>Feature sequence001 1884 151 gene locus_tag LOCUS_00010 1884 151 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974200.1 protein_id gnl|my_center|LOCUS_00010 2213 3046 gene locus_tag LOCUS_00020 2213 3046 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974197.1 protein_id gnl|my_center|LOCUS_00020 3257 4894 gene locus_tag LOCUS_00030 3257 4894 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967267.1 protein_id gnl|my_center|LOCUS_00030 4891 5745 gene locus_tag LOCUS_00040 4891 5745 CDS product DUF296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087478.1 protein_id gnl|my_center|LOCUS_00040 7491 5860 gene locus_tag LOCUS_00050 7491 5860 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534776.1 protein_id gnl|my_center|LOCUS_00050 7955 7485 gene locus_tag LOCUS_00060 7955 7485 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_00060 8156 8422 gene locus_tag LOCUS_00070 8156 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8419 8814 gene locus_tag LOCUS_00080 8419 8814 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_00080 8825 9706 gene locus_tag LOCUS_00090 8825 9706 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075293048.1 protein_id gnl|my_center|LOCUS_00090 9714 11318 gene locus_tag LOCUS_00100 9714 11318 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_00100 11613 12758 gene locus_tag LOCUS_00110 11613 12758 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921144.1 protein_id gnl|my_center|LOCUS_00110 13015 13515 gene locus_tag LOCUS_00120 gene purE 13015 13515 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077767952.1 protein_id gnl|my_center|LOCUS_00120 13512 13874 gene locus_tag LOCUS_00130 13512 13874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00130 13843 13855 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13871 14653 gene locus_tag LOCUS_00140 13871 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00140 15123 14839 gene locus_tag LOCUS_00150 15123 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15182 15211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15419 15652 gene locus_tag LOCUS_00160 gene rpsU 15419 15652 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089854.1 protein_id gnl|my_center|LOCUS_00160 15885 16730 gene locus_tag LOCUS_00170 15885 16730 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529652.1 protein_id gnl|my_center|LOCUS_00170 17576 16731 gene locus_tag LOCUS_00180 17576 16731 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089860.1 protein_id gnl|my_center|LOCUS_00180 18097 17618 gene locus_tag LOCUS_00190 18097 17618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18655 18167 gene locus_tag LOCUS_00200 18655 18167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19332 18652 gene locus_tag LOCUS_00210 19332 18652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19776 19339 gene locus_tag LOCUS_00220 19776 19339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20971 19769 gene locus_tag LOCUS_00230 20971 19769 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965507.1 protein_id gnl|my_center|LOCUS_00230 21305 21006 gene locus_tag LOCUS_00240 21305 21006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 21703 21485 gene locus_tag LOCUS_00250 21703 21485 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 protein_id gnl|my_center|LOCUS_00250 21930 22118 gene locus_tag LOCUS_00260 21930 22118 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008131172.1 protein_id gnl|my_center|LOCUS_00260 23909 22281 gene locus_tag LOCUS_00270 23909 22281 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532916.1 protein_id gnl|my_center|LOCUS_00270 24766 24005 gene locus_tag LOCUS_00280 24766 24005 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921315.1 protein_id gnl|my_center|LOCUS_00280 24944 26854 gene locus_tag LOCUS_00290 24944 26854 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084127.1 protein_id gnl|my_center|LOCUS_00290 27761 26877 gene locus_tag LOCUS_00300 27761 26877 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976557.1 protein_id gnl|my_center|LOCUS_00300 28534 27809 gene locus_tag LOCUS_00310 28534 27809 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390453.1 protein_id gnl|my_center|LOCUS_00310 28795 28995 gene locus_tag LOCUS_00320 28795 28995 CDS product DUF1192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084320.1 protein_id gnl|my_center|LOCUS_00320 29234 29695 gene locus_tag LOCUS_00330 29234 29695 CDS product DUF1465 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084322.1 protein_id gnl|my_center|LOCUS_00330 29738 29742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30043 29807 gene locus_tag LOCUS_00340 gene rpmE 30043 29807 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529118.1 protein_id gnl|my_center|LOCUS_00340 30192 31970 gene locus_tag LOCUS_00350 30192 31970 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_00350 32394 31993 gene locus_tag LOCUS_00360 32394 31993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33359 32511 gene locus_tag LOCUS_00370 33359 32511 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971568.1 protein_id gnl|my_center|LOCUS_00370 33717 33388 gene locus_tag LOCUS_00380 33717 33388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 35783 33714 gene locus_tag LOCUS_00390 35783 33714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 34943 34982 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36691 35906 gene locus_tag LOCUS_00400 36691 35906 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529126.1 protein_id gnl|my_center|LOCUS_00400 37760 36837 gene locus_tag LOCUS_00410 37760 36837 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084334.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00410 38413 37757 gene locus_tag LOCUS_00420 38413 37757 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921389.1 protein_id gnl|my_center|LOCUS_00420 39564 38410 gene locus_tag LOCUS_00430 39564 38410 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337231.1 protein_id gnl|my_center|LOCUS_00430 39754 41757 gene locus_tag LOCUS_00440 39754 41757 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528676.1 protein_id gnl|my_center|LOCUS_00440 42974 41898 gene locus_tag LOCUS_00450 gene fba 42974 41898 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084337.1 protein_id gnl|my_center|LOCUS_00450 43322 43065 gene locus_tag LOCUS_00460 43322 43065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 44022 43390 gene locus_tag LOCUS_00470 44022 43390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00470 44973 44527 gene locus_tag LOCUS_00480 44973 44527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 46047 45079 gene locus_tag LOCUS_00490 46047 45079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 46915 46184 gene locus_tag LOCUS_00500 46915 46184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 48143 46797 gene locus_tag LOCUS_00510 48143 46797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 48476 48853 gene locus_tag LOCUS_00520 48476 48853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 48866 49234 gene locus_tag LOCUS_00530 48866 49234 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973287.1 protein_id gnl|my_center|LOCUS_00530 49451 50035 gene locus_tag LOCUS_00540 49451 50035 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388839.1 protein_id gnl|my_center|LOCUS_00540 50327 51151 gene locus_tag LOCUS_00550 50327 51151 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173440.1 protein_id gnl|my_center|LOCUS_00550 52534 51173 gene locus_tag LOCUS_00560 52534 51173 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388932.1 protein_id gnl|my_center|LOCUS_00560 52782 53525 gene locus_tag LOCUS_00570 52782 53525 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970171.1 protein_id gnl|my_center|LOCUS_00570 54407 53628 gene locus_tag LOCUS_00580 54407 53628 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992233.1 protein_id gnl|my_center|LOCUS_00580 54597 55109 gene locus_tag LOCUS_00590 gene ruvC 54597 55109 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004445748.1 protein_id gnl|my_center|LOCUS_00590 55285 55902 gene locus_tag LOCUS_00600 gene ruvA 55285 55902 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084352.1 protein_id gnl|my_center|LOCUS_00600 55899 56294 gene locus_tag LOCUS_00610 55899 56294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00610 56270 56929 gene locus_tag LOCUS_00620 56270 56929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00620 56931 57191 gene locus_tag LOCUS_00630 56931 57191 CDS product HicA-related toxin-antitoxin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265861.1 protein_id gnl|my_center|LOCUS_00630 57188 57412 gene locus_tag LOCUS_00640 57188 57412 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920709.1 protein_id gnl|my_center|LOCUS_00640 57442 57960 gene locus_tag LOCUS_00650 57442 57960 CDS product DUF3828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087484.1 protein_id gnl|my_center|LOCUS_00650 57971 58375 gene locus_tag LOCUS_00660 gene ybgC 57971 58375 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089947.1 protein_id gnl|my_center|LOCUS_00660 58419 59075 gene locus_tag LOCUS_00670 58419 59075 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089896.1 protein_id gnl|my_center|LOCUS_00670 59072 59314 gene locus_tag LOCUS_00680 59072 59314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 59452 59892 gene locus_tag LOCUS_00690 59452 59892 CDS product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173002.1 protein_id gnl|my_center|LOCUS_00690 60217 60708 gene locus_tag LOCUS_00700 60217 60708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 60837 61283 gene locus_tag LOCUS_00710 gene tolR 60837 61283 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527592.1 protein_id gnl|my_center|LOCUS_00710 61312 62514 gene locus_tag LOCUS_00720 61312 62514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 62511 63878 gene locus_tag LOCUS_00730 gene tolB 62511 63878 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173006.1 protein_id gnl|my_center|LOCUS_00730 64105 64608 gene locus_tag LOCUS_00740 gene pal 64105 64608 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089884.1 protein_id gnl|my_center|LOCUS_00740 64692 65666 gene locus_tag LOCUS_00750 gene ybgF 64692 65666 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173009.1 protein_id gnl|my_center|LOCUS_00750 >Feature sequence002 407 198 gene locus_tag LOCUS_00760 407 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 616 404 gene locus_tag LOCUS_00770 616 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 1089 613 gene locus_tag LOCUS_00780 1089 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 1580 1074 gene locus_tag LOCUS_00790 1580 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 2026 1763 gene locus_tag LOCUS_00800 2026 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 2067 2741 gene locus_tag LOCUS_00810 2067 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 2738 3064 gene locus_tag LOCUS_00820 2738 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 3065 3829 gene locus_tag LOCUS_00830 3065 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 3902 4345 gene locus_tag LOCUS_00840 3902 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 4367 4771 gene locus_tag LOCUS_00850 4367 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 4771 5178 gene locus_tag LOCUS_00860 4771 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 5175 5390 gene locus_tag LOCUS_00870 5175 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 5387 6136 gene locus_tag LOCUS_00880 5387 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 6141 6488 gene locus_tag LOCUS_00890 6141 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 6524 7507 gene locus_tag LOCUS_00900 6524 7507 CDS product DUF2303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972629.1 protein_id gnl|my_center|LOCUS_00900 7569 8687 gene locus_tag LOCUS_00910 gene dnaN 7569 8687 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083651.1 protein_id gnl|my_center|LOCUS_00910 8728 8991 gene locus_tag LOCUS_00920 8728 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 8984 9985 gene locus_tag LOCUS_00930 8984 9985 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215829472.1 protein_id gnl|my_center|LOCUS_00930 9978 10211 gene locus_tag LOCUS_00940 9978 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 10214 10702 gene locus_tag LOCUS_00950 10214 10702 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531834.1 protein_id gnl|my_center|LOCUS_00950 10715 10921 gene locus_tag LOCUS_00960 10715 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 11115 12260 gene locus_tag LOCUS_00970 11115 12260 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087764.1 protein_id gnl|my_center|LOCUS_00970 12731 12961 gene locus_tag LOCUS_00980 12731 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 13321 13013 gene locus_tag LOCUS_00990 13321 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 13502 13380 gene locus_tag LOCUS_01000 13502 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 14504 13572 gene locus_tag LOCUS_01010 14504 13572 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339003.1 protein_id gnl|my_center|LOCUS_01010 14704 15129 gene locus_tag LOCUS_01020 14704 15129 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400759.1 protein_id gnl|my_center|LOCUS_01020 15212 16222 gene locus_tag LOCUS_01030 15212 16222 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_01030 16369 16539 gene locus_tag LOCUS_01040 16369 16539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 16866 16552 gene locus_tag LOCUS_01050 gene sugE 16866 16552 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528463.1 protein_id gnl|my_center|LOCUS_01050 17488 16985 gene locus_tag LOCUS_01060 17488 16985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 17799 17485 gene locus_tag LOCUS_01070 17799 17485 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171641.1 protein_id gnl|my_center|LOCUS_01070 18967 17990 gene locus_tag LOCUS_01080 18967 17990 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087781.1 protein_id gnl|my_center|LOCUS_01080 20033 18978 gene locus_tag LOCUS_01090 gene plsX 20033 18978 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975024.1 protein_id gnl|my_center|LOCUS_01090 20697 20149 gene locus_tag LOCUS_01100 20697 20149 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389354.1 protein_id gnl|my_center|LOCUS_01100 21233 20694 gene locus_tag LOCUS_01110 21233 20694 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312818.1 protein_id gnl|my_center|LOCUS_01110 21375 21869 gene locus_tag LOCUS_01120 gene bamE 21375 21869 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171637.1 protein_id gnl|my_center|LOCUS_01120 22516 21947 gene locus_tag LOCUS_01130 22516 21947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01130 22959 22426 gene locus_tag LOCUS_01140 22959 22426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01140 23025 23270 gene locus_tag LOCUS_01150 23025 23270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 23515 23177 gene locus_tag LOCUS_01160 23515 23177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 25777 23621 gene locus_tag LOCUS_01170 25777 23621 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532237.1 protein_id gnl|my_center|LOCUS_01170 25986 26876 gene locus_tag LOCUS_01180 25986 26876 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727392.1 protein_id gnl|my_center|LOCUS_01180 28094 26889 gene locus_tag LOCUS_01190 28094 26889 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383177.1 protein_id gnl|my_center|LOCUS_01190 29045 28134 gene locus_tag LOCUS_01200 gene thiL 29045 28134 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087788.1 protein_id gnl|my_center|LOCUS_01200 29715 29233 gene locus_tag LOCUS_01210 gene nusB 29715 29233 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087789.1 protein_id gnl|my_center|LOCUS_01210 30146 29712 gene locus_tag LOCUS_01220 30146 29712 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312824.1 protein_id gnl|my_center|LOCUS_01220 30230 30239 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30920 30273 gene locus_tag LOCUS_01230 30920 30273 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975015.1 protein_id gnl|my_center|LOCUS_01230 32065 30920 gene locus_tag LOCUS_01240 gene ribD 32065 30920 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087792.1 protein_id gnl|my_center|LOCUS_01240 32555 32058 gene locus_tag LOCUS_01250 gene nrdR 32555 32058 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532250.1 protein_id gnl|my_center|LOCUS_01250 33033 32563 gene locus_tag LOCUS_01260 33033 32563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 33272 33030 gene locus_tag LOCUS_01270 33272 33030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 34649 33348 gene locus_tag LOCUS_01280 34649 33348 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975013.1 protein_id gnl|my_center|LOCUS_01280 34860 36062 gene locus_tag LOCUS_01290 gene nhaA 34860 36062 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064707.1 protein_id gnl|my_center|LOCUS_01290 36131 36361 gene locus_tag LOCUS_01300 36131 36361 CDS product antitoxin MazE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388652.1 protein_id gnl|my_center|LOCUS_01300 36358 36681 gene locus_tag LOCUS_01310 36358 36681 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110754436.1 protein_id gnl|my_center|LOCUS_01310 38565 37246 gene locus_tag LOCUS_01320 38565 37246 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529314.1 protein_id gnl|my_center|LOCUS_01320 39265 38753 gene locus_tag LOCUS_01330 39265 38753 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 protein_id gnl|my_center|LOCUS_01330 39918 39469 gene locus_tag LOCUS_01340 39918 39469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 40978 39923 gene locus_tag LOCUS_01350 40978 39923 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_01350 41151 42176 gene locus_tag LOCUS_01360 gene hemB 41151 42176 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_01360 42339 43673 gene locus_tag LOCUS_01370 42339 43673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 43731 44990 gene locus_tag LOCUS_01380 43731 44990 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087499.1 protein_id gnl|my_center|LOCUS_01380 45048 45521 gene locus_tag LOCUS_01390 45048 45521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 45791 45552 gene locus_tag LOCUS_01400 45791 45552 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_01400 46210 45788 gene locus_tag LOCUS_01410 46210 45788 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928694.1 protein_id gnl|my_center|LOCUS_01410 46348 47094 gene locus_tag LOCUS_01420 46348 47094 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087800.1 protein_id gnl|my_center|LOCUS_01420 47162 48271 gene locus_tag LOCUS_01430 47162 48271 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640543.1 protein_id gnl|my_center|LOCUS_01430 48423 49415 gene locus_tag LOCUS_01440 48423 49415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 49504 50109 gene locus_tag LOCUS_01450 49504 50109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 51735 50302 gene locus_tag LOCUS_01460 51735 50302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 52340 51714 gene locus_tag LOCUS_01470 52340 51714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 52472 53263 gene locus_tag LOCUS_01480 52472 53263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 53913 53170 gene locus_tag LOCUS_01490 gene recO 53913 53170 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532580.1 protein_id gnl|my_center|LOCUS_01490 53917 54198 gene locus_tag LOCUS_01500 53917 54198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 56442 54202 gene locus_tag LOCUS_01510 56442 54202 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087826.1 protein_id gnl|my_center|LOCUS_01510 56998 56606 gene locus_tag LOCUS_01520 gene rpoZ 56998 56606 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008133017.1 protein_id gnl|my_center|LOCUS_01520 58777 57101 gene locus_tag LOCUS_01530 58777 57101 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531038.1 protein_id gnl|my_center|LOCUS_01530 59041 59790 gene locus_tag LOCUS_01540 59041 59790 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087825.1 protein_id gnl|my_center|LOCUS_01540 59800 60204 gene locus_tag LOCUS_01550 gene acpS 59800 60204 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971345.1 protein_id gnl|my_center|LOCUS_01550 60958 60260 gene locus_tag LOCUS_01560 gene aqpZ 60958 60260 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089853.1 protein_id gnl|my_center|LOCUS_01560 61217 61047 gene locus_tag LOCUS_01570 61217 61047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 62059 61211 gene locus_tag LOCUS_01580 62059 61211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01580 62184 63074 gene locus_tag LOCUS_01590 gene lepB 62184 63074 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087823.1 protein_id gnl|my_center|LOCUS_01590 63105 63836 gene locus_tag LOCUS_01600 gene rnc 63105 63836 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087822.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence003 749 3484 gene locus_tag LOCUS_01610 749 3484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027997802.1 protein_id gnl|my_center|LOCUS_01610 3481 3930 gene locus_tag LOCUS_01620 3481 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 3947 5479 gene locus_tag LOCUS_01630 3947 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 5446 5655 gene locus_tag LOCUS_01640 5446 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 6263 5661 gene locus_tag LOCUS_01650 6263 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 6290 6952 gene locus_tag LOCUS_01660 6290 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061532.1 protein_id gnl|my_center|LOCUS_01660 6949 8190 gene locus_tag LOCUS_01670 6949 8190 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269077.1 protein_id gnl|my_center|LOCUS_01670 8187 9368 gene locus_tag LOCUS_01680 8187 9368 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972423.1 protein_id gnl|my_center|LOCUS_01680 9551 10534 gene locus_tag LOCUS_01690 gene cobS 9551 10534 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175820.1 protein_id gnl|my_center|LOCUS_01690 10549 10965 gene locus_tag LOCUS_01700 10549 10965 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704421.1 protein_id gnl|my_center|LOCUS_01700 10962 12863 gene locus_tag LOCUS_01710 gene cobT 10962 12863 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_01710 12895 13896 gene locus_tag LOCUS_01720 12895 13896 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083009.1 protein_id gnl|my_center|LOCUS_01720 14353 14066 gene locus_tag LOCUS_01730 gene rpmB 14353 14066 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082994.1 protein_id gnl|my_center|LOCUS_01730 14631 15452 gene locus_tag LOCUS_01740 14631 15452 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844825.1 protein_id gnl|my_center|LOCUS_01740 15917 15573 gene locus_tag LOCUS_01750 15917 15573 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_01750 17098 15914 gene locus_tag LOCUS_01760 17098 15914 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529745.1 protein_id gnl|my_center|LOCUS_01760 17367 19220 gene locus_tag LOCUS_01770 17367 19220 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314796.1 protein_id gnl|my_center|LOCUS_01770 19246 19488 gene locus_tag LOCUS_01780 19246 19488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 19579 20418 gene locus_tag LOCUS_01790 19579 20418 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088098.1 protein_id gnl|my_center|LOCUS_01790 20415 20741 gene locus_tag LOCUS_01800 20415 20741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 20738 21436 gene locus_tag LOCUS_01810 20738 21436 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529746.1 protein_id gnl|my_center|LOCUS_01810 21474 22220 gene locus_tag LOCUS_01820 21474 22220 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536803.1 protein_id gnl|my_center|LOCUS_01820 22252 23235 gene locus_tag LOCUS_01830 22252 23235 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170962.1 protein_id gnl|my_center|LOCUS_01830 24025 23372 gene locus_tag LOCUS_01840 24025 23372 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310979.1 protein_id gnl|my_center|LOCUS_01840 24444 24178 gene locus_tag LOCUS_01850 gene rpmA 24444 24178 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003492686.1 protein_id gnl|my_center|LOCUS_01850 25237 24545 gene locus_tag LOCUS_01860 25237 24545 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529062.1 protein_id gnl|my_center|LOCUS_01860 25579 25668 gene locus_tag LOCUS_t00010 25579 25668 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 26066 25713 gene locus_tag LOCUS_01870 26066 25713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 26398 26081 gene locus_tag LOCUS_01880 26398 26081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 26797 26414 gene locus_tag LOCUS_01890 26797 26414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 28260 27355 gene locus_tag LOCUS_01900 28260 27355 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528171.1 protein_id gnl|my_center|LOCUS_01900 28704 29384 gene locus_tag LOCUS_01910 28704 29384 CDS product DUF2161 family putative PD-(D/E)XK-type phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086936.1 protein_id gnl|my_center|LOCUS_01910 29762 30841 gene locus_tag LOCUS_01920 29762 30841 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_01920 30846 32297 gene locus_tag LOCUS_01930 30846 32297 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012416341.1 protein_id gnl|my_center|LOCUS_01930 32287 33048 gene locus_tag LOCUS_01940 32287 33048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818996.1 protein_id gnl|my_center|LOCUS_01940 33045 33725 gene locus_tag LOCUS_01950 33045 33725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808030.1 protein_id gnl|my_center|LOCUS_01950 33739 34845 gene locus_tag LOCUS_01960 33739 34845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 35012 35779 gene locus_tag LOCUS_01970 35012 35779 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051633.1 protein_id gnl|my_center|LOCUS_01970 38194 35840 gene locus_tag LOCUS_01980 38194 35840 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_01980 39923 38295 gene locus_tag LOCUS_01990 gene pgi 39923 38295 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252578.1 protein_id gnl|my_center|LOCUS_01990 40800 40045 gene locus_tag LOCUS_02000 40800 40045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 41347 40823 gene locus_tag LOCUS_02010 41347 40823 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083268.1 protein_id gnl|my_center|LOCUS_02010 42567 41344 gene locus_tag LOCUS_02020 42567 41344 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083267.1 protein_id gnl|my_center|LOCUS_02020 44015 42687 gene locus_tag LOCUS_02030 44015 42687 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083266.1 protein_id gnl|my_center|LOCUS_02030 45385 44015 gene locus_tag LOCUS_02040 45385 44015 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083265.1 protein_id gnl|my_center|LOCUS_02040 45861 45382 gene locus_tag LOCUS_02050 gene rlmH 45861 45382 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083264.1 protein_id gnl|my_center|LOCUS_02050 46233 45877 gene locus_tag LOCUS_02060 gene rsfS 46233 45877 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529073.1 protein_id gnl|my_center|LOCUS_02060 46816 46358 gene locus_tag LOCUS_02070 46816 46358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02070 48281 46989 gene locus_tag LOCUS_02080 48281 46989 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083261.1 protein_id gnl|my_center|LOCUS_02080 49523 48294 gene locus_tag LOCUS_02090 gene proB 49523 48294 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083260.1 protein_id gnl|my_center|LOCUS_02090 49706 49915 gene locus_tag LOCUS_02100 49706 49915 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010915421.1 protein_id gnl|my_center|LOCUS_02100 50067 50330 gene locus_tag LOCUS_02110 gene rpsU 50067 50330 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976084.1 protein_id gnl|my_center|LOCUS_02110 50415 50795 gene locus_tag LOCUS_02120 50415 50795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 50999 51316 gene locus_tag LOCUS_02130 50999 51316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 51602 52162 gene locus_tag LOCUS_02140 51602 52162 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965738.1 protein_id gnl|my_center|LOCUS_02140 52262 52939 gene locus_tag LOCUS_02150 52262 52939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085827.1 protein_id gnl|my_center|LOCUS_02150 53015 54469 gene locus_tag LOCUS_02160 53015 54469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 54919 54458 gene locus_tag LOCUS_02170 54919 54458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 55042 56196 gene locus_tag LOCUS_02180 55042 56196 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_02180 56193 56849 gene locus_tag LOCUS_02190 56193 56849 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564970.1 protein_id gnl|my_center|LOCUS_02190 58393 56879 gene locus_tag LOCUS_02200 58393 56879 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918316.1 protein_id gnl|my_center|LOCUS_02200 59177 58548 gene locus_tag LOCUS_02210 59177 58548 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966112.1 protein_id gnl|my_center|LOCUS_02210 59913 59215 gene locus_tag LOCUS_02220 59913 59215 CDS product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090673.1 protein_id gnl|my_center|LOCUS_02220 61049 59910 gene locus_tag LOCUS_02230 61049 59910 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388792.1 protein_id gnl|my_center|LOCUS_02230 61747 61049 gene locus_tag LOCUS_02240 gene phnL 61747 61049 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403602.1 protein_id gnl|my_center|LOCUS_02240 61961 61752 gene locus_tag LOCUS_02250 61961 61752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 62764 61958 gene locus_tag LOCUS_02260 gene phnK 62764 61958 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529518.1 protein_id gnl|my_center|LOCUS_02260 <63448 62764 gene locus_tag LOCUS_02270 <63448 62764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003530631.1:alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ >Feature sequence004 <1 1021 gene locus_tag LOCUS_02280 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265516.1:thioredoxin family protein 1058 1699 gene locus_tag LOCUS_02290 1058 1699 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918109.1 protein_id gnl|my_center|LOCUS_02290 2972 1893 gene locus_tag LOCUS_02300 2972 1893 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397425.1 protein_id gnl|my_center|LOCUS_02300 3828 2980 gene locus_tag LOCUS_02310 gene ugpE 3828 2980 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083556.1 protein_id gnl|my_center|LOCUS_02310 4709 3828 gene locus_tag LOCUS_02320 gene ugpA 4709 3828 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083557.1 protein_id gnl|my_center|LOCUS_02320 6095 4773 gene locus_tag LOCUS_02330 gene ugpB 6095 4773 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083558.1 protein_id gnl|my_center|LOCUS_02330 6300 7478 gene locus_tag LOCUS_02340 6300 7478 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978505.1 protein_id gnl|my_center|LOCUS_02340 7475 8404 gene locus_tag LOCUS_02350 7475 8404 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091889128.1 protein_id gnl|my_center|LOCUS_02350 8416 9378 gene locus_tag LOCUS_02360 8416 9378 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528049.1 protein_id gnl|my_center|LOCUS_02360 10397 9420 gene locus_tag LOCUS_02370 10397 9420 CDS product bifunctional helix-turn-helix domain-containing protein/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083513.1 protein_id gnl|my_center|LOCUS_02370 10602 11000 gene locus_tag LOCUS_02380 10602 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 11550 11008 gene locus_tag LOCUS_02390 11550 11008 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_02390 11571 12272 gene locus_tag LOCUS_02400 gene nth 11571 12272 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965134.1 protein_id gnl|my_center|LOCUS_02400 12469 12188 gene locus_tag LOCUS_02410 12469 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 12378 13427 gene locus_tag LOCUS_02420 gene xylF 12378 13427 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529274.1 protein_id gnl|my_center|LOCUS_02420 13420 14724 gene locus_tag LOCUS_02430 13420 14724 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396013.1 protein_id gnl|my_center|LOCUS_02430 14895 15674 gene locus_tag LOCUS_02440 14895 15674 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061398.1 protein_id gnl|my_center|LOCUS_02440 15790 16056 gene locus_tag LOCUS_02450 15790 16056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 16659 17519 gene locus_tag LOCUS_02460 16659 17519 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090335.1 protein_id gnl|my_center|LOCUS_02460 18457 17513 gene locus_tag LOCUS_02470 18457 17513 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089907.1 protein_id gnl|my_center|LOCUS_02470 19782 18454 gene locus_tag LOCUS_02480 gene deoA 19782 18454 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529628.1 protein_id gnl|my_center|LOCUS_02480 20548 19784 gene locus_tag LOCUS_02490 gene deoC 20548 19784 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309955.1 protein_id gnl|my_center|LOCUS_02490 21360 20548 gene locus_tag LOCUS_02500 21360 20548 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719365.1 protein_id gnl|my_center|LOCUS_02500 21883 21464 gene locus_tag LOCUS_02510 21883 21464 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564559.1 protein_id gnl|my_center|LOCUS_02510 22870 21887 gene locus_tag LOCUS_02520 22870 21887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536145.1 protein_id gnl|my_center|LOCUS_02520 24125 23025 gene locus_tag LOCUS_02530 24125 23025 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968370.1 protein_id gnl|my_center|LOCUS_02530 25875 24328 gene locus_tag LOCUS_02540 25875 24328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 protein_id gnl|my_center|LOCUS_02540 26917 25916 gene locus_tag LOCUS_02550 26917 25916 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309949.1 protein_id gnl|my_center|LOCUS_02550 27098 27877 gene locus_tag LOCUS_02560 gene moeB 27098 27877 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083588.1 protein_id gnl|my_center|LOCUS_02560 28856 27906 gene locus_tag LOCUS_02570 gene gshB 28856 27906 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083495.1 protein_id gnl|my_center|LOCUS_02570 29380 29000 gene locus_tag LOCUS_02580 29380 29000 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328395.1 protein_id gnl|my_center|LOCUS_02580 30303 29377 gene locus_tag LOCUS_02590 gene rsmI 30303 29377 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083497.1 protein_id gnl|my_center|LOCUS_02590 30494 31702 gene locus_tag LOCUS_02600 30494 31702 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000235.1 protein_id gnl|my_center|LOCUS_02600 32041 31712 gene locus_tag LOCUS_02610 32041 31712 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390589.1 protein_id gnl|my_center|LOCUS_02610 32301 32041 gene locus_tag LOCUS_02620 32301 32041 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390588.1 protein_id gnl|my_center|LOCUS_02620 33583 32384 gene locus_tag LOCUS_02630 gene hemW 33583 32384 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172453.1 protein_id gnl|my_center|LOCUS_02630 34227 33580 gene locus_tag LOCUS_02640 gene rdgB 34227 33580 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083500.1 protein_id gnl|my_center|LOCUS_02640 35120 34404 gene locus_tag LOCUS_02650 gene rph 35120 34404 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310174.1 protein_id gnl|my_center|LOCUS_02650 35269 36354 gene locus_tag LOCUS_02660 gene hrcA 35269 36354 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083502.1 protein_id gnl|my_center|LOCUS_02660 36400 36663 gene locus_tag LOCUS_02670 36400 36663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 36660 37052 gene locus_tag LOCUS_02680 36660 37052 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970565.1 protein_id gnl|my_center|LOCUS_02680 37146 37388 gene locus_tag LOCUS_02690 37146 37388 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089470.1 protein_id gnl|my_center|LOCUS_02690 37385 37717 gene locus_tag LOCUS_02700 37385 37717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 38264 37731 gene locus_tag LOCUS_02710 38264 37731 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398796.1 protein_id gnl|my_center|LOCUS_02710 38857 38261 gene locus_tag LOCUS_02720 38857 38261 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199275557.1 protein_id gnl|my_center|LOCUS_02720 39481 39807 gene locus_tag LOCUS_02730 39481 39807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02730 39860 41692 gene locus_tag LOCUS_02740 gene lepA 39860 41692 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970755.1 protein_id gnl|my_center|LOCUS_02740 43458 41845 gene locus_tag LOCUS_02750 43458 41845 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395823.1 protein_id gnl|my_center|LOCUS_02750 43653 44579 gene locus_tag LOCUS_02760 43653 44579 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338820.1 protein_id gnl|my_center|LOCUS_02760 45216 44731 gene locus_tag LOCUS_02770 45216 44731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084161.1 protein_id gnl|my_center|LOCUS_02770 46578 45328 gene locus_tag LOCUS_02780 46578 45328 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222328.1 protein_id gnl|my_center|LOCUS_02780 47438 46722 gene locus_tag LOCUS_02790 47438 46722 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143609.1 protein_id gnl|my_center|LOCUS_02790 47846 47451 gene locus_tag LOCUS_02800 47846 47451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 47991 48158 gene locus_tag LOCUS_02810 47991 48158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 48521 49186 gene locus_tag LOCUS_02820 48521 49186 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705440.1 protein_id gnl|my_center|LOCUS_02820 50549 49230 gene locus_tag LOCUS_02830 50549 49230 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_02830 51064 50546 gene locus_tag LOCUS_02840 51064 50546 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577036.1 protein_id gnl|my_center|LOCUS_02840 52116 51139 gene locus_tag LOCUS_02850 52116 51139 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_02850 52009 52254 gene locus_tag LOCUS_02860 52009 52254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 52441 53307 gene locus_tag LOCUS_02870 52441 53307 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222998.1 protein_id gnl|my_center|LOCUS_02870 53599 55551 gene locus_tag LOCUS_02880 53599 55551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 55701 55612 gene locus_tag LOCUS_t00020 55701 55612 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 55963 56247 gene locus_tag LOCUS_02890 55963 56247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 56328 56987 gene locus_tag LOCUS_02900 gene msrA 56328 56987 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083656.1 protein_id gnl|my_center|LOCUS_02900 57058 57648 gene locus_tag LOCUS_02910 57058 57648 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369672.1 protein_id gnl|my_center|LOCUS_02910 57690 58724 gene locus_tag LOCUS_02920 57690 58724 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815960.1 protein_id gnl|my_center|LOCUS_02920 58895 61060 gene locus_tag LOCUS_02930 58895 61060 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929814.1 protein_id gnl|my_center|LOCUS_02930 61130 61321 gene locus_tag LOCUS_02940 61130 61321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence005 893 144 gene locus_tag LOCUS_02950 893 144 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_02950 1434 1757 gene locus_tag LOCUS_02960 1434 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02960 2796 2374 gene locus_tag LOCUS_02970 2796 2374 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241082.1 protein_id gnl|my_center|LOCUS_02970 3398 3871 gene locus_tag LOCUS_02980 gene mraZ 3398 3871 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530948.1 protein_id gnl|my_center|LOCUS_02980 3937 4929 gene locus_tag LOCUS_02990 gene rsmH 3937 4929 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966431.1 protein_id gnl|my_center|LOCUS_02990 4926 5312 gene locus_tag LOCUS_03000 4926 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 5309 7081 gene locus_tag LOCUS_03010 5309 7081 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089348.1 protein_id gnl|my_center|LOCUS_03010 7120 8574 gene locus_tag LOCUS_03020 7120 8574 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089347.1 protein_id gnl|my_center|LOCUS_03020 8571 9995 gene locus_tag LOCUS_03030 8571 9995 CDS product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530953.1 protein_id gnl|my_center|LOCUS_03030 10016 11098 gene locus_tag LOCUS_03040 gene mraY 10016 11098 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530954.1 protein_id gnl|my_center|LOCUS_03040 11101 12531 gene locus_tag LOCUS_03050 gene murD 11101 12531 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530955.1 protein_id gnl|my_center|LOCUS_03050 12662 13849 gene locus_tag LOCUS_03060 12662 13849 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338556.1 protein_id gnl|my_center|LOCUS_03060 13955 15088 gene locus_tag LOCUS_03070 13955 15088 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089343.1 protein_id gnl|my_center|LOCUS_03070 15093 16187 gene locus_tag LOCUS_03080 gene murG 15093 16187 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089342.1 protein_id gnl|my_center|LOCUS_03080 16210 17631 gene locus_tag LOCUS_03090 gene murC 16210 17631 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089341.1 protein_id gnl|my_center|LOCUS_03090 17628 18551 gene locus_tag LOCUS_03100 gene murB 17628 18551 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089340.1 protein_id gnl|my_center|LOCUS_03100 18851 19816 gene locus_tag LOCUS_03110 18851 19816 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089338.1 protein_id gnl|my_center|LOCUS_03110 19813 21141 gene locus_tag LOCUS_03120 gene ftsA 19813 21141 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242933.1 protein_id gnl|my_center|LOCUS_03120 21280 22968 gene locus_tag LOCUS_03130 gene ftsZ 21280 22968 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089336.1 protein_id gnl|my_center|LOCUS_03130 23280 24227 gene locus_tag LOCUS_03140 gene lpxC 23280 24227 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089335.1 protein_id gnl|my_center|LOCUS_03140 24385 25311 gene locus_tag LOCUS_03150 24385 25311 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089334.1 protein_id gnl|my_center|LOCUS_03150 25372 27057 gene locus_tag LOCUS_03160 gene recN 25372 27057 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089333.1 protein_id gnl|my_center|LOCUS_03160 27893 27066 gene locus_tag LOCUS_03170 27893 27066 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972290.1 protein_id gnl|my_center|LOCUS_03170 28371 27982 gene locus_tag LOCUS_03180 28371 27982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 28722 30932 gene locus_tag LOCUS_03190 28722 30932 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389140.1 protein_id gnl|my_center|LOCUS_03190 31985 31182 gene locus_tag LOCUS_03200 31985 31182 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532367.1 protein_id gnl|my_center|LOCUS_03200 32197 34353 gene locus_tag LOCUS_03210 gene ligA 32197 34353 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242938.1 protein_id gnl|my_center|LOCUS_03210 34584 35447 gene locus_tag LOCUS_03220 34584 35447 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256476.1 protein_id gnl|my_center|LOCUS_03220 35674 35943 gene locus_tag LOCUS_03230 35674 35943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03230 35907 35922 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35936 36328 gene locus_tag LOCUS_03240 35936 36328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03240 36325 36624 gene locus_tag LOCUS_03250 36325 36624 CDS product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532749.1 protein_id gnl|my_center|LOCUS_03250 38496 36655 gene locus_tag LOCUS_03260 38496 36655 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966432.1 protein_id gnl|my_center|LOCUS_03260 38800 39042 gene locus_tag LOCUS_03270 38800 39042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 39126 39254 gene locus_tag LOCUS_03280 39126 39254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 40367 39420 gene locus_tag LOCUS_03290 40367 39420 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089328.1 protein_id gnl|my_center|LOCUS_03290 40728 40399 gene locus_tag LOCUS_03300 40728 40399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 40993 40697 gene locus_tag LOCUS_03310 40993 40697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 41200 41006 gene locus_tag LOCUS_03320 41200 41006 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893919.1 protein_id gnl|my_center|LOCUS_03320 43736 41370 gene locus_tag LOCUS_03330 43736 41370 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 protein_id gnl|my_center|LOCUS_03330 43824 44252 gene locus_tag LOCUS_03340 43824 44252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 44909 44274 gene locus_tag LOCUS_03350 gene msrA 44909 44274 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_03350 45360 44911 gene locus_tag LOCUS_03360 gene msrB 45360 44911 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529102.1 protein_id gnl|my_center|LOCUS_03360 46551 45475 gene locus_tag LOCUS_03370 46551 45475 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339267.1 protein_id gnl|my_center|LOCUS_03370 46669 47373 gene locus_tag LOCUS_03380 46669 47373 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 protein_id gnl|my_center|LOCUS_03380 47438 48406 gene locus_tag LOCUS_03390 47438 48406 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089253.1 protein_id gnl|my_center|LOCUS_03390 48470 49753 gene locus_tag LOCUS_03400 48470 49753 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 protein_id gnl|my_center|LOCUS_03400 49750 50415 gene locus_tag LOCUS_03410 49750 50415 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_03410 50704 50423 gene locus_tag LOCUS_03420 50704 50423 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_03420 50814 51608 gene locus_tag LOCUS_03430 50814 51608 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531940.1 protein_id gnl|my_center|LOCUS_03430 52206 51646 gene locus_tag LOCUS_03440 52206 51646 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 protein_id gnl|my_center|LOCUS_03440 52468 53907 gene locus_tag LOCUS_03450 52468 53907 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089298.1 protein_id gnl|my_center|LOCUS_03450 >Feature sequence006 380 168 gene locus_tag LOCUS_03460 380 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 482 808 gene locus_tag LOCUS_03470 482 808 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971365.1 protein_id gnl|my_center|LOCUS_03470 1260 1754 gene locus_tag LOCUS_03480 1260 1754 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529534.1 protein_id gnl|my_center|LOCUS_03480 1757 2377 gene locus_tag LOCUS_03490 1757 2377 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921332.1 protein_id gnl|my_center|LOCUS_03490 3490 2495 gene locus_tag LOCUS_03500 3490 2495 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836229.1 protein_id gnl|my_center|LOCUS_03500 4077 4463 gene locus_tag LOCUS_03510 4077 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 4491 5069 gene locus_tag LOCUS_03520 4491 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 5080 5295 gene locus_tag LOCUS_03530 5080 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5298 5615 gene locus_tag LOCUS_03540 5298 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5608 8127 gene locus_tag LOCUS_03550 5608 8127 CDS product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120707288.1 protein_id gnl|my_center|LOCUS_03550 8124 8873 gene locus_tag LOCUS_03560 gene virB5 8124 8873 CDS product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040069.1 protein_id gnl|my_center|LOCUS_03560 8861 9052 gene locus_tag LOCUS_03570 8861 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 9432 10376 gene locus_tag LOCUS_03580 9432 10376 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974426.1 protein_id gnl|my_center|LOCUS_03580 10553 11314 gene locus_tag LOCUS_03590 10553 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 11311 12282 gene locus_tag LOCUS_03600 gene virB9 11311 12282 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891495.1 protein_id gnl|my_center|LOCUS_03600 12279 13340 gene locus_tag LOCUS_03610 12279 13340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 13340 14251 gene locus_tag LOCUS_03620 gene virB11 13340 14251 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034519683.1 protein_id gnl|my_center|LOCUS_03620 14248 16002 gene locus_tag LOCUS_03630 14248 16002 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108653168.1 protein_id gnl|my_center|LOCUS_03630 16628 16143 gene locus_tag LOCUS_03640 16628 16143 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929079.1 protein_id gnl|my_center|LOCUS_03640 20195 16860 gene locus_tag LOCUS_03650 20195 16860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 20495 20205 gene locus_tag LOCUS_03660 20495 20205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 20705 21118 gene locus_tag LOCUS_03670 20705 21118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 21111 21881 gene locus_tag LOCUS_03680 21111 21881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 21881 22387 gene locus_tag LOCUS_03690 21881 22387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 23878 22928 gene locus_tag LOCUS_03700 23878 22928 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368640.1 protein_id gnl|my_center|LOCUS_03700 24143 23880 gene locus_tag LOCUS_03710 24143 23880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 24804 24169 gene locus_tag LOCUS_03720 24804 24169 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387714.1 protein_id gnl|my_center|LOCUS_03720 25340 25212 gene locus_tag LOCUS_03730 25340 25212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 25761 25931 gene locus_tag LOCUS_03740 25761 25931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 25943 26347 gene locus_tag LOCUS_03750 25943 26347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 26932 27132 gene locus_tag LOCUS_03760 26932 27132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 27489 27235 gene locus_tag LOCUS_03770 27489 27235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 27884 27606 gene locus_tag LOCUS_03780 27884 27606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111771.1 protein_id gnl|my_center|LOCUS_03780 28179 27895 gene locus_tag LOCUS_03790 28179 27895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 28412 28185 gene locus_tag LOCUS_03800 28412 28185 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082903.1 protein_id gnl|my_center|LOCUS_03800 28610 28431 gene locus_tag LOCUS_03810 28610 28431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 28778 29113 gene locus_tag LOCUS_03820 28778 29113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 29110 29991 gene locus_tag LOCUS_03830 29110 29991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 30843 30070 gene locus_tag LOCUS_03840 30843 30070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 31358 30843 gene locus_tag LOCUS_03850 31358 30843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 32104 31355 gene locus_tag LOCUS_03860 32104 31355 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_03860 33885 32113 gene locus_tag LOCUS_03870 33885 32113 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_03870 34193 33882 gene locus_tag LOCUS_03880 34193 33882 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_03880 34503 34267 gene locus_tag LOCUS_03890 34503 34267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 34767 35114 gene locus_tag LOCUS_03900 34767 35114 CDS product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035880.