 protein_id gnl|my_center|LOCUS_24340 6967 6191 gene locus_tag LOCUS_24350 gene hisQ 6967 6191 CDS product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527442.1 protein_id gnl|my_center|LOCUS_24350 7819 7022 gene locus_tag LOCUS_24360 7819 7022 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197330.1 protein_id gnl|my_center|LOCUS_24360 <9262 8013 gene locus_tag LOCUS_24370 <9262 8013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011378679.1:voltage-gated potassium channel protein >Feature sequence116 1055 426 gene locus_tag LOCUS_24380 1055 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1943 1116 gene locus_tag LOCUS_24390 1943 1116 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_24390 2720 2154 gene locus_tag LOCUS_24400 gene efp 2720 2154 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388832.1 protein_id gnl|my_center|LOCUS_24400 3725 2727 gene locus_tag LOCUS_24410 3725 2727 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918602.1 protein_id gnl|my_center|LOCUS_24410 3767 4747 gene locus_tag LOCUS_24420 gene epmA 3767 4747 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918606.1 protein_id gnl|my_center|LOCUS_24420 4824 5201 gene locus_tag LOCUS_24430 4824 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 5353 5922 gene locus_tag LOCUS_24440 5353 5922 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816758.1 protein_id gnl|my_center|LOCUS_24440 6541 5888 gene locus_tag LOCUS_24450 gene thiE 6541 5888 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 protein_id gnl|my_center|LOCUS_24450 7464 6544 gene locus_tag LOCUS_24460 7464 6544 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_24460 7894 7496 gene locus_tag LOCUS_24470 7894 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 7959 8189 gene locus_tag LOCUS_24480 7959 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 8212 8544 gene locus_tag LOCUS_24490 8212 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence117 <1 600 gene locus_tag LOCUS_24500 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005094688.1:sulfotransferase 1677 721 gene locus_tag LOCUS_24510 1677 721 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_24510 2663 1707 gene locus_tag LOCUS_24520 gene mbfA 2663 1707 CDS product iron exporter MbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090619.1 protein_id gnl|my_center|LOCUS_24520 2826 4673 gene locus_tag LOCUS_24530 2826 4673 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141384.1 protein_id gnl|my_center|LOCUS_24530 4670 6043 gene locus_tag LOCUS_24540 4670 6043 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_24540 6292 6603 gene locus_tag LOCUS_24550 6292 6603 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106968.1 protein_id gnl|my_center|LOCUS_24550 6600 6896 gene locus_tag LOCUS_24560 6600 6896 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556002.1 protein_id gnl|my_center|LOCUS_24560 7566 7027 gene locus_tag LOCUS_24570 7566 7027 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136728.1 protein_id gnl|my_center|LOCUS_24570 8843 7563 gene locus_tag LOCUS_24580 8843 7563 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_24580 9032 8847 gene locus_tag LOCUS_24590 9032 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence118 65 1099 gene locus_tag LOCUS_24600 65 1099 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085973.1 protein_id gnl|my_center|LOCUS_24600 2376 1369 gene locus_tag LOCUS_24610 2376 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2320 2646 gene locus_tag LOCUS_24620 2320 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 3380 3036 gene locus_tag LOCUS_24630 3380 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 4846 3830 gene locus_tag LOCUS_24640 4846 3830 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440682.1 protein_id gnl|my_center|LOCUS_24640 5543 5136 gene locus_tag LOCUS_24650 5543 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 6130 5765 gene locus_tag LOCUS_24660 6130 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 7311 6136 gene locus_tag LOCUS_24670 7311 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084732.1 protein_id gnl|my_center|LOCUS_24670 7726 8091 gene locus_tag LOCUS_24680 7726 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence119 4222 1121 gene locus_tag LOCUS_24690 4222 1121 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087229.1 protein_id gnl|my_center|LOCUS_24690 5343 4219 gene locus_tag LOCUS_24700 5343 4219 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087228.1 protein_id gnl|my_center|LOCUS_24700 6708 5350 gene locus_tag LOCUS_24710 6708 5350 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494095.1 protein_id gnl|my_center|LOCUS_24710 7035 7811 gene locus_tag LOCUS_24720 7035 7811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086813.