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03900 35325 36074 gene locus_tag LOCUS_03910 35325 36074 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095521776.1 protein_id gnl|my_center|LOCUS_03910 37095 36355 gene locus_tag LOCUS_03920 37095 36355 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 protein_id gnl|my_center|LOCUS_03920 37233 37652 gene locus_tag LOCUS_03930 37233 37652 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176526623.1 protein_id gnl|my_center|LOCUS_03930 39655 38429 gene locus_tag LOCUS_03940 39655 38429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 39957 39655 gene locus_tag LOCUS_03950 39957 39655 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_03950 40093 40317 gene locus_tag LOCUS_03960 40093 40317 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_03960 40374 40634 gene locus_tag LOCUS_03970 40374 40634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 40647 40820 gene locus_tag LOCUS_03980 40647 40820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 41132 41464 gene locus_tag LOCUS_03990 41132 41464 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974941.1 protein_id gnl|my_center|LOCUS_03990 41690 42160 gene locus_tag LOCUS_04000 41690 42160 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_04000 42157 42828 gene locus_tag LOCUS_04010 42157 42828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 43268 42825 gene locus_tag LOCUS_04020 43268 42825 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388781.1 protein_id gnl|my_center|LOCUS_04020 43723 43268 gene locus_tag LOCUS_04030 gene mntR 43723 43268 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504117.1 protein_id gnl|my_center|LOCUS_04030 43804 45132 gene locus_tag LOCUS_04040 43804 45132 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992307.1 protein_id gnl|my_center|LOCUS_04040 45303 45767 gene locus_tag LOCUS_04050 45303 45767 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929652.1 protein_id gnl|my_center|LOCUS_04050 45784 46602 gene locus_tag LOCUS_04060 45784 46602 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974348.1 protein_id gnl|my_center|LOCUS_04060 46656 48230 gene locus_tag LOCUS_04070 46656 48230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04070 48175 48867 gene locus_tag LOCUS_04080 48175 48867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 48867 49787 gene locus_tag LOCUS_04090 48867 49787 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836264.1 protein_id gnl|my_center|LOCUS_04090 49801 50085 gene locus_tag LOCUS_04100 49801 50085 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533011.1 protein_id gnl|my_center|LOCUS_04100 50085 50549 gene locus_tag LOCUS_04110 50085 50549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 50797 52302 gene locus_tag LOCUS_04120 gene lnt 50797 52302 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_04120 52299 53021 gene locus_tag LOCUS_04130 52299 53021 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384391.1 protein_id gnl|my_center|LOCUS_04130 53021 53527 gene locus_tag LOCUS_04140 gene lspA 53021 53527 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390715.1 protein_id gnl|my_center|LOCUS_04140 53524 54219 gene locus_tag LOCUS_04150 53524 54219 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309853.1 protein_id gnl|my_center|LOCUS_04150 55310 54582 gene locus_tag LOCUS_04160 55310 54582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence007 212 27 gene locus_tag LOCUS_04170 212 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 237 662 gene locus_tag LOCUS_04180 237 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 662 1276 gene locus_tag LOCUS_04190 662 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 1281 3653 gene locus_tag LOCUS_04200 1281 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 3650 4408 gene locus_tag LOCUS_04210 3650 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 5442 4543 gene locus_tag LOCUS_04220 5442 4543 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_04220 5827 6888 gene locus_tag LOCUS_04230 5827 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 7393 7423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8614 8279 gene locus_tag LOCUS_04240 8614 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 8883 8608 gene locus_tag LOCUS_04250 8883 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 9104 8880 gene locus_tag LOCUS_04260 9104 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 9373 9101 gene locus_tag LOCUS_04270 9373 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 11195 9663 gene locus_tag LOCUS_04280 11195 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090658.1 protein_id gnl|my_center|LOCUS_04280 11946 11197 gene locus_tag LOCUS_04290 11946 11197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918723.1 protein_id gnl|my_center|LOCUS_04290 13462 12107 gene locus_tag LOCUS_04300 13462 12107 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_04300 14924 13476 gene locus_tag LOCUS_04310 14924 13476 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030742.1 protein_id gnl|my_center|LOCUS_04310 15913 14921 gene locus_tag LOCUS_04320 15913 14921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 17091 16048 gene locus_tag LOCUS_04330 17091 16048 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_04330 18046 17327 gene locus_tag LOCUS_04340 18046 17327 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_04340 19808 18102 gene locus_tag LOCUS_04350 19808 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 19922 20560 gene locus_tag LOCUS_04360 19922 20560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04360 20484 20717 gene locus_tag LOCUS_04370 20484 20717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04370 21281 20745 gene locus_tag LOCUS_04380 gene ppa 21281 20745 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310823.1 protein_id gnl|my_center|LOCUS_04380 21459 22181 gene locus_tag LOCUS_04390 21459 22181 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_04390 23553 22186 gene locus_tag LOCUS_04400 23553 22186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 23485 23673 gene locus_tag LOCUS_04410 23485 23673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 24312 23779 gene locus_tag LOCUS_04420 gene hutX 24312 23779 CDS product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972342.1 protein_id gnl|my_center|LOCUS_04420 24670 24323 gene locus_tag LOCUS_04430 24670 24323 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089812.1 protein_id gnl|my_center|LOCUS_04430 24952 25908 gene locus_tag LOCUS_04440 24952 25908 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972341.1 protein_id gnl|my_center|LOCUS_04440 25905 27011 gene locus_tag LOCUS_04450 25905 27011 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531243.1 protein_id gnl|my_center|LOCUS_04450 27004 27837 gene locus_tag LOCUS_04460 27004 27837 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066564.1 protein_id gnl|my_center|LOCUS_04460 27976 28485 gene locus_tag LOCUS_04470 27976 28485 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083403.1 protein_id gnl|my_center|LOCUS_04470 28715 29749 gene locus_tag LOCUS_04480 28715 29749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 30693 29746 gene locus_tag LOCUS_04490 30693 29746 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088162.1 protein_id gnl|my_center|LOCUS_04490 30927 31244 gene locus_tag LOCUS_04500 30927 31244 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534939.1 protein_id gnl|my_center|LOCUS_04500 32781 31339 gene locus_tag LOCUS_04510 32781 31339 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529019.1 protein_id gnl|my_center|LOCUS_04510 33179 34237 gene locus_tag LOCUS_04520 33179 34237 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180937856.1 protein_id gnl|my_center|LOCUS_04520 34301 34813 gene locus_tag LOCUS_04530 34301 34813 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339251.1 protein_id gnl|my_center|LOCUS_04530 34810 36123 gene locus_tag LOCUS_04540 34810 36123 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_04540 36215 36529 gene locus_tag LOCUS_04550 36215 36529 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810016.1 protein_id gnl|my_center|LOCUS_04550 36526 37353 gene locus_tag LOCUS_04560 36526 37353 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853567.1 protein_id gnl|my_center|LOCUS_04560 37350 38156 gene locus_tag LOCUS_04570 37350 38156 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820133.1 protein_id gnl|my_center|LOCUS_04570 38206 38991 gene locus_tag LOCUS_04580 38206 38991 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_04580 39013 39783 gene locus_tag LOCUS_04590 39013 39783 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228906.1 protein_id gnl|my_center|LOCUS_04590 39806 40768 gene locus_tag LOCUS_04600 39806 40768 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810917.1 protein_id gnl|my_center|LOCUS_04600 41002 40811 gene locus_tag LOCUS_04610 41002 40811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 41078 41404 gene locus_tag LOCUS_04620 41078 41404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 41563 41489 gene locus_tag LOCUS_t00030 41563 41489 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 41776 42324 gene locus_tag LOCUS_04630 41776 42324 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973263.1 protein_id gnl|my_center|LOCUS_04630 42402 43301 gene locus_tag LOCUS_04640 gene trxA 42402 43301 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083423.1 protein_id gnl|my_center|LOCUS_04640 43318 43989 gene locus_tag LOCUS_04650 43318 43989 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_04650 44127 45497 gene locus_tag LOCUS_04660 44127 45497 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083411.1 protein_id gnl|my_center|LOCUS_04660 47050 45614 gene locus_tag LOCUS_04670 47050 45614 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090487.1 protein_id gnl|my_center|LOCUS_04670 48066 47185 gene locus_tag LOCUS_04680 48066 47185 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929635.1 protein_id gnl|my_center|LOCUS_04680 49520 48189 gene locus_tag LOCUS_04690 49520 48189 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086911.1 protein_id gnl|my_center|LOCUS_04690 50386 49532 gene locus_tag LOCUS_04700 50386 49532 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086912.1 protein_id gnl|my_center|LOCUS_04700 51318 50383 gene locus_tag LOCUS_04710 51318 50383 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171120.1 protein_id gnl|my_center|LOCUS_04710 51965 51429 gene locus_tag LOCUS_04720 51965 51429 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314763.1 protein_id gnl|my_center|LOCUS_04720 53340 52195 gene locus_tag LOCUS_04730 53340 52195 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090484.1 protein_id gnl|my_center|LOCUS_04730 53908 54120 gene locus_tag LOCUS_04740 53908 54120 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407785.1 protein_id gnl|my_center|LOCUS_04740 54117 54506 gene locus_tag LOCUS_04750 54117 54506 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_04750 54910 54698 gene locus_tag LOCUS_04760 54910 54698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04760 >Feature sequence008 2432 1899 gene locus_tag LOCUS_04770 2432 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2880 2701 gene locus_tag LOCUS_04780 2880 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 6073 2912 gene locus_tag LOCUS_04790 6073 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 6225 7154 gene locus_tag LOCUS_04800 6225 7154 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172821.1 protein_id gnl|my_center|LOCUS_04800 7151 7924 gene locus_tag LOCUS_04810 7151 7924 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083972.1 protein_id gnl|my_center|LOCUS_04810 9188 7935 gene locus_tag LOCUS_04820 9188 7935 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085100.1 protein_id gnl|my_center|LOCUS_04820 9726 9196 gene locus_tag LOCUS_04830 gene mobB 9726 9196 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039619.1 protein_id gnl|my_center|LOCUS_04830 10815 9808 gene locus_tag LOCUS_04840 10815 9808 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088223.1 protein_id gnl|my_center|LOCUS_04840 11561 10965 gene locus_tag LOCUS_04850 gene fdh3B 11561 10965 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088224.1 protein_id gnl|my_center|LOCUS_04850 14555 11577 gene locus_tag LOCUS_04860 14555 11577 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967510.1 protein_id gnl|my_center|LOCUS_04860 14817 14569 gene locus_tag LOCUS_04870 14817 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 15620 14814 gene locus_tag LOCUS_04880 15620 14814 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088228.1 protein_id gnl|my_center|LOCUS_04880 16444 15728 gene locus_tag LOCUS_04890 16444 15728 CDS product DUF3306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970356.1 protein_id gnl|my_center|LOCUS_04890 16971 16441 gene locus_tag LOCUS_04900 16971 16441 CDS product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970357.1 protein_id gnl|my_center|LOCUS_04900 17992 16982 gene locus_tag LOCUS_04910 17992 16982 CDS product DUF6352 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970358.1 protein_id gnl|my_center|LOCUS_04910 18543 17989 gene locus_tag LOCUS_04920 18543 17989 CDS product DUF6505 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970359.1 protein_id gnl|my_center|LOCUS_04920 19283 18540 gene locus_tag LOCUS_04930 19283 18540 CDS product biotin/lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088231.1 protein_id gnl|my_center|LOCUS_04930 19418 21457 gene locus_tag LOCUS_04940 19418 21457 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127577866.1 protein_id gnl|my_center|LOCUS_04940 22791 21604 gene locus_tag LOCUS_04950 22791 21604 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967505.1 protein_id gnl|my_center|LOCUS_04950 22997 23227 gene locus_tag LOCUS_04960 22997 23227 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174267.1 protein_id gnl|my_center|LOCUS_04960 23252 24385 gene locus_tag LOCUS_04970 23252 24385 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392735.1 protein_id gnl|my_center|LOCUS_04970 24685 24560 gene locus_tag LOCUS_04980 24685 24560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 25382 24756 gene locus_tag LOCUS_04990 gene mobA 25382 24756 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921607.1 protein_id gnl|my_center|LOCUS_04990 26426 25533 gene locus_tag LOCUS_05000 gene fdhD 26426 25533 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966588.1 protein_id gnl|my_center|LOCUS_05000 26952 26440 gene locus_tag LOCUS_05010 26952 26440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 27144 28385 gene locus_tag LOCUS_05020 27144 28385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 29408 28398 gene locus_tag LOCUS_05030 29408 28398 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085657.1 protein_id gnl|my_center|LOCUS_05030 30427 29405 gene locus_tag LOCUS_05040 30427 29405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085658.1 protein_id gnl|my_center|LOCUS_05040 31371 30424 gene locus_tag LOCUS_05050 31371 30424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384486.1 protein_id gnl|my_center|LOCUS_05050 31550 31368 gene locus_tag LOCUS_05060 31550 31368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 32542 31559 gene locus_tag LOCUS_05070 32542 31559 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384485.1 protein_id gnl|my_center|LOCUS_05070 34335 32734 gene locus_tag LOCUS_05080 34335 32734 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384484.1 protein_id gnl|my_center|LOCUS_05080 35638 34487 gene locus_tag LOCUS_05090 gene argE 35638 34487 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338096.1 protein_id gnl|my_center|LOCUS_05090 35802 36770 gene locus_tag LOCUS_05100 35802 36770 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031570.1 protein_id gnl|my_center|LOCUS_05100 37059 37448 gene locus_tag LOCUS_05110 37059 37448 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111546447.1 protein_id gnl|my_center|LOCUS_05110 37521 38693 gene locus_tag LOCUS_05120 37521 38693 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085805.1 protein_id gnl|my_center|LOCUS_05120 38708 39817 gene locus_tag LOCUS_05130 38708 39817 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_05130 40550 39906 gene locus_tag LOCUS_05140 gene eda 40550 39906 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_05140 41279 40590 gene locus_tag LOCUS_05150 gene pgl 41279 40590 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974508.1 protein_id gnl|my_center|LOCUS_05150 42781 41279 gene locus_tag LOCUS_05160 gene zwf 42781 41279 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530236.1 protein_id gnl|my_center|LOCUS_05160 43658 42906 gene locus_tag LOCUS_05170 43658 42906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536332.1 protein_id gnl|my_center|LOCUS_05170 44679 43813 gene locus_tag LOCUS_05180 44679 43813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527923.1 protein_id gnl|my_center|LOCUS_05180 45575 44685 gene locus_tag LOCUS_05190 45575 44685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338504.1 protein_id gnl|my_center|LOCUS_05190 46647 45583 gene locus_tag LOCUS_05200 46647 45583 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973844.1 protein_id gnl|my_center|LOCUS_05200 48337 46757 gene locus_tag LOCUS_05210 48337 46757 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139954.1 protein_id gnl|my_center|LOCUS_05210 48605 51997 gene locus_tag LOCUS_05220 48605 51997 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921365.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence009 595 122 gene locus_tag LOCUS_05230 gene smpB 595 122 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087830.1 protein_id gnl|my_center|LOCUS_05230 1239 592 gene locus_tag LOCUS_05240 1239 592 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_05240 2184 1291 gene locus_tag LOCUS_05250 gene dapA 2184 1291 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171604.1 protein_id gnl|my_center|LOCUS_05250 2353 4221 gene locus_tag LOCUS_05260 2353 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4202 4417 gene locus_tag LOCUS_05270 4202 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 4428 5333 gene locus_tag LOCUS_05280 4428 5333 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532597.1 protein_id gnl|my_center|LOCUS_05280 5999 5340 gene locus_tag LOCUS_05290 5999 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 8403 6013 gene locus_tag LOCUS_05300 8403 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 10065 8713 gene locus_tag LOCUS_05310 10065 8713 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087746.1 protein_id gnl|my_center|LOCUS_05310 14802 10468 gene locus_tag LOCUS_05320 14802 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 16814 14802 gene locus_tag LOCUS_05330 16814 14802 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972438.1 protein_id gnl|my_center|LOCUS_05330 17681 16929 gene locus_tag LOCUS_05340 17681 16929 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243760.1 protein_id gnl|my_center|LOCUS_05340 18032 17700 gene locus_tag LOCUS_05350 18032 17700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 17914 18843 gene locus_tag LOCUS_05360 17914 18843 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083880.1 protein_id gnl|my_center|LOCUS_05360 18955 19839 gene locus_tag LOCUS_05370 18955 19839 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083879.1 protein_id gnl|my_center|LOCUS_05370 19920 21056 gene locus_tag LOCUS_05380 19920 21056 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083878.1 protein_id gnl|my_center|LOCUS_05380 21223 22101 gene locus_tag LOCUS_05390 21223 22101 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243765.1 protein_id gnl|my_center|LOCUS_05390 22098 23132 gene locus_tag LOCUS_05400 22098 23132 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083876.1 protein_id gnl|my_center|LOCUS_05400 23129 23890 gene locus_tag LOCUS_05410 23129 23890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083875.1 protein_id gnl|my_center|LOCUS_05410 24056 24793 gene locus_tag LOCUS_05420 24056 24793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083874.1 protein_id gnl|my_center|LOCUS_05420 24909 25988 gene locus_tag LOCUS_05430 24909 25988 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112678.1 protein_id gnl|my_center|LOCUS_05430 25994 27889 gene locus_tag LOCUS_05440 25994 27889 CDS product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083873.1 protein_id gnl|my_center|LOCUS_05440 28757 27939 gene locus_tag LOCUS_05450 28757 27939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 29839 28769 gene locus_tag LOCUS_05460 29839 28769 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083664.1 protein_id gnl|my_center|LOCUS_05460 31628 29922 gene locus_tag LOCUS_05470 31628 29922 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 protein_id gnl|my_center|LOCUS_05470 32616 31732 gene locus_tag LOCUS_05480 32616 31732 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329207.1 protein_id gnl|my_center|LOCUS_05480 32794 33960 gene locus_tag LOCUS_05490 32794 33960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 35295 34024 gene locus_tag LOCUS_05500 gene ccrA 35295 34024 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721248.1 protein_id gnl|my_center|LOCUS_05500 35558 35893 gene locus_tag LOCUS_05510 35558 35893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 36688 35918 gene locus_tag LOCUS_05520 gene ubiG 36688 35918 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966657.1 protein_id gnl|my_center|LOCUS_05520 36839 38077 gene locus_tag LOCUS_05530 36839 38077 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083048.1 protein_id gnl|my_center|LOCUS_05530 38124 38924 gene locus_tag LOCUS_05540 38124 38924 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 protein_id gnl|my_center|LOCUS_05540 38941 40341 gene locus_tag LOCUS_05550 38941 40341 CDS product bifunctional serine/threonine-protein kinase/universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088428.1 protein_id gnl|my_center|LOCUS_05550 40391 41431 gene locus_tag LOCUS_05560 40391 41431 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_05560 41443 42717 gene locus_tag LOCUS_05570 41443 42717 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104167.1 protein_id gnl|my_center|LOCUS_05570 43024 42758 gene locus_tag LOCUS_05580 43024 42758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 43277 42990 gene locus_tag LOCUS_05590 43277 42990 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_05590 43614 44741 gene locus_tag LOCUS_05600 43614 44741 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387905.1 protein_id gnl|my_center|LOCUS_05600 45027 44749 gene locus_tag LOCUS_05610 45027 44749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 45111 46598 gene locus_tag LOCUS_05620 45111 46598 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_05620 46731 47039 gene locus_tag LOCUS_05630 46731 47039 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812024.1 protein_id gnl|my_center|LOCUS_05630 47812 47204 gene locus_tag LOCUS_05640 47812 47204 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976313.1 protein_id gnl|my_center|LOCUS_05640 48597 47824 gene locus_tag LOCUS_05650 48597 47824 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614697.1 protein_id gnl|my_center|LOCUS_05650 48808 48611 gene locus_tag LOCUS_05660 gene thiS 48808 48611 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972407.1 protein_id gnl|my_center|LOCUS_05660 49826 48792 gene locus_tag LOCUS_05670 gene thiO 49826 48792 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972408.1 protein_id gnl|my_center|LOCUS_05670 51307 50189 gene locus_tag LOCUS_05680 51307 50189 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973578.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence010 <1 551 gene locus_tag LOCUS_05690 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006310167.1:bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE 685 1635 gene locus_tag LOCUS_05700 685 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05700 1554 2216 gene locus_tag LOCUS_05710 1554 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05710 2695 2264 gene locus_tag LOCUS_05720 2695 2264 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_05720 3129 2725 gene locus_tag LOCUS_05730 3129 2725 CDS product DUF1579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169262433.1 protein_id gnl|my_center|LOCUS_05730 3303 4811 gene locus_tag LOCUS_05740 gene amn 3303 4811 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119204.1 protein_id gnl|my_center|LOCUS_05740 3824 3871 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5722 4952 gene locus_tag LOCUS_05750 5722 4952 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_05750 6676 5831 gene locus_tag LOCUS_05760 6676 5831 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085546.1 protein_id gnl|my_center|LOCUS_05760 7109 6705 gene locus_tag LOCUS_05770 7109 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7259 8098 gene locus_tag LOCUS_05780 7259 8098 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967606.1 protein_id gnl|my_center|LOCUS_05780 10000 8177 gene locus_tag LOCUS_05790 gene typA 10000 8177 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083371.1 protein_id gnl|my_center|LOCUS_05790 11477 10176 gene locus_tag LOCUS_05800 11477 10176 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083364.1 protein_id gnl|my_center|LOCUS_05800 11599 12285 gene locus_tag LOCUS_05810 11599 12285 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970605.1 protein_id gnl|my_center|LOCUS_05810 12282 13499 gene locus_tag LOCUS_05820 gene trpB 12282 13499 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083569.1 protein_id gnl|my_center|LOCUS_05820 13567 15561 gene locus_tag LOCUS_05830 13567 15561 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992212.1 protein_id gnl|my_center|LOCUS_05830 16099 15506 gene locus_tag LOCUS_05840 16099 15506 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083950.1 protein_id gnl|my_center|LOCUS_05840 16477 16148 gene locus_tag LOCUS_05850 16477 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 16616 16542 gene locus_tag LOCUS_t00040 16616 16542 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17888 16713 gene locus_tag LOCUS_05860 17888 16713 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172745.1 protein_id gnl|my_center|LOCUS_05860 18076 18468 gene locus_tag LOCUS_05870 gene apaG 18076 18468 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172741.1 protein_id gnl|my_center|LOCUS_05870 18465 19640 gene locus_tag LOCUS_05880 gene argE 18465 19640 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 protein_id gnl|my_center|LOCUS_05880 20378 19659 gene locus_tag LOCUS_05890 20378 19659 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_05890 21430 20405 gene locus_tag LOCUS_05900 21430 20405 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083919.1 protein_id gnl|my_center|LOCUS_05900 22350 21430 gene locus_tag LOCUS_05910 gene argF 22350 21430 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083918.1 protein_id gnl|my_center|LOCUS_05910 23617 22391 gene locus_tag LOCUS_05920 23617 22391 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970888.1 protein_id gnl|my_center|LOCUS_05920 23854 24183 gene locus_tag LOCUS_05930 23854 24183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 24188 24745 gene locus_tag LOCUS_05940 24188 24745 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083916.1 protein_id gnl|my_center|LOCUS_05940 25187 24825 gene locus_tag LOCUS_05950 25187 24825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05950 25246 25266 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27011 25848 gene locus_tag LOCUS_05960 27011 25848 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266807.1 protein_id gnl|my_center|LOCUS_05960 28209 27178 gene locus_tag LOCUS_05970 28209 27178 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035216729.1 protein_id gnl|my_center|LOCUS_05970 29352 28309 gene locus_tag LOCUS_05980 29352 28309 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167093.1 protein_id gnl|my_center|LOCUS_05980 30543 29467 gene locus_tag LOCUS_05990 30543 29467 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_05990 30846 31973 gene locus_tag LOCUS_06000 30846 31973 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_06000 33353 32001 gene locus_tag LOCUS_06010 33353 32001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06010 34204 33446 gene locus_tag LOCUS_06020 34204 33446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06020 34457 35716 gene locus_tag LOCUS_06030 34457 35716 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530229.1 protein_id gnl|my_center|LOCUS_06030 35945 35733 gene locus_tag LOCUS_06040 35945 35733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 35844 36470 gene locus_tag LOCUS_06050 35844 36470 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836211.1 protein_id gnl|my_center|LOCUS_06050 36480 37739 gene locus_tag LOCUS_06060 36480 37739 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920457.1 protein_id gnl|my_center|LOCUS_06060 37826 39073 gene locus_tag LOCUS_06070 gene hemA 37826 39073 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844889.1 protein_id gnl|my_center|LOCUS_06070 39367 39936 gene locus_tag LOCUS_06080 gene hslV 39367 39936 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528351.1 protein_id gnl|my_center|LOCUS_06080 39933 40469 gene locus_tag LOCUS_06090 39933 40469 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330425.1 protein_id gnl|my_center|LOCUS_06090 40466 41776 gene locus_tag LOCUS_06100 gene hslU 40466 41776 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083473.1 protein_id gnl|my_center|LOCUS_06100 41802 43373 gene locus_tag LOCUS_06110 gene murJ 41802 43373 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_06110 43464 44513 gene locus_tag LOCUS_06120 gene trpS 43464 44513 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083624.1 protein_id gnl|my_center|LOCUS_06120 44606 45100 gene locus_tag LOCUS_06130 44606 45100 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528063.1 protein_id gnl|my_center|LOCUS_06130 45210 45770 gene locus_tag LOCUS_06140 45210 45770 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083622.1 protein_id gnl|my_center|LOCUS_06140 45943 46626 gene locus_tag LOCUS_06150 gene tsaB 45943 46626 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083621.1 protein_id gnl|my_center|LOCUS_06150 46764 47219 gene locus_tag LOCUS_06160 gene rimI 46764 47219 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083620.1 protein_id gnl|my_center|LOCUS_06160 47430 47996 gene locus_tag LOCUS_06170 47430 47996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06170 48088 49494 gene locus_tag LOCUS_06180 gene miaB 48088 49494 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503457.1 protein_id gnl|my_center|LOCUS_06180 49654 50814 gene locus_tag LOCUS_06190 49654 50814 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083616.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence011 <1 2572 gene locus_tag LOCUS_06200 <1 2572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918050.1:methyl-accepting chemotaxis protein 2560 2940 gene locus_tag LOCUS_06210 gene rplT 2560 2940 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710091.1 protein_id gnl|my_center|LOCUS_06210 3828 3049 gene locus_tag LOCUS_06220 3828 3049 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265631.1 protein_id gnl|my_center|LOCUS_06220 4492 3860 gene locus_tag LOCUS_06230 4492 3860 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_06230 4974 4501 gene locus_tag LOCUS_06240 4974 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5653 5183 gene locus_tag LOCUS_06250 5653 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 5782 6864 gene locus_tag LOCUS_06260 gene pheS 5782 6864 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083532.1 protein_id gnl|my_center|LOCUS_06260 6893 8080 gene locus_tag LOCUS_06270 6893 8080 CDS product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533639.1 protein_id gnl|my_center|LOCUS_06270 8077 10500 gene locus_tag LOCUS_06280 gene pheT 8077 10500 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083531.1 protein_id gnl|my_center|LOCUS_06280 11270 10677 gene locus_tag LOCUS_06290 11270 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 11397 12308 gene locus_tag LOCUS_06300 11397 12308 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728061.1 protein_id gnl|my_center|LOCUS_06300 12305 13384 gene locus_tag LOCUS_06310 12305 13384 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339268.1 protein_id gnl|my_center|LOCUS_06310 13541 14287 gene locus_tag LOCUS_06320 13541 14287 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064061.1 protein_id gnl|my_center|LOCUS_06320 14975 14301 gene locus_tag LOCUS_06330 14975 14301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 15107 15814 gene locus_tag LOCUS_06340 15107 15814 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530969.1 protein_id gnl|my_center|LOCUS_06340 15801 16133 gene locus_tag LOCUS_06350 15801 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 16260 17126 gene locus_tag LOCUS_06360 16260 17126 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241072.1 protein_id gnl|my_center|LOCUS_06360 17129 18109 gene locus_tag LOCUS_06370 17129 18109 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112881.1 protein_id gnl|my_center|LOCUS_06370 19835 18273 gene locus_tag LOCUS_06380 gene murJ 19835 18273 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088657.1 protein_id gnl|my_center|LOCUS_06380 20882 19896 gene locus_tag LOCUS_06390 20882 19896 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920729.1 protein_id gnl|my_center|LOCUS_06390 21021 21848 gene locus_tag LOCUS_06400 21021 21848 CDS product ChbG/HpnK family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090259.1 protein_id gnl|my_center|LOCUS_06400 21945 23648 gene locus_tag LOCUS_06410 21945 23648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 24230 23736 gene locus_tag LOCUS_06420 24230 23736 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014491764.1 protein_id gnl|my_center|LOCUS_06420 24564 25985 gene locus_tag LOCUS_06430 24564 25985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 27923 26004 gene locus_tag LOCUS_06440 27923 26004 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083208.1 protein_id gnl|my_center|LOCUS_06440 27977 27986 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28511 28927 gene locus_tag LOCUS_06450 28511 28927 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085852.1 protein_id gnl|my_center|LOCUS_06450 29068 29490 gene locus_tag LOCUS_06460 29068 29490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 29487 30308 gene locus_tag LOCUS_06470 29487 30308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 30748 30320 gene locus_tag LOCUS_06480 30748 30320 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085853.1 protein_id gnl|my_center|LOCUS_06480 31097 30813 gene locus_tag LOCUS_06490 31097 30813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 31420 33222 gene locus_tag LOCUS_06500 31420 33222 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085855.1 protein_id gnl|my_center|LOCUS_06500 33239 33838 gene locus_tag LOCUS_06510 33239 33838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 33862 34197 gene locus_tag LOCUS_06520 33862 34197 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085858.1 protein_id gnl|my_center|LOCUS_06520 35369 34236 gene locus_tag LOCUS_06530 35369 34236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 35514 35744 gene locus_tag LOCUS_06540 35514 35744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 35741 36538 gene locus_tag LOCUS_06550 35741 36538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 37174 36542 gene locus_tag LOCUS_06560 37174 36542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 37746 37171 gene locus_tag LOCUS_06570 37746 37171 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085885.1 protein_id gnl|my_center|LOCUS_06570 40064 37836 gene locus_tag LOCUS_06580 40064 37836 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085886.1 protein_id gnl|my_center|LOCUS_06580 40344 40838 gene locus_tag LOCUS_06590 40344 40838 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085887.1 protein_id gnl|my_center|LOCUS_06590 41233 40928 gene locus_tag LOCUS_06600 41233 40928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 41564 44338 gene locus_tag LOCUS_06610 41564 44338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 43489 43535 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44660 44277 gene locus_tag LOCUS_06620 44660 44277 CDS product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530737.1 protein_id gnl|my_center|LOCUS_06620 45219 45428 gene locus_tag LOCUS_06630 45219 45428 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003508146.1 protein_id gnl|my_center|LOCUS_06630 45609 47054 gene locus_tag LOCUS_06640 45609 47054 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061417.1 protein_id gnl|my_center|LOCUS_06640 47139 47411 gene locus_tag LOCUS_06650 gene infA 47139 47411 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084263.1 protein_id gnl|my_center|LOCUS_06650 47420 47689 gene locus_tag LOCUS_06660 47420 47689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 48587 47964 gene locus_tag LOCUS_06670 48587 47964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 49600 48971 gene locus_tag LOCUS_06680 49600 48971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence012 1147 869 gene locus_tag LOCUS_06690 1147 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 3701 1152 gene locus_tag LOCUS_06700 gene clpA 3701 1152 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087911.1 protein_id gnl|my_center|LOCUS_06700 4091 3750 gene locus_tag LOCUS_06710 gene clpS 4091 3750 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975286.1 protein_id gnl|my_center|LOCUS_06710 3994 4233 gene locus_tag LOCUS_06720 3994 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 4370 5242 gene locus_tag LOCUS_06730 gene kdsA 4370 5242 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087568.1 protein_id gnl|my_center|LOCUS_06730 5235 6449 gene locus_tag LOCUS_06740 5235 6449 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 protein_id gnl|my_center|LOCUS_06740 6605 8104 gene locus_tag LOCUS_06750 6605 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 8591 8136 gene locus_tag LOCUS_06760 gene queF 8591 8136 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122403094.1 protein_id gnl|my_center|LOCUS_06760 8842 10125 gene locus_tag LOCUS_06770 gene eno 8842 10125 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531479.1 protein_id gnl|my_center|LOCUS_06770 10804 10130 gene locus_tag LOCUS_06780 10804 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 11004 11936 gene locus_tag LOCUS_06790 11004 11936 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 protein_id gnl|my_center|LOCUS_06790 12701 11916 gene locus_tag LOCUS_06800 12701 11916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083743.1 protein_id gnl|my_center|LOCUS_06800 13864 12698 gene locus_tag LOCUS_06810 gene tgt 13864 12698 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529609.1 protein_id gnl|my_center|LOCUS_06810 14680 13922 gene locus_tag LOCUS_06820 14680 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 15116 14763 gene locus_tag LOCUS_06830 15116 14763 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265729.1 protein_id gnl|my_center|LOCUS_06830 15204 15785 gene locus_tag LOCUS_06840 15204 15785 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_06840 16496 15792 gene locus_tag LOCUS_06850 16496 15792 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265698.1 protein_id gnl|my_center|LOCUS_06850 17355 16615 gene locus_tag LOCUS_06860 17355 16615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 17662 18711 gene locus_tag LOCUS_06870 17662 18711 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086411.1 protein_id gnl|my_center|LOCUS_06870 18714 19784 gene locus_tag LOCUS_06880 18714 19784 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311608.1 protein_id gnl|my_center|LOCUS_06880 19781 20617 gene locus_tag LOCUS_06890 19781 20617 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086028.1 protein_id gnl|my_center|LOCUS_06890 20614 21414 gene locus_tag LOCUS_06900 20614 21414 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025576071.1 protein_id gnl|my_center|LOCUS_06900 21426 22238 gene locus_tag LOCUS_06910 gene puuE 21426 22238 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_06910 22417 23325 gene locus_tag LOCUS_06920 gene puuE 22417 23325 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897147.1 protein_id gnl|my_center|LOCUS_06920 23376 23981 gene locus_tag LOCUS_06930 23376 23981 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090029.1 protein_id gnl|my_center|LOCUS_06930 25709 24159 gene locus_tag LOCUS_06940 25709 24159 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268564.1 protein_id gnl|my_center|LOCUS_06940 26719 25868 gene locus_tag LOCUS_06950 26719 25868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 27748 26834 gene locus_tag LOCUS_06960 27748 26834 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038953.1 protein_id gnl|my_center|LOCUS_06960 28721 27903 gene locus_tag LOCUS_06970 28721 27903 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172112.1 protein_id gnl|my_center|LOCUS_06970 29749 28886 gene locus_tag LOCUS_06980 29749 28886 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086069.1 protein_id gnl|my_center|LOCUS_06980 30953 29919 gene locus_tag LOCUS_06990 30953 29919 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086070.1 protein_id gnl|my_center|LOCUS_06990 32046 30964 gene locus_tag LOCUS_07000 32046 30964 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086071.1 protein_id gnl|my_center|LOCUS_07000 32549 33451 gene locus_tag LOCUS_07010 32549 33451 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089937.1 protein_id gnl|my_center|LOCUS_07010 33448 34593 gene locus_tag LOCUS_07020 33448 34593 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539274.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07020 34590 34793 gene locus_tag LOCUS_07030 34590 34793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 34880 35773 gene locus_tag LOCUS_07040 34880 35773 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089943.1 protein_id gnl|my_center|LOCUS_07040 35929 36888 gene locus_tag LOCUS_07050 35929 36888 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 protein_id gnl|my_center|LOCUS_07050 36885 38165 gene locus_tag LOCUS_07060 36885 38165 CDS product hydantoinase/carbamoylase family amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075381701.1 protein_id gnl|my_center|LOCUS_07060 38375 39610 gene locus_tag LOCUS_07070 38375 39610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 39607 40275 gene locus_tag LOCUS_07080 39607 40275 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106037.1 protein_id gnl|my_center|LOCUS_07080 40299 41801 gene locus_tag LOCUS_07090 40299 41801 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931017.1 protein_id gnl|my_center|LOCUS_07090 41878 42834 gene locus_tag LOCUS_07100 41878 42834 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812302.1 protein_id gnl|my_center|LOCUS_07100 42890 43708 gene locus_tag LOCUS_07110 42890 43708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223851055.1 protein_id gnl|my_center|LOCUS_07110 43708 45534 gene locus_tag LOCUS_07120 43708 45534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533440.1 protein_id gnl|my_center|LOCUS_07120 46509 45592 gene locus_tag LOCUS_07130 46509 45592 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966109.1 protein_id gnl|my_center|LOCUS_07130 48041 46527 gene locus_tag LOCUS_07140 48041 46527 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969853.1 protein_id gnl|my_center|LOCUS_07140 48247 48071 gene locus_tag LOCUS_07150 48247 48071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 <49060 48322 gene locus_tag LOCUS_07160 <49060 48322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338163.1:AI-2E family transporter >Feature sequence013 944 42 gene locus_tag LOCUS_07170 944 42 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083373.1 protein_id gnl|my_center|LOCUS_07170 2465 1125 gene locus_tag LOCUS_07180 2465 1125 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530907.1 protein_id gnl|my_center|LOCUS_07180 2643 4454 gene locus_tag LOCUS_07190 2643 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529923.1 protein_id gnl|my_center|LOCUS_07190 4604 6076 gene locus_tag LOCUS_07200 4604 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 6193 7062 gene locus_tag LOCUS_07210 6193 7062 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174657.1 protein_id gnl|my_center|LOCUS_07210 7459 7076 gene locus_tag LOCUS_07220 7459 7076 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 protein_id gnl|my_center|LOCUS_07220 7726 8169 gene locus_tag LOCUS_07230 7726 8169 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_07230 8283 9263 gene locus_tag LOCUS_07240 8283 9263 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967295.1 protein_id gnl|my_center|LOCUS_07240 9617 12640 gene locus_tag LOCUS_07250 gene ileS 9617 12640 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090213.1 protein_id gnl|my_center|LOCUS_07250 12637 13119 gene locus_tag LOCUS_07260 gene lspA 12637 13119 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174654.1 protein_id gnl|my_center|LOCUS_07260 13195 13839 gene locus_tag LOCUS_07270 13195 13839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 14005 15312 gene locus_tag LOCUS_07280 14005 15312 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857633.1 protein_id gnl|my_center|LOCUS_07280 15364 16659 gene locus_tag LOCUS_07290 15364 16659 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967298.1 protein_id gnl|my_center|LOCUS_07290 16882 18684 gene locus_tag LOCUS_07300 gene mutL 16882 18684 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090225.1 protein_id gnl|my_center|LOCUS_07300 19060 18689 gene locus_tag LOCUS_07310 19060 18689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 19719 19057 gene locus_tag LOCUS_07320 19719 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 20816 19911 gene locus_tag LOCUS_07330 20816 19911 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087048.1 protein_id gnl|my_center|LOCUS_07330 21466 20900 gene locus_tag LOCUS_07340 gene rsmD 21466 20900 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090226.1 protein_id gnl|my_center|LOCUS_07340 23768 21642 gene locus_tag LOCUS_07350 23768 21642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 23897 24361 gene locus_tag LOCUS_07360 23897 24361 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399543.1 protein_id gnl|my_center|LOCUS_07360 24749 24378 gene locus_tag LOCUS_07370 24749 24378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 25182 25589 gene locus_tag LOCUS_07380 25182 25589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 26367 25609 gene locus_tag LOCUS_07390 26367 25609 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530562.1 protein_id gnl|my_center|LOCUS_07390 26457 27032 gene locus_tag LOCUS_07400 26457 27032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 27897 26992 gene locus_tag LOCUS_07410 27897 26992 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968832.1 protein_id gnl|my_center|LOCUS_07410 28836 27922 gene locus_tag LOCUS_07420 28836 27922 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090229.1 protein_id gnl|my_center|LOCUS_07420 29243 28833 gene locus_tag LOCUS_07430 29243 28833 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 protein_id gnl|my_center|LOCUS_07430 29491 29240 gene locus_tag LOCUS_07440 29491 29240 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892665.1 protein_id gnl|my_center|LOCUS_07440 30829 29549 gene locus_tag LOCUS_07450 gene purD 30829 29549 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532813.1 protein_id gnl|my_center|LOCUS_07450 30942 32531 gene locus_tag LOCUS_07460 gene xseA 30942 32531 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090239.1 protein_id gnl|my_center|LOCUS_07460 33389 32544 gene locus_tag LOCUS_07470 33389 32544 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967309.1 protein_id gnl|my_center|LOCUS_07470 33478 33699 gene locus_tag LOCUS_07480 33478 33699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 34695 33670 gene locus_tag LOCUS_07490 gene lpxK 34695 33670 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090246.1 protein_id gnl|my_center|LOCUS_07490 35999 34695 gene locus_tag LOCUS_07500 35999 34695 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 protein_id gnl|my_center|LOCUS_07500 36748 35996 gene locus_tag LOCUS_07510 36748 35996 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532344.1 protein_id gnl|my_center|LOCUS_07510 37001 36768 gene locus_tag LOCUS_07520 37001 36768 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532345.1 protein_id gnl|my_center|LOCUS_07520 37956 37129 gene locus_tag LOCUS_07530 37956 37129 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174622.1 protein_id gnl|my_center|LOCUS_07530 38204 38734 gene locus_tag LOCUS_07540 38204 38734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 39567 38746 gene locus_tag LOCUS_07550 39567 38746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 40691 39696 gene locus_tag LOCUS_07560 gene ubiA 40691 39696 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090253.1 protein_id gnl|my_center|LOCUS_07560 41147 40710 gene locus_tag LOCUS_07570 41147 40710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 41405 42148 gene locus_tag LOCUS_07580 41405 42148 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967316.1 protein_id gnl|my_center|LOCUS_07580 42310 43479 gene locus_tag LOCUS_07590 42310 43479 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173971.1 protein_id gnl|my_center|LOCUS_07590 43650 45047 gene locus_tag LOCUS_07600 43650 45047 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083983.1 protein_id gnl|my_center|LOCUS_07600 45140 45313 gene locus_tag LOCUS_07610 45140 45313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 46213 45332 gene locus_tag LOCUS_07620 46213 45332 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530338.1 protein_id gnl|my_center|LOCUS_07620 46382 46786 gene locus_tag LOCUS_07630 46382 46786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence014 2134 134 gene locus_tag LOCUS_07640 2134 134 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975761.1 protein_id gnl|my_center|LOCUS_07640 2979 2233 gene locus_tag LOCUS_07650 2979 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3861 3046 gene locus_tag LOCUS_07660 gene proC 3861 3046 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463862.1 protein_id gnl|my_center|LOCUS_07660 4525 4019 gene locus_tag LOCUS_07670 4525 4019 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311131.1 protein_id gnl|my_center|LOCUS_07670 5171 4902 gene locus_tag LOCUS_07680 5171 4902 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976378.1 protein_id gnl|my_center|LOCUS_07680 5377 5958 gene locus_tag LOCUS_07690 5377 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 6134 7078 gene locus_tag LOCUS_07700 6134 7078 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174674.1 protein_id gnl|my_center|LOCUS_07700 7098 7823 gene locus_tag LOCUS_07710 gene queC 7098 7823 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_07710 7813 8376 gene locus_tag LOCUS_07720 7813 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 8535 10400 gene locus_tag LOCUS_07730 8535 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 10541 11155 gene locus_tag LOCUS_07740 10541 11155 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090175.1 protein_id gnl|my_center|LOCUS_07740 11245 11859 gene locus_tag LOCUS_07750 gene pth 11245 11859 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090174.1 protein_id gnl|my_center|LOCUS_07750 12468 11866 gene locus_tag LOCUS_07760 12468 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965405.1 protein_id gnl|my_center|LOCUS_07760 12612 12842 gene locus_tag LOCUS_07770 12612 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 12832 13278 gene locus_tag LOCUS_07780 12832 13278 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680499.1 protein_id gnl|my_center|LOCUS_07780 13288 14385 gene locus_tag LOCUS_07790 gene ychF 13288 14385 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090173.1 protein_id gnl|my_center|LOCUS_07790 14419 15432 gene locus_tag LOCUS_07800 14419 15432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 15511 16728 gene locus_tag LOCUS_07810 15511 16728 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064424.1 protein_id gnl|my_center|LOCUS_07810 16725 17606 gene locus_tag LOCUS_07820 16725 17606 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_07820 16929 16950 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17752 18831 gene locus_tag LOCUS_07830 17752 18831 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_07830 19101 19820 gene locus_tag LOCUS_07840 19101 19820 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975205.1 protein_id gnl|my_center|LOCUS_07840 19868 21079 gene locus_tag LOCUS_07850 gene mdpA 19868 21079 CDS product metallopeptidase MdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_07850 21135 22070 gene locus_tag LOCUS_07860 21135 22070 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974065.1 protein_id gnl|my_center|LOCUS_07860 22432 22211 gene locus_tag LOCUS_07870 22432 22211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07870 22461 22500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24024 22915 gene locus_tag LOCUS_07880 gene mtnA 24024 22915 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_07880 24559 24032 gene locus_tag LOCUS_07890 24559 24032 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972163.1 protein_id gnl|my_center|LOCUS_07890 25443 24565 gene locus_tag LOCUS_07900 25443 24565 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083781.1 protein_id gnl|my_center|LOCUS_07900 26465 25596 gene locus_tag LOCUS_07910 26465 25596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07910 27772 26474 gene locus_tag LOCUS_07920 27772 26474 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529985.1 protein_id gnl|my_center|LOCUS_07920 27338 27347 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28378 27827 gene locus_tag LOCUS_07930 gene petA 28378 27827 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085272.1 protein_id gnl|my_center|LOCUS_07930 30436 28571 gene locus_tag LOCUS_07940 30436 28571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037763.1 protein_id gnl|my_center|LOCUS_07940 30615 31160 gene locus_tag LOCUS_07950 30615 31160 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254662.1 protein_id gnl|my_center|LOCUS_07950 31171 32106 gene locus_tag LOCUS_07960 gene hemF 31171 32106 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175030.1 protein_id gnl|my_center|LOCUS_07960 33366 32119 gene locus_tag LOCUS_07970 33366 32119 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085256.1 protein_id gnl|my_center|LOCUS_07970 33620 33363 gene locus_tag LOCUS_07980 33620 33363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 34290 33643 gene locus_tag LOCUS_07990 34290 33643 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967402.1 protein_id gnl|my_center|LOCUS_07990 34901 34287 gene locus_tag LOCUS_08000 34901 34287 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175034.1 protein_id gnl|my_center|LOCUS_08000 35080 36102 gene locus_tag LOCUS_08010 35080 36102 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085252.1 protein_id gnl|my_center|LOCUS_08010 36116 37030 gene locus_tag LOCUS_08020 36116 37030 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085251.1 protein_id gnl|my_center|LOCUS_08020 37034 39868 gene locus_tag LOCUS_08030 37034 39868 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085250.1 protein_id gnl|my_center|LOCUS_08030 40041 42140 gene locus_tag LOCUS_08040 40041 42140 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085249.1 protein_id gnl|my_center|LOCUS_08040 42754 42245 gene locus_tag LOCUS_08050 42754 42245 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085246.1 protein_id gnl|my_center|LOCUS_08050 43834 43322 gene locus_tag LOCUS_08060 43834 43322 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529919.1 protein_id gnl|my_center|LOCUS_08060 43748 44083 gene locus_tag LOCUS_08070 43748 44083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 44141 45040 gene locus_tag LOCUS_08080 44141 45040 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_08080 47112 45295 gene locus_tag LOCUS_08090 47112 45295 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence015 1141 566 gene locus_tag LOCUS_08100 1141 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 2321 1176 gene locus_tag LOCUS_08110 2321 1176 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531883.1 protein_id gnl|my_center|LOCUS_08110 3185 2325 gene locus_tag LOCUS_08120 3185 2325 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173242.1 protein_id gnl|my_center|LOCUS_08120 4347 3202 gene locus_tag LOCUS_08130 4347 3202 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921501.1 protein_id gnl|my_center|LOCUS_08130 4640 5584 gene locus_tag LOCUS_08140 4640 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 6963 5572 gene locus_tag LOCUS_08150 6963 5572 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_08150 7843 6965 gene locus_tag LOCUS_08160 7843 6965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_08160 8771 7956 gene locus_tag LOCUS_08170 8771 7956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_08170 9933 8926 gene locus_tag LOCUS_08180 9933 8926 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_08180 10135 10938 gene locus_tag LOCUS_08190 10135 10938 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 protein_id gnl|my_center|LOCUS_08190 11271 10981 gene locus_tag LOCUS_08200 11271 10981 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626476.1 protein_id gnl|my_center|LOCUS_08200 11629 11273 gene locus_tag LOCUS_08210 11629 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 13238 11691 gene locus_tag LOCUS_08220 13238 11691 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083340.1 protein_id gnl|my_center|LOCUS_08220 14654 13326 gene locus_tag LOCUS_08230 14654 13326 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845126.1 protein_id gnl|my_center|LOCUS_08230 15994 14729 gene locus_tag LOCUS_08240 15994 14729 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390890.1 protein_id gnl|my_center|LOCUS_08240 16269 17774 gene locus_tag LOCUS_08250 16269 17774 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267880.1 protein_id gnl|my_center|LOCUS_08250 17986 18930 gene locus_tag LOCUS_08260 17986 18930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311351.1 protein_id gnl|my_center|LOCUS_08260 18930 19814 gene locus_tag LOCUS_08270 18930 19814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992460.1 protein_id gnl|my_center|LOCUS_08270 19929 21728 gene locus_tag LOCUS_08280 19929 21728 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_08280 21739 22464 gene locus_tag LOCUS_08290 21739 22464 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 protein_id gnl|my_center|LOCUS_08290 22551 23111 gene locus_tag LOCUS_08300 22551 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 24236 23169 gene locus_tag LOCUS_08310 24236 23169 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086741.1 protein_id gnl|my_center|LOCUS_08310 24715 24257 gene locus_tag LOCUS_08320 24715 24257 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_08320 25251 24712 gene locus_tag LOCUS_08330 25251 24712 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388009.1 protein_id gnl|my_center|LOCUS_08330 26483 25320 gene locus_tag LOCUS_08340 26483 25320 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 protein_id gnl|my_center|LOCUS_08340 26940 26539 gene locus_tag LOCUS_08350 gene vapC 26940 26539 CDS product type II toxin-antitoxin system toxin VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970128.1 protein_id gnl|my_center|LOCUS_08350 27188 26940 gene locus_tag LOCUS_08360 gene vapB 27188 26940 CDS product type II toxin-antitoxin system antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970129.1 protein_id gnl|my_center|LOCUS_08360 28191 27256 gene locus_tag LOCUS_08370 28191 27256 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_08370 29278 28364 gene locus_tag LOCUS_08380 29278 28364 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086127.1 protein_id gnl|my_center|LOCUS_08380 30216 29275 gene locus_tag LOCUS_08390 30216 29275 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_08390 30216 30437 gene locus_tag LOCUS_08400 30216 30437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 31960 30359 gene locus_tag LOCUS_08410 31960 30359 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086125.1 protein_id gnl|my_center|LOCUS_08410 33639 32227 gene locus_tag LOCUS_08420 33639 32227 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_08420 34983 33754 gene locus_tag LOCUS_08430 34983 33754 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_08430 37188 35182 gene locus_tag LOCUS_08440 37188 35182 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970956.1 protein_id gnl|my_center|LOCUS_08440 37667 38482 gene locus_tag LOCUS_08450 37667 38482 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379663.1 protein_id gnl|my_center|LOCUS_08450 38603 39376 gene locus_tag LOCUS_08460 38603 39376 CDS product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972190.1 protein_id gnl|my_center|LOCUS_08460 40256 39459 gene locus_tag LOCUS_08470 40256 39459 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967312.1 protein_id gnl|my_center|LOCUS_08470 41866 40439 gene locus_tag LOCUS_08480 41866 40439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 42134 42574 gene locus_tag LOCUS_08490 42134 42574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 42671 43171 gene locus_tag LOCUS_08500 42671 43171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 43168 44010 gene locus_tag LOCUS_08510 43168 44010 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384832.1 protein_id gnl|my_center|LOCUS_08510 44496 44017 gene locus_tag LOCUS_08520 44496 44017 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532579.1 protein_id gnl|my_center|LOCUS_08520 45028 44561 gene locus_tag LOCUS_08530 45028 44561 CDS product oxidation-sensing regulator MosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405595.1 protein_id gnl|my_center|LOCUS_08530 45277 45564 gene locus_tag LOCUS_08540 gene groES 45277 45564 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970827.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence016 1527 736 gene locus_tag LOCUS_08550 1527 736 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 protein_id gnl|my_center|LOCUS_08550 2270 1638 gene locus_tag LOCUS_08560 2270 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3058 2201 gene locus_tag LOCUS_08570 3058 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 5484 3055 gene locus_tag LOCUS_08580 5484 3055 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965154.1 protein_id gnl|my_center|LOCUS_08580 7344 5944 gene locus_tag LOCUS_08590 gene ahcY 7344 5944 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088685.1 protein_id gnl|my_center|LOCUS_08590 7823 7467 gene locus_tag LOCUS_08600 7823 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 8218 7835 gene locus_tag LOCUS_08610 8218 7835 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067454.1 protein_id gnl|my_center|LOCUS_08610 8792 8346 gene locus_tag LOCUS_08620 8792 8346 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336939.1 protein_id gnl|my_center|LOCUS_08620 10599 8800 gene locus_tag LOCUS_08630 10599 8800 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528336.1 protein_id gnl|my_center|LOCUS_08630 11386 10685 gene locus_tag LOCUS_08640 11386 10685 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008542552.1 protein_id gnl|my_center|LOCUS_08640 11530 12306 gene locus_tag LOCUS_08650 11530 12306 CDS product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529914.1 protein_id gnl|my_center|LOCUS_08650 12511 14121 gene locus_tag LOCUS_08660 12511 14121 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090863.1 protein_id gnl|my_center|LOCUS_08660 14330 15337 gene locus_tag LOCUS_08670 14330 15337 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808871.1 protein_id gnl|my_center|LOCUS_08670 15848 16315 gene locus_tag LOCUS_08680 15848 16315 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090847.1 protein_id gnl|my_center|LOCUS_08680 18463 16538 gene locus_tag LOCUS_08690 18463 16538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970425.1 protein_id gnl|my_center|LOCUS_08690 16947 17022 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19374 18472 gene locus_tag LOCUS_08700 19374 18472 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 protein_id gnl|my_center|LOCUS_08700 20338 19379 gene locus_tag LOCUS_08710 20338 19379 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084172.1 protein_id gnl|my_center|LOCUS_08710 22277 20490 gene locus_tag LOCUS_08720 22277 20490 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965642.1 protein_id gnl|my_center|LOCUS_08720 22654 22833 gene locus_tag LOCUS_08730 22654 22833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 22911 23912 gene locus_tag LOCUS_08740 gene iolG 22911 23912 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387540.1 protein_id gnl|my_center|LOCUS_08740 24171 23986 gene locus_tag LOCUS_08750 24171 23986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 24088 24540 gene locus_tag LOCUS_08760 24088 24540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 25048 24605 gene locus_tag LOCUS_08770 25048 24605 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529616.1 protein_id gnl|my_center|LOCUS_08770 26380 25133 gene locus_tag LOCUS_08780 26380 25133 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894844.1 protein_id gnl|my_center|LOCUS_08780 26975 26517 gene locus_tag LOCUS_08790 26975 26517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 27857 27027 gene locus_tag LOCUS_08800 27857 27027 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853567.1 protein_id gnl|my_center|LOCUS_08800 28101 28763 gene locus_tag LOCUS_08810 28101 28763 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974309.1 protein_id gnl|my_center|LOCUS_08810 28767 29465 gene locus_tag LOCUS_08820 28767 29465 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531516.1 protein_id gnl|my_center|LOCUS_08820 29501 31345 gene locus_tag LOCUS_08830 gene cyaD1 29501 31345 CDS product adenylate cyclase CyaD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968600.1 protein_id gnl|my_center|LOCUS_08830 31478 32746 gene locus_tag LOCUS_08840 31478 32746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 32743 33876 gene locus_tag LOCUS_08850 32743 33876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 35802 33886 gene locus_tag LOCUS_08860 35802 33886 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_08860 36835 35852 gene locus_tag LOCUS_08870 36835 35852 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528641.1 protein_id gnl|my_center|LOCUS_08870 37223 38119 gene locus_tag LOCUS_08880 gene nadC 37223 38119 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_08880 38136 40190 gene locus_tag LOCUS_08890 38136 40190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 40860 40360 gene locus_tag LOCUS_08900 40860 40360 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089070.1 protein_id gnl|my_center|LOCUS_08900 41089 42318 gene locus_tag LOCUS_08910 41089 42318 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089071.1 protein_id gnl|my_center|LOCUS_08910 42481 43497 gene locus_tag LOCUS_08920 42481 43497 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089072.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence017 442 1359 gene locus_tag LOCUS_08930 442 1359 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537755.1 protein_id gnl|my_center|LOCUS_08930 1863 1369 gene locus_tag LOCUS_08940 1863 1369 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969210.1 protein_id gnl|my_center|LOCUS_08940 2425 1916 gene locus_tag LOCUS_08950 gene gpt 2425 1916 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532017.1 protein_id gnl|my_center|LOCUS_08950 3308 2544 gene locus_tag LOCUS_08960 3308 2544 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088357.1 protein_id gnl|my_center|LOCUS_08960 4287 3409 gene locus_tag LOCUS_08970 4287 3409 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965090.1 protein_id gnl|my_center|LOCUS_08970 4444 5268 gene locus_tag LOCUS_08980 gene map 4444 5268 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174009106.1 protein_id gnl|my_center|LOCUS_08980 5265 6017 gene locus_tag LOCUS_08990 gene radC 5265 6017 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_08990 6140 7555 gene locus_tag LOCUS_09000 6140 7555 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_09000 7548 8570 gene locus_tag LOCUS_09010 7548 8570 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088359.1 protein_id gnl|my_center|LOCUS_09010 8657 9484 gene locus_tag LOCUS_09020 8657 9484 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967763.1 protein_id gnl|my_center|LOCUS_09020 9547 10344 gene locus_tag LOCUS_09030 9547 10344 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088363.1 protein_id gnl|my_center|LOCUS_09030 10498 12672 gene locus_tag LOCUS_09040 10498 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 13305 12706 gene locus_tag LOCUS_09050 13305 12706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 13654 13385 gene locus_tag LOCUS_09060 13654 13385 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088370.1 protein_id gnl|my_center|LOCUS_09060 13844 14569 gene locus_tag LOCUS_09070 13844 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 15313 14579 gene locus_tag LOCUS_09080 15313 14579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 15393 15557 gene locus_tag LOCUS_09090 15393 15557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 17331 15694 gene locus_tag LOCUS_09100 17331 15694 CDS product molybdopterin-binding/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088405.1 protein_id gnl|my_center|LOCUS_09100 18020 17328 gene locus_tag LOCUS_09110 18020 17328 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088406.1 protein_id gnl|my_center|LOCUS_09110 18654 18025 gene locus_tag LOCUS_09120 18654 18025 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971443.1 protein_id gnl|my_center|LOCUS_09120 18992 18654 gene locus_tag LOCUS_09130 18992 18654 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531447.1 protein_id gnl|my_center|LOCUS_09130 19192 19848 gene locus_tag LOCUS_09140 19192 19848 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085111.1 protein_id gnl|my_center|LOCUS_09140 21047 19845 gene locus_tag LOCUS_09150 21047 19845 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532113.1 protein_id gnl|my_center|LOCUS_09150 21588 21211 gene locus_tag LOCUS_09160 21588 21211 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083764.1 protein_id gnl|my_center|LOCUS_09160 22588 21875 gene locus_tag LOCUS_09170 22588 21875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09170 22685 23038 gene locus_tag LOCUS_09180 22685 23038 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532858.1 protein_id gnl|my_center|LOCUS_09180 23858 23055 gene locus_tag LOCUS_09190 23858 23055 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088410.1 protein_id gnl|my_center|LOCUS_09190 26299 23936 gene locus_tag LOCUS_09200 26299 23936 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531266.1 protein_id gnl|my_center|LOCUS_09200 26912 26400 gene locus_tag LOCUS_09210 26912 26400 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027560187.1 protein_id gnl|my_center|LOCUS_09210 27227 28585 gene locus_tag LOCUS_09220 27227 28585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 29065 28613 gene locus_tag LOCUS_09230 29065 28613 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088412.1 protein_id gnl|my_center|LOCUS_09230 29203 30627 gene locus_tag LOCUS_09240 29203 30627 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088413.1 protein_id gnl|my_center|LOCUS_09240 30620 31873 gene locus_tag LOCUS_09250 30620 31873 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530809.1 protein_id gnl|my_center|LOCUS_09250 31864 32274 gene locus_tag LOCUS_09260 31864 32274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 32306 33046 gene locus_tag LOCUS_09270 gene pcaD 32306 33046 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104401.1 protein_id gnl|my_center|LOCUS_09270 33122 33517 gene locus_tag LOCUS_09280 gene pcaC 33122 33517 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112676.1 protein_id gnl|my_center|LOCUS_09280 34185 33667 gene locus_tag LOCUS_09290 34185 33667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 35041 34343 gene locus_tag LOCUS_09300 35041 34343 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173266.1 protein_id gnl|my_center|LOCUS_09300 35232 35624 gene locus_tag LOCUS_09310 35232 35624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 35635 36867 gene locus_tag LOCUS_09320 35635 36867 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502893.1 protein_id gnl|my_center|LOCUS_09320 37068 38078 gene locus_tag LOCUS_09330 37068 38078 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969498.1 protein_id gnl|my_center|LOCUS_09330 38361 39278 gene locus_tag LOCUS_09340 38361 39278 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529092.1 protein_id gnl|my_center|LOCUS_09340 39284 40678 gene locus_tag LOCUS_09350 gene livM 39284 40678 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394369.1 protein_id gnl|my_center|LOCUS_09350 40678 41535 gene locus_tag LOCUS_09360 40678 41535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066618.1 protein_id gnl|my_center|LOCUS_09360 41532 42311 gene locus_tag LOCUS_09370 41532 42311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529095.1 protein_id gnl|my_center|LOCUS_09370 42313 42687 gene locus_tag LOCUS_09380 42313 42687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529096.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence018 189 818 gene locus_tag LOCUS_09390 189 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1910 1353 gene locus_tag LOCUS_09400 1910 1353 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172196.1 protein_id gnl|my_center|LOCUS_09400 4294 1925 gene locus_tag LOCUS_09410 4294 1925 CDS product Orn/Lys/Arg decarboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966057.1 protein_id gnl|my_center|LOCUS_09410 4496 5260 gene locus_tag LOCUS_09420 gene fabI 4496 5260 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390974.1 protein_id gnl|my_center|LOCUS_09420 5275 7779 gene locus_tag LOCUS_09430 5275 7779 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086240.1 protein_id gnl|my_center|LOCUS_09430 7781 9160 gene locus_tag LOCUS_09440 7781 9160 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389222.1 protein_id gnl|my_center|LOCUS_09440 9160 10383 gene locus_tag LOCUS_09450 9160 10383 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061605.1 protein_id gnl|my_center|LOCUS_09450 10457 11314 gene locus_tag LOCUS_09460 10457 11314 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 protein_id gnl|my_center|LOCUS_09460 11349 12236 gene locus_tag LOCUS_09470 11349 12236 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337350.1 protein_id gnl|my_center|LOCUS_09470 12620 12285 gene locus_tag LOCUS_09480 12620 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 13136 12687 gene locus_tag LOCUS_09490 13136 12687 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038704.1 protein_id gnl|my_center|LOCUS_09490 13280 13693 gene locus_tag LOCUS_09500 13280 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 13718 14530 gene locus_tag LOCUS_09510 13718 14530 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920789.1 protein_id gnl|my_center|LOCUS_09510 15943 14534 gene locus_tag LOCUS_09520 15943 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 17607 15988 gene locus_tag LOCUS_09530 17607 15988 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114829082.1 protein_id gnl|my_center|LOCUS_09530 20372 17622 gene locus_tag LOCUS_09540 gene tssH 20372 17622 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480775.1 protein_id gnl|my_center|LOCUS_09540 20253 20594 gene locus_tag LOCUS_09550 20253 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 21043 20525 gene locus_tag LOCUS_09560 21043 20525 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105495.1 protein_id gnl|my_center|LOCUS_09560 21632 21267 gene locus_tag LOCUS_09570 21632 21267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 23268 21763 gene locus_tag LOCUS_09580 23268 21763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 24404 23382 gene locus_tag LOCUS_09590 24404 23382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 25199 24498 gene locus_tag LOCUS_09600 25199 24498 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105478.1 protein_id gnl|my_center|LOCUS_09600 25918 25202 gene locus_tag LOCUS_09610 gene tagF 25918 25202 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106966.1 protein_id gnl|my_center|LOCUS_09610 29502 25918 gene locus_tag LOCUS_09620 gene tssM 29502 25918 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525287.1 protein_id gnl|my_center|LOCUS_09620 30155 29499 gene locus_tag LOCUS_09630 30155 29499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 31770 30439 gene locus_tag LOCUS_09640 gene tssK 31770 30439 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115052.1 protein_id gnl|my_center|LOCUS_09640 32347 31847 gene locus_tag LOCUS_09650 gene tssJ 32347 31847 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246952.1 protein_id gnl|my_center|LOCUS_09650 32934 32344 gene locus_tag LOCUS_09660 32934 32344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09660 33607 32921 gene locus_tag LOCUS_09670 33607 32921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 33654 33896 gene locus_tag LOCUS_09680 33654 33896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 34889 33909 gene locus_tag LOCUS_09690 gene tssG 34889 33909 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941101.1 protein_id gnl|my_center|LOCUS_09690 36601 34853 gene locus_tag LOCUS_09700 gene tssF 36601 34853 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189792.1 protein_id gnl|my_center|LOCUS_09700 37022 36606 gene locus_tag LOCUS_09710 gene tssE 37022 36606 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097809.1 protein_id gnl|my_center|LOCUS_09710 38649 37165 gene locus_tag LOCUS_09720 gene tssC 38649 37165 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105492.1 protein_id gnl|my_center|LOCUS_09720 39178 38675 gene locus_tag LOCUS_09730 gene tssB 39178 38675 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114607.1 protein_id gnl|my_center|LOCUS_09730 <39799 39180 gene locus_tag LOCUS_09740 <39799 39180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705724.1:type VI secretion system protein TssA >Feature sequence019 258 1880 gene locus_tag LOCUS_09750 258 1880 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528039.1 protein_id gnl|my_center|LOCUS_09750 2003 2722 gene locus_tag LOCUS_09760 2003 2722 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160062.1 protein_id gnl|my_center|LOCUS_09760 3284 2805 gene locus_tag LOCUS_09770 3284 2805 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975746.1 protein_id gnl|my_center|LOCUS_09770 3467 3988 gene locus_tag LOCUS_09780 3467 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4198 4746 gene locus_tag LOCUS_09790 4198 4746 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103843.1 protein_id gnl|my_center|LOCUS_09790 6010 4856 gene locus_tag LOCUS_09800 6010 4856 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_09800 6095 6634 gene locus_tag LOCUS_09810 6095 6634 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403782.1 protein_id gnl|my_center|LOCUS_09810 7016 6642 gene locus_tag LOCUS_09820 7016 6642 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084205.1 protein_id gnl|my_center|LOCUS_09820 7580 7020 gene locus_tag LOCUS_09830 gene hpt 7580 7020 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003497442.1 protein_id gnl|my_center|LOCUS_09830 8555 7719 gene locus_tag LOCUS_09840 8555 7719 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265776.1 protein_id gnl|my_center|LOCUS_09840 8688 9347 gene locus_tag LOCUS_09850 gene ftsE 8688 9347 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010911739.1 protein_id gnl|my_center|LOCUS_09850 9340 10305 gene locus_tag LOCUS_09860 9340 10305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529399.1 protein_id gnl|my_center|LOCUS_09860 10394 11191 gene locus_tag LOCUS_09870 10394 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 11242 12027 gene locus_tag LOCUS_09880 11242 12027 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529394.1 protein_id gnl|my_center|LOCUS_09880 12047 12550 gene locus_tag LOCUS_09890 12047 12550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 13283 12630 gene locus_tag LOCUS_09900 13283 12630 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329552.1 protein_id gnl|my_center|LOCUS_09900 13332 14381 gene locus_tag LOCUS_09910 13332 14381 CDS product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920082.1 protein_id gnl|my_center|LOCUS_09910 15345 14449 gene locus_tag LOCUS_09920 gene rpoH 15345 14449 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090072.1 protein_id gnl|my_center|LOCUS_09920 16603 15560 gene locus_tag LOCUS_09930 16603 15560 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393680.1 protein_id gnl|my_center|LOCUS_09930 16790 16662 gene locus_tag LOCUS_09940 16790 16662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 18202 16787 gene locus_tag LOCUS_09950 18202 16787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09950 20231 18219 gene locus_tag LOCUS_09960 20231 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 20436 21509 gene locus_tag LOCUS_09970 gene tsaD 20436 21509 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174299077.1 protein_id gnl|my_center|LOCUS_09970 21506 22519 gene locus_tag LOCUS_09980 21506 22519 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083397.1 protein_id gnl|my_center|LOCUS_09980 22519 22854 gene locus_tag LOCUS_09990 22519 22854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 22930 23337 gene locus_tag LOCUS_10000 22930 23337 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_10000 24626 23499 gene locus_tag LOCUS_10010 24626 23499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 24866 26818 gene locus_tag LOCUS_10020 gene acs 24866 26818 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174953.1 protein_id gnl|my_center|LOCUS_10020 27413 28570 gene locus_tag LOCUS_10030 27413 28570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 28567 29238 gene locus_tag LOCUS_10040 28567 29238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 32466 29239 gene locus_tag LOCUS_10050 32466 29239 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240187.1 protein_id gnl|my_center|LOCUS_10050 33654 32479 gene locus_tag LOCUS_10060 33654 32479 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972288.1 protein_id gnl|my_center|LOCUS_10060 34346 33708 gene locus_tag LOCUS_10070 34346 33708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 34580 35377 gene locus_tag LOCUS_10080 34580 35377 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083382.1 protein_id gnl|my_center|LOCUS_10080 35374 36588 gene locus_tag LOCUS_10090 35374 36588 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087074.1 protein_id gnl|my_center|LOCUS_10090 36589 36894 gene locus_tag LOCUS_10100 36589 36894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 37927 37142 gene locus_tag LOCUS_10110 37927 37142 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528877.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence020 146 1795 gene locus_tag LOCUS_10120 146 1795 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919157.1 protein_id gnl|my_center|LOCUS_10120 2861 1890 gene locus_tag LOCUS_10130 2861 1890 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_10130 3994 2957 gene locus_tag LOCUS_10140 gene cobD 3994 2957 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531122.1 protein_id gnl|my_center|LOCUS_10140 3993 4994 gene locus_tag LOCUS_10150 gene cbiB 3993 4994 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338227.1 protein_id gnl|my_center|LOCUS_10150 5032 5286 gene locus_tag LOCUS_10160 5032 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975287.1 protein_id gnl|my_center|LOCUS_10160 5283 5720 gene locus_tag LOCUS_10170 5283 5720 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417282.1 protein_id gnl|my_center|LOCUS_10170 6338 5727 gene locus_tag LOCUS_10180 gene cobO 6338 5727 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531120.1 protein_id gnl|my_center|LOCUS_10180 6876 6364 gene locus_tag LOCUS_10190 gene cobU 6876 6364 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 protein_id gnl|my_center|LOCUS_10190 7293 7961 gene locus_tag LOCUS_10200 7293 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 8306 9157 gene locus_tag LOCUS_10210 8306 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 9184 12570 gene locus_tag LOCUS_10220 gene cobN 9184 12570 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531086.1 protein_id gnl|my_center|LOCUS_10220 12567 13979 gene locus_tag LOCUS_10230 gene cobG 12567 13979 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970292.1 protein_id gnl|my_center|LOCUS_10230 13976 14608 gene locus_tag LOCUS_10240 13976 14608 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528811.1 protein_id gnl|my_center|LOCUS_10240 14613 15356 gene locus_tag LOCUS_10250 14613 15356 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531083.1 protein_id gnl|my_center|LOCUS_10250 15353 16351 gene locus_tag LOCUS_10260 15353 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 17058 16276 gene locus_tag LOCUS_10270 17058 16276 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067029.1 protein_id gnl|my_center|LOCUS_10270 17180 17788 gene locus_tag LOCUS_10280 17180 17788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10280 17712 18449 gene locus_tag LOCUS_10290 17712 18449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 18446 18835 gene locus_tag LOCUS_10300 18446 18835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 18846 19610 gene locus_tag LOCUS_10310 gene cobM 18846 19610 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086055.1 protein_id gnl|my_center|LOCUS_10310 19795 21225 gene locus_tag LOCUS_10320 19795 21225 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531076.1 protein_id gnl|my_center|LOCUS_10320 21231 21872 gene locus_tag LOCUS_10330 gene bluB 21231 21872 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086038.1 protein_id gnl|my_center|LOCUS_10330 21875 22627 gene locus_tag LOCUS_10340 gene cobF 21875 22627 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528807.1 protein_id gnl|my_center|LOCUS_10340 22873 23388 gene locus_tag LOCUS_10350 22873 23388 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083867.1 protein_id gnl|my_center|LOCUS_10350 23641 23390 gene locus_tag LOCUS_10360 23641 23390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968930.1 protein_id gnl|my_center|LOCUS_10360 25061 23727 gene locus_tag LOCUS_10370 25061 23727 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966720.1 protein_id gnl|my_center|LOCUS_10370 25418 25134 gene locus_tag LOCUS_10380 25418 25134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 25607 26449 gene locus_tag LOCUS_10390 gene dapD 25607 26449 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 protein_id gnl|my_center|LOCUS_10390 27084 26572 gene locus_tag LOCUS_10400 27084 26572 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090056.1 protein_id gnl|my_center|LOCUS_10400 28692 27184 gene locus_tag LOCUS_10410 28692 27184 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921435.1 protein_id gnl|my_center|LOCUS_10410 28984 30003 gene locus_tag LOCUS_10420 28984 30003 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920700.1 protein_id gnl|my_center|LOCUS_10420 30031 30300 gene locus_tag LOCUS_10430 30031 30300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 30305 30523 gene locus_tag LOCUS_10440 30305 30523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 31069 31599 gene locus_tag LOCUS_10450 31069 31599 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_10450 32735 31746 gene locus_tag LOCUS_10460 32735 31746 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_10460 33726 32839 gene locus_tag LOCUS_10470 33726 32839 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391054.1 protein_id gnl|my_center|LOCUS_10470 35096 33891 gene locus_tag LOCUS_10480 35096 33891 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086815.1 protein_id gnl|my_center|LOCUS_10480 35927 35187 gene locus_tag LOCUS_10490 35927 35187 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086814.1 protein_id gnl|my_center|LOCUS_10490 36687 35917 gene locus_tag LOCUS_10500 36687 35917 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence021 467 1321 gene locus_tag LOCUS_10510 467 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1957 1328 gene locus_tag LOCUS_10520 1957 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 3003 2137 gene locus_tag LOCUS_10530 3003 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 3330 4766 gene locus_tag LOCUS_10540 3330 4766 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_10540 4783 5508 gene locus_tag LOCUS_10550 4783 5508 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338687.1 protein_id gnl|my_center|LOCUS_10550 5540 6376 gene locus_tag LOCUS_10560 5540 6376 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480502.1 protein_id gnl|my_center|LOCUS_10560 6400 6987 gene locus_tag LOCUS_10570 6400 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 7062 8405 gene locus_tag LOCUS_10580 7062 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 8402 9112 gene locus_tag LOCUS_10590 8402 9112 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_10590 9112 9816 gene locus_tag LOCUS_10600 9112 9816 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044955.1 protein_id gnl|my_center|LOCUS_10600 9813 10946 gene locus_tag LOCUS_10610 9813 10946 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_10610 11658 11023 gene locus_tag LOCUS_10620 11658 11023 CDS product NrsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975391.1 protein_id gnl|my_center|LOCUS_10620 12214 11645 gene locus_tag LOCUS_10630 12214 11645 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085822.1 protein_id gnl|my_center|LOCUS_10630 12451 13380 gene locus_tag LOCUS_10640 12451 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 13412 13864 gene locus_tag LOCUS_10650 13412 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 15235 14243 gene locus_tag LOCUS_10660 gene pstS 15235 14243 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809635.1 protein_id gnl|my_center|LOCUS_10660 15747 17459 gene locus_tag LOCUS_10670 15747 17459 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_10670 18299 17550 gene locus_tag LOCUS_10680 18299 17550 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173811.1 protein_id gnl|my_center|LOCUS_10680 19095 18313 gene locus_tag LOCUS_10690 19095 18313 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 protein_id gnl|my_center|LOCUS_10690 19297 20463 gene locus_tag LOCUS_10700 19297 20463 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529310.1 protein_id gnl|my_center|LOCUS_10700 20605 21504 gene locus_tag LOCUS_10710 gene ppk2 20605 21504 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965809.1 protein_id gnl|my_center|LOCUS_10710 22338 21550 gene locus_tag LOCUS_10720 22338 21550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 22892 22335 gene locus_tag LOCUS_10730 22892 22335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 22891 23358 gene locus_tag LOCUS_10740 22891 23358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 23386 23778 gene locus_tag LOCUS_10750 23386 23778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 24578 23952 gene locus_tag LOCUS_10760 24578 23952 CDS product DUF3540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187892.1 protein_id gnl|my_center|LOCUS_10760 26137 24617 gene locus_tag LOCUS_10770 26137 24617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 26675 26268 gene locus_tag LOCUS_10780 26675 26268 CDS product DUF4150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366584.1 protein_id gnl|my_center|LOCUS_10780 27754 26687 gene locus_tag LOCUS_10790 27754 26687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10790 30728 27744 gene locus_tag LOCUS_10800 30728 27744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10800 31451 30819 gene locus_tag LOCUS_10810 31451 30819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 31718 32275 gene locus_tag LOCUS_10820 31718 32275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 32404 33396 gene locus_tag LOCUS_10830 32404 33396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921606.1 protein_id gnl|my_center|LOCUS_10830 33436 34551 gene locus_tag LOCUS_10840 33436 34551 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084368.1 protein_id gnl|my_center|LOCUS_10840 34548 34886 gene locus_tag LOCUS_10850 34548 34886 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908409.1 protein_id gnl|my_center|LOCUS_10850 35007 36656 gene locus_tag LOCUS_10860 35007 36656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence022 <1 613 gene locus_tag LOCUS_10870 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089175.1:2-isopropylmalate synthase 687 2069 gene locus_tag LOCUS_10880 687 2069 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387881.1 protein_id gnl|my_center|LOCUS_10880 2183 3454 gene locus_tag LOCUS_10890 2183 3454 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972735.1 protein_id gnl|my_center|LOCUS_10890 3614 3689 gene locus_tag LOCUS_t00050 3614 3689 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3947 4546 gene locus_tag LOCUS_10900 3947 4546 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528212.1 protein_id gnl|my_center|LOCUS_10900 4543 6282 gene locus_tag LOCUS_10910 4543 6282 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930387.1 protein_id gnl|my_center|LOCUS_10910 6428 6682 gene locus_tag LOCUS_10920 6428 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 8074 6686 gene locus_tag LOCUS_10930 8074 6686 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762889.1 protein_id gnl|my_center|LOCUS_10930 8201 9613 gene locus_tag LOCUS_10940 8201 9613 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804144.1 protein_id gnl|my_center|LOCUS_10940 11785 9722 gene locus_tag LOCUS_10950 gene malQ 11785 9722 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113656.1 protein_id gnl|my_center|LOCUS_10950 14051 11841 gene locus_tag LOCUS_10960 gene glgB 14051 11841 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275125.1 protein_id gnl|my_center|LOCUS_10960 14264 14593 gene locus_tag LOCUS_10970 14264 14593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 16095 14716 gene locus_tag LOCUS_10980 gene glgA 16095 14716 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085562.1 protein_id gnl|my_center|LOCUS_10980 16315 18402 gene locus_tag LOCUS_10990 gene glgX 16315 18402 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096571.1 protein_id gnl|my_center|LOCUS_10990 18441 18710 gene locus_tag LOCUS_11000 18441 18710 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_11000 18730 19008 gene locus_tag LOCUS_11010 18730 19008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 20995 19025 gene locus_tag LOCUS_11020 gene glgX 20995 19025 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066959.1 protein_id gnl|my_center|LOCUS_11020 23478 21001 gene locus_tag LOCUS_11030 23478 21001 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973547.1 protein_id gnl|my_center|LOCUS_11030 23755 23576 gene locus_tag LOCUS_11040 23755 23576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 24038 23796 gene locus_tag LOCUS_11050 24038 23796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 23920 25134 gene locus_tag LOCUS_11060 23920 25134 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972122.1 protein_id gnl|my_center|LOCUS_11060 25143 26612 gene locus_tag LOCUS_11070 25143 26612 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528231.1 protein_id gnl|my_center|LOCUS_11070 26832 27524 gene locus_tag LOCUS_11080 26832 27524 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_11080 28639 27629 gene locus_tag LOCUS_11090 28639 27629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11090 28860 29177 gene locus_tag LOCUS_11100 28860 29177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 29554 29201 gene locus_tag LOCUS_11110 gene uraH 29554 29201 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087207.1 protein_id gnl|my_center|LOCUS_11110 29634 30869 gene locus_tag LOCUS_11120 29634 30869 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061555.1 protein_id gnl|my_center|LOCUS_11120 31012 33561 gene locus_tag LOCUS_11130 31012 33561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 34012 33584 gene locus_tag LOCUS_11140 34012 33584 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088783.1 protein_id gnl|my_center|LOCUS_11140 34213 34650 gene locus_tag LOCUS_11150 gene lysM 34213 34650 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853464.1 protein_id gnl|my_center|LOCUS_11150 34901 35953 gene locus_tag LOCUS_11160 34901 35953 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_11160 35950 36462 gene locus_tag LOCUS_11170 35950 36462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence023 2043 484 gene locus_tag LOCUS_11180 2043 484 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974902.1 protein_id gnl|my_center|LOCUS_11180 3020 2127 gene locus_tag LOCUS_11190 3020 2127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067068.1 protein_id gnl|my_center|LOCUS_11190 3955 3017 gene locus_tag LOCUS_11200 3955 3017 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967433.1 protein_id gnl|my_center|LOCUS_11200 4455 4934 gene locus_tag LOCUS_11210 4455 4934 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_11210 5891 4947 gene locus_tag LOCUS_11220 gene hemC 5891 4947 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_11220 7560 6007 gene locus_tag LOCUS_11230 7560 6007 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338253.1 protein_id gnl|my_center|LOCUS_11230 8508 7582 gene locus_tag LOCUS_11240 gene chlG 8508 7582 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388385.1 protein_id gnl|my_center|LOCUS_11240 8942 8505 gene locus_tag LOCUS_11250 8942 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 12288 8827 gene locus_tag LOCUS_11260 12288 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11260 12526 12290 gene locus_tag LOCUS_11270 12526 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 12938 14404 gene locus_tag LOCUS_11280 gene ppsR 12938 14404 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_11280 14686 14420 gene locus_tag LOCUS_11290 14686 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 15900 14686 gene locus_tag LOCUS_11300 15900 14686 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720441.1 protein_id gnl|my_center|LOCUS_11300 17243 15906 gene locus_tag LOCUS_11310 17243 15906 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388386.1 protein_id gnl|my_center|LOCUS_11310 18872 17418 gene locus_tag LOCUS_11320 gene ppsR 18872 17418 CDS product transcriptional regulator PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388384.1 protein_id gnl|my_center|LOCUS_11320 19848 18946 gene locus_tag LOCUS_11330 gene ppaA 19848 18946 CDS product oxygen-sensing regulator PpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720447.1 protein_id gnl|my_center|LOCUS_11330 20302 20835 gene locus_tag LOCUS_11340 20302 20835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 20832 22082 gene locus_tag LOCUS_11350 20832 22082 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388381.1 protein_id gnl|my_center|LOCUS_11350 22140 23813 gene locus_tag LOCUS_11360 gene bchB 22140 23813 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388380.1 protein_id gnl|my_center|LOCUS_11360 23788 23997 gene locus_tag LOCUS_11370 23788 23997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 23994 24923 gene locus_tag LOCUS_11380 gene bchL 23994 24923 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388378.1 protein_id gnl|my_center|LOCUS_11380 24923 25624 gene locus_tag LOCUS_11390 gene bchM 24923 25624 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388377.1 protein_id gnl|my_center|LOCUS_11390 25621 27054 gene locus_tag LOCUS_11400 25621 27054 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388376.1 protein_id gnl|my_center|LOCUS_11400 27095 27871 gene locus_tag LOCUS_11410 gene puhA 27095 27871 CDS product photosynthetic reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388375.1 protein_id gnl|my_center|LOCUS_11410 27868 28533 gene locus_tag LOCUS_11420 gene puhB 27868 28533 CDS product photosynthetic complex putative assembly protein PuhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388374.1 protein_id gnl|my_center|LOCUS_11420 28547 29020 gene locus_tag LOCUS_11430 28547 29020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 29017 29337 gene locus_tag LOCUS_11440 29017 29337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720458.1 protein_id gnl|my_center|LOCUS_11440 29334 30413 gene locus_tag LOCUS_11450 gene acsF 29334 30413 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338129.1 protein_id gnl|my_center|LOCUS_11450 30423 31295 gene locus_tag LOCUS_11460 gene puhE 30423 31295 CDS product putative photosynthetic complex assembly protein PuhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388372.1 protein_id gnl|my_center|LOCUS_11460 31325 32056 gene locus_tag LOCUS_11470 31325 32056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11470 32053 32592 gene locus_tag LOCUS_11480 32053 32592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11480 33571 32603 gene locus_tag LOCUS_11490 gene pufM 33571 32603 CDS product photosynthetic reaction center subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390722.1 protein_id gnl|my_center|LOCUS_11490 34516 33692 gene locus_tag LOCUS_11500 gene pufL 34516 33692 CDS product photosynthetic reaction center subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390723.1 protein_id gnl|my_center|LOCUS_11500 34908 35087 gene locus_tag LOCUS_11510 34908 35087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 35342 35106 gene locus_tag LOCUS_11520 35342 35106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 36876 35425 gene locus_tag LOCUS_11530 gene bchZ 36876 35425 CDS product chlorophyllide a reductase subunit Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390726.1 protein_id gnl|my_center|LOCUS_11530 <37610 36876 gene locus_tag LOCUS_11540 <37610 36876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338110.1:chlorophyllide a reductase subunit Y >Feature sequence024 344 1117 gene locus_tag LOCUS_11550 344 1117 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083606.1 protein_id gnl|my_center|LOCUS_11550 1114 1440 gene locus_tag LOCUS_11560 1114 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11560 1430 3844 gene locus_tag LOCUS_11570 gene infB 1430 3844 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083605.