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence120 321 1388 gene locus_tag LOCUS_24730 gene recA 321 1388 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_24730 1495 1929 gene locus_tag LOCUS_24740 1495 1929 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971196.1 protein_id gnl|my_center|LOCUS_24740 2346 2011 gene locus_tag LOCUS_24750 2346 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2914 2348 gene locus_tag LOCUS_24760 2914 2348 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228982.1 protein_id gnl|my_center|LOCUS_24760 3426 2974 gene locus_tag LOCUS_24770 3426 2974 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228499.1 protein_id gnl|my_center|LOCUS_24770 3652 6291 gene locus_tag LOCUS_24780 gene alaS 3652 6291 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390445.1 protein_id gnl|my_center|LOCUS_24780 8135 6429 gene locus_tag LOCUS_24790 8135 6429 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391140.1 protein_id gnl|my_center|LOCUS_24790 >Feature sequence121 1258 128 gene locus_tag LOCUS_24800 gene odc2 1258 128 CDS product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970259.1 protein_id gnl|my_center|LOCUS_24800 2095 1499 gene locus_tag LOCUS_24810 2095 1499 CDS product phosphatidylethanolamine N-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509340.1 protein_id gnl|my_center|LOCUS_24810 2221 2940 gene locus_tag LOCUS_24820 2221 2940 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958593.1 protein_id gnl|my_center|LOCUS_24820 2937 4343 gene locus_tag LOCUS_24830 2937 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4378 4890 gene locus_tag LOCUS_24840 4378 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4919 6898 gene locus_tag LOCUS_24850 gene parE 4919 6898 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390520.1 protein_id gnl|my_center|LOCUS_24850 <8196 7067 gene locus_tag LOCUS_24860 <8196 7067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087593.1:molybdopterin molybdotransferase MoeA >Feature sequence122 791 345 gene locus_tag LOCUS_24870 791 345 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388845.1 protein_id gnl|my_center|LOCUS_24870 1810 788 gene locus_tag LOCUS_24880 gene ruvB 1810 788 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388844.1 protein_id gnl|my_center|LOCUS_24880 2409 1807 gene locus_tag LOCUS_24890 gene ruvA 2409 1807 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084352.1 protein_id gnl|my_center|LOCUS_24890 2897 2406 gene locus_tag LOCUS_24900 gene ruvC 2897 2406 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388842.1 protein_id gnl|my_center|LOCUS_24900 3616 2897 gene locus_tag LOCUS_24910 3616 2897 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084350.1 protein_id gnl|my_center|LOCUS_24910 3748 4155 gene locus_tag LOCUS_24920 gene msrB 3748 4155 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529102.1 protein_id gnl|my_center|LOCUS_24920 4254 4604 gene locus_tag LOCUS_24930 4254 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 5622 4660 gene locus_tag LOCUS_24940 gene msrP 5622 4660 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_24940 5897 6709 gene locus_tag LOCUS_24950 gene mazG 5897 6709 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_24950 6874 7074 gene locus_tag LOCUS_24960 6874 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 7219 7419 gene locus_tag LOCUS_24970 7219 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence123 1416 205 gene locus_tag LOCUS_24980 1416 205 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 protein_id gnl|my_center|LOCUS_24980 2247 1426 gene locus_tag LOCUS_24990 2247 1426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 protein_id gnl|my_center|LOCUS_24990 3077 2244 gene locus_tag LOCUS_25000 3077 2244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089193.1 protein_id gnl|my_center|LOCUS_25000 3534 3085 gene locus_tag LOCUS_25010 gene cynS 3534 3085 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088475.1 protein_id gnl|my_center|LOCUS_25010 4489 3602 gene locus_tag LOCUS_25020 4489 3602 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088480.1 protein_id gnl|my_center|LOCUS_25020 4831 4517 gene locus_tag LOCUS_25030 4831 4517 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_25030 5970 4834 gene locus_tag LOCUS_25040 5970 4834 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921632.1 protein_id gnl|my_center|LOCUS_25040 6521 5973 gene locus_tag LOCUS_25050 6521 5973 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088482.1 protein_id gnl|my_center|LOCUS_25050 6770 7369 gene locus_tag LOCUS_25060 6770 7369 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence124 2648 99 gene locus_tag LOCUS_25070 gene glgP 2648 99 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939622.1 protein_id gnl|my_center|LOCUS_25070 3342 2704 gene locus_tag LOCUS_25080 3342 2704 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 protein_id gnl|my_center|LOCUS_25080 3796 3359 gene locus_tag LOCUS_25090 3796 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 6170 3804 gene locus_tag LOCUS_25100 6170 3804 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120163.1 protein_id gnl|my_center|LOCUS_25100 7383 6121 gene locus_tag LOCUS_25110 7383 6121 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927045.