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11570 3943 4371 gene locus_tag LOCUS_11580 gene rbfA 3943 4371 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083604.1 protein_id gnl|my_center|LOCUS_11580 4364 5311 gene locus_tag LOCUS_11590 gene truB 4364 5311 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172518.1 protein_id gnl|my_center|LOCUS_11590 5703 5972 gene locus_tag LOCUS_11600 gene rpsO 5703 5972 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309908.1 protein_id gnl|my_center|LOCUS_11600 6239 8407 gene locus_tag LOCUS_11610 gene pnp 6239 8407 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970644.1 protein_id gnl|my_center|LOCUS_11610 8605 9240 gene locus_tag LOCUS_11620 8605 9240 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038740.1 protein_id gnl|my_center|LOCUS_11620 10413 9415 gene locus_tag LOCUS_11630 10413 9415 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083626.1 protein_id gnl|my_center|LOCUS_11630 10889 10503 gene locus_tag LOCUS_11640 10889 10503 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 protein_id gnl|my_center|LOCUS_11640 11425 10886 gene locus_tag LOCUS_11650 11425 10886 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083471.1 protein_id gnl|my_center|LOCUS_11650 12630 11452 gene locus_tag LOCUS_11660 12630 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 13337 12627 gene locus_tag LOCUS_11670 13337 12627 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_11670 13600 14091 gene locus_tag LOCUS_11680 gene secB 13600 14091 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083468.1 protein_id gnl|my_center|LOCUS_11680 14265 15008 gene locus_tag LOCUS_11690 14265 15008 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814694.1 protein_id gnl|my_center|LOCUS_11690 15724 15017 gene locus_tag LOCUS_11700 gene dnaQ 15724 15017 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083467.1 protein_id gnl|my_center|LOCUS_11700 16343 15717 gene locus_tag LOCUS_11710 gene coaE 16343 15717 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639852.1 protein_id gnl|my_center|LOCUS_11710 17736 16387 gene locus_tag LOCUS_11720 17736 16387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 18563 17733 gene locus_tag LOCUS_11730 18563 17733 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083464.1 protein_id gnl|my_center|LOCUS_11730 19019 20059 gene locus_tag LOCUS_11740 gene hemE 19019 20059 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085186.1 protein_id gnl|my_center|LOCUS_11740 20090 20512 gene locus_tag LOCUS_11750 gene hemJ 20090 20512 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528731.1 protein_id gnl|my_center|LOCUS_11750 20731 21996 gene locus_tag LOCUS_11760 gene rho 20731 21996 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083462.1 protein_id gnl|my_center|LOCUS_11760 22048 23361 gene locus_tag LOCUS_11770 gene mnmE 22048 23361 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083461.1 protein_id gnl|my_center|LOCUS_11770 23424 25310 gene locus_tag LOCUS_11780 gene mnmG 23424 25310 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528734.1 protein_id gnl|my_center|LOCUS_11780 25333 25980 gene locus_tag LOCUS_11790 gene rsmG 25333 25980 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178639.1 protein_id gnl|my_center|LOCUS_11790 25977 26807 gene locus_tag LOCUS_11800 25977 26807 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528736.1 protein_id gnl|my_center|LOCUS_11800 26825 27712 gene locus_tag LOCUS_11810 26825 27712 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311060.1 protein_id gnl|my_center|LOCUS_11810 28064 27717 gene locus_tag LOCUS_11820 28064 27717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 28609 27971 gene locus_tag LOCUS_11830 28609 27971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 29178 28627 gene locus_tag LOCUS_11840 29178 28627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 31789 29165 gene locus_tag LOCUS_11850 gene leuS 31789 29165 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083454.1 protein_id gnl|my_center|LOCUS_11850 31885 32550 gene locus_tag LOCUS_11860 31885 32550 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083450.1 protein_id gnl|my_center|LOCUS_11860 33132 32563 gene locus_tag LOCUS_11870 33132 32563 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171578751.1 protein_id gnl|my_center|LOCUS_11870 33214 33900 gene locus_tag LOCUS_11880 33214 33900 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310886.1 protein_id gnl|my_center|LOCUS_11880 33904 34368 gene locus_tag LOCUS_11890 33904 34368 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083447.1 protein_id gnl|my_center|LOCUS_11890 35191 34376 gene locus_tag LOCUS_11900 gene xth 35191 34376 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083446.1 protein_id gnl|my_center|LOCUS_11900 36100 35276 gene locus_tag LOCUS_11910 36100 35276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence025 <1 2005 gene locus_tag LOCUS_11920 <1 2005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919805.1:NADH-quinone oxidoreductase subunit L 2010 3521 gene locus_tag LOCUS_11930 2010 3521 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975094.1 protein_id gnl|my_center|LOCUS_11930 3533 4960 gene locus_tag LOCUS_11940 gene nuoN 3533 4960 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087671.1 protein_id gnl|my_center|LOCUS_11940 5085 5861 gene locus_tag LOCUS_11950 5085 5861 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087670.1 protein_id gnl|my_center|LOCUS_11950 5982 7652 gene locus_tag LOCUS_11960 5982 7652 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171719.1 protein_id gnl|my_center|LOCUS_11960 7681 8085 gene locus_tag LOCUS_11970 gene mce 7681 8085 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_11970 8090 8503 gene locus_tag LOCUS_11980 8090 8503 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762436.1 protein_id gnl|my_center|LOCUS_11980 8500 8730 gene locus_tag LOCUS_11990 8500 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 9177 9731 gene locus_tag LOCUS_12000 9177 9731 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027161524.1 protein_id gnl|my_center|LOCUS_12000 9736 10401 gene locus_tag LOCUS_12010 9736 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 10401 10871 gene locus_tag LOCUS_12020 10401 10871 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919458.1 protein_id gnl|my_center|LOCUS_12020 10879 11976 gene locus_tag LOCUS_12030 gene queA 10879 11976 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969322.1 protein_id gnl|my_center|LOCUS_12030 12156 12818 gene locus_tag LOCUS_12040 12156 12818 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086826.1 protein_id gnl|my_center|LOCUS_12040 12975 14393 gene locus_tag LOCUS_12050 gene der 12975 14393 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972209.1 protein_id gnl|my_center|LOCUS_12050 15307 14567 gene locus_tag LOCUS_12060 15307 14567 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086835.1 protein_id gnl|my_center|LOCUS_12060 16954 15467 gene locus_tag LOCUS_12070 gene purF 16954 15467 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086836.1 protein_id gnl|my_center|LOCUS_12070 17681 16998 gene locus_tag LOCUS_12080 17681 16998 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379721.1 protein_id gnl|my_center|LOCUS_12080 19185 17788 gene locus_tag LOCUS_12090 gene radA 19185 17788 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086838.1 protein_id gnl|my_center|LOCUS_12090 20472 19342 gene locus_tag LOCUS_12100 gene alr 20472 19342 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967543.1 protein_id gnl|my_center|LOCUS_12100 21956 20469 gene locus_tag LOCUS_12110 21956 20469 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086847.1 protein_id gnl|my_center|LOCUS_12110 22689 22126 gene locus_tag LOCUS_12120 gene rplI 22689 22126 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532521.1 protein_id gnl|my_center|LOCUS_12120 23712 22750 gene locus_tag LOCUS_12130 23712 22750 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086853.1 protein_id gnl|my_center|LOCUS_12130 24114 23869 gene locus_tag LOCUS_12140 gene rpsR 24114 23869 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007592020.1 protein_id gnl|my_center|LOCUS_12140 24576 24118 gene locus_tag LOCUS_12150 24576 24118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 24903 25838 gene locus_tag LOCUS_12160 gene fabD 24903 25838 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086857.1 protein_id gnl|my_center|LOCUS_12160 25881 26618 gene locus_tag LOCUS_12170 gene fabG 25881 26618 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086858.1 protein_id gnl|my_center|LOCUS_12170 26876 27109 gene locus_tag LOCUS_12180 26876 27109 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130699.1 protein_id gnl|my_center|LOCUS_12180 27143 28435 gene locus_tag LOCUS_12190 gene fabF 27143 28435 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086859.1 protein_id gnl|my_center|LOCUS_12190 28864 28637 gene locus_tag LOCUS_12200 28864 28637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 28746 30005 gene locus_tag LOCUS_12210 gene mltG 28746 30005 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086860.1 protein_id gnl|my_center|LOCUS_12210 30128 31009 gene locus_tag LOCUS_12220 30128 31009 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969071.1 protein_id gnl|my_center|LOCUS_12220 31010 31660 gene locus_tag LOCUS_12230 gene gmk 31010 31660 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971396.1 protein_id gnl|my_center|LOCUS_12230 32518 31670 gene locus_tag LOCUS_12240 gene rsmA 32518 31670 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086876.1 protein_id gnl|my_center|LOCUS_12240 33549 32515 gene locus_tag LOCUS_12250 gene pdxA 33549 32515 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086877.1 protein_id gnl|my_center|LOCUS_12250 <36087 33590 gene locus_tag LOCUS_12260 <36087 33590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063921454.1:LPS-assembly protein LptD >Feature sequence026 2968 197 gene locus_tag LOCUS_12270 2968 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3618 3112 gene locus_tag LOCUS_12280 3618 3112 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974971.1 protein_id gnl|my_center|LOCUS_12280 4853 3630 gene locus_tag LOCUS_12290 4853 3630 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389823.1 protein_id gnl|my_center|LOCUS_12290 5856 4942 gene locus_tag LOCUS_12300 gene gcvA 5856 4942 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813028.1 protein_id gnl|my_center|LOCUS_12300 5966 7486 gene locus_tag LOCUS_12310 5966 7486 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067364.1 protein_id gnl|my_center|LOCUS_12310 7626 8843 gene locus_tag LOCUS_12320 7626 8843 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085402.1 protein_id gnl|my_center|LOCUS_12320 8974 10167 gene locus_tag LOCUS_12330 8974 10167 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336759.1 protein_id gnl|my_center|LOCUS_12330 10497 10177 gene locus_tag LOCUS_12340 10497 10177 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_12340 10835 10560 gene locus_tag LOCUS_12350 10835 10560 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_12350 10869 12545 gene locus_tag LOCUS_12360 10869 12545 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926151.1 protein_id gnl|my_center|LOCUS_12360 12655 13161 gene locus_tag LOCUS_12370 12655 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 14145 13189 gene locus_tag LOCUS_12380 gene tal 14145 13189 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309875.1 protein_id gnl|my_center|LOCUS_12380 14348 15223 gene locus_tag LOCUS_12390 14348 15223 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976081.1 protein_id gnl|my_center|LOCUS_12390 15310 16965 gene locus_tag LOCUS_12400 15310 16965 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529320.1 protein_id gnl|my_center|LOCUS_12400 17922 16993 gene locus_tag LOCUS_12410 17922 16993 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086730.1 protein_id gnl|my_center|LOCUS_12410 18043 19539 gene locus_tag LOCUS_12420 18043 19539 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529086.1 protein_id gnl|my_center|LOCUS_12420 19555 19824 gene locus_tag LOCUS_12430 19555 19824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 19825 20247 gene locus_tag LOCUS_12440 19825 20247 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096578551.1 protein_id gnl|my_center|LOCUS_12440 20244 21398 gene locus_tag LOCUS_12450 20244 21398 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086732.1 protein_id gnl|my_center|LOCUS_12450 21740 21402 gene locus_tag LOCUS_12460 21740 21402 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_12460 21990 21712 gene locus_tag LOCUS_12470 21990 21712 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_12470 22032 22934 gene locus_tag LOCUS_12480 gene mmsB 22032 22934 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531206.1 protein_id gnl|my_center|LOCUS_12480 22978 23934 gene locus_tag LOCUS_12490 gene nudC 22978 23934 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090845.1 protein_id gnl|my_center|LOCUS_12490 23981 24709 gene locus_tag LOCUS_12500 23981 24709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 25616 24762 gene locus_tag LOCUS_12510 25616 24762 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_12510 26372 25635 gene locus_tag LOCUS_12520 26372 25635 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084239.1 protein_id gnl|my_center|LOCUS_12520 26576 27115 gene locus_tag LOCUS_12530 26576 27115 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084240.1 protein_id gnl|my_center|LOCUS_12530 27311 29179 gene locus_tag LOCUS_12540 27311 29179 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173514.1 protein_id gnl|my_center|LOCUS_12540 29228 29518 gene locus_tag LOCUS_12550 29228 29518 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074357.1 protein_id gnl|my_center|LOCUS_12550 29515 29880 gene locus_tag LOCUS_12560 29515 29880 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141056643.1 protein_id gnl|my_center|LOCUS_12560 29957 31054 gene locus_tag LOCUS_12570 29957 31054 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527941.1 protein_id gnl|my_center|LOCUS_12570 31056 32231 gene locus_tag LOCUS_12580 31056 32231 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527942.1 protein_id gnl|my_center|LOCUS_12580 32228 35278 gene locus_tag LOCUS_12590 32228 35278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 35436 35909 gene locus_tag LOCUS_12600 gene greA 35436 35909 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence027 804 376 gene locus_tag LOCUS_12610 804 376 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535003.1 protein_id gnl|my_center|LOCUS_12610 1674 865 gene locus_tag LOCUS_12620 1674 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2878 1667 gene locus_tag LOCUS_12630 2878 1667 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531771.1 protein_id gnl|my_center|LOCUS_12630 3555 2875 gene locus_tag LOCUS_12640 3555 2875 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087891.1 protein_id gnl|my_center|LOCUS_12640 3998 3603 gene locus_tag LOCUS_12650 3998 3603 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_12650 4121 4957 gene locus_tag LOCUS_12660 4121 4957 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171560.1 protein_id gnl|my_center|LOCUS_12660 6050 4914 gene locus_tag LOCUS_12670 6050 4914 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969160.1 protein_id gnl|my_center|LOCUS_12670 6559 6269 gene locus_tag LOCUS_12680 6559 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 6675 7073 gene locus_tag LOCUS_12690 6675 7073 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537642.1 protein_id gnl|my_center|LOCUS_12690 7092 8468 gene locus_tag LOCUS_12700 7092 8468 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_12700 8926 8726 gene locus_tag LOCUS_12710 8926 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 9371 9138 gene locus_tag LOCUS_12720 9371 9138 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315820.1 protein_id gnl|my_center|LOCUS_12720 9659 9492 gene locus_tag LOCUS_12730 gene rpmG 9659 9492 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707650.1 protein_id gnl|my_center|LOCUS_12730 10550 9816 gene locus_tag LOCUS_12740 10550 9816 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 protein_id gnl|my_center|LOCUS_12740 10993 10547 gene locus_tag LOCUS_12750 10993 10547 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252183.1 protein_id gnl|my_center|LOCUS_12750 11811 10993 gene locus_tag LOCUS_12760 11811 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12760 13271 11733 gene locus_tag LOCUS_12770 13271 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12770 13920 15200 gene locus_tag LOCUS_12780 gene urtA 13920 15200 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173500.1 protein_id gnl|my_center|LOCUS_12780 15349 16950 gene locus_tag LOCUS_12790 gene urtB 15349 16950 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084266.1 protein_id gnl|my_center|LOCUS_12790 17152 16925 gene locus_tag LOCUS_12800 17152 16925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 17252 18070 gene locus_tag LOCUS_12810 17252 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12810 18067 18831 gene locus_tag LOCUS_12820 gene urtD 18067 18831 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531846.1 protein_id gnl|my_center|LOCUS_12820 18828 19529 gene locus_tag LOCUS_12830 gene urtE 18828 19529 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972304.1 protein_id gnl|my_center|LOCUS_12830 19693 20772 gene locus_tag LOCUS_12840 gene ppk2 19693 20772 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809186.1 protein_id gnl|my_center|LOCUS_12840 21123 20818 gene locus_tag LOCUS_12850 21123 20818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 21314 22315 gene locus_tag LOCUS_12860 gene gnd 21314 22315 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089498.1 protein_id gnl|my_center|LOCUS_12860 22322 22849 gene locus_tag LOCUS_12870 22322 22849 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089501.1 protein_id gnl|my_center|LOCUS_12870 23266 22865 gene locus_tag LOCUS_12880 23266 22865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530034.1 protein_id gnl|my_center|LOCUS_12880 24717 23266 gene locus_tag LOCUS_12890 24717 23266 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939668.1 protein_id gnl|my_center|LOCUS_12890 24898 24982 gene locus_tag LOCUS_t00060 24898 24982 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25069 26502 gene locus_tag LOCUS_12900 gene tig 25069 26502 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087709.1 protein_id gnl|my_center|LOCUS_12900 26675 27298 gene locus_tag LOCUS_12910 26675 27298 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087708.1 protein_id gnl|my_center|LOCUS_12910 27585 28778 gene locus_tag LOCUS_12920 gene clpX 27585 28778 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008547851.1 protein_id gnl|my_center|LOCUS_12920 29297 31720 gene locus_tag LOCUS_12930 gene lon 29297 31720 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087707.1 protein_id gnl|my_center|LOCUS_12930 31834 33639 gene locus_tag LOCUS_12940 31834 33639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 33725 33650 gene locus_tag LOCUS_t00070 33725 33650 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 33916 33992 gene locus_tag LOCUS_t00080 33916 33992 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 35612 34374 gene locus_tag LOCUS_12950 35612 34374 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163929.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence028 <1 935 gene locus_tag LOCUS_12960 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086385.1:serine/threonine-protein kinase 1237 956 gene locus_tag LOCUS_12970 1237 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967720.1 protein_id gnl|my_center|LOCUS_12970 2904 1285 gene locus_tag LOCUS_12980 2904 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4581 3025 gene locus_tag LOCUS_12990 4581 3025 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967728.1 protein_id gnl|my_center|LOCUS_12990 5953 4739 gene locus_tag LOCUS_13000 5953 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 7470 5944 gene locus_tag LOCUS_13010 7470 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 7648 8916 gene locus_tag LOCUS_13020 7648 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 8913 9380 gene locus_tag LOCUS_13030 8913 9380 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_13030 9429 11216 gene locus_tag LOCUS_13040 9429 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 11610 11203 gene locus_tag LOCUS_13050 11610 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 11778 11705 gene locus_tag LOCUS_t00090 11778 11705 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12265 11813 gene locus_tag LOCUS_13060 12265 11813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 14928 12415 gene locus_tag LOCUS_13070 14928 12415 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992271.1 protein_id gnl|my_center|LOCUS_13070 15841 15014 gene locus_tag LOCUS_13080 15841 15014 CDS product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975227.1 protein_id gnl|my_center|LOCUS_13080 16922 15903 gene locus_tag LOCUS_13090 16922 15903 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_13090 16797 16843 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17597 16962 gene locus_tag LOCUS_13100 17597 16962 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083844.1 protein_id gnl|my_center|LOCUS_13100 18120 17614 gene locus_tag LOCUS_13110 18120 17614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 18442 18358 gene locus_tag LOCUS_t00100 18442 18358 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 18656 19501 gene locus_tag LOCUS_13120 gene rlmB 18656 19501 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921492.1 protein_id gnl|my_center|LOCUS_13120 20035 19514 gene locus_tag LOCUS_13130 20035 19514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 20334 22007 gene locus_tag LOCUS_13140 20334 22007 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463736.1 protein_id gnl|my_center|LOCUS_13140 22782 22348 gene locus_tag LOCUS_13150 22782 22348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 23096 22779 gene locus_tag LOCUS_13160 23096 22779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 23308 23096 gene locus_tag LOCUS_13170 23308 23096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 23601 23305 gene locus_tag LOCUS_13180 23601 23305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 24290 23598 gene locus_tag LOCUS_13190 24290 23598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 24688 24287 gene locus_tag LOCUS_13200 24688 24287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 25035 24685 gene locus_tag LOCUS_13210 25035 24685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 25766 25032 gene locus_tag LOCUS_13220 25766 25032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 26040 25849 gene locus_tag LOCUS_13230 26040 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 26501 26563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26704 27075 gene locus_tag LOCUS_13240 26704 27075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 27199 28833 gene locus_tag LOCUS_13250 27199 28833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 28844 29122 gene locus_tag LOCUS_13260 28844 29122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 29115 29630 gene locus_tag LOCUS_13270 29115 29630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 29627 30004 gene locus_tag LOCUS_13280 29627 30004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 30016 30231 gene locus_tag LOCUS_13290 30016 30231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 30240 30548 gene locus_tag LOCUS_13300 30240 30548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 30915 30514 gene locus_tag LOCUS_13310 30915 30514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 31289 30912 gene locus_tag LOCUS_13320 31289 30912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 31524 31291 gene locus_tag LOCUS_13330 31524 31291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 32546 31521 gene locus_tag LOCUS_13340 32546 31521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 32548 32597 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33255 32881 gene locus_tag LOCUS_13350 33255 32881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 33665 33252 gene locus_tag LOCUS_13360 33665 33252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 33859 33653 gene locus_tag LOCUS_13370 33859 33653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 34179 33856 gene locus_tag LOCUS_13380 34179 33856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 35015 34179 gene locus_tag LOCUS_13390 35015 34179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence029 564 178 gene locus_tag LOCUS_13400 564 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1723 671 gene locus_tag LOCUS_13410 1723 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2858 1833 gene locus_tag LOCUS_13420 2858 1833 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965922.1 protein_id gnl|my_center|LOCUS_13420 4825 3041 gene locus_tag LOCUS_13430 4825 3041 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 protein_id gnl|my_center|LOCUS_13430 7002 5323 gene locus_tag LOCUS_13440 7002 5323 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971317.1 protein_id gnl|my_center|LOCUS_13440 7249 8010 gene locus_tag LOCUS_13450 7249 8010 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085310.1 protein_id gnl|my_center|LOCUS_13450 8117 9547 gene locus_tag LOCUS_13460 8117 9547 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366505.1 protein_id gnl|my_center|LOCUS_13460 9560 10564 gene locus_tag LOCUS_13470 gene cydB 9560 10564 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391964.1 protein_id gnl|my_center|LOCUS_13470 10661 11551 gene locus_tag LOCUS_13480 10661 11551 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_13480 12522 11557 gene locus_tag LOCUS_13490 12522 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 12589 13266 gene locus_tag LOCUS_13500 12589 13266 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086528.1 protein_id gnl|my_center|LOCUS_13500 13263 14681 gene locus_tag LOCUS_13510 13263 14681 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086529.1 protein_id gnl|my_center|LOCUS_13510 14725 15123 gene locus_tag LOCUS_13520 14725 15123 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061700.1 protein_id gnl|my_center|LOCUS_13520 15171 16229 gene locus_tag LOCUS_13530 gene mutY 15171 16229 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921414.1 protein_id gnl|my_center|LOCUS_13530 17436 16237 gene locus_tag LOCUS_13540 17436 16237 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968922.1 protein_id gnl|my_center|LOCUS_13540 18389 17778 gene locus_tag LOCUS_13550 18389 17778 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971095.1 protein_id gnl|my_center|LOCUS_13550 18483 18797 gene locus_tag LOCUS_13560 18483 18797 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388819.1 protein_id gnl|my_center|LOCUS_13560 18805 19113 gene locus_tag LOCUS_13570 18805 19113 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969010.1 protein_id gnl|my_center|LOCUS_13570 20340 19138 gene locus_tag LOCUS_13580 20340 19138 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023808673.1 protein_id gnl|my_center|LOCUS_13580 20453 20941 gene locus_tag LOCUS_13590 20453 20941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 20985 21482 gene locus_tag LOCUS_13600 20985 21482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 21590 22210 gene locus_tag LOCUS_13610 21590 22210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 24595 23447 gene locus_tag LOCUS_13620 24595 23447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 24477 25775 gene locus_tag LOCUS_13630 24477 25775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13630 26005 26355 gene locus_tag LOCUS_13640 26005 26355 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390995.1 protein_id gnl|my_center|LOCUS_13640 26402 27163 gene locus_tag LOCUS_13650 26402 27163 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 protein_id gnl|my_center|LOCUS_13650 27225 27452 gene locus_tag LOCUS_13660 27225 27452 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006206606.1 protein_id gnl|my_center|LOCUS_13660 27545 28162 gene locus_tag LOCUS_13670 27545 28162 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084005.1 protein_id gnl|my_center|LOCUS_13670 28175 28651 gene locus_tag LOCUS_13680 28175 28651 CDS product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084004.1 protein_id gnl|my_center|LOCUS_13680 30161 28929 gene locus_tag LOCUS_13690 30161 28929 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085568.1 protein_id gnl|my_center|LOCUS_13690 30336 30599 gene locus_tag LOCUS_13700 30336 30599 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332579.1 protein_id gnl|my_center|LOCUS_13700 30596 31021 gene locus_tag LOCUS_13710 30596 31021 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085221.1 protein_id gnl|my_center|LOCUS_13710 32190 31030 gene locus_tag LOCUS_13720 32190 31030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13720 32746 32078 gene locus_tag LOCUS_13730 32746 32078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13730 33126 32740 gene locus_tag LOCUS_13740 33126 32740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence030 366 1421 gene locus_tag LOCUS_13750 366 1421 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532104.1 protein_id gnl|my_center|LOCUS_13750 1512 2090 gene locus_tag LOCUS_13760 gene thpR 1512 2090 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083289.1 protein_id gnl|my_center|LOCUS_13760 2093 2383 gene locus_tag LOCUS_13770 2093 2383 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 protein_id gnl|my_center|LOCUS_13770 3163 2393 gene locus_tag LOCUS_13780 3163 2393 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 protein_id gnl|my_center|LOCUS_13780 3236 4402 gene locus_tag LOCUS_13790 gene ftsY 3236 4402 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083304.1 protein_id gnl|my_center|LOCUS_13790 4446 5075 gene locus_tag LOCUS_13800 4446 5075 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067297.1 protein_id gnl|my_center|LOCUS_13800 5863 5078 gene locus_tag LOCUS_13810 5863 5078 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_13810 6058 6432 gene locus_tag LOCUS_13820 6058 6432 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965096.1 protein_id gnl|my_center|LOCUS_13820 7414 6440 gene locus_tag LOCUS_13830 7414 6440 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083359.1 protein_id gnl|my_center|LOCUS_13830 7610 8257 gene locus_tag LOCUS_13840 7610 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 7990 8041 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8343 9563 gene locus_tag LOCUS_13850 gene rlmN 8343 9563 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083356.1 protein_id gnl|my_center|LOCUS_13850 9568 10047 gene locus_tag LOCUS_13860 9568 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 11870 10197 gene locus_tag LOCUS_13870 gene ggt 11870 10197 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814321.1 protein_id gnl|my_center|LOCUS_13870 12016 12624 gene locus_tag LOCUS_13880 12016 12624 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921284.1 protein_id gnl|my_center|LOCUS_13880 12743 13525 gene locus_tag LOCUS_13890 12743 13525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 13525 14130 gene locus_tag LOCUS_13900 13525 14130 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528995.1 protein_id gnl|my_center|LOCUS_13900 14896 14138 gene locus_tag LOCUS_13910 14896 14138 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083296.1 protein_id gnl|my_center|LOCUS_13910 15932 14964 gene locus_tag LOCUS_13920 15932 14964 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086588.1 protein_id gnl|my_center|LOCUS_13920 17095 16073 gene locus_tag LOCUS_13930 17095 16073 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531222.1 protein_id gnl|my_center|LOCUS_13930 17395 17111 gene locus_tag LOCUS_13940 17395 17111 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973871.1 protein_id gnl|my_center|LOCUS_13940 17634 17392 gene locus_tag LOCUS_13950 17634 17392 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875306.1 protein_id gnl|my_center|LOCUS_13950 18441 17695 gene locus_tag LOCUS_13960 gene fabG 18441 17695 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_13960 19751 18438 gene locus_tag LOCUS_13970 19751 18438 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086589.1 protein_id gnl|my_center|LOCUS_13970 20889 19762 gene locus_tag LOCUS_13980 20889 19762 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086590.1 protein_id gnl|my_center|LOCUS_13980 21359 20886 gene locus_tag LOCUS_13990 21359 20886 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975879.1 protein_id gnl|my_center|LOCUS_13990 21822 21541 gene locus_tag LOCUS_14000 21822 21541 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007592476.1 protein_id gnl|my_center|LOCUS_14000 22073 24022 gene locus_tag LOCUS_14010 22073 24022 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917955.1 protein_id gnl|my_center|LOCUS_14010 26834 24135 gene locus_tag LOCUS_14020 gene acnA 26834 24135 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393923.1 protein_id gnl|my_center|LOCUS_14020 27071 27688 gene locus_tag LOCUS_14030 gene ccmA 27071 27688 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083298.1 protein_id gnl|my_center|LOCUS_14030 27685 28353 gene locus_tag LOCUS_14040 gene ccmB 27685 28353 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083299.1 protein_id gnl|my_center|LOCUS_14040 28600 28358 gene locus_tag LOCUS_14050 28600 28358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 28928 29689 gene locus_tag LOCUS_14060 28928 29689 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083300.1 protein_id gnl|my_center|LOCUS_14060 29703 29876 gene locus_tag LOCUS_14070 29703 29876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 29873 30496 gene locus_tag LOCUS_14080 29873 30496 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 protein_id gnl|my_center|LOCUS_14080 31344 30649 gene locus_tag LOCUS_14090 gene purQ 31344 30649 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088468.1 protein_id gnl|my_center|LOCUS_14090 31591 31349 gene locus_tag LOCUS_14100 gene purS 31591 31349 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088473.1 protein_id gnl|my_center|LOCUS_14100 32309 31674 gene locus_tag LOCUS_14110 32309 31674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 <33120 32327 gene locus_tag LOCUS_14120 <33120 32327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008974302.1:phosphoribosylaminoimidazolesuccinocarboxamide synthase >Feature sequence031 1674 841 gene locus_tag LOCUS_14130 gene kduI 1674 841 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975773.1 protein_id gnl|my_center|LOCUS_14130 3142 1799 gene locus_tag LOCUS_14140 gene uxaC 3142 1799 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338259.1 protein_id gnl|my_center|LOCUS_14140 3328 4071 gene locus_tag LOCUS_14150 3328 4071 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244084.1 protein_id gnl|my_center|LOCUS_14150 5087 5587 gene locus_tag LOCUS_14160 5087 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14160 6535 5609 gene locus_tag LOCUS_14170 6535 5609 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083278.1 protein_id gnl|my_center|LOCUS_14170 6956 6606 gene locus_tag LOCUS_14180 6956 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 7061 9247 gene locus_tag LOCUS_14190 7061 9247 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083277.1 protein_id gnl|my_center|LOCUS_14190 9764 9799 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9819 10085 gene locus_tag LOCUS_14200 9819 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14200 10085 11614 gene locus_tag LOCUS_14210 gene atpA 10085 11614 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083274.1 protein_id gnl|my_center|LOCUS_14210 11717 12586 gene locus_tag LOCUS_14220 11717 12586 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083273.1 protein_id gnl|my_center|LOCUS_14220 12653 14116 gene locus_tag LOCUS_14230 gene atpD 12653 14116 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072597055.1 protein_id gnl|my_center|LOCUS_14230 14223 14636 gene locus_tag LOCUS_14240 14223 14636 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067132.1 protein_id gnl|my_center|LOCUS_14240 15079 14693 gene locus_tag LOCUS_14250 15079 14693 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703163.1 protein_id gnl|my_center|LOCUS_14250 18212 15120 gene locus_tag LOCUS_14260 gene putA 18212 15120 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_14260 18343 18798 gene locus_tag LOCUS_14270 18343 18798 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089995.1 protein_id gnl|my_center|LOCUS_14270 19828 18821 gene locus_tag LOCUS_14280 19828 18821 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391427.1 protein_id gnl|my_center|LOCUS_14280 20123 21184 gene locus_tag LOCUS_14290 20123 21184 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_14290 21331 22125 gene locus_tag LOCUS_14300 21331 22125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 protein_id gnl|my_center|LOCUS_14300 22122 22892 gene locus_tag LOCUS_14310 22122 22892 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 protein_id gnl|my_center|LOCUS_14310 23672 23055 gene locus_tag LOCUS_14320 23672 23055 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329564.1 protein_id gnl|my_center|LOCUS_14320 23810 24073 gene locus_tag LOCUS_14330 23810 24073 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_14330 24490 24086 gene locus_tag LOCUS_14340 24490 24086 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_14340 24717 24487 gene locus_tag LOCUS_14350 24717 24487 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_14350 25918 24725 gene locus_tag LOCUS_14360 25918 24725 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563408.1 protein_id gnl|my_center|LOCUS_14360 27128 25959 gene locus_tag LOCUS_14370 27128 25959 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086701.1 protein_id gnl|my_center|LOCUS_14370 28171 27269 gene locus_tag LOCUS_14380 28171 27269 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083045.1 protein_id gnl|my_center|LOCUS_14380 28364 29953 gene locus_tag LOCUS_14390 28364 29953 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084138.1 protein_id gnl|my_center|LOCUS_14390 29964 30866 gene locus_tag LOCUS_14400 29964 30866 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_14400 31013 31957 gene locus_tag LOCUS_14410 31013 31957 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970130.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence032 <1 616 gene locus_tag LOCUS_14420 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838136.1:histidine kinase 1112 873 gene locus_tag LOCUS_14430 1112 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1029 1754 gene locus_tag LOCUS_14440 1029 1754 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087316.1 protein_id gnl|my_center|LOCUS_14440 1897 3531 gene locus_tag LOCUS_14450 1897 3531 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087315.1 protein_id gnl|my_center|LOCUS_14450 3545 4537 gene locus_tag LOCUS_14460 3545 4537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087314.1 protein_id gnl|my_center|LOCUS_14460 4534 5535 gene locus_tag LOCUS_14470 4534 5535 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087313.1 protein_id gnl|my_center|LOCUS_14470 5535 6467 gene locus_tag LOCUS_14480 5535 6467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967433.1 protein_id gnl|my_center|LOCUS_14480 6536 7339 gene locus_tag LOCUS_14490 6536 7339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087311.1 protein_id gnl|my_center|LOCUS_14490 7629 8201 gene locus_tag LOCUS_14500 7629 8201 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_14500 8201 8782 gene locus_tag LOCUS_14510 8201 8782 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606167.1 protein_id gnl|my_center|LOCUS_14510 9723 8893 gene locus_tag LOCUS_14520 9723 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 10260 9736 gene locus_tag LOCUS_14530 10260 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 10629 11825 gene locus_tag LOCUS_14540 10629 11825 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114098.1 protein_id gnl|my_center|LOCUS_14540 12008 11934 gene locus_tag LOCUS_t00110 12008 11934 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12213 12289 gene locus_tag LOCUS_t00120 12213 12289 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13024 12368 gene locus_tag LOCUS_14550 13024 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 13122 13307 gene locus_tag LOCUS_14560 13122 13307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 13965 13384 gene locus_tag LOCUS_14570 13965 13384 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532736.1 protein_id gnl|my_center|LOCUS_14570 14092 15006 gene locus_tag LOCUS_14580 14092 15006 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965893.1 protein_id gnl|my_center|LOCUS_14580 15786 15010 gene locus_tag LOCUS_14590 15786 15010 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085404.1 protein_id gnl|my_center|LOCUS_14590 15925 16374 gene locus_tag LOCUS_14600 15925 16374 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527979.1 protein_id gnl|my_center|LOCUS_14600 16906 16382 gene locus_tag LOCUS_14610 16906 16382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088311.1 protein_id gnl|my_center|LOCUS_14610 17116 18420 gene locus_tag LOCUS_14620 17116 18420 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_14620 18609 18821 gene locus_tag LOCUS_14630 18609 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 18893 19741 gene locus_tag LOCUS_14640 18893 19741 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529142.1 protein_id gnl|my_center|LOCUS_14640 20360 19764 gene locus_tag LOCUS_14650 20360 19764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 20586 21515 gene locus_tag LOCUS_14660 20586 21515 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085438.1 protein_id gnl|my_center|LOCUS_14660 21757 25686 gene locus_tag LOCUS_14670 21757 25686 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269157.1 protein_id gnl|my_center|LOCUS_14670 25759 26892 gene locus_tag LOCUS_14680 gene aroC 25759 26892 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_14680 26918 28195 gene locus_tag LOCUS_14690 gene ribB 26918 28195 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085401.1 protein_id gnl|my_center|LOCUS_14690 28865 28197 gene locus_tag LOCUS_14700 28865 28197 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707099.1 protein_id gnl|my_center|LOCUS_14700 28946 29791 gene locus_tag LOCUS_14710 gene folP 28946 29791 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337038.1 protein_id gnl|my_center|LOCUS_14710 29788 30162 gene locus_tag LOCUS_14720 gene folB 29788 30162 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544155.1 protein_id gnl|my_center|LOCUS_14720 30152 30667 gene locus_tag LOCUS_14730 gene folK 30152 30667 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531872.1 protein_id gnl|my_center|LOCUS_14730 31517 30675 gene locus_tag LOCUS_14740 gene fabI 31517 30675 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085415.1 protein_id gnl|my_center|LOCUS_14740 32524 31604 gene locus_tag LOCUS_14750 32524 31604 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085412.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence033 1754 162 gene locus_tag LOCUS_14760 gene purH 1754 162 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083410.1 protein_id gnl|my_center|LOCUS_14760 3557 1839 gene locus_tag LOCUS_14770 3557 1839 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_14770 4487 3648 gene locus_tag LOCUS_14780 4487 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4440 4697 gene locus_tag LOCUS_14790 4440 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5801 4875 gene locus_tag LOCUS_14800 gene htpX 5801 4875 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085237.1 protein_id gnl|my_center|LOCUS_14800 5873 6205 gene locus_tag LOCUS_14810 5873 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 7003 6239 gene locus_tag LOCUS_14820 7003 6239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390971.1 protein_id gnl|my_center|LOCUS_14820 8013 7000 gene locus_tag LOCUS_14830 8013 7000 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 protein_id gnl|my_center|LOCUS_14830 9180 8149 gene locus_tag LOCUS_14840 9180 8149 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390967.1 protein_id gnl|my_center|LOCUS_14840 9646 9167 gene locus_tag LOCUS_14850 gene tsaA 9646 9167 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087894.1 protein_id gnl|my_center|LOCUS_14850 10480 9659 gene locus_tag LOCUS_14860 10480 9659 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073705.1 protein_id gnl|my_center|LOCUS_14860 11393 10485 gene locus_tag LOCUS_14870 11393 10485 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_14870 12124 11402 gene locus_tag LOCUS_14880 12124 11402 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_14880 12831 12130 gene locus_tag LOCUS_14890 12831 12130 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 protein_id gnl|my_center|LOCUS_14890 12931 13827 gene locus_tag LOCUS_14900 12931 13827 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970364.1 protein_id gnl|my_center|LOCUS_14900 14973 13837 gene locus_tag LOCUS_14910 14973 13837 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401700.1 protein_id gnl|my_center|LOCUS_14910 15086 16906 gene locus_tag LOCUS_14920 15086 16906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391308.1 protein_id gnl|my_center|LOCUS_14920 16981 17355 gene locus_tag LOCUS_14930 gene hisE 16981 17355 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084141.1 protein_id gnl|my_center|LOCUS_14930 17530 17606 gene locus_tag LOCUS_t00130 17530 17606 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19749 18241 gene locus_tag LOCUS_14940 19749 18241 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967310.1 protein_id gnl|my_center|LOCUS_14940 19839 20849 gene locus_tag LOCUS_14950 19839 20849 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192764.1 protein_id gnl|my_center|LOCUS_14950 21127 21777 gene locus_tag LOCUS_14960 21127 21777 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965346.1 protein_id gnl|my_center|LOCUS_14960 21774 23693 gene locus_tag LOCUS_14970 21774 23693 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084153.1 protein_id gnl|my_center|LOCUS_14970 24026 23700 gene locus_tag LOCUS_14980 24026 23700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 24242 26116 gene locus_tag LOCUS_14990 24242 26116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 24541 24635 gene locus_tag LOCUS_t00140 24541 24635 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 26224 26451 gene locus_tag LOCUS_15000 26224 26451 CDS product cysteine rich repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173581.1 protein_id gnl|my_center|LOCUS_15000 26508 27641 gene locus_tag LOCUS_15010 26508 27641 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526828.1 protein_id gnl|my_center|LOCUS_15010 27638 28795 gene locus_tag LOCUS_15020 27638 28795 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967657.1 protein_id gnl|my_center|LOCUS_15020 28795 31956 gene locus_tag LOCUS_15030 28795 31956 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089465.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence034 300 509 gene locus_tag LOCUS_15040 300 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 645 1508 gene locus_tag LOCUS_15050 gene motA 645 1508 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_15050 2078 1614 gene locus_tag LOCUS_15060 2078 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2088 2324 gene locus_tag LOCUS_15070 2088 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2679 2604 gene locus_tag LOCUS_t00150 2679 2604 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2792 3082 gene locus_tag LOCUS_15080 2792 3082 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598721.1 protein_id gnl|my_center|LOCUS_15080 3084 3416 gene locus_tag LOCUS_15090 3084 3416 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174939.1 protein_id gnl|my_center|LOCUS_15090 3486 4178 gene locus_tag LOCUS_15100 3486 4178 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819076.1 protein_id gnl|my_center|LOCUS_15100 4350 4186 gene locus_tag LOCUS_15110 4350 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 4727 4314 gene locus_tag LOCUS_15120 4727 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 5667 4738 gene locus_tag LOCUS_15130 gene xerD 5667 4738 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083022.1 protein_id gnl|my_center|LOCUS_15130 5855 5664 gene locus_tag LOCUS_15140 5855 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 5980 6603 gene locus_tag LOCUS_15150 5980 6603 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 protein_id gnl|my_center|LOCUS_15150 6600 7751 gene locus_tag LOCUS_15160 gene aroB 6600 7751 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529358.1 protein_id gnl|my_center|LOCUS_15160 7846 7925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8423 8427 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8941 8510 gene locus_tag LOCUS_15170 8941 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 10038 9043 gene locus_tag LOCUS_15180 10038 9043 CDS product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808328.