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence125 568 789 gene locus_tag LOCUS_25120 568 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2312 1158 gene locus_tag LOCUS_25130 gene pimD 2312 1158 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_25130 3527 2316 gene locus_tag LOCUS_25140 gene pimC 3527 2316 CDS product pimeloyl-CoA dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090542.1 protein_id gnl|my_center|LOCUS_25140 4832 3651 gene locus_tag LOCUS_25150 4832 3651 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033454214.1 protein_id gnl|my_center|LOCUS_25150 6519 4825 gene locus_tag LOCUS_25160 gene pimA 6519 4825 CDS product dicarboxylate--CoA ligase PimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090544.1 protein_id gnl|my_center|LOCUS_25160 <7495 6516 gene locus_tag LOCUS_25170 <7495 6516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090545.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein >Feature sequence126 1269 1682 gene locus_tag LOCUS_25180 1269 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1757 2704 gene locus_tag LOCUS_25190 1757 2704 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 protein_id gnl|my_center|LOCUS_25190 4251 2722 gene locus_tag LOCUS_25200 gene hutH 4251 2722 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527399.1 protein_id gnl|my_center|LOCUS_25200 5933 4248 gene locus_tag LOCUS_25210 5933 4248 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088981.1 protein_id gnl|my_center|LOCUS_25210 6724 6002 gene locus_tag LOCUS_25220 gene hutC 6724 6002 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389049.1 protein_id gnl|my_center|LOCUS_25220 <7486 6721 gene locus_tag LOCUS_25230 <7486 6721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114456.1:imidazolonepropionase >Feature sequence127 1676 801 gene locus_tag LOCUS_25240 1676 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2242 1673 gene locus_tag LOCUS_25250 2242 1673 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640472.1 protein_id gnl|my_center|LOCUS_25250 2457 2239 gene locus_tag LOCUS_25260 gene infA 2457 2239 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617696.1 protein_id gnl|my_center|LOCUS_25260 3816 2515 gene locus_tag LOCUS_25270 gene hisD 3816 2515 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390581.1 protein_id gnl|my_center|LOCUS_25270 4502 3813 gene locus_tag LOCUS_25280 gene hisG 4502 3813 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390582.1 protein_id gnl|my_center|LOCUS_25280 4822 4646 gene locus_tag LOCUS_25290 4822 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 6334 5003 gene locus_tag LOCUS_25300 6334 5003 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390686.1 protein_id gnl|my_center|LOCUS_25300 6467 7252 gene locus_tag LOCUS_25310 6467 7252 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence128 468 914 gene locus_tag LOCUS_25320 gene rpiB 468 914 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015889.1 protein_id gnl|my_center|LOCUS_25320 911 2209 gene locus_tag LOCUS_25330 911 2209 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389580.1 protein_id gnl|my_center|LOCUS_25330 2219 2674 gene locus_tag LOCUS_25340 gene nrdR 2219 2674 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389579.1 protein_id gnl|my_center|LOCUS_25340 2680 3774 gene locus_tag LOCUS_25350 gene ribD 2680 3774 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_25350 3774 4391 gene locus_tag LOCUS_25360 3774 4391 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_25360 4388 5503 gene locus_tag LOCUS_25370 gene ribB 4388 5503 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_25370 5500 5982 gene locus_tag LOCUS_25380 5500 5982 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720942.1 protein_id gnl|my_center|LOCUS_25380 5979 6464 gene locus_tag LOCUS_25390 gene nusB 5979 6464 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707539.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence129 1667 411 gene locus_tag LOCUS_25400 1667 411 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390164.1 protein_id gnl|my_center|LOCUS_25400 2303 1704 gene locus_tag LOCUS_25410 2303 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 2435 4246 gene locus_tag LOCUS_25420 gene phaC 2435 4246 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_25420 4937 4266 gene locus_tag LOCUS_25430 4937 4266 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388419.