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15180 9929 10237 gene locus_tag LOCUS_15190 9929 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 12112 10298 gene locus_tag LOCUS_15200 12112 10298 CDS product glucan ABC transporter ATP-binding protein/ permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084139.1 protein_id gnl|my_center|LOCUS_15200 12253 13020 gene locus_tag LOCUS_15210 12253 13020 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086581.1 protein_id gnl|my_center|LOCUS_15210 13049 13873 gene locus_tag LOCUS_15220 13049 13873 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086582.1 protein_id gnl|my_center|LOCUS_15220 14407 13883 gene locus_tag LOCUS_15230 14407 13883 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965381.1 protein_id gnl|my_center|LOCUS_15230 16946 14412 gene locus_tag LOCUS_15240 16946 14412 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968934.1 protein_id gnl|my_center|LOCUS_15240 17560 18036 gene locus_tag LOCUS_15250 17560 18036 CDS product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532768.1 protein_id gnl|my_center|LOCUS_15250 18068 19303 gene locus_tag LOCUS_15260 18068 19303 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088242.1 protein_id gnl|my_center|LOCUS_15260 20194 19418 gene locus_tag LOCUS_15270 20194 19418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 20655 20200 gene locus_tag LOCUS_15280 20655 20200 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639995.1 protein_id gnl|my_center|LOCUS_15280 21435 20671 gene locus_tag LOCUS_15290 gene gloB 21435 20671 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240047.1 protein_id gnl|my_center|LOCUS_15290 21576 22343 gene locus_tag LOCUS_15300 21576 22343 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 protein_id gnl|my_center|LOCUS_15300 22408 23403 gene locus_tag LOCUS_15310 22408 23403 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083023.1 protein_id gnl|my_center|LOCUS_15310 23583 25022 gene locus_tag LOCUS_15320 23583 25022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 26341 25277 gene locus_tag LOCUS_15330 gene hemH 26341 25277 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973308.1 protein_id gnl|my_center|LOCUS_15330 26616 28118 gene locus_tag LOCUS_15340 26616 28118 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_15340 28115 28813 gene locus_tag LOCUS_15350 28115 28813 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 protein_id gnl|my_center|LOCUS_15350 30056 28824 gene locus_tag LOCUS_15360 30056 28824 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967026.1 protein_id gnl|my_center|LOCUS_15360 31086 30238 gene locus_tag LOCUS_15370 31086 30238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_15370 <31898 31235 gene locus_tag LOCUS_15380 <31898 31235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337371.1:ABC transporter substrate-binding protein >Feature sequence035 704 81 gene locus_tag LOCUS_15390 704 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2460 685 gene locus_tag LOCUS_15400 2460 685 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083348.1 protein_id gnl|my_center|LOCUS_15400 5009 2724 gene locus_tag LOCUS_15410 5009 2724 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327060.1 protein_id gnl|my_center|LOCUS_15410 6992 5160 gene locus_tag LOCUS_15420 6992 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 8909 7074 gene locus_tag LOCUS_15430 8909 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 9097 11841 gene locus_tag LOCUS_15440 gene mutS 9097 11841 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968548.1 protein_id gnl|my_center|LOCUS_15440 12044 11862 gene locus_tag LOCUS_15450 12044 11862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 12386 12150 gene locus_tag LOCUS_15460 12386 12150 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_15460 13255 12383 gene locus_tag LOCUS_15470 13255 12383 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_15470 13976 13272 gene locus_tag LOCUS_15480 13976 13272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 14394 14041 gene locus_tag LOCUS_15490 14394 14041 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533675.1 protein_id gnl|my_center|LOCUS_15490 15810 14476 gene locus_tag LOCUS_15500 15810 14476 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055726633.1 protein_id gnl|my_center|LOCUS_15500 15712 15903 gene locus_tag LOCUS_15510 15712 15903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 15974 16873 gene locus_tag LOCUS_15520 15974 16873 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084250.1 protein_id gnl|my_center|LOCUS_15520 18102 17125 gene locus_tag LOCUS_15530 18102 17125 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084251.1 protein_id gnl|my_center|LOCUS_15530 19090 18113 gene locus_tag LOCUS_15540 19090 18113 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173506.1 protein_id gnl|my_center|LOCUS_15540 20434 19118 gene locus_tag LOCUS_15550 20434 19118 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084253.1 protein_id gnl|my_center|LOCUS_15550 21514 20666 gene locus_tag LOCUS_15560 21514 20666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15560 21881 21402 gene locus_tag LOCUS_15570 21881 21402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15570 22615 21881 gene locus_tag LOCUS_15580 22615 21881 CDS product pilus assembly protein CpaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083492.1 protein_id gnl|my_center|LOCUS_15580 24105 22663 gene locus_tag LOCUS_15590 24105 22663 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173504.1 protein_id gnl|my_center|LOCUS_15590 24881 24102 gene locus_tag LOCUS_15600 gene cpaB 24881 24102 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083494.1 protein_id gnl|my_center|LOCUS_15600 25322 25008 gene locus_tag LOCUS_15610 25322 25008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 25749 25585 gene locus_tag LOCUS_15620 25749 25585 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706435.1 protein_id gnl|my_center|LOCUS_15620 26163 26687 gene locus_tag LOCUS_15630 26163 26687 CDS product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135176341.1 protein_id gnl|my_center|LOCUS_15630 26884 27501 gene locus_tag LOCUS_15640 26884 27501 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086719.1 protein_id gnl|my_center|LOCUS_15640 27510 28133 gene locus_tag LOCUS_15650 27510 28133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 28397 28161 gene locus_tag LOCUS_15660 28397 28161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 28980 28420 gene locus_tag LOCUS_15670 28980 28420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 30050 29142 gene locus_tag LOCUS_15680 30050 29142 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974266.1 protein_id gnl|my_center|LOCUS_15680 30943 30047 gene locus_tag LOCUS_15690 30943 30047 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036918.1 protein_id gnl|my_center|LOCUS_15690 31251 31129 gene locus_tag LOCUS_15700 31251 31129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence036 323 126 gene locus_tag LOCUS_15710 323 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1732 338 gene locus_tag LOCUS_15720 gene fumC 1732 338 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089259.1 protein_id gnl|my_center|LOCUS_15720 2459 1821 gene locus_tag LOCUS_15730 2459 1821 CDS product SspB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531016.1 protein_id gnl|my_center|LOCUS_15730 3287 2949 gene locus_tag LOCUS_15740 3287 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3532 4281 gene locus_tag LOCUS_15750 3532 4281 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089252.1 protein_id gnl|my_center|LOCUS_15750 4278 4760 gene locus_tag LOCUS_15760 4278 4760 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918290.1 protein_id gnl|my_center|LOCUS_15760 4764 5279 gene locus_tag LOCUS_15770 4764 5279 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972020.1 protein_id gnl|my_center|LOCUS_15770 5432 6604 gene locus_tag LOCUS_15780 gene hflK 5432 6604 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_15780 6601 7530 gene locus_tag LOCUS_15790 6601 7530 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089248.1 protein_id gnl|my_center|LOCUS_15790 7549 7734 gene locus_tag LOCUS_15800 7549 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 8978 9403 gene locus_tag LOCUS_15810 8978 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15810 9580 9921 gene locus_tag LOCUS_15820 9580 9921 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_15820 10953 10018 gene locus_tag LOCUS_15830 gene serB 10953 10018 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402824.1 protein_id gnl|my_center|LOCUS_15830 10175 10215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11001 11906 gene locus_tag LOCUS_15840 gene miaA 11001 11906 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089244.1 protein_id gnl|my_center|LOCUS_15840 13370 11910 gene locus_tag LOCUS_15850 13370 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 13672 15465 gene locus_tag LOCUS_15860 13672 15465 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827432.1 protein_id gnl|my_center|LOCUS_15860 15609 16322 gene locus_tag LOCUS_15870 15609 16322 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529033.1 protein_id gnl|my_center|LOCUS_15870 16319 17032 gene locus_tag LOCUS_15880 16319 17032 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067327.1 protein_id gnl|my_center|LOCUS_15880 17029 17568 gene locus_tag LOCUS_15890 gene ilvN 17029 17568 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089241.1 protein_id gnl|my_center|LOCUS_15890 17623 17934 gene locus_tag LOCUS_15900 17623 17934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 18154 18372 gene locus_tag LOCUS_15910 18154 18372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 18491 19123 gene locus_tag LOCUS_15920 18491 19123 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173714.1 protein_id gnl|my_center|LOCUS_15920 19161 20180 gene locus_tag LOCUS_15930 gene ilvC 19161 20180 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089237.1 protein_id gnl|my_center|LOCUS_15930 20317 20598 gene locus_tag LOCUS_15940 20317 20598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 20623 20847 gene locus_tag LOCUS_15950 20623 20847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 21599 21057 gene locus_tag LOCUS_15960 21599 21057 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087128.1 protein_id gnl|my_center|LOCUS_15960 21813 22697 gene locus_tag LOCUS_15970 21813 22697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089228.1 protein_id gnl|my_center|LOCUS_15970 22694 23482 gene locus_tag LOCUS_15980 22694 23482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089227.1 protein_id gnl|my_center|LOCUS_15980 23655 24686 gene locus_tag LOCUS_15990 23655 24686 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808730.1 protein_id gnl|my_center|LOCUS_15990 24814 25221 gene locus_tag LOCUS_16000 24814 25221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 25314 26162 gene locus_tag LOCUS_16010 gene pdxY 25314 26162 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_16010 26168 27289 gene locus_tag LOCUS_16020 26168 27289 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650978.1 protein_id gnl|my_center|LOCUS_16020 27306 28208 gene locus_tag LOCUS_16030 27306 28208 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531073.1 protein_id gnl|my_center|LOCUS_16030 28205 28957 gene locus_tag LOCUS_16040 28205 28957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089220.1 protein_id gnl|my_center|LOCUS_16040 29002 31104 gene locus_tag LOCUS_16050 29002 31104 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398653.1 protein_id gnl|my_center|LOCUS_16050 31354 31196 gene locus_tag LOCUS_16060 31354 31196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence037 893 117 gene locus_tag LOCUS_16070 893 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16070 1306 1040 gene locus_tag LOCUS_16080 1306 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16080 2339 1752 gene locus_tag LOCUS_16090 2339 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3516 2389 gene locus_tag LOCUS_16100 3516 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 4339 3860 gene locus_tag LOCUS_16110 4339 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 5146 6099 gene locus_tag LOCUS_16120 5146 6099 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528010.1 protein_id gnl|my_center|LOCUS_16120 6330 6809 gene locus_tag LOCUS_16130 6330 6809 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085922.1 protein_id gnl|my_center|LOCUS_16130 6806 8392 gene locus_tag LOCUS_16140 6806 8392 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 protein_id gnl|my_center|LOCUS_16140 8403 11285 gene locus_tag LOCUS_16150 gene fdhF 8403 11285 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970349.1 protein_id gnl|my_center|LOCUS_16150 11272 12114 gene locus_tag LOCUS_16160 gene fdhD 11272 12114 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083120.1 protein_id gnl|my_center|LOCUS_16160 12111 12380 gene locus_tag LOCUS_16170 12111 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 13047 12697 gene locus_tag LOCUS_16180 13047 12697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16180 13443 13048 gene locus_tag LOCUS_16190 13443 13048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16190 13349 14458 gene locus_tag LOCUS_16200 13349 14458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 14708 14517 gene locus_tag LOCUS_16210 14708 14517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16210 15514 14747 gene locus_tag LOCUS_16220 15514 14747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16220 15705 16628 gene locus_tag LOCUS_16230 15705 16628 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970319.1 protein_id gnl|my_center|LOCUS_16230 17238 16636 gene locus_tag LOCUS_16240 17238 16636 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968923.1 protein_id gnl|my_center|LOCUS_16240 17349 18236 gene locus_tag LOCUS_16250 17349 18236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 18300 20018 gene locus_tag LOCUS_16260 18300 20018 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968443.1 protein_id gnl|my_center|LOCUS_16260 20633 20028 gene locus_tag LOCUS_16270 20633 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 21486 20689 gene locus_tag LOCUS_16280 21486 20689 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067731.1 protein_id gnl|my_center|LOCUS_16280 21729 21550 gene locus_tag LOCUS_16290 21729 21550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 21728 22420 gene locus_tag LOCUS_16300 21728 22420 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083540.1 protein_id gnl|my_center|LOCUS_16300 22652 23410 gene locus_tag LOCUS_16310 22652 23410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 23407 24270 gene locus_tag LOCUS_16320 23407 24270 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_16320 25249 24290 gene locus_tag LOCUS_16330 25249 24290 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529572.1 protein_id gnl|my_center|LOCUS_16330 27434 25353 gene locus_tag LOCUS_16340 27434 25353 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965129.1 protein_id gnl|my_center|LOCUS_16340 27848 27546 gene locus_tag LOCUS_16350 27848 27546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16350 28387 27797 gene locus_tag LOCUS_16360 28387 27797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16360 29385 28552 gene locus_tag LOCUS_16370 29385 28552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16370 30071 29322 gene locus_tag LOCUS_16380 30071 29322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16380 >Feature sequence038 3 281 gene locus_tag LOCUS_16390 3 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 285 752 gene locus_tag LOCUS_16400 285 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 772 1020 gene locus_tag LOCUS_16410 772 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1996 1031 gene locus_tag LOCUS_16420 1996 1031 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_16420 3040 2126 gene locus_tag LOCUS_16430 3040 2126 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 protein_id gnl|my_center|LOCUS_16430 3410 4447 gene locus_tag LOCUS_16440 gene exoZ 3410 4447 CDS product exopolysaccharide production protein ExoZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850573.1 protein_id gnl|my_center|LOCUS_16440 4906 5259 gene locus_tag LOCUS_16450 4906 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16450 6372 5302 gene locus_tag LOCUS_16460 6372 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 6444 7361 gene locus_tag LOCUS_16470 6444 7361 CDS product DUF6492 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966521.1 protein_id gnl|my_center|LOCUS_16470 8286 7372 gene locus_tag LOCUS_16480 gene uppJ 8286 7372 CDS product polysaccharide biosynthesis UDP-hexose transferase UppJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972269.1 protein_id gnl|my_center|LOCUS_16480 9670 8321 gene locus_tag LOCUS_16490 9670 8321 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976154.1 protein_id gnl|my_center|LOCUS_16490 9989 11059 gene locus_tag LOCUS_16500 9989 11059 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085029.1 protein_id gnl|my_center|LOCUS_16500 12823 11099 gene locus_tag LOCUS_16510 12823 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 13063 12989 gene locus_tag LOCUS_t00160 13063 12989 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15018 13216 gene locus_tag LOCUS_16520 gene recJ 15018 13216 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110375784.1 protein_id gnl|my_center|LOCUS_16520 16140 15142 gene locus_tag LOCUS_16530 gene glpX 16140 15142 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087135.1 protein_id gnl|my_center|LOCUS_16530 17550 16204 gene locus_tag LOCUS_16540 17550 16204 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087134.1 protein_id gnl|my_center|LOCUS_16540 18039 17608 gene locus_tag LOCUS_16550 18039 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 19454 18234 gene locus_tag LOCUS_16560 19454 18234 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171284.1 protein_id gnl|my_center|LOCUS_16560 20122 19667 gene locus_tag LOCUS_16570 20122 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 20241 22064 gene locus_tag LOCUS_16580 gene phaC 20241 22064 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531993.1 protein_id gnl|my_center|LOCUS_16580 23659 22322 gene locus_tag LOCUS_16590 23659 22322 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_16590 24086 24934 gene locus_tag LOCUS_16600 24086 24934 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528568.1 protein_id gnl|my_center|LOCUS_16600 25946 25011 gene locus_tag LOCUS_16610 gene argC 25946 25011 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_16610 27064 26180 gene locus_tag LOCUS_16620 27064 26180 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526295.1 protein_id gnl|my_center|LOCUS_16620 27170 28051 gene locus_tag LOCUS_16630 27170 28051 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705524.1 protein_id gnl|my_center|LOCUS_16630 29072 28116 gene locus_tag LOCUS_16640 gene speB 29072 28116 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391007.1 protein_id gnl|my_center|LOCUS_16640 29370 29089 gene locus_tag LOCUS_16650 29370 29089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 30261 29497 gene locus_tag LOCUS_16660 30261 29497 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185690.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence039 <1 516 gene locus_tag LOCUS_16670 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056341.1:Fe-S cluster assembly protein SufB 522 1349 gene locus_tag LOCUS_16680 gene phnE 522 1349 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113152.1 protein_id gnl|my_center|LOCUS_16680 1346 2047 gene locus_tag LOCUS_16690 gene phnC 1346 2047 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267538.1 protein_id gnl|my_center|LOCUS_16690 2507 2857 gene locus_tag LOCUS_16700 2507 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 3033 4022 gene locus_tag LOCUS_16710 3033 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 4915 6546 gene locus_tag LOCUS_16720 4915 6546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173725.1 protein_id gnl|my_center|LOCUS_16720 6646 8070 gene locus_tag LOCUS_16730 6646 8070 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969923.1 protein_id gnl|my_center|LOCUS_16730 8108 8299 gene locus_tag LOCUS_16740 8108 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 8311 9729 gene locus_tag LOCUS_16750 gene gatA 8311 9729 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_16750 9761 9949 gene locus_tag LOCUS_16760 9761 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 9951 10979 gene locus_tag LOCUS_16770 9951 10979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16770 11045 11335 gene locus_tag LOCUS_16780 11045 11335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16780 11405 12283 gene locus_tag LOCUS_16790 11405 12283 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_16790 12353 12556 gene locus_tag LOCUS_16800 12353 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 12553 13962 gene locus_tag LOCUS_16810 12553 13962 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_16810 14724 14023 gene locus_tag LOCUS_16820 14724 14023 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099978.1 protein_id gnl|my_center|LOCUS_16820 16098 14944 gene locus_tag LOCUS_16830 16098 14944 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_16830 17009 16095 gene locus_tag LOCUS_16840 17009 16095 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327735.1 protein_id gnl|my_center|LOCUS_16840 18013 17012 gene locus_tag LOCUS_16850 18013 17012 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331322.1 protein_id gnl|my_center|LOCUS_16850 18757 18047 gene locus_tag LOCUS_16860 18757 18047 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820594.1 protein_id gnl|my_center|LOCUS_16860 19814 18780 gene locus_tag LOCUS_16870 19814 18780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090640.1 protein_id gnl|my_center|LOCUS_16870 20874 19825 gene locus_tag LOCUS_16880 20874 19825 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966121.1 protein_id gnl|my_center|LOCUS_16880 21896 20994 gene locus_tag LOCUS_16890 21896 20994 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090643.1 protein_id gnl|my_center|LOCUS_16890 22863 21907 gene locus_tag LOCUS_16900 22863 21907 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090644.1 protein_id gnl|my_center|LOCUS_16900 24573 22957 gene locus_tag LOCUS_16910 24573 22957 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173725.1 protein_id gnl|my_center|LOCUS_16910 25685 24978 gene locus_tag LOCUS_16920 25685 24978 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064937.1 protein_id gnl|my_center|LOCUS_16920 26069 26278 gene locus_tag LOCUS_16930 26069 26278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 26280 27713 gene locus_tag LOCUS_16940 26280 27713 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969923.1 protein_id gnl|my_center|LOCUS_16940 27917 28675 gene locus_tag LOCUS_16950 27917 28675 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_16950 28711 29664 gene locus_tag LOCUS_16960 28711 29664 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence040 452 2176 gene locus_tag LOCUS_16970 452 2176 CDS product mucoidy inhibitor MuiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089817.1 protein_id gnl|my_center|LOCUS_16970 2920 2342 gene locus_tag LOCUS_16980 2920 2342 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970153.1 protein_id gnl|my_center|LOCUS_16980 4355 3147 gene locus_tag LOCUS_16990 4355 3147 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384353.1 protein_id gnl|my_center|LOCUS_16990 4601 5893 gene locus_tag LOCUS_17000 4601 5893 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972329.1 protein_id gnl|my_center|LOCUS_17000 6010 7230 gene locus_tag LOCUS_17010 6010 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 8459 7470 gene locus_tag LOCUS_17020 8459 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 9952 8996 gene locus_tag LOCUS_17030 9952 8996 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069458977.1 protein_id gnl|my_center|LOCUS_17030 10038 10748 gene locus_tag LOCUS_17040 gene mtgA 10038 10748 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067328.1 protein_id gnl|my_center|LOCUS_17040 10907 11092 gene locus_tag LOCUS_17050 gene rpmF 10907 11092 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535764.1 protein_id gnl|my_center|LOCUS_17050 11213 11782 gene locus_tag LOCUS_17060 11213 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 11989 11795 gene locus_tag LOCUS_17070 11989 11795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 12156 13850 gene locus_tag LOCUS_17080 12156 13850 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965204.1 protein_id gnl|my_center|LOCUS_17080 14420 13899 gene locus_tag LOCUS_17090 gene phaR 14420 13899 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083059.1 protein_id gnl|my_center|LOCUS_17090 14733 15911 gene locus_tag LOCUS_17100 14733 15911 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086505.1 protein_id gnl|my_center|LOCUS_17100 15919 16134 gene locus_tag LOCUS_17110 15919 16134 CDS product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721263.1 protein_id gnl|my_center|LOCUS_17110 16275 16997 gene locus_tag LOCUS_17120 16275 16997 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709750.1 protein_id gnl|my_center|LOCUS_17120 17372 17692 gene locus_tag LOCUS_17130 17372 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 17963 17712 gene locus_tag LOCUS_17140 17963 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17140 18847 17960 gene locus_tag LOCUS_17150 18847 17960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17150 19175 20038 gene locus_tag LOCUS_17160 19175 20038 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383375.1 protein_id gnl|my_center|LOCUS_17160 22837 20123 gene locus_tag LOCUS_17170 22837 20123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 24322 23033 gene locus_tag LOCUS_17180 gene lysA 24322 23033 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920074.1 protein_id gnl|my_center|LOCUS_17180 24886 24485 gene locus_tag LOCUS_17190 24886 24485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 26348 24957 gene locus_tag LOCUS_17200 gene argH 26348 24957 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965353.1 protein_id gnl|my_center|LOCUS_17200 26377 27009 gene locus_tag LOCUS_17210 26377 27009 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084198.1 protein_id gnl|my_center|LOCUS_17210 27252 29111 gene locus_tag LOCUS_17220 27252 29111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence041 585 989 gene locus_tag LOCUS_17230 585 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1076 1468 gene locus_tag LOCUS_17240 1076 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1599 2636 gene locus_tag LOCUS_17250 1599 2636 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971418.1 protein_id gnl|my_center|LOCUS_17250 3528 2647 gene locus_tag LOCUS_17260 3528 2647 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185528.1 protein_id gnl|my_center|LOCUS_17260 5773 3617 gene locus_tag LOCUS_17270 gene flhA 5773 3617 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966504.1 protein_id gnl|my_center|LOCUS_17270 5974 6276 gene locus_tag LOCUS_17280 5974 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6434 6772 gene locus_tag LOCUS_17290 6434 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 8152 6788 gene locus_tag LOCUS_17300 8152 6788 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089740.1 protein_id gnl|my_center|LOCUS_17300 8547 8197 gene locus_tag LOCUS_17310 gene fliN 8547 8197 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089739.1 protein_id gnl|my_center|LOCUS_17310 9157 8558 gene locus_tag LOCUS_17320 9157 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 10170 9154 gene locus_tag LOCUS_17330 gene fliG 10170 9154 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089737.1 protein_id gnl|my_center|LOCUS_17330 11861 10185 gene locus_tag LOCUS_17340 gene fliF 11861 10185 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089736.1 protein_id gnl|my_center|LOCUS_17340 12358 12083 gene locus_tag LOCUS_17350 12358 12083 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 protein_id gnl|my_center|LOCUS_17350 13142 12465 gene locus_tag LOCUS_17360 13142 12465 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089735.1 protein_id gnl|my_center|LOCUS_17360 14805 13159 gene locus_tag LOCUS_17370 14805 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 15045 16229 gene locus_tag LOCUS_17380 gene mnmA 15045 16229 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529903.1 protein_id gnl|my_center|LOCUS_17380 16278 16934 gene locus_tag LOCUS_17390 16278 16934 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089732.1 protein_id gnl|my_center|LOCUS_17390 17035 17111 gene locus_tag LOCUS_t00170 17035 17111 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17423 17106 gene locus_tag LOCUS_17400 17423 17106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 17648 18655 gene locus_tag LOCUS_17410 17648 18655 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_17410 18664 19128 gene locus_tag LOCUS_17420 18664 19128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927161.1 protein_id gnl|my_center|LOCUS_17420 19231 20823 gene locus_tag LOCUS_17430 gene cydA 19231 20823 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210730.1 protein_id gnl|my_center|LOCUS_17430 20852 22003 gene locus_tag LOCUS_17440 gene cydB 20852 22003 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 protein_id gnl|my_center|LOCUS_17440 22021 22221 gene locus_tag LOCUS_17450 22021 22221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 22233 22682 gene locus_tag LOCUS_17460 22233 22682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 22679 24379 gene locus_tag LOCUS_17470 gene cydD 22679 24379 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941872.1 protein_id gnl|my_center|LOCUS_17470 24373 26037 gene locus_tag LOCUS_17480 gene cydC 24373 26037 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097323.1 protein_id gnl|my_center|LOCUS_17480 26085 26789 gene locus_tag LOCUS_17490 26085 26789 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626211.1 protein_id gnl|my_center|LOCUS_17490 26981 28279 gene locus_tag LOCUS_17500 26981 28279 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390060.1 protein_id gnl|my_center|LOCUS_17500 28304 28669 gene locus_tag LOCUS_17510 28304 28669 CDS product DUF5368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390059.1 protein_id gnl|my_center|LOCUS_17510 28709 29290 gene locus_tag LOCUS_17520 28709 29290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence042 189 1478 gene locus_tag LOCUS_17530 189 1478 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175379.1 protein_id gnl|my_center|LOCUS_17530 2192 1626 gene locus_tag LOCUS_17540 2192 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2420 2629 gene locus_tag LOCUS_17550 2420 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2661 2999 gene locus_tag LOCUS_17560 2661 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2996 3202 gene locus_tag LOCUS_17570 2996 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4331 3603 gene locus_tag LOCUS_17580 gene istB 4331 3603 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090918.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17580 5830 4331 gene locus_tag LOCUS_17590 gene istA 5830 4331 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 protein_id gnl|my_center|LOCUS_17590 7128 5890 gene locus_tag LOCUS_17600 7128 5890 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339306.1 protein_id gnl|my_center|LOCUS_17600 7760 7242 gene locus_tag LOCUS_17610 7760 7242 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140383.1 protein_id gnl|my_center|LOCUS_17610 7883 8503 gene locus_tag LOCUS_17620 7883 8503 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965344.1 protein_id gnl|my_center|LOCUS_17620 8500 9192 gene locus_tag LOCUS_17630 8500 9192 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379663.1 protein_id gnl|my_center|LOCUS_17630 11082 9274 gene locus_tag LOCUS_17640 11082 9274 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992392.1 protein_id gnl|my_center|LOCUS_17640 11317 12624 gene locus_tag LOCUS_17650 gene blh 11317 12624 CDS product bifunctional sulfur transferase/dioxygenase Blh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973062.1 protein_id gnl|my_center|LOCUS_17650 12645 12953 gene locus_tag LOCUS_17660 gene bigR 12645 12953 CDS product sulfite-sensing transcriptional repressor BigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328584.1 protein_id gnl|my_center|LOCUS_17660 12950 13360 gene locus_tag LOCUS_17670 12950 13360 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967550.1 protein_id gnl|my_center|LOCUS_17670 13357 13812 gene locus_tag LOCUS_17680 13357 13812 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 protein_id gnl|my_center|LOCUS_17680 13809 14591 gene locus_tag LOCUS_17690 13809 14591 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_17690 14829 14885 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15106 15384 gene locus_tag LOCUS_17700 15106 15384 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383336.1 protein_id gnl|my_center|LOCUS_17700 15392 16477 gene locus_tag LOCUS_17710 15392 16477 CDS product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703366.1 protein_id gnl|my_center|LOCUS_17710 16492 16875 gene locus_tag LOCUS_17720 16492 16875 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969505.1 protein_id gnl|my_center|LOCUS_17720 17593 17147 gene locus_tag LOCUS_17730 17593 17147 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_17730 17667 20222 gene locus_tag LOCUS_17740 17667 20222 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336989.1 protein_id gnl|my_center|LOCUS_17740 20239 20868 gene locus_tag LOCUS_17750 20239 20868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 20865 21401 gene locus_tag LOCUS_17760 gene lspA 20865 21401 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939214.1 protein_id gnl|my_center|LOCUS_17760 21398 21952 gene locus_tag LOCUS_17770 21398 21952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 22195 23295 gene locus_tag LOCUS_17780 22195 23295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 23345 24265 gene locus_tag LOCUS_17790 23345 24265 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 protein_id gnl|my_center|LOCUS_17790 24724 25362 gene locus_tag LOCUS_17800 24724 25362 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967896.1 protein_id gnl|my_center|LOCUS_17800 26018 25383 gene locus_tag LOCUS_17810 26018 25383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 26189 26434 gene locus_tag LOCUS_17820 26189 26434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 26566 27576 gene locus_tag LOCUS_17830 26566 27576 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257389.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence043 927 133 gene locus_tag LOCUS_17840 927 133 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874280.1 protein_id gnl|my_center|LOCUS_17840 2320 941 gene locus_tag LOCUS_17850 2320 941 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064251.1 protein_id gnl|my_center|LOCUS_17850 3524 2331 gene locus_tag LOCUS_17860 3524 2331 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874276.1 protein_id gnl|my_center|LOCUS_17860 4646 3624 gene locus_tag LOCUS_17870 4646 3624 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_17870 5850 4825 gene locus_tag LOCUS_17880 5850 4825 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_17880 6111 7301 gene locus_tag LOCUS_17890 gene metC 6111 7301 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087217.1 protein_id gnl|my_center|LOCUS_17890 7655 7320 gene locus_tag LOCUS_17900 7655 7320 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087215.1 protein_id gnl|my_center|LOCUS_17900 8419 7652 gene locus_tag LOCUS_17910 8419 7652 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174100.1 protein_id gnl|my_center|LOCUS_17910 10198 8510 gene locus_tag LOCUS_17920 10198 8510 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087212.1 protein_id gnl|my_center|LOCUS_17920 10142 10390 gene locus_tag LOCUS_17930 10142 10390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 10439 10726 gene locus_tag LOCUS_17940 10439 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 10864 10788 gene locus_tag LOCUS_t00180 10864 10788 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11241 10936 gene locus_tag LOCUS_17950 11241 10936 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171332.1 protein_id gnl|my_center|LOCUS_17950 11402 11326 gene locus_tag LOCUS_t00190 11402 11326 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12041 11475 gene locus_tag LOCUS_17960 12041 11475 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087183.1 protein_id gnl|my_center|LOCUS_17960 12196 14034 gene locus_tag LOCUS_17970 12196 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 14031 14762 gene locus_tag LOCUS_17980 14031 14762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 14984 15625 gene locus_tag LOCUS_17990 14984 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 16709 15654 gene locus_tag LOCUS_18000 16709 15654 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081140.1 protein_id gnl|my_center|LOCUS_18000 17590 16706 gene locus_tag LOCUS_18010 17590 16706 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974011.1 protein_id gnl|my_center|LOCUS_18010 17921 17547 gene locus_tag LOCUS_18020 17921 17547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 18310 17939 gene locus_tag LOCUS_18030 18310 17939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 20100 18316 gene locus_tag LOCUS_18040 gene aspS 20100 18316 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086916.1 protein_id gnl|my_center|LOCUS_18040 20256 21395 gene locus_tag LOCUS_18050 gene rnd 20256 21395 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086908.1 protein_id gnl|my_center|LOCUS_18050 22917 21406 gene locus_tag LOCUS_18060 gene ppx 22917 21406 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086895.1 protein_id gnl|my_center|LOCUS_18060 25111 22919 gene locus_tag LOCUS_18070 25111 22919 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171108.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence044 2040 52 gene locus_tag LOCUS_18080 2040 52 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337373.1 protein_id gnl|my_center|LOCUS_18080 2952 2278 gene locus_tag LOCUS_18090 2952 2278 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088702.1 protein_id gnl|my_center|LOCUS_18090 3190 3837 gene locus_tag LOCUS_18100 3190 3837 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090480.1 protein_id gnl|my_center|LOCUS_18100 3842 4864 gene locus_tag LOCUS_18110 3842 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5000 6493 gene locus_tag LOCUS_18120 5000 6493 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087076.1 protein_id gnl|my_center|LOCUS_18120 7145 7432 gene locus_tag LOCUS_18130 7145 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 9160 7562 gene locus_tag LOCUS_18140 9160 7562 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966515.1 protein_id gnl|my_center|LOCUS_18140 10510 9335 gene locus_tag LOCUS_18150 10510 9335 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395366.1 protein_id gnl|my_center|LOCUS_18150 10638 11894 gene locus_tag LOCUS_18160 10638 11894 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532855.1 protein_id gnl|my_center|LOCUS_18160 13230 12118 gene locus_tag LOCUS_18170 13230 12118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974060.1 protein_id gnl|my_center|LOCUS_18170 15996 13234 gene locus_tag LOCUS_18180 gene rbbA 15996 13234 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974059.1 protein_id gnl|my_center|LOCUS_18180 17063 15993 gene locus_tag LOCUS_18190 17063 15993 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966136.1 protein_id gnl|my_center|LOCUS_18190 17431 19110 gene locus_tag LOCUS_18200 17431 19110 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 protein_id gnl|my_center|LOCUS_18200 19118 20533 gene locus_tag LOCUS_18210 19118 20533 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524980.1 protein_id gnl|my_center|LOCUS_18210 20530 21726 gene locus_tag LOCUS_18220 20530 21726 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540302.1 protein_id gnl|my_center|LOCUS_18220 21955 21731 gene locus_tag LOCUS_18230 21955 21731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 22275 23162 gene locus_tag LOCUS_18240 22275 23162 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060909735.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence045 644 1030 gene locus_tag LOCUS_18250 644 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974781.1 protein_id gnl|my_center|LOCUS_18250 1209 3194 gene locus_tag LOCUS_18260 1209 3194 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 protein_id gnl|my_center|LOCUS_18260 3240 3521 gene locus_tag LOCUS_18270 3240 3521 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_18270 3518 4351 gene locus_tag LOCUS_18280 gene thiD 3518 4351 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_18280 4348 6513 gene locus_tag LOCUS_18290 gene scpA 4348 6513 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085838.1 protein_id gnl|my_center|LOCUS_18290 6843 6574 gene locus_tag LOCUS_18300 6843 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 7769 6981 gene locus_tag LOCUS_18310 7769 6981 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974521.1 protein_id gnl|my_center|LOCUS_18310 8674 7766 gene locus_tag LOCUS_18320 8674 7766 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971012.1 protein_id gnl|my_center|LOCUS_18320 10085 8868 gene locus_tag LOCUS_18330 10085 8868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378875.1 protein_id gnl|my_center|LOCUS_18330 11197 10082 gene locus_tag LOCUS_18340 11197 10082 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971010.1 protein_id gnl|my_center|LOCUS_18340 11326 12063 gene locus_tag LOCUS_18350 11326 12063 CDS product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391328.1 protein_id gnl|my_center|LOCUS_18350 13460 12177 gene locus_tag LOCUS_18360 13460 12177 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088652.1 protein_id gnl|my_center|LOCUS_18360 13611 14069 gene locus_tag LOCUS_18370 13611 14069 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329027.1 protein_id gnl|my_center|LOCUS_18370 14970 14074 gene locus_tag LOCUS_18380 14970 14074 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815329.1 protein_id gnl|my_center|LOCUS_18380 15876 15028 gene locus_tag LOCUS_18390 15876 15028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 17165 15999 gene locus_tag LOCUS_18400 17165 15999 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158896.1 protein_id gnl|my_center|LOCUS_18400 17292 18278 gene locus_tag LOCUS_18410 gene meaB 17292 18278 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_18410 18283 18924 gene locus_tag LOCUS_18420 18283 18924 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085831.1 protein_id gnl|my_center|LOCUS_18420 19026 20372 gene locus_tag LOCUS_18430 19026 20372 CDS product TIGR03808 family TAT-translocated repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085830.1 protein_id gnl|my_center|LOCUS_18430 20700 20374 gene locus_tag LOCUS_18440 20700 20374 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243739.1 protein_id gnl|my_center|LOCUS_18440 20924 20697 gene locus_tag LOCUS_18450 20924 20697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 21968 20970 gene locus_tag LOCUS_18460 21968 20970 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 protein_id gnl|my_center|LOCUS_18460 22138 22962 gene locus_tag LOCUS_18470 22138 22962 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815017.1 protein_id gnl|my_center|LOCUS_18470 23067 23303 gene locus_tag LOCUS_18480 23067 23303 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909609.1 protein_id gnl|my_center|LOCUS_18480 23574 23290 gene locus_tag LOCUS_18490 23574 23290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 23564 25858 gene locus_tag LOCUS_18500 23564 25858 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086918.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence046 513 635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 807 1529 gene locus_tag LOCUS_18510 807 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 1443 1491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1538 1687 gene locus_tag LOCUS_18520 1538 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1742 2473 gene locus_tag LOCUS_18530 1742 2473 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066671.1 protein_id gnl|my_center|LOCUS_18530 2674 3219 gene locus_tag LOCUS_18540 2674 3219 CDS product 2,4'-dihydroxyacetophenone dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066672.1 protein_id gnl|my_center|LOCUS_18540 3748 3341 gene locus_tag LOCUS_18550 gene fliX 3748 3341 CDS product flagellar assembly regulator FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920437.1 protein_id gnl|my_center|LOCUS_18550 3979 5112 gene locus_tag LOCUS_18560 3979 5112 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173283.1 protein_id gnl|my_center|LOCUS_18560 5112 5468 gene locus_tag LOCUS_18570 5112 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 5472 5960 gene locus_tag LOCUS_18580 5472 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088582.1 protein_id gnl|my_center|LOCUS_18580 6141 6629 gene locus_tag LOCUS_18590 6141 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 6883 8220 gene locus_tag LOCUS_18600 6883 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 8410 9756 gene locus_tag LOCUS_18610 8410 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 9807 10199 gene locus_tag LOCUS_18620 gene flbT 9807 10199 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088588.1 protein_id gnl|my_center|LOCUS_18620 11675 10347 gene locus_tag LOCUS_18630 11675 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 13883 12015 gene locus_tag LOCUS_18640 gene flgK 13883 12015 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088594.1 protein_id gnl|my_center|LOCUS_18640 15354 13945 gene locus_tag LOCUS_18650 15354 13945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 16566 15553 gene locus_tag LOCUS_18660 16566 15553 CDS product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975680.1 protein_id gnl|my_center|LOCUS_18660 18008 16563 gene locus_tag LOCUS_18670 18008 16563 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531864.1 protein_id gnl|my_center|LOCUS_18670 18558 18022 gene locus_tag LOCUS_18680 18558 18022 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_18680 19533 18559 gene locus_tag LOCUS_18690 19533 18559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 19765 21945 gene locus_tag LOCUS_18700 19765 21945 CDS product exopolysaccharide transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087735.1 protein_id gnl|my_center|LOCUS_18700 23202 21952 gene locus_tag LOCUS_18710 23202 21952 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966320.1 protein_id gnl|my_center|LOCUS_18710 23338 24390 gene locus_tag LOCUS_18720 23338 24390 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083903.1 protein_id gnl|my_center|LOCUS_18720 24710 24501 gene locus_tag LOCUS_18730 24710 24501 CDS product DUF2842 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379956.