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence130 1307 621 gene locus_tag LOCUS_25440 1307 621 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919525.1 protein_id gnl|my_center|LOCUS_25440 1437 1799 gene locus_tag LOCUS_25450 1437 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3005 1809 gene locus_tag LOCUS_25460 3005 1809 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_25460 5026 3002 gene locus_tag LOCUS_25470 gene ligA 5026 3002 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388694.1 protein_id gnl|my_center|LOCUS_25470 6717 5023 gene locus_tag LOCUS_25480 gene recN 6717 5023 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388695.1 protein_id gnl|my_center|LOCUS_25480 7074 6727 gene locus_tag LOCUS_25490 7074 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence131 460 1959 gene locus_tag LOCUS_25500 460 1959 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086731.1 protein_id gnl|my_center|LOCUS_25500 1966 3111 gene locus_tag LOCUS_25510 1966 3111 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086732.1 protein_id gnl|my_center|LOCUS_25510 3124 4005 gene locus_tag LOCUS_25520 gene mmsB 3124 4005 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531206.1 protein_id gnl|my_center|LOCUS_25520 4913 4170 gene locus_tag LOCUS_25530 gene cobB 4913 4170 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391392.1 protein_id gnl|my_center|LOCUS_25530 5675 4920 gene locus_tag LOCUS_25540 5675 4920 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721008.1 protein_id gnl|my_center|LOCUS_25540 6574 5672 gene locus_tag LOCUS_25550 6574 5672 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387968.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence132 1594 230 gene locus_tag LOCUS_25560 1594 230 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845126.1 protein_id gnl|my_center|LOCUS_25560 3097 1718 gene locus_tag LOCUS_25570 3097 1718 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_25570 6071 3075 gene locus_tag LOCUS_25580 6071 3075 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391446.1 protein_id gnl|my_center|LOCUS_25580 <7027 6094 gene locus_tag LOCUS_25590 <7027 6094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028172437.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence133 157 825 gene locus_tag LOCUS_25600 157 825 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 protein_id gnl|my_center|LOCUS_25600 2263 794 gene locus_tag LOCUS_25610 2263 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 2192 2386 gene locus_tag LOCUS_25620 2192 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 3246 2476 gene locus_tag LOCUS_25630 3246 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 4267 3329 gene locus_tag LOCUS_25640 4267 3329 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_25640 5156 4269 gene locus_tag LOCUS_25650 5156 4269 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040238.1 protein_id gnl|my_center|LOCUS_25650 6466 5231 gene locus_tag LOCUS_25660 6466 5231 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086451.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence134 1609 83 gene locus_tag LOCUS_25670 1609 83 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_25670 1796 2458 gene locus_tag LOCUS_25680 1796 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2474 2548 gene locus_tag LOCUS_t00390 2474 2548 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4447 2555 gene locus_tag LOCUS_25690 4447 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 5494 4514 gene locus_tag LOCUS_25700 5494 4514 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_25700 6645 5542 gene locus_tag LOCUS_25710 6645 5542 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918900.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence135 395 925 gene locus_tag LOCUS_25720 395 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 1436 966 gene locus_tag LOCUS_25730 1436 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2442 1447 gene locus_tag LOCUS_25740 2442 1447 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_25740 2597 4174 gene locus_tag LOCUS_25750 2597 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 4474 5322 gene locus_tag LOCUS_25760 4474 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25760 5507 6649 gene locus_tag LOCUS_25770 5507 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence136 249 758 gene locus_tag LOCUS_25780 249 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 782 967 gene locus_tag LOCUS_25790 782 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 964 1266 gene locus_tag LOCUS_25800 964 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1503 1273 gene locus_tag LOCUS_25810 1503 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1829 1500 gene locus_tag LOCUS_25820 1829 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2098 1826 gene locus_tag LOCUS_25830 2098 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2373 2095 gene locus_tag LOCUS_25840 2373 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2832 2377 gene locus_tag LOCUS_25850 2832 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2911 3186 gene locus_tag LOCUS_25860 2911 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 3186 3350 gene locus_tag LOCUS_25870 3186 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 3391 3786 gene locus_tag LOCUS_25880 3391 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 3925 4245 gene locus_tag LOCUS_25890 3925 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 4337 4531 gene locus_tag LOCUS_25900 4337 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 4604 5521 gene locus_tag LOCUS_25910 4604 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 5920 5528 gene locus_tag LOCUS_25920 5920 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 6015 6209 gene locus_tag LOCUS_25930 6015 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence137 551 2260 gene locus_tag LOCUS_25940 gene kdpA 551 2260 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970238.1 protein_id gnl|my_center|LOCUS_25940 2271 4304 gene locus_tag LOCUS_25950 gene kdpB 2271 4304 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970239.1 protein_id gnl|my_center|LOCUS_25950 4318 4914 gene locus_tag LOCUS_25960 4318 4914 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089516.