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence047 868 1617 gene locus_tag LOCUS_18740 868 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1801 2379 gene locus_tag LOCUS_18750 1801 2379 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972884.1 protein_id gnl|my_center|LOCUS_18750 2388 3794 gene locus_tag LOCUS_18760 2388 3794 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089571.1 protein_id gnl|my_center|LOCUS_18760 3832 4980 gene locus_tag LOCUS_18770 3832 4980 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588846.1 protein_id gnl|my_center|LOCUS_18770 6659 4989 gene locus_tag LOCUS_18780 6659 4989 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088981.1 protein_id gnl|my_center|LOCUS_18780 7462 6656 gene locus_tag LOCUS_18790 gene hutG 7462 6656 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918842.1 protein_id gnl|my_center|LOCUS_18790 9116 7581 gene locus_tag LOCUS_18800 gene hutH 9116 7581 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036761.1 protein_id gnl|my_center|LOCUS_18800 10345 9113 gene locus_tag LOCUS_18810 gene hutI 10345 9113 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532303.1 protein_id gnl|my_center|LOCUS_18810 10450 11817 gene locus_tag LOCUS_18820 10450 11817 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532304.1 protein_id gnl|my_center|LOCUS_18820 11823 12572 gene locus_tag LOCUS_18830 gene hutC 11823 12572 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088985.1 protein_id gnl|my_center|LOCUS_18830 12910 12647 gene locus_tag LOCUS_18840 12910 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 13193 13585 gene locus_tag LOCUS_18850 13193 13585 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067089.1 protein_id gnl|my_center|LOCUS_18850 13781 14686 gene locus_tag LOCUS_18860 13781 14686 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391037.1 protein_id gnl|my_center|LOCUS_18860 14762 15439 gene locus_tag LOCUS_18870 14762 15439 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338008.1 protein_id gnl|my_center|LOCUS_18870 15624 15776 gene locus_tag LOCUS_18880 15624 15776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 17003 15789 gene locus_tag LOCUS_18890 gene phaZ 17003 15789 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089442.1 protein_id gnl|my_center|LOCUS_18890 17179 17835 gene locus_tag LOCUS_18900 17179 17835 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967666.1 protein_id gnl|my_center|LOCUS_18900 17946 19391 gene locus_tag LOCUS_18910 17946 19391 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329213.1 protein_id gnl|my_center|LOCUS_18910 19501 20505 gene locus_tag LOCUS_18920 19501 20505 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968221.1 protein_id gnl|my_center|LOCUS_18920 21681 20509 gene locus_tag LOCUS_18930 gene pobA 21681 20509 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532959.1 protein_id gnl|my_center|LOCUS_18930 22659 21781 gene locus_tag LOCUS_18940 22659 21781 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085763.1 protein_id gnl|my_center|LOCUS_18940 23441 22656 gene locus_tag LOCUS_18950 23441 22656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 23544 24017 gene locus_tag LOCUS_18960 23544 24017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence048 1478 195 gene locus_tag LOCUS_18970 1478 195 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099149.1 protein_id gnl|my_center|LOCUS_18970 2020 1505 gene locus_tag LOCUS_18980 2020 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 3080 2085 gene locus_tag LOCUS_18990 gene yiaO 3080 2085 CDS product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776887.1 protein_id gnl|my_center|LOCUS_18990 4496 3156 gene locus_tag LOCUS_19000 4496 3156 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892321.1 protein_id gnl|my_center|LOCUS_19000 4745 5659 gene locus_tag LOCUS_19010 4745 5659 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084956.1 protein_id gnl|my_center|LOCUS_19010 7163 5709 gene locus_tag LOCUS_19020 7163 5709 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086915.1 protein_id gnl|my_center|LOCUS_19020 7156 9807 gene locus_tag LOCUS_19030 7156 9807 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088809.1 protein_id gnl|my_center|LOCUS_19030 10135 10602 gene locus_tag LOCUS_19040 10135 10602 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971001.1 protein_id gnl|my_center|LOCUS_19040 10702 12909 gene locus_tag LOCUS_19050 10702 12909 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085521.1 protein_id gnl|my_center|LOCUS_19050 13112 13531 gene locus_tag LOCUS_19060 gene soxX 13112 13531 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171929.1 protein_id gnl|my_center|LOCUS_19060 13557 13988 gene locus_tag LOCUS_19070 13557 13988 CDS product SoxY-related AACIE arm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085519.1 protein_id gnl|my_center|LOCUS_19070 14000 14323 gene locus_tag LOCUS_19080 14000 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 14467 15237 gene locus_tag LOCUS_19090 gene soxA 14467 15237 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174733.1 protein_id gnl|my_center|LOCUS_19090 16752 15277 gene locus_tag LOCUS_19100 16752 15277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 17392 17973 gene locus_tag LOCUS_19110 17392 17973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19110 18001 18156 gene locus_tag LOCUS_19120 18001 18156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 18934 18179 gene locus_tag LOCUS_19130 18934 18179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396373.1 protein_id gnl|my_center|LOCUS_19130 19971 18931 gene locus_tag LOCUS_19140 19971 18931 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065319.1 protein_id gnl|my_center|LOCUS_19140 21083 19968 gene locus_tag LOCUS_19150 21083 19968 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211377.1 protein_id gnl|my_center|LOCUS_19150 21598 21125 gene locus_tag LOCUS_19160 21598 21125 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529534.1 protein_id gnl|my_center|LOCUS_19160 23101 21632 gene locus_tag LOCUS_19170 23101 21632 CDS product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529536.1 protein_id gnl|my_center|LOCUS_19170 23689 23171 gene locus_tag LOCUS_19180 23689 23171 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999085.1 protein_id gnl|my_center|LOCUS_19180 23960 23772 gene locus_tag LOCUS_19190 23960 23772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 24482 24063 gene locus_tag LOCUS_19200 24482 24063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence049 215 1207 gene locus_tag LOCUS_19210 215 1207 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037471335.1 protein_id gnl|my_center|LOCUS_19210 1204 2040 gene locus_tag LOCUS_19220 1204 2040 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368523.1 protein_id gnl|my_center|LOCUS_19220 2040 3599 gene locus_tag LOCUS_19230 2040 3599 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982234.1 protein_id gnl|my_center|LOCUS_19230 5002 3764 gene locus_tag LOCUS_19240 5002 3764 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387979.1 protein_id gnl|my_center|LOCUS_19240 5114 5353 gene locus_tag LOCUS_19250 5114 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 6290 5532 gene locus_tag LOCUS_19260 6290 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19260 8000 6597 gene locus_tag LOCUS_19270 8000 6597 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089571.1 protein_id gnl|my_center|LOCUS_19270 8572 7997 gene locus_tag LOCUS_19280 8572 7997 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089572.1 protein_id gnl|my_center|LOCUS_19280 9590 8592 gene locus_tag LOCUS_19290 9590 8592 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972883.1 protein_id gnl|my_center|LOCUS_19290 9490 9705 gene locus_tag LOCUS_19300 9490 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 9817 10614 gene locus_tag LOCUS_19310 9817 10614 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926031.1 protein_id gnl|my_center|LOCUS_19310 10879 10640 gene locus_tag LOCUS_19320 10879 10640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 11064 11783 gene locus_tag LOCUS_19330 gene minC 11064 11783 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241985.1 protein_id gnl|my_center|LOCUS_19330 11816 12631 gene locus_tag LOCUS_19340 gene minD 11816 12631 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314831.1 protein_id gnl|my_center|LOCUS_19340 12628 12891 gene locus_tag LOCUS_19350 gene minE 12628 12891 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887983.1 protein_id gnl|my_center|LOCUS_19350 12992 13342 gene locus_tag LOCUS_19360 12992 13342 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_19360 13342 13755 gene locus_tag LOCUS_19370 gene arsC 13342 13755 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085868.1 protein_id gnl|my_center|LOCUS_19370 13797 15131 gene locus_tag LOCUS_19380 13797 15131 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113751.1 protein_id gnl|my_center|LOCUS_19380 15183 16235 gene locus_tag LOCUS_19390 15183 16235 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043376805.1 protein_id gnl|my_center|LOCUS_19390 17499 16258 gene locus_tag LOCUS_19400 gene arsK 17499 16258 CDS product arsenite efflux MFS transporter ArsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974577.1 protein_id gnl|my_center|LOCUS_19400 18902 17499 gene locus_tag LOCUS_19410 18902 17499 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085876.1 protein_id gnl|my_center|LOCUS_19410 19254 18937 gene locus_tag LOCUS_19420 19254 18937 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172264.1 protein_id gnl|my_center|LOCUS_19420 20259 19339 gene locus_tag LOCUS_19430 20259 19339 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 protein_id gnl|my_center|LOCUS_19430 20747 20256 gene locus_tag LOCUS_19440 20747 20256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 22249 20828 gene locus_tag LOCUS_19450 22249 20828 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926174.1 protein_id gnl|my_center|LOCUS_19450 22836 22474 gene locus_tag LOCUS_19460 22836 22474 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640610.1 protein_id gnl|my_center|LOCUS_19460 25175 23013 gene locus_tag LOCUS_19470 gene katG 25175 23013 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence050 <1 2330 gene locus_tag LOCUS_19480 <1 2330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083576.1:double-strand break repair protein AddB 2327 5800 gene locus_tag LOCUS_19490 gene addA 2327 5800 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921368.1 protein_id gnl|my_center|LOCUS_19490 5917 6237 gene locus_tag LOCUS_19500 gene trxA 5917 6237 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968307.1 protein_id gnl|my_center|LOCUS_19500 6524 6321 gene locus_tag LOCUS_19510 6524 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 6664 8808 gene locus_tag LOCUS_19520 6664 8808 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_19520 10009 8813 gene locus_tag LOCUS_19530 10009 8813 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_19530 10109 10441 gene locus_tag LOCUS_19540 10109 10441 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068504438.1 protein_id gnl|my_center|LOCUS_19540 10443 10955 gene locus_tag LOCUS_19550 10443 10955 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002730154.1 protein_id gnl|my_center|LOCUS_19550 11752 11012 gene locus_tag LOCUS_19560 11752 11012 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083731.1 protein_id gnl|my_center|LOCUS_19560 12005 11808 gene locus_tag LOCUS_19570 12005 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 12281 12144 gene locus_tag LOCUS_19580 12281 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 13298 12399 gene locus_tag LOCUS_19590 13298 12399 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727392.1 protein_id gnl|my_center|LOCUS_19590 15112 13409 gene locus_tag LOCUS_19600 15112 13409 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384487.1 protein_id gnl|my_center|LOCUS_19600 16130 15246 gene locus_tag LOCUS_19610 16130 15246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816047.1 protein_id gnl|my_center|LOCUS_19610 17113 16139 gene locus_tag LOCUS_19620 17113 16139 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162734144.1 protein_id gnl|my_center|LOCUS_19620 17938 17141 gene locus_tag LOCUS_19630 17938 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 17398 17411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18093 18650 gene locus_tag LOCUS_19640 18093 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 18647 20236 gene locus_tag LOCUS_19650 18647 20236 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040799.1 protein_id gnl|my_center|LOCUS_19650 20378 21325 gene locus_tag LOCUS_19660 20378 21325 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311984.1 protein_id gnl|my_center|LOCUS_19660 21486 22526 gene locus_tag LOCUS_19670 21486 22526 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731241.1 protein_id gnl|my_center|LOCUS_19670 22499 23254 gene locus_tag LOCUS_19680 22499 23254 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065073.1 protein_id gnl|my_center|LOCUS_19680 <25251 23409 gene locus_tag LOCUS_19690 <25251 23409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257258.1:NAD(+) synthase >Feature sequence051 1229 60 gene locus_tag LOCUS_19700 1229 60 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_19700 1430 2284 gene locus_tag LOCUS_19710 1430 2284 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084215.1 protein_id gnl|my_center|LOCUS_19710 2448 3548 gene locus_tag LOCUS_19720 gene hisC 2448 3548 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529387.1 protein_id gnl|my_center|LOCUS_19720 3548 4495 gene locus_tag LOCUS_19730 3548 4495 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 protein_id gnl|my_center|LOCUS_19730 4577 4652 gene locus_tag LOCUS_t00200 4577 4652 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5317 6168 gene locus_tag LOCUS_19740 5317 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 6170 6466 gene locus_tag LOCUS_19750 6170 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 6994 8619 gene locus_tag LOCUS_19760 6994 8619 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_19760 8720 9664 gene locus_tag LOCUS_19770 gene gsiC 8720 9664 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065129.1 protein_id gnl|my_center|LOCUS_19770 9657 10544 gene locus_tag LOCUS_19780 9657 10544 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243753.1 protein_id gnl|my_center|LOCUS_19780 10591 11886 gene locus_tag LOCUS_19790 10591 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 11867 12019 gene locus_tag LOCUS_19800 11867 12019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 12130 13566 gene locus_tag LOCUS_19810 12130 13566 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925697.1 protein_id gnl|my_center|LOCUS_19810 13730 14911 gene locus_tag LOCUS_19820 13730 14911 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 protein_id gnl|my_center|LOCUS_19820 14908 15510 gene locus_tag LOCUS_19830 14908 15510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 15586 17901 gene locus_tag LOCUS_19840 15586 17901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 17976 19016 gene locus_tag LOCUS_19850 17976 19016 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064135.1 protein_id gnl|my_center|LOCUS_19850 20074 19148 gene locus_tag LOCUS_19860 20074 19148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 20559 20092 gene locus_tag LOCUS_19870 20559 20092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 20808 21770 gene locus_tag LOCUS_19880 20808 21770 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088986.1 protein_id gnl|my_center|LOCUS_19880 21985 22758 gene locus_tag LOCUS_19890 21985 22758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088987.1 protein_id gnl|my_center|LOCUS_19890 22770 23549 gene locus_tag LOCUS_19900 22770 23549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966753.1 protein_id gnl|my_center|LOCUS_19900 23638 24498 gene locus_tag LOCUS_19910 23638 24498 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965671.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence052 1052 429 gene locus_tag LOCUS_19920 1052 429 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_19920 1736 1056 gene locus_tag LOCUS_19930 1736 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2209 1733 gene locus_tag LOCUS_19940 2209 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2543 2223 gene locus_tag LOCUS_19950 2543 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2911 2699 gene locus_tag LOCUS_19960 2911 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 3180 3827 gene locus_tag LOCUS_19970 3180 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 4241 3933 gene locus_tag LOCUS_19980 4241 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 4650 4393 gene locus_tag LOCUS_19990 4650 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090083.1 protein_id gnl|my_center|LOCUS_19990 4965 5954 gene locus_tag LOCUS_20000 4965 5954 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086118.1 protein_id gnl|my_center|LOCUS_20000 5951 6712 gene locus_tag LOCUS_20010 5951 6712 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086119.1 protein_id gnl|my_center|LOCUS_20010 6733 8190 gene locus_tag LOCUS_20020 6733 8190 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086120.1 protein_id gnl|my_center|LOCUS_20020 8277 9884 gene locus_tag LOCUS_20030 8277 9884 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086121.1 protein_id gnl|my_center|LOCUS_20030 10053 11084 gene locus_tag LOCUS_20040 10053 11084 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463752.1 protein_id gnl|my_center|LOCUS_20040 11332 12180 gene locus_tag LOCUS_20050 11332 12180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086123.1 protein_id gnl|my_center|LOCUS_20050 12344 14122 gene locus_tag LOCUS_20060 12344 14122 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083859.1 protein_id gnl|my_center|LOCUS_20060 14205 14522 gene locus_tag LOCUS_20070 14205 14522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 15471 14674 gene locus_tag LOCUS_20080 gene iolB 15471 14674 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528375.1 protein_id gnl|my_center|LOCUS_20080 16506 15622 gene locus_tag LOCUS_20090 gene iolE 16506 15622 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 protein_id gnl|my_center|LOCUS_20090 18506 16659 gene locus_tag LOCUS_20100 gene iolD 18506 16659 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528372.1 protein_id gnl|my_center|LOCUS_20100 20615 18681 gene locus_tag LOCUS_20110 gene iolC 20615 18681 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528371.1 protein_id gnl|my_center|LOCUS_20110 21628 20753 gene locus_tag LOCUS_20120 21628 20753 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502014.1 protein_id gnl|my_center|LOCUS_20120 21814 22485 gene locus_tag LOCUS_20130 21814 22485 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966024.1 protein_id gnl|my_center|LOCUS_20130 23392 22589 gene locus_tag LOCUS_20140 23392 22589 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969397.1 protein_id gnl|my_center|LOCUS_20140 24400 23525 gene locus_tag LOCUS_20150 24400 23525 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974199.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence053 1 462 gene locus_tag LOCUS_20160 1 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 465 1682 gene locus_tag LOCUS_20170 465 1682 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533691.1 protein_id gnl|my_center|LOCUS_20170 2168 1722 gene locus_tag LOCUS_20180 2168 1722 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084076.1 protein_id gnl|my_center|LOCUS_20180 2659 2171 gene locus_tag LOCUS_20190 2659 2171 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084075.1 protein_id gnl|my_center|LOCUS_20190 4002 2710 gene locus_tag LOCUS_20200 gene hisD 4002 2710 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084074.1 protein_id gnl|my_center|LOCUS_20200 4516 4070 gene locus_tag LOCUS_20210 4516 4070 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530200.1 protein_id gnl|my_center|LOCUS_20210 5841 4549 gene locus_tag LOCUS_20220 gene murA 5841 4549 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970968.1 protein_id gnl|my_center|LOCUS_20220 6057 5893 gene locus_tag LOCUS_20230 6057 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 6352 7308 gene locus_tag LOCUS_20240 6352 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 7443 9767 gene locus_tag LOCUS_20250 7443 9767 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089886.1 protein_id gnl|my_center|LOCUS_20250 9994 11451 gene locus_tag LOCUS_20260 9994 11451 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968583.1 protein_id gnl|my_center|LOCUS_20260 11462 12922 gene locus_tag LOCUS_20270 11462 12922 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175987.1 protein_id gnl|my_center|LOCUS_20270 13567 12938 gene locus_tag LOCUS_20280 13567 12938 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327211.1 protein_id gnl|my_center|LOCUS_20280 13732 14076 gene locus_tag LOCUS_20290 13732 14076 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173552.1 protein_id gnl|my_center|LOCUS_20290 14073 15167 gene locus_tag LOCUS_20300 14073 15167 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083959.1 protein_id gnl|my_center|LOCUS_20300 15487 15218 gene locus_tag LOCUS_20310 15487 15218 CDS product DUF6460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172810.1 protein_id gnl|my_center|LOCUS_20310 16251 15571 gene locus_tag LOCUS_20320 16251 15571 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084012.1 protein_id gnl|my_center|LOCUS_20320 18014 16368 gene locus_tag LOCUS_20330 18014 16368 CDS product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921437.1 protein_id gnl|my_center|LOCUS_20330 18128 18895 gene locus_tag LOCUS_20340 18128 18895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 19982 18906 gene locus_tag LOCUS_20350 19982 18906 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083964.1 protein_id gnl|my_center|LOCUS_20350 20006 20965 gene locus_tag LOCUS_20360 20006 20965 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083965.1 protein_id gnl|my_center|LOCUS_20360 21318 20986 gene locus_tag LOCUS_20370 21318 20986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 21422 21742 gene locus_tag LOCUS_20380 21422 21742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 21873 24359 gene locus_tag LOCUS_20390 21873 24359 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650294.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence054 1852 920 gene locus_tag LOCUS_20400 1852 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2145 4067 gene locus_tag LOCUS_20410 gene dnaK 2145 4067 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083506.1 protein_id gnl|my_center|LOCUS_20410 4222 5346 gene locus_tag LOCUS_20420 gene dnaJ 4222 5346 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309945.1 protein_id gnl|my_center|LOCUS_20420 5615 5424 gene locus_tag LOCUS_20430 5615 5424 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767547.1 protein_id gnl|my_center|LOCUS_20430 5907 5710 gene locus_tag LOCUS_20440 5907 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 5825 8026 gene locus_tag LOCUS_20450 5825 8026 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390989.1 protein_id gnl|my_center|LOCUS_20450 8668 9945 gene locus_tag LOCUS_20460 gene coaBC 8668 9945 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083582.1 protein_id gnl|my_center|LOCUS_20460 9966 10445 gene locus_tag LOCUS_20470 gene dut 9966 10445 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_20470 10442 10894 gene locus_tag LOCUS_20480 10442 10894 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_20480 10986 11972 gene locus_tag LOCUS_20490 gene cysK 10986 11972 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 protein_id gnl|my_center|LOCUS_20490 13414 12044 gene locus_tag LOCUS_20500 13414 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 13918 13484 gene locus_tag LOCUS_20510 13918 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 14291 13923 gene locus_tag LOCUS_20520 14291 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 15527 14415 gene locus_tag LOCUS_20530 15527 14415 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084283.1 protein_id gnl|my_center|LOCUS_20530 18656 15606 gene locus_tag LOCUS_20540 gene polA 18656 15606 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173101.1 protein_id gnl|my_center|LOCUS_20540 19695 18766 gene locus_tag LOCUS_20550 19695 18766 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088087.1 protein_id gnl|my_center|LOCUS_20550 20424 19738 gene locus_tag LOCUS_20560 20424 19738 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199325.1 protein_id gnl|my_center|LOCUS_20560 20665 20874 gene locus_tag LOCUS_20570 20665 20874 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008874821.1 protein_id gnl|my_center|LOCUS_20570 22441 21203 gene locus_tag LOCUS_20580 22441 21203 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 protein_id gnl|my_center|LOCUS_20580 22686 23399 gene locus_tag LOCUS_20590 22686 23399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 24389 23409 gene locus_tag LOCUS_20600 24389 23409 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083909.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence055 <1 1257 gene locus_tag LOCUS_20610 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088122.1:RluA family pseudouridine synthase 1411 1911 gene locus_tag LOCUS_20620 1411 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 1921 2673 gene locus_tag LOCUS_20630 1921 2673 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385291.1 protein_id gnl|my_center|LOCUS_20630 3001 3435 gene locus_tag LOCUS_20640 3001 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3693 5693 gene locus_tag LOCUS_20650 3693 5693 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088023.1 protein_id gnl|my_center|LOCUS_20650 5833 6453 gene locus_tag LOCUS_20660 5833 6453 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925853.1 protein_id gnl|my_center|LOCUS_20660 6498 7016 gene locus_tag LOCUS_20670 6498 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 7269 7048 gene locus_tag LOCUS_20680 7269 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 7290 7766 gene locus_tag LOCUS_20690 7290 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 8040 7771 gene locus_tag LOCUS_20700 8040 7771 CDS product DUF3253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338323.1 protein_id gnl|my_center|LOCUS_20700 8764 8054 gene locus_tag LOCUS_20710 8764 8054 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087926.1 protein_id gnl|my_center|LOCUS_20710 8873 9301 gene locus_tag LOCUS_20720 8873 9301 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_20720 9298 9480 gene locus_tag LOCUS_20730 9298 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 10005 9490 gene locus_tag LOCUS_20740 10005 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 11313 10141 gene locus_tag LOCUS_20750 11313 10141 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_20750 12464 11454 gene locus_tag LOCUS_20760 12464 11454 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241170.1 protein_id gnl|my_center|LOCUS_20760 13482 12556 gene locus_tag LOCUS_20770 13482 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 14529 13600 gene locus_tag LOCUS_20780 14529 13600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 15957 14605 gene locus_tag LOCUS_20790 gene mgtE 15957 14605 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088007.1 protein_id gnl|my_center|LOCUS_20790 16232 16148 gene locus_tag LOCUS_t00210 16232 16148 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16596 16330 gene locus_tag LOCUS_20800 16596 16330 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088012.1 protein_id gnl|my_center|LOCUS_20800 16718 17458 gene locus_tag LOCUS_20810 gene lipB 16718 17458 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258843.1 protein_id gnl|my_center|LOCUS_20810 17512 17712 gene locus_tag LOCUS_20820 17512 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 17828 19435 gene locus_tag LOCUS_20830 17828 19435 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040777.1 protein_id gnl|my_center|LOCUS_20830 19512 20129 gene locus_tag LOCUS_20840 19512 20129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974208.1 protein_id gnl|my_center|LOCUS_20840 20492 20091 gene locus_tag LOCUS_20850 20492 20091 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316411.1 protein_id gnl|my_center|LOCUS_20850 20620 20997 gene locus_tag LOCUS_20860 20620 20997 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969008.1 protein_id gnl|my_center|LOCUS_20860 21169 23061 gene locus_tag LOCUS_20870 21169 23061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 23195 23971 gene locus_tag LOCUS_20880 23195 23971 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence056 1198 188 gene locus_tag LOCUS_20890 1198 188 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087629.1 protein_id gnl|my_center|LOCUS_20890 1458 2624 gene locus_tag LOCUS_20900 1458 2624 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966314.1 protein_id gnl|my_center|LOCUS_20900 3394 2657 gene locus_tag LOCUS_20910 3394 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 6964 3485 gene locus_tag LOCUS_20920 gene dnaE 6964 3485 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087634.1 protein_id gnl|my_center|LOCUS_20920 7334 7068 gene locus_tag LOCUS_20930 7334 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 8016 7318 gene locus_tag LOCUS_20940 8016 7318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087642.1 protein_id gnl|my_center|LOCUS_20940 9320 8022 gene locus_tag LOCUS_20950 9320 8022 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_20950 10648 9317 gene locus_tag LOCUS_20960 10648 9317 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531107.1 protein_id gnl|my_center|LOCUS_20960 11333 10773 gene locus_tag LOCUS_20970 gene coaD 11333 10773 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087462.1 protein_id gnl|my_center|LOCUS_20970 13434 11347 gene locus_tag LOCUS_20980 13434 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 13740 15701 gene locus_tag LOCUS_20990 13740 15701 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971407.1 protein_id gnl|my_center|LOCUS_20990 15888 15709 gene locus_tag LOCUS_21000 15888 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 16786 16055 gene locus_tag LOCUS_21010 16786 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167373524.1 protein_id gnl|my_center|LOCUS_21010 16861 18339 gene locus_tag LOCUS_21020 16861 18339 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384423.1 protein_id gnl|my_center|LOCUS_21020 18350 19495 gene locus_tag LOCUS_21030 18350 19495 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_21030 19692 19534 gene locus_tag LOCUS_21040 19692 19534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 20093 19689 gene locus_tag LOCUS_21050 20093 19689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 20548 20096 gene locus_tag LOCUS_21060 20548 20096 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086883.1 protein_id gnl|my_center|LOCUS_21060 22092 20599 gene locus_tag LOCUS_21070 22092 20599 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171097.1 protein_id gnl|my_center|LOCUS_21070 22243 23436 gene locus_tag LOCUS_21080 gene lptF 22243 23436 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086881.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence057 929 2491 gene locus_tag LOCUS_21090 929 2491 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967198.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21090 2505 2837 gene locus_tag LOCUS_21100 2505 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21100 3005 3373 gene locus_tag LOCUS_21110 3005 3373 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531148.1 protein_id gnl|my_center|LOCUS_21110 3504 4508 gene locus_tag LOCUS_21120 3504 4508 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531149.1 protein_id gnl|my_center|LOCUS_21120 4505 5950 gene locus_tag LOCUS_21130 4505 5950 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109667839.1 protein_id gnl|my_center|LOCUS_21130 6283 6041 gene locus_tag LOCUS_21140 6283 6041 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970195.1 protein_id gnl|my_center|LOCUS_21140 6552 7856 gene locus_tag LOCUS_21150 6552 7856 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090554.1 protein_id gnl|my_center|LOCUS_21150 7860 8303 gene locus_tag LOCUS_21160 7860 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 8315 9754 gene locus_tag LOCUS_21170 gene pyk 8315 9754 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089873.1 protein_id gnl|my_center|LOCUS_21170 10124 9759 gene locus_tag LOCUS_21180 10124 9759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 10563 10216 gene locus_tag LOCUS_21190 10563 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 10883 10560 gene locus_tag LOCUS_21200 10883 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 12991 11036 gene locus_tag LOCUS_21210 12991 11036 CDS product VC_2705 family sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259231.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21210 13265 13005 gene locus_tag LOCUS_21220 13265 13005 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256445.1 protein_id gnl|my_center|LOCUS_21220 14408 13419 gene locus_tag LOCUS_21230 14408 13419 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529205.1 protein_id gnl|my_center|LOCUS_21230 15099 14452 gene locus_tag LOCUS_21240 15099 14452 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337477.1 protein_id gnl|my_center|LOCUS_21240 15366 15241 gene locus_tag LOCUS_21250 gene ykgO 15366 15241 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006611362.1 protein_id gnl|my_center|LOCUS_21250 15673 15882 gene locus_tag LOCUS_21260 15673 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 16944 15901 gene locus_tag LOCUS_21270 gene obgE 16944 15901 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083257.1 protein_id gnl|my_center|LOCUS_21270 17980 17114 gene locus_tag LOCUS_21280 17980 17114 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114756.1 protein_id gnl|my_center|LOCUS_21280 18484 19038 gene locus_tag LOCUS_21290 18484 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 19373 19053 gene locus_tag LOCUS_21300 19373 19053 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531125.1 protein_id gnl|my_center|LOCUS_21300 19463 19987 gene locus_tag LOCUS_21310 19463 19987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 20592 20870 gene locus_tag LOCUS_21320 20592 20870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 21610 22764 gene locus_tag LOCUS_21330 21610 22764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence058 <1 1924 gene locus_tag LOCUS_21340 <1 1924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922389.1:multidrug efflux RND transporter permease subunit 1969 2673 gene locus_tag LOCUS_21350 1969 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114342.1 protein_id gnl|my_center|LOCUS_21350 3907 2792 gene locus_tag LOCUS_21360 3907 2792 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088791.1 protein_id gnl|my_center|LOCUS_21360 4325 3900 gene locus_tag LOCUS_21370 4325 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 6018 4537 gene locus_tag LOCUS_21380 gene gatA 6018 4537 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087849.1 protein_id gnl|my_center|LOCUS_21380 6433 6146 gene locus_tag LOCUS_21390 gene gatC 6433 6146 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531787.1 protein_id gnl|my_center|LOCUS_21390 7310 6612 gene locus_tag LOCUS_21400 7310 6612 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975133.1 protein_id gnl|my_center|LOCUS_21400 7571 7332 gene locus_tag LOCUS_21410 7571 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21410 7866 9566 gene locus_tag LOCUS_21420 gene ade 7866 9566 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992329.1 protein_id gnl|my_center|LOCUS_21420 10663 9683 gene locus_tag LOCUS_21430 10663 9683 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_21430 11589 10660 gene locus_tag LOCUS_21440 11589 10660 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_21440 12677 11613 gene locus_tag LOCUS_21450 12677 11613 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975815.1 protein_id gnl|my_center|LOCUS_21450 14028 12748 gene locus_tag LOCUS_21460 14028 12748 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460953.1 protein_id gnl|my_center|LOCUS_21460 14403 14116 gene locus_tag LOCUS_21470 14403 14116 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814039.1 protein_id gnl|my_center|LOCUS_21470 14490 15254 gene locus_tag LOCUS_21480 14490 15254 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040191.1 protein_id gnl|my_center|LOCUS_21480 15333 16310 gene locus_tag LOCUS_21490 15333 16310 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214557.1 protein_id gnl|my_center|LOCUS_21490 16385 16891 gene locus_tag LOCUS_21500 gene ruvX 16385 16891 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719835.1 protein_id gnl|my_center|LOCUS_21500 17343 16966 gene locus_tag LOCUS_21510 17343 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 17631 18545 gene locus_tag LOCUS_21520 17631 18545 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 protein_id gnl|my_center|LOCUS_21520 18757 18960 gene locus_tag LOCUS_21530 18757 18960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 19942 19019 gene locus_tag LOCUS_21540 19942 19019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 20688 19855 gene locus_tag LOCUS_21550 20688 19855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 22022 20721 gene locus_tag LOCUS_21560 22022 20721 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171586.1 protein_id gnl|my_center|LOCUS_21560 22239 22015 gene locus_tag LOCUS_21570 22239 22015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 23188 22244 gene locus_tag LOCUS_21580 23188 22244 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087859.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence059 375 1040 gene locus_tag LOCUS_21590 375 1040 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013635657.1 protein_id gnl|my_center|LOCUS_21590 1564 1109 gene locus_tag LOCUS_21600 1564 1109 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313709.1 protein_id gnl|my_center|LOCUS_21600 1691 2620 gene locus_tag LOCUS_21610 gene rocF 1691 2620 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533362.1 protein_id gnl|my_center|LOCUS_21610 2623 3711 gene locus_tag LOCUS_21620 2623 3711 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533363.1 protein_id gnl|my_center|LOCUS_21620 4553 3678 gene locus_tag LOCUS_21630 4553 3678 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524248.1 protein_id gnl|my_center|LOCUS_21630 4677 5453 gene locus_tag LOCUS_21640 4677 5453 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767735.1 protein_id gnl|my_center|LOCUS_21640 5582 6271 gene locus_tag LOCUS_21650 5582 6271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085934.1 protein_id gnl|my_center|LOCUS_21650 6271 6981 gene locus_tag LOCUS_21660 6271 6981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 protein_id gnl|my_center|LOCUS_21660 7221 7955 gene locus_tag LOCUS_21670 7221 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 7968 8777 gene locus_tag LOCUS_21680 gene aotP 7968 8777 CDS product arginine/ornithine transport ATP-binding protein AotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085940.1 protein_id gnl|my_center|LOCUS_21680 9874 8843 gene locus_tag LOCUS_21690 9874 8843 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091836956.1 protein_id gnl|my_center|LOCUS_21690 9975 11849 gene locus_tag LOCUS_21700 gene uidA 9975 11849 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003648792.1 protein_id gnl|my_center|LOCUS_21700 11930 12910 gene locus_tag LOCUS_21710 11930 12910 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_21710 12988 13494 gene locus_tag LOCUS_21720 12988 13494 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577036.1 protein_id gnl|my_center|LOCUS_21720 13501 14811 gene locus_tag LOCUS_21730 13501 14811 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_21730 14822 17239 gene locus_tag LOCUS_21740 14822 17239 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065355591.1 protein_id gnl|my_center|LOCUS_21740 18023 17229 gene locus_tag LOCUS_21750 18023 17229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 18954 18376 gene locus_tag LOCUS_21760 18954 18376 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084064.1 protein_id gnl|my_center|LOCUS_21760 19508 19008 gene locus_tag LOCUS_21770 19508 19008 CDS product twin-arginine translocation pathway signal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965303.1 protein_id gnl|my_center|LOCUS_21770 20677 19763 gene locus_tag LOCUS_21780 20677 19763 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967782.1 protein_id gnl|my_center|LOCUS_21780 20837 21283 gene locus_tag LOCUS_21790 20837 21283 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967781.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence060 376 113 gene locus_tag LOCUS_21800 376 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 1811 444 gene locus_tag LOCUS_21810 gene gor 1811 444 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086538.1 protein_id gnl|my_center|LOCUS_21810 3096 1804 gene locus_tag LOCUS_21820 3096 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 3300 4262 gene locus_tag LOCUS_21830 3300 4262 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966067.1 protein_id gnl|my_center|LOCUS_21830 4362 4841 gene locus_tag LOCUS_21840 4362 4841 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085946.1 protein_id gnl|my_center|LOCUS_21840 4854 6353 gene locus_tag LOCUS_21850 4854 6353 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172209.1 protein_id gnl|my_center|LOCUS_21850 7401 6334 gene locus_tag LOCUS_21860 7401 6334 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_21860 8181 7522 gene locus_tag LOCUS_21870 8181 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 8999 8298 gene locus_tag LOCUS_21880 gene rpiA 8999 8298 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086536.1 protein_id gnl|my_center|LOCUS_21880 10573 9122 gene locus_tag LOCUS_21890 10573 9122 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083629.1 protein_id gnl|my_center|LOCUS_21890 11188 10715 gene locus_tag LOCUS_21900 11188 10715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 11244 11957 gene locus_tag LOCUS_21910 11244 11957 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086535.1 protein_id gnl|my_center|LOCUS_21910 11995 12069 gene locus_tag LOCUS_t00220 11995 12069 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13023 13436 gene locus_tag LOCUS_21920 13023 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 13746 14273 gene locus_tag LOCUS_21930 13746 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 15620 14289 gene locus_tag LOCUS_21940 15620 14289 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531507.1 protein_id gnl|my_center|LOCUS_21940 15795 17006 gene locus_tag LOCUS_21950 gene cyoA 15795 17006 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531506.1 protein_id gnl|my_center|LOCUS_21950 17021 19027 gene locus_tag LOCUS_21960 gene cyoB 17021 19027 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531505.1 protein_id gnl|my_center|LOCUS_21960 19044 19664 gene locus_tag LOCUS_21970 gene cyoC 19044 19664 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531504.1 protein_id gnl|my_center|LOCUS_21970 19661 20044 gene locus_tag LOCUS_21980 gene cyoD 19661 20044 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082984.1 protein_id gnl|my_center|LOCUS_21980 20041 20799 gene locus_tag LOCUS_21990 20041 20799 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531502.1 protein_id gnl|my_center|LOCUS_21990 20840 22087 gene locus_tag LOCUS_22000 20840 22087 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 protein_id gnl|my_center|LOCUS_22000 22084 22617 gene locus_tag LOCUS_22010 22084 22617 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531509.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence061 1374 1156 gene locus_tag LOCUS_22020 1374 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 3728 1386 gene locus_tag LOCUS_22030 3728 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972634.1 protein_id gnl|my_center|LOCUS_22030 4375 3737 gene locus_tag LOCUS_22040 4375 3737 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972633.1 protein_id gnl|my_center|LOCUS_22040 5262 4375 gene locus_tag LOCUS_22050 5262 4375 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816096.1 protein_id gnl|my_center|LOCUS_22050 5642 5262 gene locus_tag LOCUS_22060 5642 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 6211 5639 gene locus_tag LOCUS_22070 6211 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 6978 6208 gene locus_tag LOCUS_22080 6978 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 7358 6981 gene locus_tag LOCUS_22090 7358 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 8491 7460 gene locus_tag LOCUS_22100 8491 7460 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975797.1 protein_id gnl|my_center|LOCUS_22100 8913 8554 gene locus_tag LOCUS_22110 8913 8554 CDS product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975798.1 protein_id gnl|my_center|LOCUS_22110 10077 8977 gene locus_tag LOCUS_22120 10077 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 11615 10074 gene locus_tag LOCUS_22130 11615 10074 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384022.1 protein_id gnl|my_center|LOCUS_22130 11875 11612 gene locus_tag LOCUS_22140 11875 11612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 12438 11836 gene locus_tag LOCUS_22150 12438 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 13843 12443 gene locus_tag LOCUS_22160 13843 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 14445 13840 gene locus_tag LOCUS_22170 14445 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 15173 14589 gene locus_tag LOCUS_22180 15173 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972632.1 protein_id gnl|my_center|LOCUS_22180 16071 15283 gene locus_tag LOCUS_22190 16071 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 18165 16405 gene locus_tag LOCUS_22200 18165 16405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 18802 18317 gene locus_tag LOCUS_22210 18802 18317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 18847 18865 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20226 19336 gene locus_tag LOCUS_22220 20226 19336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 21281 20226 gene locus_tag LOCUS_22230 21281 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 21502 21278 gene locus_tag LOCUS_22240 21502 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 22095 21499 gene locus_tag LOCUS_22250 22095 21499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976044.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence062 1479 379 gene locus_tag LOCUS_22260 1479 379 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529717.1 protein_id gnl|my_center|LOCUS_22260 1885 1493 gene locus_tag LOCUS_22270 1885 1493 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165969.1 protein_id gnl|my_center|LOCUS_22270 2481 4940 gene locus_tag LOCUS_22280 2481 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 4892 7042 gene locus_tag LOCUS_22290 4892 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 7049 8473 gene locus_tag LOCUS_22300 7049 8473 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 protein_id gnl|my_center|LOCUS_22300 9900 8680 gene locus_tag LOCUS_22310 9900 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 11207 9963 gene locus_tag LOCUS_22320 11207 9963 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 protein_id gnl|my_center|LOCUS_22320 12316 11327 gene locus_tag LOCUS_22330 gene galE 12316 11327 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 protein_id gnl|my_center|LOCUS_22330 12650 12681 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12697 13392 gene locus_tag LOCUS_22340 gene galU 12697 13392 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970204.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22340 13418 14299 gene locus_tag LOCUS_22350 13418 14299 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966655.1 protein_id gnl|my_center|LOCUS_22350 14462 14914 gene locus_tag LOCUS_22360 14462 14914 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_22360 16130 14889 gene locus_tag LOCUS_22370 16130 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 16307 18541 gene locus_tag LOCUS_22380 gene purL 16307 18541 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088464.1 protein_id gnl|my_center|LOCUS_22380 18593 18829 gene locus_tag LOCUS_22390 18593 18829 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088461.1 protein_id gnl|my_center|LOCUS_22390 18852 19121 gene locus_tag LOCUS_22400 18852 19121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 19139 19474 gene locus_tag LOCUS_22410 gene grxD 19139 19474 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531377.1 protein_id gnl|my_center|LOCUS_22410 20451 19537 gene locus_tag LOCUS_22420 20451 19537 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393678.1 protein_id gnl|my_center|LOCUS_22420 20525 21463 gene locus_tag LOCUS_22430 20525 21463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence063 585 7 gene locus_tag LOCUS_22440 gene def 585 7 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090831.1 protein_id gnl|my_center|LOCUS_22440 705 1889 gene locus_tag LOCUS_22450 gene rmuC 705 1889 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175976.1 protein_id gnl|my_center|LOCUS_22450 2411 1902 gene locus_tag LOCUS_22460 2411 1902 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532532.1 protein_id gnl|my_center|LOCUS_22460 3289 2507 gene locus_tag LOCUS_22470 3289 2507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083741.1 protein_id gnl|my_center|LOCUS_22470 4131 3301 gene locus_tag LOCUS_22480 4131 3301 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965193.1 protein_id gnl|my_center|LOCUS_22480 5114 4149 gene locus_tag LOCUS_22490 5114 4149 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167770862.1 protein_id gnl|my_center|LOCUS_22490 5400 8210 gene locus_tag LOCUS_22500 5400 8210 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965190.1 protein_id gnl|my_center|LOCUS_22500 8303 8905 gene locus_tag LOCUS_22510 gene grpE 8303 8905 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026613481.1 protein_id gnl|my_center|LOCUS_22510 8909 9100 gene locus_tag LOCUS_22520 8909 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22520 9085 9093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9169 9453 gene locus_tag LOCUS_22530 9169 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22530 10089 9466 gene locus_tag LOCUS_22540 10089 9466 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 protein_id gnl|my_center|LOCUS_22540 11019 10102 gene locus_tag LOCUS_22550 gene dapB 11019 10102 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528616.1 protein_id gnl|my_center|LOCUS_22550 12084 11086 gene locus_tag LOCUS_22560 12084 11086 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258159.1 protein_id gnl|my_center|LOCUS_22560 12284 12610 gene locus_tag LOCUS_22570 12284 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 14217 12976 gene locus_tag LOCUS_22580 14217 12976 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087863.1 protein_id gnl|my_center|LOCUS_22580 14446 14219 gene locus_tag LOCUS_22590 14446 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 14622 15026 gene locus_tag LOCUS_22600 14622 15026 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087465.1 protein_id gnl|my_center|LOCUS_22600 15125 16258 gene locus_tag LOCUS_22610 15125 16258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 17254 16268 gene locus_tag LOCUS_22620 gene mepA 17254 16268 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967706.1 protein_id gnl|my_center|LOCUS_22620 17361 18347 gene locus_tag LOCUS_22630 17361 18347 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090510.1 protein_id gnl|my_center|LOCUS_22630 18450 18623 gene locus_tag LOCUS_22640 18450 18623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 19596 18646 gene locus_tag LOCUS_22650 19596 18646 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529581.1 protein_id gnl|my_center|LOCUS_22650 19934 19596 gene locus_tag LOCUS_22660 19934 19596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 20385 20101 gene locus_tag LOCUS_22670 20385 20101 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008539997.1 protein_id gnl|my_center|LOCUS_22670 21382 20414 gene locus_tag LOCUS_22680 gene sppA 21382 20414 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083566.1 protein_id gnl|my_center|LOCUS_22680 <22380 21502 gene locus_tag LOCUS_22690 <22380 21502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919351.1:Hsp70 family protein >Feature sequence064 3007 2711 gene locus_tag LOCUS_22700 3007 2711 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975556.1 protein_id gnl|my_center|LOCUS_22700 3170 5272 gene locus_tag LOCUS_22710 gene recG 3170 5272 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 protein_id gnl|my_center|LOCUS_22710 5969 5250 gene locus_tag LOCUS_22720 5969 5250 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050423699.1 protein_id gnl|my_center|LOCUS_22720 6137 6514 gene locus_tag LOCUS_22730 6137 6514 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314952.1 protein_id gnl|my_center|LOCUS_22730 7801 6533 gene locus_tag LOCUS_22740 7801 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22740 8372 7809 gene locus_tag LOCUS_22750 8372 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22750 9860 8487 gene locus_tag LOCUS_22760 gene glmU 9860 8487 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533259.1 protein_id gnl|my_center|LOCUS_22760 10145 11695 gene locus_tag LOCUS_22770 10145 11695 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921572.1 protein_id gnl|my_center|LOCUS_22770 11683 13866 gene locus_tag LOCUS_22780 gene mdoH 11683 13866 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881051.1 protein_id gnl|my_center|LOCUS_22780 14289 13885 gene locus_tag LOCUS_22790 14289 13885 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037960.1 protein_id gnl|my_center|LOCUS_22790 15231 14332 gene locus_tag LOCUS_22800 15231 14332 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064693.1 protein_id gnl|my_center|LOCUS_22800 16490 15321 gene locus_tag LOCUS_22810 16490 15321 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084987.1 protein_id gnl|my_center|LOCUS_22810 17121 16492 gene locus_tag LOCUS_22820 17121 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 17521 17132 gene locus_tag LOCUS_22830 17521 17132 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972060.1 protein_id gnl|my_center|LOCUS_22830 18652 17678 gene locus_tag LOCUS_22840 gene argC 18652 17678 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082328.1 protein_id gnl|my_center|LOCUS_22840 20605 18977 gene locus_tag LOCUS_22850 20605 18977 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087573.1 protein_id gnl|my_center|LOCUS_22850 21218 20817 gene locus_tag LOCUS_22860 21218 20817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 22145 21384 gene locus_tag LOCUS_22870 gene tpiA 22145 21384 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389642.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence065 297 1070 gene locus_tag LOCUS_22880 297 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 1172 1576 gene locus_tag LOCUS_22890 1172 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1734 2093 gene locus_tag LOCUS_22900 1734 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3343 2099 gene locus_tag LOCUS_22910 3343 2099 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088821.1 protein_id gnl|my_center|LOCUS_22910 3627 3899 gene locus_tag LOCUS_22920 gene hupB 3627 3899 CDS product DNA-binding protein HupB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531811.1 protein_id gnl|my_center|LOCUS_22920 3995 5170 gene locus_tag LOCUS_22930 3995 5170 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089432.1 protein_id gnl|my_center|LOCUS_22930 5220 5534 gene locus_tag LOCUS_22940 5220 5534 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_22940 5518 5790 gene locus_tag LOCUS_22950 5518 5790 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041364541.1 protein_id gnl|my_center|LOCUS_22950 5847 6446 gene locus_tag LOCUS_22960 5847 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 6875 6453 gene locus_tag LOCUS_22970 6875 6453 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088599.1 protein_id gnl|my_center|LOCUS_22970 7101 8339 gene locus_tag LOCUS_22980 7101 8339 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_22980 8612 8364 gene locus_tag LOCUS_22990 8612 8364 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531878.1 protein_id gnl|my_center|LOCUS_22990 9139 8798 gene locus_tag LOCUS_23000 9139 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 9029 9295 gene locus_tag LOCUS_23010 9029 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 9401 15115 gene locus_tag LOCUS_23020 9401 15115 CDS product kinesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396557.1 protein_id gnl|my_center|LOCUS_23020 15078 15440 gene locus_tag LOCUS_23030 15078 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 16671 15787 gene locus_tag LOCUS_23040 16671 15787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 16980 16693 gene locus_tag LOCUS_23050 16980 16693 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036743091.1 protein_id gnl|my_center|LOCUS_23050 17733 17137 gene locus_tag LOCUS_23060 17733 17137 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538228.1 protein_id gnl|my_center|LOCUS_23060 17896 17672 gene locus_tag LOCUS_23070 17896 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 18366 18079 gene locus_tag LOCUS_23080 18366 18079 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084140443.1 protein_id gnl|my_center|LOCUS_23080 18454 18672 gene locus_tag LOCUS_23090 18454 18672 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970277.1 protein_id gnl|my_center|LOCUS_23090 19057 18737 gene locus_tag LOCUS_23100 19057 18737 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084751.1 protein_id gnl|my_center|LOCUS_23100 19718 19723 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21226 20129 gene locus_tag LOCUS_23110 21226 20129 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205497.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence066 4825 1103 gene locus_tag LOCUS_23120 4825 1103 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087047.1 protein_id gnl|my_center|LOCUS_23120 5603 6013 gene locus_tag LOCUS_23130 5603 6013 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087052.1 protein_id gnl|my_center|LOCUS_23130 6118 6765 gene locus_tag LOCUS_23140 6118 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 7453 6773 gene locus_tag LOCUS_23150 gene aat 7453 6773 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087059.1 protein_id gnl|my_center|LOCUS_23150 9037 7643 gene locus_tag LOCUS_23160 gene accC 9037 7643 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_23160 9498 9034 gene locus_tag LOCUS_23170 gene accB 9498 9034 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531358.1 protein_id gnl|my_center|LOCUS_23170 10026 9568 gene locus_tag LOCUS_23180 gene aroQ 10026 9568 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531359.1 protein_id gnl|my_center|LOCUS_23180 10941 10129 gene locus_tag LOCUS_23190 10941 10129 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087067.1 protein_id gnl|my_center|LOCUS_23190 11101 12306 gene locus_tag LOCUS_23200 11101 12306 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087069.1 protein_id gnl|my_center|LOCUS_23200 12370 14634 gene locus_tag LOCUS_23210 12370 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 17454 14692 gene locus_tag LOCUS_23220 17454 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 18093 19373 gene locus_tag LOCUS_23230 18093 19373 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_23230 19522 21969 gene locus_tag LOCUS_23240 19522 21969 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087080.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence067 <1 599 gene locus_tag LOCUS_23250 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087621.1:outer membrane protein assembly factor BamA 640 1695 gene locus_tag LOCUS_23260 gene lpxD 640 1695 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087620.1 protein_id gnl|my_center|LOCUS_23260 1828 2286 gene locus_tag LOCUS_23270 gene fabZ 1828 2286 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975310.1 protein_id gnl|my_center|LOCUS_23270 2338 3147 gene locus_tag LOCUS_23280 gene lpxA 2338 3147 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 protein_id gnl|my_center|LOCUS_23280 3144 4019 gene locus_tag LOCUS_23290 gene lpxI 3144 4019 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967850.1 protein_id gnl|my_center|LOCUS_23290 4016 5212 gene locus_tag LOCUS_23300 gene lpxB 4016 5212 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087615.1 protein_id gnl|my_center|LOCUS_23300 6206 5217 gene locus_tag LOCUS_23310 6206 5217 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_23310 7643 6354 gene locus_tag LOCUS_23320 gene gltA 7643 6354 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328205.1 protein_id gnl|my_center|LOCUS_23320 9339 7921 gene locus_tag LOCUS_23330 gene gltX 9339 7921 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087606.1 protein_id gnl|my_center|LOCUS_23330 9521 11782 gene locus_tag LOCUS_23340 9521 11782 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921625.1 protein_id gnl|my_center|LOCUS_23340 12177 11776 gene locus_tag LOCUS_23350 12177 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23350 12445 12305 gene locus_tag LOCUS_23360 12445 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23360 13765 12554 gene locus_tag LOCUS_23370 13765 12554 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_23370 14262 13765 gene locus_tag LOCUS_23380 gene moaC 14262 13765 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971801.1 protein_id gnl|my_center|LOCUS_23380 15071 14259 gene locus_tag LOCUS_23390 gene trpC 15071 14259 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531739.1 protein_id gnl|my_center|LOCUS_23390 16092 15079 gene locus_tag LOCUS_23400 gene trpD 16092 15079 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328329.1 protein_id gnl|my_center|LOCUS_23400 16444 16148 gene locus_tag LOCUS_23410 16444 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 16668 16339 gene locus_tag LOCUS_23420 16668 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 18248 16737 gene locus_tag LOCUS_23430 18248 16737 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992401.1 protein_id gnl|my_center|LOCUS_23430 18617 18384 gene locus_tag LOCUS_23440 18617 18384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 18813 19505 gene locus_tag LOCUS_23450 18813 19505 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140133.1 protein_id gnl|my_center|LOCUS_23450 19549 20208 gene locus_tag LOCUS_23460 19549 20208 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966008.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence068 124 813 gene locus_tag LOCUS_23470 124 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1432 818 gene locus_tag LOCUS_23480 1432 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2215 1607 gene locus_tag LOCUS_23490 2215 1607 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526566.1 protein_id gnl|my_center|LOCUS_23490 2474 2295 gene locus_tag LOCUS_23500 2474 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2633 2785 gene locus_tag LOCUS_23510 2633 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23510 3249 2917 gene locus_tag LOCUS_23520 3249 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 4649 3336 gene locus_tag LOCUS_23530 4649 3336 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531147.1 protein_id gnl|my_center|LOCUS_23530 5536 4646 gene locus_tag LOCUS_23540 5536 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 6729 5827 gene locus_tag LOCUS_23550 6729 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 7466 6879 gene locus_tag LOCUS_23560 7466 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 8595 7624 gene locus_tag LOCUS_23570 8595 7624 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082920.1 protein_id gnl|my_center|LOCUS_23570 9541 8780 gene locus_tag LOCUS_23580 9541 8780 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919296.1 protein_id gnl|my_center|LOCUS_23580 9806 10864 gene locus_tag LOCUS_23590 gene ugpC 9806 10864 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061266.1 protein_id gnl|my_center|LOCUS_23590 10975 12300 gene locus_tag LOCUS_23600 10975 12300 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086695.1 protein_id gnl|my_center|LOCUS_23600 12620 12375 gene locus_tag LOCUS_23610 12620 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 12502 13395 gene locus_tag LOCUS_23620 12502 13395 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170961.1 protein_id gnl|my_center|LOCUS_23620 13388 14296 gene locus_tag LOCUS_23630 13388 14296 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086697.1 protein_id gnl|my_center|LOCUS_23630 14473 15366 gene locus_tag LOCUS_23640 14473 15366 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969407.1 protein_id gnl|my_center|LOCUS_23640 16459 15383 gene locus_tag LOCUS_23650 16459 15383 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004433466.1 protein_id gnl|my_center|LOCUS_23650 16563 17474 gene locus_tag LOCUS_23660 16563 17474 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392198.1 protein_id gnl|my_center|LOCUS_23660 18252 17491 gene locus_tag LOCUS_23670 18252 17491 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966024.1 protein_id gnl|my_center|LOCUS_23670 18395 19525 gene locus_tag LOCUS_23680 18395 19525 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827650.1 protein_id gnl|my_center|LOCUS_23680 19590 19760 gene locus_tag LOCUS_23690 19590 19760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 19757 19939 gene locus_tag LOCUS_23700 19757 19939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 20064 19980 gene locus_tag LOCUS_t00230 20064 19980 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20553 20717 gene locus_tag LOCUS_23710 20553 20717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 21317 20745 gene locus_tag LOCUS_23720 21317 20745 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315684.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence069 1426 506 gene locus_tag LOCUS_23730 1426 506 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172837.1 protein_id gnl|my_center|LOCUS_23730 2476 1541 gene locus_tag LOCUS_23740 gene trxB 2476 1541 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265863.1 protein_id gnl|my_center|LOCUS_23740 3532 2549 gene locus_tag LOCUS_23750 3532 2549 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038688.1 protein_id gnl|my_center|LOCUS_23750 3633 4097 gene locus_tag LOCUS_23760 3633 4097 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157328319.1 protein_id gnl|my_center|LOCUS_23760 4102 4557 gene locus_tag LOCUS_23770 4102 4557 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 protein_id gnl|my_center|LOCUS_23770 5030 4542 gene locus_tag LOCUS_23780 5030 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 5602 5126 gene locus_tag LOCUS_23790 gene greA 5602 5126 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014764680.1 protein_id gnl|my_center|LOCUS_23790 9065 5703 gene locus_tag LOCUS_23800 gene carB 9065 5703 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090112.1 protein_id gnl|my_center|LOCUS_23800 9285 9689 gene locus_tag LOCUS_23810 9285 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 10099 9596 gene locus_tag LOCUS_23820 10099 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 10893 10201 gene locus_tag LOCUS_23830 10893 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 11206 10985 gene locus_tag LOCUS_23840 11206 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 11588 11325 gene locus_tag LOCUS_23850 11588 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 11768 12982 gene locus_tag LOCUS_23860 gene cfa1 11768 12982 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330709.1 protein_id gnl|my_center|LOCUS_23860 13511 12990 gene locus_tag LOCUS_23870 13511 12990 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620314.1 protein_id gnl|my_center|LOCUS_23870 13986 13558 gene locus_tag LOCUS_23880 13986 13558 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088962.1 protein_id gnl|my_center|LOCUS_23880 15849 14227 gene locus_tag LOCUS_23890 15849 14227 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530640.1 protein_id gnl|my_center|LOCUS_23890 16243 16025 gene locus_tag LOCUS_23900 16243 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23900 17142 16156 gene locus_tag LOCUS_23910 17142 16156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23910 17298 17759 gene locus_tag LOCUS_23920 17298 17759 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090104.1 protein_id gnl|my_center|LOCUS_23920 18167 17763 gene locus_tag LOCUS_23930 18167 17763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 18451 18146 gene locus_tag LOCUS_23940 18451 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 18847 18614 gene locus_tag LOCUS_23950 18847 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 19275 19000 gene locus_tag LOCUS_23960 19275 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 19393 21300 gene locus_tag LOCUS_23970 gene dnaG 19393 21300 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090085.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence070 261 422 gene locus_tag LOCUS_23980 261 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 1441 509 gene locus_tag LOCUS_23990 1441 509 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 protein_id gnl|my_center|LOCUS_23990 2022 1468 gene locus_tag LOCUS_24000 2022 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2558 2019 gene locus_tag LOCUS_24010 gene lspA 2558 2019 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939214.1 protein_id gnl|my_center|LOCUS_24010 3184 2555 gene locus_tag LOCUS_24020 3184 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 5822 3201 gene locus_tag LOCUS_24030 5822 3201 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971190.1 protein_id gnl|my_center|LOCUS_24030 5896 6345 gene locus_tag LOCUS_24040 5896 6345 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_24040 6596 7000 gene locus_tag LOCUS_24050 6596 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 7193 6963 gene locus_tag LOCUS_24060 7193 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 7132 7431 gene locus_tag LOCUS_24070 7132 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 7358 7597 gene locus_tag LOCUS_24080 7358 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 8023 7817 gene locus_tag LOCUS_24090 8023 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 8766 8020 gene locus_tag LOCUS_24100 8766 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 8992 8786 gene locus_tag LOCUS_24110 8992 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 9089 9655 gene locus_tag LOCUS_24120 9089 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545718.1 protein_id gnl|my_center|LOCUS_24120 9667 10596 gene locus_tag LOCUS_24130 9667 10596 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388364.1 protein_id gnl|my_center|LOCUS_24130 11715 10612 gene locus_tag LOCUS_24140 11715 10612 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085973.1 protein_id gnl|my_center|LOCUS_24140 11881 12477 gene locus_tag LOCUS_24150 11881 12477 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524578.1 protein_id gnl|my_center|LOCUS_24150 12467 13210 gene locus_tag LOCUS_24160 12467 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 13392 14633 gene locus_tag LOCUS_24170 13392 14633 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_24170 14638 15021 gene locus_tag LOCUS_24180 14638 15021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 15039 15425 gene locus_tag LOCUS_24190 15039 15425 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090276.1 protein_id gnl|my_center|LOCUS_24190 15913 15464 gene locus_tag LOCUS_24200 15913 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 17476 16043 gene locus_tag LOCUS_24210 17476 16043 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089225.1 protein_id gnl|my_center|LOCUS_24210 17916 17473 gene locus_tag LOCUS_24220 17916 17473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 17939 18199 gene locus_tag LOCUS_24230 17939 18199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 18399 18752 gene locus_tag LOCUS_24240 18399 18752 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005845276.1 protein_id gnl|my_center|LOCUS_24240 18761 20005 gene locus_tag LOCUS_24250 18761 20005 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467692.1 protein_id gnl|my_center|LOCUS_24250 <21305 20263 gene locus_tag LOCUS_24260 <21305 20263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001549912.1:MOBP family relaxase >Feature sequence071 894 6149 gene locus_tag LOCUS_24270 894 6149 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087210.1 protein_id gnl|my_center|LOCUS_24270 6218 8329 gene locus_tag LOCUS_24280 gene pbpC 6218 8329 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494094.1 protein_id gnl|my_center|LOCUS_24280 8624 8421 gene locus_tag LOCUS_24290 8624 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24290 11440 8549 gene locus_tag LOCUS_24300 11440 8549 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 protein_id gnl|my_center|LOCUS_24300 12320 11457 gene locus_tag LOCUS_24310 12320 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 12512 13189 gene locus_tag LOCUS_24320 gene mexL 12512 13189 CDS product efflux system transcriptional repressor MexL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_24320 13289 14137 gene locus_tag LOCUS_24330 gene phnC 13289 14137 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311734.1 protein_id gnl|my_center|LOCUS_24330 14191 15108 gene locus_tag LOCUS_24340 gene phnD 14191 15108 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090669.1 protein_id gnl|my_center|LOCUS_24340 15184 16065 gene locus_tag LOCUS_24350 gene phnE 15184 16065 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090668.1 protein_id gnl|my_center|LOCUS_24350 16062 16916 gene locus_tag LOCUS_24360 gene phnE 16062 16916 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090667.1 protein_id gnl|my_center|LOCUS_24360 17854 17102 gene locus_tag LOCUS_24370 gene phnF 17854 17102 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311161.1 protein_id gnl|my_center|LOCUS_24370 17976 18380 gene locus_tag LOCUS_24380 gene phnG 17976 18380 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494051.1 protein_id gnl|my_center|LOCUS_24380 18380 18982 gene locus_tag LOCUS_24390 gene phnH 18380 18982 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992374.1 protein_id gnl|my_center|LOCUS_24390 18982 20178 gene locus_tag LOCUS_24400 18982 20178 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084041.1 protein_id gnl|my_center|LOCUS_24400 20175 21131 gene locus_tag LOCUS_24410 20175 21131 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084042.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence072 <1 1028 gene locus_tag LOCUS_24420 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085846.1:DUF853 family protein 1279 2670 gene locus_tag LOCUS_24430 1279 2670 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529548.1 protein_id gnl|my_center|LOCUS_24430 2675 3256 gene locus_tag LOCUS_24440 2675 3256 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_24440 3375 3575 gene locus_tag LOCUS_24450 3375 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 3575 3814 gene locus_tag LOCUS_24460 3575 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 3874 4341 gene locus_tag LOCUS_24470 3874 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 4310 5587 gene locus_tag LOCUS_24480 4310 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 5724 6911 gene locus_tag LOCUS_24490 5724 6911 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920629.1 protein_id gnl|my_center|LOCUS_24490 6908 7108 gene locus_tag LOCUS_24500 6908 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 7105 7287 gene locus_tag LOCUS_24510 7105 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 7284 7820 gene locus_tag LOCUS_24520 7284 7820 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971285.1 protein_id gnl|my_center|LOCUS_24520 7846 9090 gene locus_tag LOCUS_24530 7846 9090 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 protein_id gnl|my_center|LOCUS_24530 9967 9125 gene locus_tag LOCUS_24540 9967 9125 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965209.1 protein_id gnl|my_center|LOCUS_24540 10813 10034 gene locus_tag LOCUS_24550 10813 10034 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965209.1 protein_id gnl|my_center|LOCUS_24550 10887 11456 gene locus_tag LOCUS_24560 10887 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 11460 11804 gene locus_tag LOCUS_24570 11460 11804 CDS product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938789.1 protein_id gnl|my_center|LOCUS_24570 11801 12211 gene locus_tag LOCUS_24580 11801 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 12244 12654 gene locus_tag LOCUS_24590 12244 12654 CDS product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383953.1 protein_id gnl|my_center|LOCUS_24590 12665 13045 gene locus_tag LOCUS_24600 12665 13045 CDS product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719629.1 protein_id gnl|my_center|LOCUS_24600 13081 13293 gene locus_tag LOCUS_24610 13081 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 13283 13873 gene locus_tag LOCUS_24620 13283 13873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 13886 14524 gene locus_tag LOCUS_24630 13886 14524 CDS product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 protein_id gnl|my_center|LOCUS_24630 14545 15426 gene locus_tag LOCUS_24640 14545 15426 CDS product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 protein_id gnl|my_center|LOCUS_24640 15423 15866 gene locus_tag LOCUS_24650 15423 15866 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971294.1 protein_id gnl|my_center|LOCUS_24650 15866 19783 gene locus_tag LOCUS_24660 15866 19783 CDS product glycoside hydrolase TIM-barrel-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971295.1 protein_id gnl|my_center|LOCUS_24660 19848 20159 gene locus_tag LOCUS_24670 19848 20159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 20200 20868 gene locus_tag LOCUS_24680 20200 20868 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence073 479 30 gene locus_tag LOCUS_24690 479 30 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088271.1 protein_id gnl|my_center|LOCUS_24690 605 1135 gene locus_tag LOCUS_24700 605 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 1899 1132 gene locus_tag LOCUS_24710 1899 1132 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444218.1 protein_id gnl|my_center|LOCUS_24710 2063 2530 gene locus_tag LOCUS_24720 2063 2530 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090707.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24720 2606 3010 gene locus_tag LOCUS_24730 2606 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 3148 4119 gene locus_tag LOCUS_24740 3148 4119 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175852.1 protein_id gnl|my_center|LOCUS_24740 4564 4133 gene locus_tag LOCUS_24750 4564 4133 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_24750 5547 4726 gene locus_tag LOCUS_24760 5547 4726 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921493.1 protein_id gnl|my_center|LOCUS_24760 5956 6528 gene locus_tag LOCUS_24770 5956 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 6658 7206 gene locus_tag LOCUS_24780 6658 7206 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176079.1 protein_id gnl|my_center|LOCUS_24780 7290 8039 gene locus_tag LOCUS_24790 7290 8039 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967457.1 protein_id gnl|my_center|LOCUS_24790 8218 8847 gene locus_tag LOCUS_24800 8218 8847 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967896.1 protein_id gnl|my_center|LOCUS_24800 9553 9023 gene locus_tag LOCUS_24810 9553 9023 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975835.1 protein_id gnl|my_center|LOCUS_24810 9938 9612 gene locus_tag LOCUS_24820 9938 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 10109 10885 gene locus_tag LOCUS_24830 10109 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 11285 11073 gene locus_tag LOCUS_24840 11285 11073 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153775551.1 protein_id gnl|my_center|LOCUS_24840 11940 13460 gene locus_tag LOCUS_24850 11940 13460 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967491.1 protein_id gnl|my_center|LOCUS_24850 13470 13937 gene locus_tag LOCUS_24860 13470 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 14099 15568 gene locus_tag LOCUS_24870 14099 15568 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971261.1 protein_id gnl|my_center|LOCUS_24870 16599 15739 gene locus_tag LOCUS_24880 16599 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 16757 16776 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16985 18829 gene locus_tag LOCUS_24890 16985 18829 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921178.1 protein_id gnl|my_center|LOCUS_24890 18833 19261 gene locus_tag LOCUS_24900 18833 19261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 20720 19398 gene locus_tag LOCUS_24910 20720 19398 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979394.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence074 262 639 gene locus_tag LOCUS_24920 262 639 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086290.1 protein_id gnl|my_center|LOCUS_24920 676 1746 gene locus_tag LOCUS_24930 676 1746 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_24930 2607 1759 gene locus_tag LOCUS_24940 gene purU 2607 1759 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921457.1 protein_id gnl|my_center|LOCUS_24940 2983 3330 gene locus_tag LOCUS_24950 2983 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 4209 3460 gene locus_tag LOCUS_24960 4209 3460 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532420.1 protein_id gnl|my_center|LOCUS_24960 5579 4206 gene locus_tag LOCUS_24970 5579 4206 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385287.1 protein_id gnl|my_center|LOCUS_24970 6782 5583 gene locus_tag LOCUS_24980 6782 5583 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388758.1 protein_id gnl|my_center|LOCUS_24980 7981 6941 gene locus_tag LOCUS_24990 7981 6941 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385289.1 protein_id gnl|my_center|LOCUS_24990 8238 8939 gene locus_tag LOCUS_25000 8238 8939 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942960.1 protein_id gnl|my_center|LOCUS_25000 9005 9217 gene locus_tag LOCUS_25010 9005 9217 CDS product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173338.1 protein_id gnl|my_center|LOCUS_25010 9729 9235 gene locus_tag LOCUS_25020 9729 9235 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_25020 11130 9748 gene locus_tag LOCUS_25030 11130 9748 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064566.1 protein_id gnl|my_center|LOCUS_25030 12395 11208 gene locus_tag LOCUS_25040 12395 11208 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494108.1 protein_id gnl|my_center|LOCUS_25040 14038 12395 gene locus_tag LOCUS_25050 14038 12395 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940550.1 protein_id gnl|my_center|LOCUS_25050 14966 14112 gene locus_tag LOCUS_25060 14966 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 14847 15065 gene locus_tag LOCUS_25070 14847 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 15127 15699 gene locus_tag LOCUS_25080 15127 15699 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921086.1 protein_id gnl|my_center|LOCUS_25080 15788 16429 gene locus_tag LOCUS_25090 15788 16429 CDS product DUF1109 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087694.1 protein_id gnl|my_center|LOCUS_25090 17221 16439 gene locus_tag LOCUS_25100 17221 16439 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976082.1 protein_id gnl|my_center|LOCUS_25100 17430 17702 gene locus_tag LOCUS_25110 17430 17702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 18122 17718 gene locus_tag LOCUS_25120 18122 17718 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844628.1 protein_id gnl|my_center|LOCUS_25120 19713 18316 gene locus_tag LOCUS_25130 gene lpdA 19713 18316 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089074.1 protein_id gnl|my_center|LOCUS_25130 20391 19891 gene locus_tag LOCUS_25140 20391 19891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence075 590 606 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4049 1689 gene locus_tag LOCUS_25150 4049 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 4681 4178 gene locus_tag LOCUS_25160 4681 4178 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_25160 5735 4689 gene locus_tag LOCUS_25170 5735 4689 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328363.1 protein_id gnl|my_center|LOCUS_25170 5868 7121 gene locus_tag LOCUS_25180 5868 7121 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085434.1 protein_id gnl|my_center|LOCUS_25180 7138 8550 gene locus_tag LOCUS_25190 7138 8550 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085355.1 protein_id gnl|my_center|LOCUS_25190 9372 8605 gene locus_tag LOCUS_25200 9372 8605 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085350.1 protein_id gnl|my_center|LOCUS_25200 9455 9958 gene locus_tag LOCUS_25210 9455 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 10699 9959 gene locus_tag LOCUS_25220 10699 9959 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965884.1 protein_id gnl|my_center|LOCUS_25220 12621 10708 gene locus_tag LOCUS_25230 gene dxs 12621 10708 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175335.1 protein_id gnl|my_center|LOCUS_25230 12179 12097 gene locus_tag LOCUS_t00240 12179 12097 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12926 14401 gene locus_tag LOCUS_25240 12926 14401 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173726.1 protein_id gnl|my_center|LOCUS_25240 14509 15921 gene locus_tag LOCUS_25250 14509 15921 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931468.1 protein_id gnl|my_center|LOCUS_25250 16002 17225 gene locus_tag LOCUS_25260 16002 17225 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537085.1 protein_id gnl|my_center|LOCUS_25260 18123 17203 gene locus_tag LOCUS_25270 18123 17203 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309798.1 protein_id gnl|my_center|LOCUS_25270 18512 18255 gene locus_tag LOCUS_25280 18512 18255 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532792.1 protein_id gnl|my_center|LOCUS_25280 19116 18592 gene locus_tag LOCUS_25290 19116 18592 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626636.1 protein_id gnl|my_center|LOCUS_25290 19718 19206 gene locus_tag LOCUS_25300 19718 19206 CDS product tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531123.1 protein_id gnl|my_center|LOCUS_25300 19922 20485 gene locus_tag LOCUS_25310 19922 20485 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626149.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence076 536 201 gene locus_tag LOCUS_25320 536 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 856 2415 gene locus_tag LOCUS_25330 gene cysS 856 2415 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086571.1 protein_id gnl|my_center|LOCUS_25330 2412 2795 gene locus_tag LOCUS_25340 2412 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2792 3181 gene locus_tag LOCUS_25350 2792 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3285 4883 gene locus_tag LOCUS_25360 gene cimA 3285 4883 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086573.1 protein_id gnl|my_center|LOCUS_25360 5375 5031 gene locus_tag LOCUS_25370 5375 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 5534 7447 gene locus_tag LOCUS_25380 5534 7447 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086576.1 protein_id gnl|my_center|LOCUS_25380 7999 7475 gene locus_tag LOCUS_25390 7999 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25390 8766 7897 gene locus_tag LOCUS_25400 8766 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25400 8981 8763 gene locus_tag LOCUS_25410 8981 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 8941 9642 gene locus_tag LOCUS_25420 8941 9642 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086577.1 protein_id gnl|my_center|LOCUS_25420 9805 10653 gene locus_tag LOCUS_25430 9805 10653 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086578.1 protein_id gnl|my_center|LOCUS_25430 10992 10663 gene locus_tag LOCUS_25440 10992 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 11296 11997 gene locus_tag LOCUS_25450 11296 11997 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084077.1 protein_id gnl|my_center|LOCUS_25450 12529 12035 gene locus_tag LOCUS_25460 12529 12035 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_25460 13638 12562 gene locus_tag LOCUS_25470 13638 12562 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339018.1 protein_id gnl|my_center|LOCUS_25470 13828 14889 gene locus_tag LOCUS_25480 13828 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 14982 15899 gene locus_tag LOCUS_25490 14982 15899 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_25490 16111 16551 gene locus_tag LOCUS_25500 16111 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 16559 16843 gene locus_tag LOCUS_25510 16559 16843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 17761 16850 gene locus_tag LOCUS_25520 17761 16850 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331465.1 protein_id gnl|my_center|LOCUS_25520 18306 17758 gene locus_tag LOCUS_25530 18306 17758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25530 18442 19485 gene locus_tag LOCUS_25540 18442 19485 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence077 2758 1547 gene locus_tag LOCUS_25550 2758 1547 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965440.1 protein_id gnl|my_center|LOCUS_25550 3911 2820 gene locus_tag LOCUS_25560 3911 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 3006 3103 gene locus_tag LOCUS_t00250 3006 3103 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5195 4050 gene locus_tag LOCUS_25570 5195 4050 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240214.1 protein_id gnl|my_center|LOCUS_25570 5173 5385 gene locus_tag LOCUS_25580 5173 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 5502 7052 gene locus_tag LOCUS_25590 5502 7052 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970122.1 protein_id gnl|my_center|LOCUS_25590 7125 8327 gene locus_tag LOCUS_25600 7125 8327 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970121.1 protein_id gnl|my_center|LOCUS_25600 8381 10219 gene locus_tag LOCUS_25610 8381 10219 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970120.1 protein_id gnl|my_center|LOCUS_25610 10264 10488 gene locus_tag LOCUS_25620 10264 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 10537 11607 gene locus_tag LOCUS_25630 10537 11607 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975317.1 protein_id gnl|my_center|LOCUS_25630 12673 11666 gene locus_tag LOCUS_25640 gene rsgA 12673 11666 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532956.1 protein_id gnl|my_center|LOCUS_25640 12900 14369 gene locus_tag LOCUS_25650 gene hydA 12900 14369 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086117.1 protein_id gnl|my_center|LOCUS_25650 17164 14534 gene locus_tag LOCUS_25660 17164 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 18299 17175 gene locus_tag LOCUS_25670 18299 17175 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931043.1 protein_id gnl|my_center|LOCUS_25670 19991 18402 gene locus_tag LOCUS_25680 19991 18402 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974139.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence078 261 926 gene locus_tag LOCUS_25690 261 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 936 1736 gene locus_tag LOCUS_25700 936 1736 CDS product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483178.1 protein_id gnl|my_center|LOCUS_25700 1747 2382 gene locus_tag LOCUS_25710 1747 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 3542 2379 gene locus_tag LOCUS_25720 3542 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 4084 3518 gene locus_tag LOCUS_25730 4084 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25730 4584 4081 gene locus_tag LOCUS_25740 4584 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25740 4880 4569 gene locus_tag LOCUS_25750 4880 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 5736 4957 gene locus_tag LOCUS_25760 5736 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052746259.1 protein_id gnl|my_center|LOCUS_25760 6446 5733 gene locus_tag LOCUS_25770 6446 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 6584 7228 gene locus_tag LOCUS_25780 6584 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 7225 8193 gene locus_tag LOCUS_25790 7225 8193 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_25790 8193 9047 gene locus_tag LOCUS_25800 8193 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 9219 9031 gene locus_tag LOCUS_25810 9219 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 9218 9901 gene locus_tag LOCUS_25820 9218 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 11469 9898 gene locus_tag LOCUS_25830 11469 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 14192 11550 gene locus_tag LOCUS_25840 14192 11550 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 protein_id gnl|my_center|LOCUS_25840 14403 15599 gene locus_tag LOCUS_25850 14403 15599 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969142.1 protein_id gnl|my_center|LOCUS_25850 15599 16741 gene locus_tag LOCUS_25860 15599 16741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25860 16771 19083 gene locus_tag LOCUS_25870 16771 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25870 19856 19308 gene locus_tag LOCUS_25880 19856 19308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence079 1168 650 gene locus_tag LOCUS_25890 1168 650 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529606.1 protein_id gnl|my_center|LOCUS_25890 2157 1168 gene locus_tag LOCUS_25900 2157 1168 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089308.1 protein_id gnl|my_center|LOCUS_25900 3205 2309 gene locus_tag LOCUS_25910 3205 2309 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_25910 3999 3337 gene locus_tag LOCUS_25920 3999 3337 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 protein_id gnl|my_center|LOCUS_25920 4881 4234 gene locus_tag LOCUS_25930 4881 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 5750 4932 gene locus_tag LOCUS_25940 5750 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 6871 5747 gene locus_tag LOCUS_25950 6871 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 6993 7508 gene locus_tag LOCUS_25960 6993 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531700.1 protein_id gnl|my_center|LOCUS_25960 8076 7837 gene locus_tag LOCUS_25970 8076 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 9977 8535 gene locus_tag LOCUS_25980 9977 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 13238 10215 gene locus_tag LOCUS_25990 13238 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 13445 13825 gene locus_tag LOCUS_26000 13445 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 13979 14845 gene locus_tag LOCUS_26010 13979 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 14983 15059 gene locus_tag LOCUS_t00260 14983 15059 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 15259 15696 gene locus_tag LOCUS_26020 15259 15696 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083554.1 protein_id gnl|my_center|LOCUS_26020 15792 16058 gene locus_tag LOCUS_26030 15792 16058 CDS product DUF1150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083553.1 protein_id gnl|my_center|LOCUS_26030 16861 16085 gene locus_tag LOCUS_26040 16861 16085 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128777536.1 protein_id gnl|my_center|LOCUS_26040 17002 18231 gene locus_tag LOCUS_26050 17002 18231 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 protein_id gnl|my_center|LOCUS_26050 18325 18924 gene locus_tag LOCUS_26060 gene infC 18325 18924 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083535.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence080 <1 554 gene locus_tag LOCUS_26070 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087257.1:bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase 572 1069 gene locus_tag LOCUS_26080 572 1069 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087256.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26080 3148 1082 gene locus_tag LOCUS_26090 3148 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 3610 3239 gene locus_tag LOCUS_26100 3610 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 4559 3534 gene locus_tag LOCUS_26110 gene lipA 4559 3534 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531487.1 protein_id gnl|my_center|LOCUS_26110 4957 4679 gene locus_tag LOCUS_26120 4957 4679 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640223.1 protein_id gnl|my_center|LOCUS_26120 5421 5032 gene locus_tag LOCUS_26130 5421 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 7028 5571 gene locus_tag LOCUS_26140 gene lpdA 7028 5571 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312480.1 protein_id gnl|my_center|LOCUS_26140 7385 7098 gene locus_tag LOCUS_26150 7385 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 8727 7405 gene locus_tag LOCUS_26160 8727 7405 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874322.1 protein_id gnl|my_center|LOCUS_26160 10134 8743 gene locus_tag LOCUS_26170 10134 8743 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087550.1 protein_id gnl|my_center|LOCUS_26170 10926 10192 gene locus_tag LOCUS_26180 10926 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26180 11264 10926 gene locus_tag LOCUS_26190 11264 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26190 11753 11442 gene locus_tag LOCUS_26200 11753 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 12877 11789 gene locus_tag LOCUS_26210 12877 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 13017 13091 gene locus_tag LOCUS_t00270 13017 13091 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13422 13138 gene locus_tag LOCUS_26220 13422 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 13654 14235 gene locus_tag LOCUS_26230 13654 14235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 15883 14285 gene locus_tag LOCUS_26240 15883 14285 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966309.1 protein_id gnl|my_center|LOCUS_26240 16118 16456 gene locus_tag LOCUS_26250 16118 16456 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205430.1 protein_id gnl|my_center|LOCUS_26250 16550 17959 gene locus_tag LOCUS_26260 gene glnA 16550 17959 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087712.1 protein_id gnl|my_center|LOCUS_26260 19338 18106 gene locus_tag LOCUS_26270 19338 18106 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530920.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence081 <1 2022 gene locus_tag LOCUS_26280 <1 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086850081.1:glycoside hydrolase family 3 N-terminal domain-containing protein 2154 2357 gene locus_tag LOCUS_26290 2154 2357 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008874821.1 protein_id gnl|my_center|LOCUS_26290 2406 2825 gene locus_tag LOCUS_26300 2406 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3804 2938 gene locus_tag LOCUS_26310 3804 2938 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395766.1 protein_id gnl|my_center|LOCUS_26310 3957 5333 gene locus_tag LOCUS_26320 3957 5333 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531252.1 protein_id gnl|my_center|LOCUS_26320 5406 6419 gene locus_tag LOCUS_26330 5406 6419 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530933.1 protein_id gnl|my_center|LOCUS_26330 6419 7225 gene locus_tag LOCUS_26340 gene metF 6419 7225 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173518.1 protein_id gnl|my_center|LOCUS_26340 7356 11111 gene locus_tag LOCUS_26350 gene metH 7356 11111 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972100.1 protein_id gnl|my_center|LOCUS_26350 11222 11524 gene locus_tag LOCUS_26360 11222 11524 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 protein_id gnl|my_center|LOCUS_26360 11521 11955 gene locus_tag LOCUS_26370 11521 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 12082 12393 gene locus_tag LOCUS_26380 12082 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26380 12342 12653 gene locus_tag LOCUS_26390 12342 12653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26390 13599 12634 gene locus_tag LOCUS_26400 13599 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 14928 13696 gene locus_tag LOCUS_26410 14928 13696 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_26410 15686 14925 gene locus_tag LOCUS_26420 15686 14925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_26420 18144 15862 gene locus_tag LOCUS_26430 18144 15862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 18474 18148 gene locus_tag LOCUS_26440 18474 18148 CDS product type II toxin-antitoxin system PrlF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212347691.1 protein_id gnl|my_center|LOCUS_26440 18699 19292 gene locus_tag LOCUS_26450 18699 19292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence082 705 70 gene locus_tag LOCUS_26460 705 70 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064395.1 protein_id gnl|my_center|LOCUS_26460 884 1525 gene locus_tag LOCUS_26470 884 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 2566 1544 gene locus_tag LOCUS_26480 2566 1544 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087338.1 protein_id gnl|my_center|LOCUS_26480 3288 2563 gene locus_tag LOCUS_26490 gene pxpB 3288 2563 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087337.1 protein_id gnl|my_center|LOCUS_26490 4052 3294 gene locus_tag LOCUS_26500 4052 3294 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049802454.1 protein_id gnl|my_center|LOCUS_26500 4455 6512 gene locus_tag LOCUS_26510 4455 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 7597 6665 gene locus_tag LOCUS_26520 7597 6665 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525204.1 protein_id gnl|my_center|LOCUS_26520 8677 7736 gene locus_tag LOCUS_26530 8677 7736 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331308.1 protein_id gnl|my_center|LOCUS_26530 11330 8805 gene locus_tag LOCUS_26540 11330 8805 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086442.1 protein_id gnl|my_center|LOCUS_26540 12220 11327 gene locus_tag LOCUS_26550 12220 11327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 11569 11614 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12672 12376 gene locus_tag LOCUS_26560 12672 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 13637 12663 gene locus_tag LOCUS_26570 13637 12663 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086444.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26570 13745 14500 gene locus_tag LOCUS_26580 13745 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 14515 15291 gene locus_tag LOCUS_26590 14515 15291 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 protein_id gnl|my_center|LOCUS_26590 16346 15321 gene locus_tag LOCUS_26600 16346 15321 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921512.1 protein_id gnl|my_center|LOCUS_26600 16501 17277 gene locus_tag LOCUS_26610 16501 17277 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402718.1 protein_id gnl|my_center|LOCUS_26610 17277 18065 gene locus_tag LOCUS_26620 gene tauC 17277 18065 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206507.1 protein_id gnl|my_center|LOCUS_26620 18079 18876 gene locus_tag LOCUS_26630 18079 18876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031738.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence083 216 608 gene locus_tag LOCUS_26640 216 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 786 986 gene locus_tag LOCUS_26650 786 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1366 2259 gene locus_tag LOCUS_26660 1366 2259 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_26660 2256 3932 gene locus_tag LOCUS_26670 2256 3932 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969427.1 protein_id gnl|my_center|LOCUS_26670 4024 5019 gene locus_tag LOCUS_26680 4024 5019 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160261.1 protein_id gnl|my_center|LOCUS_26680 5138 5842 gene locus_tag LOCUS_26690 5138 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 5915 7264 gene locus_tag LOCUS_26700 gene hemN 5915 7264 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089823.1 protein_id gnl|my_center|LOCUS_26700 7356 8075 gene locus_tag LOCUS_26710 7356 8075 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266234.1 protein_id gnl|my_center|LOCUS_26710 8075 8935 gene locus_tag LOCUS_26720 8075 8935 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970449.1 protein_id gnl|my_center|LOCUS_26720 8946 9872 gene locus_tag LOCUS_26730 8946 9872 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_26730 11575 10202 gene locus_tag LOCUS_26740 11575 10202 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085744.1 protein_id gnl|my_center|LOCUS_26740 12999 11665 gene locus_tag LOCUS_26750 12999 11665 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973451.1 protein_id gnl|my_center|LOCUS_26750 13102 13695 gene locus_tag LOCUS_26760 13102 13695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 13914 15503 gene locus_tag LOCUS_26770 13914 15503 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967343.1 protein_id gnl|my_center|LOCUS_26770 15640 16653 gene locus_tag LOCUS_26780 15640 16653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 protein_id gnl|my_center|LOCUS_26780 16658 17566 gene locus_tag LOCUS_26790 16658 17566 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence084 <1 526 gene locus_tag LOCUS_26800 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639961.1:methyl-accepting chemotaxis protein 664 750 gene locus_tag LOCUS_t00280 664 750 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 831 1238 gene locus_tag LOCUS_26810 831 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 1478 2047 gene locus_tag LOCUS_26820 1478 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_26820 2774 2073 gene locus_tag LOCUS_26830 2774 2073 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919170.1 protein_id gnl|my_center|LOCUS_26830 4396 2771 gene locus_tag LOCUS_26840 4396 2771 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265692.1 protein_id gnl|my_center|LOCUS_26840 4742 5338 gene locus_tag LOCUS_26850 4742 5338 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_26850 5352 6398 gene locus_tag LOCUS_26860 5352 6398 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087343.1 protein_id gnl|my_center|LOCUS_26860 6706 8025 gene locus_tag LOCUS_26870 6706 8025 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973417.1 protein_id gnl|my_center|LOCUS_26870 8507 8632 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8666 9370 gene locus_tag LOCUS_26880 8666 9370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26880 9452 12082 gene locus_tag LOCUS_26890 9452 12082 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085593.1 protein_id gnl|my_center|LOCUS_26890 12117 13025 gene locus_tag LOCUS_26900 gene ntrB 12117 13025 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530458.1 protein_id gnl|my_center|LOCUS_26900 13036 13827 gene locus_tag LOCUS_26910 13036 13827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530459.1 protein_id gnl|my_center|LOCUS_26910 14003 15796 gene locus_tag LOCUS_26920 14003 15796 CDS product NirA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967420.1 protein_id gnl|my_center|LOCUS_26920 15987 17570 gene locus_tag LOCUS_26930 15987 17570 CDS product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087341.1 protein_id gnl|my_center|LOCUS_26930 18423 17662 gene locus_tag LOCUS_26940 18423 17662 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930668.1 protein_id gnl|my_center|LOCUS_26940 <19115 18445 gene locus_tag LOCUS_26950 <19115 18445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192869.1:endonuclease/exonuclease/phosphatase family protein >Feature sequence085 544 155 gene locus_tag LOCUS_26960 544 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 1302 529 gene locus_tag LOCUS_26970 1302 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2700 1417 gene locus_tag LOCUS_26980 2700 1417 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463760.1 protein_id gnl|my_center|LOCUS_26980 3278 2814 gene locus_tag LOCUS_26990 3278 2814 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969433.1 protein_id gnl|my_center|LOCUS_26990 3489 6962 gene locus_tag LOCUS_27000 3489 6962 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171255.1 protein_id gnl|my_center|LOCUS_27000 8220 6970 gene locus_tag LOCUS_27010 gene tyrS 8220 6970 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240393.1 protein_id gnl|my_center|LOCUS_27010 9030 8359 gene locus_tag LOCUS_27020 9030 8359 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495402.1 protein_id gnl|my_center|LOCUS_27020 9330 10535 gene locus_tag LOCUS_27030 9330 10535 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_27030 10596 12065 gene locus_tag LOCUS_27040 gene sufB 10596 12065 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240389.1 protein_id gnl|my_center|LOCUS_27040 12065 12286 gene locus_tag LOCUS_27050 12065 12286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 12410 13162 gene locus_tag LOCUS_27060 gene sufC 12410 13162 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531483.1 protein_id gnl|my_center|LOCUS_27060 13162 14511 gene locus_tag LOCUS_27070 gene sufD 13162 14511 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087113.1 protein_id gnl|my_center|LOCUS_27070 14511 14735 gene locus_tag LOCUS_27080 14511 14735 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123298.1 protein_id gnl|my_center|LOCUS_27080 14740 15978 gene locus_tag LOCUS_27090 14740 15978 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087114.1 protein_id gnl|my_center|LOCUS_27090 15993 16376 gene locus_tag LOCUS_27100 15993 16376 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532157.1 protein_id gnl|my_center|LOCUS_27100 16670 16389 gene locus_tag LOCUS_27110 16670 16389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 16839 17726 gene locus_tag LOCUS_27120 16839 17726 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393613.1 protein_id gnl|my_center|LOCUS_27120 18209 17832 gene locus_tag LOCUS_27130 18209 17832 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529465.1 protein_id gnl|my_center|LOCUS_27130 <18937 18214 gene locus_tag LOCUS_27140 <18937 18214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085701.1:malate/lactate/ureidoglycolate dehydrogenase >Feature sequence086 1228 728 gene locus_tag LOCUS_27150 1228 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27150 1537 2088 gene locus_tag LOCUS_27160 1537 2088 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525282.1 protein_id gnl|my_center|LOCUS_27160 2168 3568 gene locus_tag LOCUS_27170 2168 3568 CDS product type VI secretion system ImpA family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086376.1 protein_id gnl|my_center|LOCUS_27170 3690 4223 gene locus_tag LOCUS_27180 gene tssB 3690 4223 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063713277.1 protein_id gnl|my_center|LOCUS_27180 4235 5737 gene locus_tag LOCUS_27190 gene tssC 4235 5737 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967726.1 protein_id gnl|my_center|LOCUS_27190 5881 6360 gene locus_tag LOCUS_27200 5881 6360 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086373.1 protein_id gnl|my_center|LOCUS_27200 6488 7036 gene locus_tag LOCUS_27210 gene tssE 6488 7036 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086372.1 protein_id gnl|my_center|LOCUS_27210 7041 9002 gene locus_tag LOCUS_27220 gene tssF 7041 9002 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170696.1 protein_id gnl|my_center|LOCUS_27220 8999 10069 gene locus_tag LOCUS_27230 gene tssG 8999 10069 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086369.1 protein_id gnl|my_center|LOCUS_27230 10087 12810 gene locus_tag LOCUS_27240 gene tssH 10087 12810 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525311.1 protein_id gnl|my_center|LOCUS_27240 12905 14227 gene locus_tag LOCUS_27250 12905 14227 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463760.1 protein_id gnl|my_center|LOCUS_27250 15836 14325 gene locus_tag LOCUS_27260 gene glpD 15836 14325 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085223.1 protein_id gnl|my_center|LOCUS_27260 17190 15844 gene locus_tag LOCUS_27270 17190 15844 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152045320.1 protein_id gnl|my_center|LOCUS_27270 17406 18689 gene locus_tag LOCUS_27280 gene pncB 17406 18689 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085115.