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence138 903 286 gene locus_tag LOCUS_25970 903 286 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931185.1 protein_id gnl|my_center|LOCUS_25970 1278 934 gene locus_tag LOCUS_25980 1278 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 1970 1275 gene locus_tag LOCUS_25990 1970 1275 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_25990 2198 1998 gene locus_tag LOCUS_26000 2198 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 3609 2308 gene locus_tag LOCUS_26010 3609 2308 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_26010 3782 4798 gene locus_tag LOCUS_26020 3782 4798 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014745580.1 protein_id gnl|my_center|LOCUS_26020 4795 6411 gene locus_tag LOCUS_26030 4795 6411 CDS product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921437.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence139 1943 297 gene locus_tag LOCUS_26040 1943 297 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113337.1 protein_id gnl|my_center|LOCUS_26040 5403 2014 gene locus_tag LOCUS_26050 5403 2014 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_26050 <6641 5689 gene locus_tag LOCUS_26060 <6641 5689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391485.1:site-specific tyrosine recombinase XerD >Feature sequence140 <1 1731 gene locus_tag LOCUS_26070 <1 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383170.1:Hint domain-containing protein 3868 1799 gene locus_tag LOCUS_26080 3868 1799 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_26080 3969 5360 gene locus_tag LOCUS_26090 gene gltX 3969 5360 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389476.1 protein_id gnl|my_center|LOCUS_26090 6291 5518 gene locus_tag LOCUS_26100 6291 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence141 489 13 gene locus_tag LOCUS_26110 489 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 677 1813 gene locus_tag LOCUS_26120 677 1813 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691920.1 protein_id gnl|my_center|LOCUS_26120 2995 1976 gene locus_tag LOCUS_26130 2995 1976 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082895.1 protein_id gnl|my_center|LOCUS_26130 4293 3232 gene locus_tag LOCUS_26140 4293 3232 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084736.1 protein_id gnl|my_center|LOCUS_26140 <6061 4363 gene locus_tag LOCUS_26150 <6061 4363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014490278.1:ParB/RepB/Spo0J family partition protein >Feature sequence142 <1 1116 gene locus_tag LOCUS_26160 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115817.1:glycosyltransferase NdvB 2476 1199 gene locus_tag LOCUS_26170 gene eno 2476 1199 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389638.1 protein_id gnl|my_center|LOCUS_26170 3387 2560 gene locus_tag LOCUS_26180 3387 2560 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 protein_id gnl|my_center|LOCUS_26180 3689 3856 gene locus_tag LOCUS_26190 3689 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 3876 4046 gene locus_tag LOCUS_26200 3876 4046 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532401.1 protein_id gnl|my_center|LOCUS_26200 5431 4199 gene locus_tag LOCUS_26210 5431 4199 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330161.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence143 1073 777 gene locus_tag LOCUS_26220 1073 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 1333 1004 gene locus_tag LOCUS_26230 1333 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2079 1336 gene locus_tag LOCUS_26240 2079 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2540 2109 gene locus_tag LOCUS_26250 2540 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 3019 2537 gene locus_tag LOCUS_26260 3019 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 3582 3019 gene locus_tag LOCUS_26270 3582 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 3743 3579 gene locus_tag LOCUS_26280 3743 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 5276 3801 gene locus_tag LOCUS_26290 5276 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951063.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence144 611 285 gene locus_tag LOCUS_26300 611 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 1355 765 gene locus_tag LOCUS_26310 1355 765 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_26310 1922 1398 gene locus_tag LOCUS_26320 gene ppa 1922 1398 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093248.1 protein_id gnl|my_center|LOCUS_26320 2135 2208 gene locus_tag LOCUS_t00400 2135 2208 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2329 3771 gene locus_tag LOCUS_26330 gene hydA 2329 3771 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102045048.1 protein_id gnl|my_center|LOCUS_26330 4069 5748 gene locus_tag LOCUS_26340 gene ettA 4069 5748 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence145 1238 420 gene locus_tag LOCUS_26350 gene cysQ 1238 420 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_26350 1269 2792 gene locus_tag LOCUS_26360 1269 2792 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388213.1 protein_id gnl|my_center|LOCUS_26360 2822 3895 gene locus_tag LOCUS_26370 2822 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 3892 5247 gene locus_tag LOCUS_26380 3892 5247 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383523.1 protein_id gnl|my_center|LOCUS_26380 <5815 5240 gene locus_tag LOCUS_26390 <5815 5240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256667.1:alpha/beta hydrolase >Feature sequence146 <1 2346 gene locus_tag LOCUS_26400 <1 2346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000558370.1:glycosyltransferase 2382 3437 gene locus_tag LOCUS_26410 gene rfbB 2382 3437 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387761.1 protein_id gnl|my_center|LOCUS_26410 3434 4315 gene locus_tag LOCUS_26420 gene rfbA 3434 4315 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387759.1 protein_id gnl|my_center|LOCUS_26420 4329 4886 gene locus_tag LOCUS_26430 gene rfbC 4329 4886 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063476367.1 protein_id gnl|my_center|LOCUS_26430 4891 5790 gene locus_tag LOCUS_26440 gene rfbD 4891 5790 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035867.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence147 504 2042 gene locus_tag LOCUS_26450 504 2042 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930411.1 protein_id gnl|my_center|LOCUS_26450 2528 3904 gene locus_tag LOCUS_26460 2528 3904 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_26460 3919 5292 gene locus_tag LOCUS_26470 3919 5292 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970715.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence148 1890 133 gene locus_tag LOCUS_26480 gene asnB 1890 133 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_26480 2903 1890 gene locus_tag LOCUS_26490 2903 1890 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_26490 3817 2900 gene locus_tag LOCUS_26500 3817 2900 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_26500 4029 4799 gene locus_tag LOCUS_26510 4029 4799 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence149 <1 696 gene locus_tag LOCUS_26520 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337243.1:UDP-N-acetylmuramate dehydrogenase 693 1601 gene locus_tag LOCUS_26530 693 1601 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388702.1 protein_id gnl|my_center|LOCUS_26530 1622 2467 gene locus_tag LOCUS_26540 1622 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 2481 3785 gene locus_tag LOCUS_26550 gene ftsA 2481 3785 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388700.1 protein_id gnl|my_center|LOCUS_26550 >Feature sequence150 <1 1956 gene locus_tag LOCUS_26560 <1 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389549.1:valine--tRNA ligase 2113 3744 gene locus_tag LOCUS_26570 gene ilvD 2113 3744 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531283.1 protein_id gnl|my_center|LOCUS_26570 4404 4012 gene locus_tag LOCUS_26580 4404 4012 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083496.1 protein_id gnl|my_center|LOCUS_26580 4906 4394 gene locus_tag LOCUS_26590 4906 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence151 <1 1014 gene locus_tag LOCUS_26600 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388017.1:tetratricopeptide repeat protein 1018 1899 gene locus_tag LOCUS_26610 1018 1899 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336977.1 protein_id gnl|my_center|LOCUS_26610 2189 1893 gene locus_tag LOCUS_26620 2189 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26620 <5029 2167 gene locus_tag LOCUS_26630 <5029 2167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528776.1:error-prone DNA polymerase >Feature sequence152 208 378 gene locus_tag LOCUS_26640 208 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 383 517 gene locus_tag LOCUS_26650 383 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 480 659 gene locus_tag LOCUS_26660 480 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 796 1329 gene locus_tag LOCUS_26670 796 1329 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965956.1 protein_id gnl|my_center|LOCUS_26670 1338 2189 gene locus_tag LOCUS_26680 1338 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2189 3628 gene locus_tag LOCUS_26690 2189 3628 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647881.1 protein_id gnl|my_center|LOCUS_26690 3625 3987 gene locus_tag LOCUS_26700 3625 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700