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence087 <1 702 gene locus_tag LOCUS_27290 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085554.1:cation-translocating P-type ATPase 699 941 gene locus_tag LOCUS_27300 699 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 1017 2051 gene locus_tag LOCUS_27310 1017 2051 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_27310 2892 2179 gene locus_tag LOCUS_27320 2892 2179 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975034.1 protein_id gnl|my_center|LOCUS_27320 4037 3066 gene locus_tag LOCUS_27330 4037 3066 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105417854.1 protein_id gnl|my_center|LOCUS_27330 4260 4964 gene locus_tag LOCUS_27340 4260 4964 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869088.1 protein_id gnl|my_center|LOCUS_27340 5156 5812 gene locus_tag LOCUS_27350 5156 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27350 5987 7723 gene locus_tag LOCUS_27360 5987 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 7856 8602 gene locus_tag LOCUS_27370 7856 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 10008 8614 gene locus_tag LOCUS_27380 10008 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 10864 10118 gene locus_tag LOCUS_27390 10864 10118 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 protein_id gnl|my_center|LOCUS_27390 11043 11762 gene locus_tag LOCUS_27400 11043 11762 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088802.1 protein_id gnl|my_center|LOCUS_27400 12010 13464 gene locus_tag LOCUS_27410 12010 13464 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085145.1 protein_id gnl|my_center|LOCUS_27410 15753 14407 gene locus_tag LOCUS_27420 15753 14407 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313911.1 protein_id gnl|my_center|LOCUS_27420 17290 15878 gene locus_tag LOCUS_27430 17290 15878 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173221.1 protein_id gnl|my_center|LOCUS_27430 18551 17655 gene locus_tag LOCUS_27440 gene rfbA 18551 17655 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983464.1 protein_id gnl|my_center|LOCUS_27440 >Feature sequence088 <1 1148 gene locus_tag LOCUS_27450 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090047.1:efflux RND transporter permease subunit 1175 2296 gene locus_tag LOCUS_27460 1175 2296 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965440.1 protein_id gnl|my_center|LOCUS_27460 2359 2877 gene locus_tag LOCUS_27470 2359 2877 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967882.1 protein_id gnl|my_center|LOCUS_27470 2874 4613 gene locus_tag LOCUS_27480 2874 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 4648 5718 gene locus_tag LOCUS_27490 4648 5718 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966094.1 protein_id gnl|my_center|LOCUS_27490 5724 6779 gene locus_tag LOCUS_27500 5724 6779 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967885.1 protein_id gnl|my_center|LOCUS_27500 8646 6892 gene locus_tag LOCUS_27510 8646 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 9020 9532 gene locus_tag LOCUS_27520 9020 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 9525 9812 gene locus_tag LOCUS_27530 9525 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 9809 10102 gene locus_tag LOCUS_27540 9809 10102 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_27540 10099 11037 gene locus_tag LOCUS_27550 10099 11037 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090053.1 protein_id gnl|my_center|LOCUS_27550 11034 11384 gene locus_tag LOCUS_27560 11034 11384 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090054.1 protein_id gnl|my_center|LOCUS_27560 11381 12901 gene locus_tag LOCUS_27570 11381 12901 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090055.1 protein_id gnl|my_center|LOCUS_27570 12898 14541 gene locus_tag LOCUS_27580 12898 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 14628 16406 gene locus_tag LOCUS_27590 14628 16406 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970120.1 protein_id gnl|my_center|LOCUS_27590 18045 16558 gene locus_tag LOCUS_27600 18045 16558 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209573.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence089 <1 689 gene locus_tag LOCUS_27610 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389786.1:ATP-binding protein note possible pseudo, frameshifted 596 1408 gene locus_tag LOCUS_27620 596 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27620 2011 1442 gene locus_tag LOCUS_27630 2011 1442 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039802.1 protein_id gnl|my_center|LOCUS_27630 2328 2011 gene locus_tag LOCUS_27640 2328 2011 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 protein_id gnl|my_center|LOCUS_27640 2475 3362 gene locus_tag LOCUS_27650 2475 3362 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396441.1 protein_id gnl|my_center|LOCUS_27650 3877 4431 gene locus_tag LOCUS_27660 3877 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 5192 4557 gene locus_tag LOCUS_27670 5192 4557 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510757.1 protein_id gnl|my_center|LOCUS_27670 5410 5871 gene locus_tag LOCUS_27680 5410 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 5889 6557 gene locus_tag LOCUS_27690 5889 6557 CDS product ribonuclease T2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090200.1 protein_id gnl|my_center|LOCUS_27690 6589 7440 gene locus_tag LOCUS_27700 6589 7440 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532491.1 protein_id gnl|my_center|LOCUS_27700 7468 8073 gene locus_tag LOCUS_27710 7468 8073 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531606.1 protein_id gnl|my_center|LOCUS_27710 8883 8227 gene locus_tag LOCUS_27720 8883 8227 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967292.1 protein_id gnl|my_center|LOCUS_27720 9240 10058 gene locus_tag LOCUS_27730 9240 10058 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598575.1 protein_id gnl|my_center|LOCUS_27730 10051 10797 gene locus_tag LOCUS_27740 10051 10797 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532482.1 protein_id gnl|my_center|LOCUS_27740 11436 10807 gene locus_tag LOCUS_27750 11436 10807 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_27750 12211 11447 gene locus_tag LOCUS_27760 gene pgeF 12211 11447 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090180.1 protein_id gnl|my_center|LOCUS_27760 13345 12248 gene locus_tag LOCUS_27770 13345 12248 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_27770 13578 13342 gene locus_tag LOCUS_27780 13578 13342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 14202 14441 gene locus_tag LOCUS_27790 14202 14441 CDS product plasmid stability protein stbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875326.1 protein_id gnl|my_center|LOCUS_27790 14438 14857 gene locus_tag LOCUS_27800 14438 14857 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817075.1 protein_id gnl|my_center|LOCUS_27800 15457 14870 gene locus_tag LOCUS_27810 15457 14870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422870.1 protein_id gnl|my_center|LOCUS_27810 15534 17651 gene locus_tag LOCUS_27820 15534 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 17738 18349 gene locus_tag LOCUS_27830 gene pgsA 17738 18349 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090204.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence090 1027 32 gene locus_tag LOCUS_27840 1027 32 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392079.1 protein_id gnl|my_center|LOCUS_27840 2130 1096 gene locus_tag LOCUS_27850 2130 1096 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087146.1 protein_id gnl|my_center|LOCUS_27850 2282 3679 gene locus_tag LOCUS_27860 2282 3679 CDS product NAD-binding homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390889.1 protein_id gnl|my_center|LOCUS_27860 3746 4411 gene locus_tag LOCUS_27870 3746 4411 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244058.1 protein_id gnl|my_center|LOCUS_27870 5701 4505 gene locus_tag LOCUS_27880 gene uxuA 5701 4505 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438562.1 protein_id gnl|my_center|LOCUS_27880 6994 5717 gene locus_tag LOCUS_27890 6994 5717 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584119.1 protein_id gnl|my_center|LOCUS_27890 7511 7005 gene locus_tag LOCUS_27900 7511 7005 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229215.1 protein_id gnl|my_center|LOCUS_27900 8620 7598 gene locus_tag LOCUS_27910 8620 7598 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391960.1 protein_id gnl|my_center|LOCUS_27910 8676 9395 gene locus_tag LOCUS_27920 8676 9395 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967032.1 protein_id gnl|my_center|LOCUS_27920 9620 9408 gene locus_tag LOCUS_27930 9620 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 9803 12202 gene locus_tag LOCUS_27940 9803 12202 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965926.1 protein_id gnl|my_center|LOCUS_27940 12292 13719 gene locus_tag LOCUS_27950 gene cls 12292 13719 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034050559.1 protein_id gnl|my_center|LOCUS_27950 13739 14461 gene locus_tag LOCUS_27960 13739 14461 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975064.1 protein_id gnl|my_center|LOCUS_27960 16452 14479 gene locus_tag LOCUS_27970 16452 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 17292 16603 gene locus_tag LOCUS_27980 17292 16603 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063695.1 protein_id gnl|my_center|LOCUS_27980 >Feature sequence091 1105 2115 gene locus_tag LOCUS_27990 1105 2115 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083542.1 protein_id gnl|my_center|LOCUS_27990 2112 2807 gene locus_tag LOCUS_28000 2112 2807 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 protein_id gnl|my_center|LOCUS_28000 3831 2836 gene locus_tag LOCUS_28010 3831 2836 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241766.1 protein_id gnl|my_center|LOCUS_28010 4015 4563 gene locus_tag LOCUS_28020 4015 4563 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083590.1 protein_id gnl|my_center|LOCUS_28020 5054 4581 gene locus_tag LOCUS_28030 5054 4581 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008131763.1 protein_id gnl|my_center|LOCUS_28030 5289 5801 gene locus_tag LOCUS_28040 gene fabA 5289 5801 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968449.1 protein_id gnl|my_center|LOCUS_28040 5947 5750 gene locus_tag LOCUS_28050 5947 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 5966 7192 gene locus_tag LOCUS_28060 gene fabB 5966 7192 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083592.1 protein_id gnl|my_center|LOCUS_28060 7204 7476 gene locus_tag LOCUS_28070 7204 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 7525 7764 gene locus_tag LOCUS_28080 7525 7764 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640023.1 protein_id gnl|my_center|LOCUS_28080 7764 8174 gene locus_tag LOCUS_28090 7764 8174 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918525.1 protein_id gnl|my_center|LOCUS_28090 8197 9024 gene locus_tag LOCUS_28100 gene fabI 8197 9024 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067646.1 protein_id gnl|my_center|LOCUS_28100 9081 9332 gene locus_tag LOCUS_28110 9081 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 9713 9348 gene locus_tag LOCUS_28120 9713 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 10637 9771 gene locus_tag LOCUS_28130 10637 9771 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 protein_id gnl|my_center|LOCUS_28130 10741 11139 gene locus_tag LOCUS_28140 10741 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 12414 11182 gene locus_tag LOCUS_28150 12414 11182 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918018.1 protein_id gnl|my_center|LOCUS_28150 12668 13276 gene locus_tag LOCUS_28160 12668 13276 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040654.1 protein_id gnl|my_center|LOCUS_28160 14379 13282 gene locus_tag LOCUS_28170 14379 13282 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085280.1 protein_id gnl|my_center|LOCUS_28170 14971 14414 gene locus_tag LOCUS_28180 14971 14414 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 protein_id gnl|my_center|LOCUS_28180 15731 15066 gene locus_tag LOCUS_28190 15731 15066 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392046.1 protein_id gnl|my_center|LOCUS_28190 16156 17859 gene locus_tag LOCUS_28200 gene rpsA 16156 17859 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027546860.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence092 <1 791 gene locus_tag LOCUS_28210 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066519.1:TonB-dependent hemoglobin/transferrin/lactoferrin family receptor 1636 827 gene locus_tag LOCUS_28220 1636 827 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971925.1 protein_id gnl|my_center|LOCUS_28220 2958 1819 gene locus_tag LOCUS_28230 2958 1819 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_28230 2872 3177 gene locus_tag LOCUS_28240 2872 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3398 4015 gene locus_tag LOCUS_28250 gene rpsD 3398 4015 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532142.1 protein_id gnl|my_center|LOCUS_28250 4358 4948 gene locus_tag LOCUS_28260 4358 4948 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086823.1 protein_id gnl|my_center|LOCUS_28260 5104 4979 gene locus_tag LOCUS_28270 5104 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 5339 5581 gene locus_tag LOCUS_28280 5339 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 6317 5652 gene locus_tag LOCUS_28290 6317 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 6529 7527 gene locus_tag LOCUS_28300 6529 7527 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088424.1 protein_id gnl|my_center|LOCUS_28300 7560 8348 gene locus_tag LOCUS_28310 7560 8348 CDS product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975194.1 protein_id gnl|my_center|LOCUS_28310 8675 8376 gene locus_tag LOCUS_28320 8675 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 8936 8679 gene locus_tag LOCUS_28330 8936 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 9098 10627 gene locus_tag LOCUS_28340 9098 10627 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088112.1 protein_id gnl|my_center|LOCUS_28340 12454 10655 gene locus_tag LOCUS_28350 12454 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 12633 14006 gene locus_tag LOCUS_28360 12633 14006 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_28360 13981 15018 gene locus_tag LOCUS_28370 13981 15018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 15228 15650 gene locus_tag LOCUS_28380 gene dksA 15228 15650 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531862.1 protein_id gnl|my_center|LOCUS_28380 16625 15723 gene locus_tag LOCUS_28390 16625 15723 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090560.1 protein_id gnl|my_center|LOCUS_28390 16746 17345 gene locus_tag LOCUS_28400 16746 17345 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence093 311 385 gene locus_tag LOCUS_t00290 311 385 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 552 986 gene locus_tag LOCUS_28410 552 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1117 2100 gene locus_tag LOCUS_28420 1117 2100 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087556.1 protein_id gnl|my_center|LOCUS_28420 2251 3024 gene locus_tag LOCUS_28430 2251 3024 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967522.1 protein_id gnl|my_center|LOCUS_28430 4700 3069 gene locus_tag LOCUS_28440 4700 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 5779 4697 gene locus_tag LOCUS_28450 5779 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 5976 6473 gene locus_tag LOCUS_28460 5976 6473 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_28460 6479 7357 gene locus_tag LOCUS_28470 6479 7357 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_28470 7377 7583 gene locus_tag LOCUS_28480 7377 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 8232 7627 gene locus_tag LOCUS_28490 8232 7627 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531972.1 protein_id gnl|my_center|LOCUS_28490 8806 8237 gene locus_tag LOCUS_28500 8806 8237 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157335780.1 protein_id gnl|my_center|LOCUS_28500 8911 9864 gene locus_tag LOCUS_28510 8911 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088297.1 protein_id gnl|my_center|LOCUS_28510 10357 9899 gene locus_tag LOCUS_28520 10357 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28520 10765 10445 gene locus_tag LOCUS_28530 10765 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 11895 10690 gene locus_tag LOCUS_28540 11895 10690 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087185.1 protein_id gnl|my_center|LOCUS_28540 13991 12093 gene locus_tag LOCUS_28550 13991 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 12788 12841 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16134 14125 gene locus_tag LOCUS_28560 gene thrS 16134 14125 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832605.1 protein_id gnl|my_center|LOCUS_28560 16432 16674 gene locus_tag LOCUS_28570 16432 16674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28570 17080 16604 gene locus_tag LOCUS_28580 17080 16604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 17079 17663 gene locus_tag LOCUS_28590 17079 17663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 17663 17968 gene locus_tag LOCUS_28600 17663 17968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence094 214 465 gene locus_tag LOCUS_28610 214 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 631 1464 gene locus_tag LOCUS_28620 631 1464 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 protein_id gnl|my_center|LOCUS_28620 1461 2276 gene locus_tag LOCUS_28630 1461 2276 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028995.1 protein_id gnl|my_center|LOCUS_28630 2465 3913 gene locus_tag LOCUS_28640 gene hydA 2465 3913 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086079.1 protein_id gnl|my_center|LOCUS_28640 3996 4661 gene locus_tag LOCUS_28650 3996 4661 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815556.1 protein_id gnl|my_center|LOCUS_28650 5673 4792 gene locus_tag LOCUS_28660 5673 4792 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081296127.1 protein_id gnl|my_center|LOCUS_28660 6712 5666 gene locus_tag LOCUS_28670 6712 5666 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414790.1 protein_id gnl|my_center|LOCUS_28670 7685 6873 gene locus_tag LOCUS_28680 7685 6873 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969502.1 protein_id gnl|my_center|LOCUS_28680 7834 8121 gene locus_tag LOCUS_28690 7834 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 8123 9550 gene locus_tag LOCUS_28700 8123 9550 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926009.1 protein_id gnl|my_center|LOCUS_28700 9547 10716 gene locus_tag LOCUS_28710 9547 10716 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089925.1 protein_id gnl|my_center|LOCUS_28710 10709 11683 gene locus_tag LOCUS_28720 10709 11683 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086096.1 protein_id gnl|my_center|LOCUS_28720 11764 12573 gene locus_tag LOCUS_28730 11764 12573 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243744.1 protein_id gnl|my_center|LOCUS_28730 12728 13426 gene locus_tag LOCUS_28740 12728 13426 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243743.1 protein_id gnl|my_center|LOCUS_28740 13461 14147 gene locus_tag LOCUS_28750 13461 14147 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464032.1 protein_id gnl|my_center|LOCUS_28750 14125 14862 gene locus_tag LOCUS_28760 14125 14862 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971584.1 protein_id gnl|my_center|LOCUS_28760 15038 15946 gene locus_tag LOCUS_28770 15038 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 16413 16024 gene locus_tag LOCUS_28780 16413 16024 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090276.1 protein_id gnl|my_center|LOCUS_28780 16315 16563 gene locus_tag LOCUS_28790 16315 16563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence095 1450 461 gene locus_tag LOCUS_28800 1450 461 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 protein_id gnl|my_center|LOCUS_28800 2791 1487 gene locus_tag LOCUS_28810 2791 1487 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039976.1 protein_id gnl|my_center|LOCUS_28810 3339 2791 gene locus_tag LOCUS_28820 3339 2791 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811089.1 protein_id gnl|my_center|LOCUS_28820 3557 7156 gene locus_tag LOCUS_28830 3557 7156 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969735.1 protein_id gnl|my_center|LOCUS_28830 7341 8036 gene locus_tag LOCUS_28840 7341 8036 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_28840 8175 8849 gene locus_tag LOCUS_28850 8175 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 8978 10654 gene locus_tag LOCUS_28860 8978 10654 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063682649.1 protein_id gnl|my_center|LOCUS_28860 10720 11826 gene locus_tag LOCUS_28870 10720 11826 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173081.1 protein_id gnl|my_center|LOCUS_28870 11833 12015 gene locus_tag LOCUS_28880 11833 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 12889 12152 gene locus_tag LOCUS_28890 12889 12152 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765563.1 protein_id gnl|my_center|LOCUS_28890 13446 12886 gene locus_tag LOCUS_28900 13446 12886 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970922.1 protein_id gnl|my_center|LOCUS_28900 13642 14436 gene locus_tag LOCUS_28910 13642 14436 CDS product DUF4394 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384314.1 protein_id gnl|my_center|LOCUS_28910 14636 16072 gene locus_tag LOCUS_28920 14636 16072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 16078 17325 gene locus_tag LOCUS_28930 16078 17325 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972739.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence096 <1 1107 gene locus_tag LOCUS_28940 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089743.1:M20 family metallopeptidase 3089 1248 gene locus_tag LOCUS_28950 3089 1248 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_28950 3885 3094 gene locus_tag LOCUS_28960 gene otsB 3885 3094 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338618.1 protein_id gnl|my_center|LOCUS_28960 4114 5709 gene locus_tag LOCUS_28970 gene otsA 4114 5709 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338617.1 protein_id gnl|my_center|LOCUS_28970 6758 5853 gene locus_tag LOCUS_28980 6758 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 6757 8004 gene locus_tag LOCUS_28990 6757 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 8059 9144 gene locus_tag LOCUS_29000 gene prfA 8059 9144 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083050.1 protein_id gnl|my_center|LOCUS_29000 9229 9507 gene locus_tag LOCUS_29010 9229 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 9546 10367 gene locus_tag LOCUS_29020 gene prmC 9546 10367 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973616.1 protein_id gnl|my_center|LOCUS_29020 10756 11778 gene locus_tag LOCUS_29030 10756 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 12643 11858 gene locus_tag LOCUS_29040 12643 11858 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265642.1 protein_id gnl|my_center|LOCUS_29040 13070 12726 gene locus_tag LOCUS_29050 13070 12726 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530931.1 protein_id gnl|my_center|LOCUS_29050 13203 13841 gene locus_tag LOCUS_29060 13203 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 13847 15679 gene locus_tag LOCUS_29070 13847 15679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 15795 16445 gene locus_tag LOCUS_29080 15795 16445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 17081 16455 gene locus_tag LOCUS_29090 gene metW 17081 16455 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_29090 >Feature sequence097 151 465 gene locus_tag LOCUS_29100 151 465 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210342306.1 protein_id gnl|my_center|LOCUS_29100 585 2894 gene locus_tag LOCUS_29110 585 2894 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088655.1 protein_id gnl|my_center|LOCUS_29110 3025 3456 gene locus_tag LOCUS_29120 3025 3456 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974792.1 protein_id gnl|my_center|LOCUS_29120 3593 4534 gene locus_tag LOCUS_29130 3593 4534 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088649.1 protein_id gnl|my_center|LOCUS_29130 5080 4547 gene locus_tag LOCUS_29140 5080 4547 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975576.1 protein_id gnl|my_center|LOCUS_29140 5435 5067 gene locus_tag LOCUS_29150 5435 5067 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061471.1 protein_id gnl|my_center|LOCUS_29150 6175 5555 gene locus_tag LOCUS_29160 6175 5555 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661920.1 protein_id gnl|my_center|LOCUS_29160 7240 6311 gene locus_tag LOCUS_29170 7240 6311 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921380.1 protein_id gnl|my_center|LOCUS_29170 8312 7533 gene locus_tag LOCUS_29180 8312 7533 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531889.1 protein_id gnl|my_center|LOCUS_29180 8437 9261 gene locus_tag LOCUS_29190 8437 9261 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088645.1 protein_id gnl|my_center|LOCUS_29190 9261 10343 gene locus_tag LOCUS_29200 9261 10343 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090884.1 protein_id gnl|my_center|LOCUS_29200 12159 10282 gene locus_tag LOCUS_29210 12159 10282 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_29210 12286 13131 gene locus_tag LOCUS_29220 12286 13131 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028152332.1 protein_id gnl|my_center|LOCUS_29220 13738 13106 gene locus_tag LOCUS_29230 13738 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 13817 14389 gene locus_tag LOCUS_29240 13817 14389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 14399 14635 gene locus_tag LOCUS_29250 14399 14635 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521369.1 protein_id gnl|my_center|LOCUS_29250 14785 15690 gene locus_tag LOCUS_29260 14785 15690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 16995 15730 gene locus_tag LOCUS_29270 16995 15730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence098 1477 1040 gene locus_tag LOCUS_29280 1477 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 1595 4327 gene locus_tag LOCUS_29290 1595 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 5123 4800 gene locus_tag LOCUS_29300 5123 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 5422 5787 gene locus_tag LOCUS_29310 5422 5787 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312714.1 protein_id gnl|my_center|LOCUS_29310 5852 6436 gene locus_tag LOCUS_29320 5852 6436 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211411592.1 protein_id gnl|my_center|LOCUS_29320 6440 6679 gene locus_tag LOCUS_29330 6440 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 6676 7281 gene locus_tag LOCUS_29340 6676 7281 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087683.1 protein_id gnl|my_center|LOCUS_29340 7294 8484 gene locus_tag LOCUS_29350 7294 8484 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531832.1 protein_id gnl|my_center|LOCUS_29350 8484 9383 gene locus_tag LOCUS_29360 8484 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 9394 9648 gene locus_tag LOCUS_29370 9394 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 9658 10962 gene locus_tag LOCUS_29380 gene nuoF 9658 10962 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087678.1 protein_id gnl|my_center|LOCUS_29380 10959 11741 gene locus_tag LOCUS_29390 10959 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 11771 13834 gene locus_tag LOCUS_29400 gene nuoG 11771 13834 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531096.1 protein_id gnl|my_center|LOCUS_29400 13841 14860 gene locus_tag LOCUS_29410 gene nuoH 13841 14860 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531848.1 protein_id gnl|my_center|LOCUS_29410 14860 15099 gene locus_tag LOCUS_29420 14860 15099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 15118 15606 gene locus_tag LOCUS_29430 gene nuoI 15118 15606 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707628.1 protein_id gnl|my_center|LOCUS_29430 15878 16501 gene locus_tag LOCUS_29440 15878 16501 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087674.1 protein_id gnl|my_center|LOCUS_29440 16501 16806 gene locus_tag LOCUS_29450 gene nuoK 16501 16806 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008547737.1 protein_id gnl|my_center|LOCUS_29450 >Feature sequence099 1203 922 gene locus_tag LOCUS_29460 1203 922 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110276.1 protein_id gnl|my_center|LOCUS_29460 1523 1200 gene locus_tag LOCUS_29470 1523 1200 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106968.1 protein_id gnl|my_center|LOCUS_29470 2466 1606 gene locus_tag LOCUS_29480 2466 1606 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968826.1 protein_id gnl|my_center|LOCUS_29480 3233 2466 gene locus_tag LOCUS_29490 3233 2466 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191658.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29490 3114 3362 gene locus_tag LOCUS_29500 3114 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 4792 3518 gene locus_tag LOCUS_29510 4792 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 5475 4870 gene locus_tag LOCUS_29520 5475 4870 CDS product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084979.1 protein_id gnl|my_center|LOCUS_29520 5745 6305 gene locus_tag LOCUS_29530 5745 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 7191 6331 gene locus_tag LOCUS_29540 7191 6331 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084980.1 protein_id gnl|my_center|LOCUS_29540 7326 7967 gene locus_tag LOCUS_29550 7326 7967 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967810.1 protein_id gnl|my_center|LOCUS_29550 8077 8742 gene locus_tag LOCUS_29560 8077 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29560 8453 8459 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8742 10724 gene locus_tag LOCUS_29570 8742 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29570 10721 11248 gene locus_tag LOCUS_29580 10721 11248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 11279 11644 gene locus_tag LOCUS_29590 11279 11644 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007600538.1 protein_id gnl|my_center|LOCUS_29590 11790 12854 gene locus_tag LOCUS_29600 11790 12854 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084984.1 protein_id gnl|my_center|LOCUS_29600 12851 13735 gene locus_tag LOCUS_29610 12851 13735 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_29610 14596 13895 gene locus_tag LOCUS_29620 14596 13895 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008138878.1 protein_id gnl|my_center|LOCUS_29620 15188 15000 gene locus_tag LOCUS_29630 15188 15000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 15330 16670 gene locus_tag LOCUS_29640 gene fliI 15330 16670 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084989.1 protein_id gnl|my_center|LOCUS_29640 >Feature sequence100 378 860 gene locus_tag LOCUS_29650 378 860 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174296.1 protein_id gnl|my_center|LOCUS_29650 862 1749 gene locus_tag LOCUS_29660 862 1749 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085135.1 protein_id gnl|my_center|LOCUS_29660 1746 2831 gene locus_tag LOCUS_29670 1746 2831 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085136.1 protein_id gnl|my_center|LOCUS_29670 2842 4635 gene locus_tag LOCUS_29680 2842 4635 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085137.1 protein_id gnl|my_center|LOCUS_29680 4834 5286 gene locus_tag LOCUS_29690 4834 5286 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528917.1 protein_id gnl|my_center|LOCUS_29690 6337 5396 gene locus_tag LOCUS_29700 6337 5396 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_29700 6491 7069 gene locus_tag LOCUS_29710 6491 7069 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_29710 7970 7047 gene locus_tag LOCUS_29720 7970 7047 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532831.1 protein_id gnl|my_center|LOCUS_29720 8098 9150 gene locus_tag LOCUS_29730 8098 9150 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_29730 9329 10123 gene locus_tag LOCUS_29740 9329 10123 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564075.1 protein_id gnl|my_center|LOCUS_29740 10132 11586 gene locus_tag LOCUS_29750 10132 11586 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929354.1 protein_id gnl|my_center|LOCUS_29750 11583 12452 gene locus_tag LOCUS_29760 11583 12452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 protein_id gnl|my_center|LOCUS_29760 12467 13249 gene locus_tag LOCUS_29770 12467 13249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 protein_id gnl|my_center|LOCUS_29770 13289 14722 gene locus_tag LOCUS_29780 13289 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 14867 14736 gene locus_tag LOCUS_29790 14867 14736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 14956 15642 gene locus_tag LOCUS_29800 14956 15642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 15846 16064 gene locus_tag LOCUS_29810 15846 16064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 <17151 16441 gene locus_tag LOCUS_29820 <17151 16441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089933.1:LysR substrate-binding domain-containing protein >Feature sequence101 763 1521 gene locus_tag LOCUS_29830 763 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 1199 1269 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1425 1787 gene locus_tag LOCUS_29840 1425 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 1970 4066 gene locus_tag LOCUS_29850 1970 4066 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_29850 4711 4229 gene locus_tag LOCUS_29860 4711 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 6054 5068 gene locus_tag LOCUS_29870 gene hisG 6054 5068 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090257.1 protein_id gnl|my_center|LOCUS_29870 7163 6051 gene locus_tag LOCUS_29880 7163 6051 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090256.1 protein_id gnl|my_center|LOCUS_29880 9024 7477 gene locus_tag LOCUS_29890 gene hisS 9024 7477 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530357.1 protein_id gnl|my_center|LOCUS_29890 10599 9223 gene locus_tag LOCUS_29900 gene glcF 10599 9223 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530352.1 protein_id gnl|my_center|LOCUS_29900 11909 10722 gene locus_tag LOCUS_29910 gene glcE 11909 10722 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577785.1 protein_id gnl|my_center|LOCUS_29910 12434 12096 gene locus_tag LOCUS_29920 12434 12096 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089332.1 protein_id gnl|my_center|LOCUS_29920 13871 12435 gene locus_tag LOCUS_29930 13871 12435 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974599.1 protein_id gnl|my_center|LOCUS_29930 13991 14896 gene locus_tag LOCUS_29940 13991 14896 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313134.1 protein_id gnl|my_center|LOCUS_29940 14942 15892 gene locus_tag LOCUS_29950 14942 15892 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528834.1 protein_id gnl|my_center|LOCUS_29950 <16614 15911 gene locus_tag LOCUS_29960 <16614 15911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084159.1:AbrB family transcriptional regulator >Feature sequence102 153 632 gene locus_tag LOCUS_29970 153 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 860 785 gene locus_tag LOCUS_t00300 860 785 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1490 1092 gene locus_tag LOCUS_29980 1490 1092 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534381.1 protein_id gnl|my_center|LOCUS_29980 1721 3061 gene locus_tag LOCUS_29990 gene aroA 1721 3061 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965151.1 protein_id gnl|my_center|LOCUS_29990 3058 3708 gene locus_tag LOCUS_30000 gene cmk 3058 3708 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083564.1 protein_id gnl|my_center|LOCUS_30000 3790 4614 gene locus_tag LOCUS_30010 3790 4614 CDS product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085427.1 protein_id gnl|my_center|LOCUS_30010 7279 4769 gene locus_tag LOCUS_30020 gene hrpB 7279 4769 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968081.1 protein_id gnl|my_center|LOCUS_30020 7366 8226 gene locus_tag LOCUS_30030 gene trpA 7366 8226 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242331.1 protein_id gnl|my_center|LOCUS_30030 8277 9182 gene locus_tag LOCUS_30040 gene accD 8277 9182 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083571.1 protein_id gnl|my_center|LOCUS_30040 9199 10521 gene locus_tag LOCUS_30050 9199 10521 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330401.1 protein_id gnl|my_center|LOCUS_30050 10502 11386 gene locus_tag LOCUS_30060 10502 11386 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063682.1 protein_id gnl|my_center|LOCUS_30060 12300 11560 gene locus_tag LOCUS_30070 gene hisA 12300 11560 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965127.1 protein_id gnl|my_center|LOCUS_30070 12944 12288 gene locus_tag LOCUS_30080 gene hisH 12944 12288 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242309.1 protein_id gnl|my_center|LOCUS_30080 13426 12941 gene locus_tag LOCUS_30090 13426 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 14026 13439 gene locus_tag LOCUS_30100 gene hisB 14026 13439 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083477.1 protein_id gnl|my_center|LOCUS_30100 15221 14235 gene locus_tag LOCUS_30110 15221 14235 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965254.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30110 15248 15282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16272 15544 gene locus_tag LOCUS_30120 16272 15544 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090825.1 protein_id gnl|my_center|LOCUS_30120 >Feature sequence103 1095 379 gene locus_tag LOCUS_30130 1095 379 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969531.1 protein_id gnl|my_center|LOCUS_30130 1820 1092 gene locus_tag LOCUS_30140 1820 1092 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975738.1 protein_id gnl|my_center|LOCUS_30140 2673 1894 gene locus_tag LOCUS_30150 2673 1894 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535100.1 protein_id gnl|my_center|LOCUS_30150 4075 2849 gene locus_tag LOCUS_30160 4075 2849 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966287.1 protein_id gnl|my_center|LOCUS_30160 4290 4967 gene locus_tag LOCUS_30170 4290 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_30170 6029 4977 gene locus_tag LOCUS_30180 gene speB 6029 4977 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329331.1 protein_id gnl|my_center|LOCUS_30180 6573 6052 gene locus_tag LOCUS_30190 6573 6052 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972322.1 protein_id gnl|my_center|LOCUS_30190 6776 7267 gene locus_tag LOCUS_30200 6776 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30200 7222 7230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7270 7833 gene locus_tag LOCUS_30210 7270 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30210 8112 9206 gene locus_tag LOCUS_30220 8112 9206 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170829.1 protein_id gnl|my_center|LOCUS_30220 9954 9415 gene locus_tag LOCUS_30230 9954 9415 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209273.1 protein_id gnl|my_center|LOCUS_30230 9984 10370 gene locus_tag LOCUS_30240 9984 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 11012 10386 gene locus_tag LOCUS_30250 11012 10386 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 protein_id gnl|my_center|LOCUS_30250 11290 11009 gene locus_tag LOCUS_30260 11290 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 11244 11546 gene locus_tag LOCUS_30270 11244 11546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 11932 11462 gene locus_tag LOCUS_30280 11932 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 12120 11932 gene locus_tag LOCUS_30290 12120 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30290 12506 12063 gene locus_tag LOCUS_30300 12506 12063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30300 13160 12609 gene locus_tag LOCUS_30310 13160 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 13247 14764 gene locus_tag LOCUS_30320 13247 14764 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966223.1 protein_id gnl|my_center|LOCUS_30320 14859 15980 gene locus_tag LOCUS_30330 14859 15980 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089178.1 protein_id gnl|my_center|LOCUS_30330 16318 16088 gene locus_tag LOCUS_30340 16318 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_30340 16568 16305 gene locus_tag LOCUS_30350 16568 16305 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence104 1107 1172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2491 1727 gene locus_tag LOCUS_30360 2491 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 2629 3543 gene locus_tag LOCUS_30370 2629 3543 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011857652.1 protein_id gnl|my_center|LOCUS_30370 3975 4229 gene locus_tag LOCUS_30380 3975 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 5137 6762 gene locus_tag LOCUS_30390 5137 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 5178 5282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6855 7700 gene locus_tag LOCUS_30400 6855 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514321.1 protein_id gnl|my_center|LOCUS_30400 7752 10223 gene locus_tag LOCUS_30410 7752 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 11465 10431 gene locus_tag LOCUS_30420 11465 10431 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091836956.1 protein_id gnl|my_center|LOCUS_30420 11587 12954 gene locus_tag LOCUS_30430 11587 12954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 12662 12699 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13004 13933 gene locus_tag LOCUS_30440 13004 13933 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_30440 13930 14787 gene locus_tag LOCUS_30450 13930 14787 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582772.1 protein_id gnl|my_center|LOCUS_30450 14796 15956 gene locus_tag LOCUS_30460 14796 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 16467 16117 gene locus_tag LOCUS_30470 16467 16117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 >Feature sequence105 173 481 gene locus_tag LOCUS_30480 gene rpsJ 173 481 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507767.1 protein_id gnl|my_center|LOCUS_30480 556 1281 gene locus_tag LOCUS_30490 gene rplC 556 1281 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088151.1 protein_id gnl|my_center|LOCUS_30490 1281 1901 gene locus_tag LOCUS_30500 gene rplD 1281 1901 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088150.1 protein_id gnl|my_center|LOCUS_30500 1898 2182 gene locus_tag LOCUS_30510 1898 2182 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088149.1 protein_id gnl|my_center|LOCUS_30510 2179 3015 gene locus_tag LOCUS_30520 gene rplB 2179 3015 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088148.1 protein_id gnl|my_center|LOCUS_30520 3024 3302 gene locus_tag LOCUS_30530 gene rpsS 3024 3302 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002964358.1 protein_id gnl|my_center|LOCUS_30530 3306 3689 gene locus_tag LOCUS_30540 gene rplV 3306 3689 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088147.1 protein_id gnl|my_center|LOCUS_30540 3700 4407 gene locus_tag LOCUS_30550 gene rpsC 3700 4407 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088146.1 protein_id gnl|my_center|LOCUS_30550 4426 4839 gene locus_tag LOCUS_30560 gene rplP 4426 4839 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531427.1 protein_id gnl|my_center|LOCUS_30560 4854 5081 gene locus_tag LOCUS_30570 gene rpmC 4854 5081 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088144.1 protein_id gnl|my_center|LOCUS_30570 5093 5335 gene locus_tag LOCUS_30580 gene rpsQ 5093 5335 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088143.1 protein_id gnl|my_center|LOCUS_30580 5545 5913 gene locus_tag LOCUS_30590 gene rplN 5545 5913 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205457.1 protein_id gnl|my_center|LOCUS_30590 5913 6230 gene locus_tag LOCUS_30600 gene rplX 5913 6230 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_30600 6223 6789 gene locus_tag LOCUS_30610 gene rplE 6223 6789 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531429.1 protein_id gnl|my_center|LOCUS_30610 6826 7131 gene locus_tag LOCUS_30620 gene rpsN 6826 7131 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919140.1 protein_id gnl|my_center|LOCUS_30620 7144 7542 gene locus_tag LOCUS_30630 gene rpsH 7144 7542 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975181.1 protein_id gnl|my_center|LOCUS_30630 7576 8109 gene locus_tag LOCUS_30640 gene rplF 7576 8109 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088138.1 protein_id gnl|my_center|LOCUS_30640 8115 8477 gene locus_tag LOCUS_30650 gene rplR 8115 8477 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313980.1 protein_id gnl|my_center|LOCUS_30650 8626 9186 gene locus_tag LOCUS_30660 gene rpsE 8626 9186 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136332.1 protein_id gnl|my_center|LOCUS_30660 9155 9394 gene locus_tag LOCUS_30670 9155 9394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 9408 9884 gene locus_tag LOCUS_30680 gene rplO 9408 9884 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531434.1 protein_id gnl|my_center|LOCUS_30680 10006 11343 gene locus_tag LOCUS_30690 gene secY 10006 11343 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088135.1 protein_id gnl|my_center|LOCUS_30690 11343 11924 gene locus_tag LOCUS_30700 11343 11924 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531436.1 protein_id gnl|my_center|LOCUS_30700 12221 13072 gene locus_tag LOCUS_30710 12221 13072 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_30710 13312 13680 gene locus_tag LOCUS_30720 gene rpsM 13312 13680 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531437.1 protein_id gnl|my_center|LOCUS_30720 13795 14184 gene locus_tag LOCUS_30730 gene rpsK 13795 14184 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603045.1 protein_id gnl|my_center|LOCUS_30730 14273 15289 gene locus_tag LOCUS_30740 14273 15289 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088132.1 protein_id gnl|my_center|LOCUS_30740 15404 15820 gene locus_tag LOCUS_30750 gene rplQ 15404 15820 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919152.1 protein_id gnl|my_center|LOCUS_30750 >Feature sequence106 <1 1794 gene locus_tag LOCUS_30760 <1 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014490278.1:ParB/RepB/Spo0J family partition protein 2235 1897 gene locus_tag LOCUS_30770 2235 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 2933 2550 gene locus_tag LOCUS_30780 2933 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 6080 3711 gene locus_tag LOCUS_30790 6080 3711 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_30790 6532 6095 gene locus_tag LOCUS_30800 6532 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 6815 6597 gene locus_tag LOCUS_30810 6815 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 7137 6934 gene locus_tag LOCUS_30820 7137 6934 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383180.1 protein_id gnl|my_center|LOCUS_30820 8303 7467 gene locus_tag LOCUS_30830 8303 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 8705 8328 gene locus_tag LOCUS_30840 8705 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 9662 9057 gene locus_tag LOCUS_30850 9662 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 9884 10297 gene locus_tag LOCUS_30860 9884 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 11608 10361 gene locus_tag LOCUS_30870 11608 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 11507 11764 gene locus_tag LOCUS_30880 11507 11764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 12471 11728 gene locus_tag LOCUS_30890 12471 11728 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958593.1 protein_id gnl|my_center|LOCUS_30890 13230 12505 gene locus_tag LOCUS_30900 13230 12505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 14996 13230 gene locus_tag LOCUS_30910 14996 13230 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 protein_id gnl|my_center|LOCUS_30910 15564 15013 gene locus_tag LOCUS_30920 15564 15013 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895638.1 protein_id gnl|my_center|LOCUS_30920 16101 15697 gene locus_tag LOCUS_30930 16101 15697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 >Feature sequence107 691 1104 gene locus_tag LOCUS_30940 gene flgB 691 1104 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088557.1 protein_id gnl|my_center|LOCUS_30940 1159 1569 gene locus_tag LOCUS_30950 gene flgC 1159 1569 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602149.1 protein_id gnl|my_center|LOCUS_30950 1584 1907 gene locus_tag LOCUS_30960 gene fliE 1584 1907 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088556.1 protein_id gnl|my_center|LOCUS_30960 1931 2197 gene locus_tag LOCUS_30970 gene fliQ 1931 2197 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088555.1 protein_id gnl|my_center|LOCUS_30970 2278 3036 gene locus_tag LOCUS_30980 gene fliR 2278 3036 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088554.1 protein_id gnl|my_center|LOCUS_30980 3043 3561 gene locus_tag LOCUS_30990 3043 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 3530 4120 gene locus_tag LOCUS_31000 3530 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31000 4188 6623 gene locus_tag LOCUS_31010 4188 6623 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088552.1 protein_id gnl|my_center|LOCUS_31010 6697 7086 gene locus_tag LOCUS_31020 6697 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 7239 8324 gene locus_tag LOCUS_31030 gene recA 7239 8324 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314063.1 protein_id gnl|my_center|LOCUS_31030 8630 11272 gene locus_tag LOCUS_31040 gene alaS 8630 11272 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240440.1 protein_id gnl|my_center|LOCUS_31040 11281 12447 gene locus_tag LOCUS_31050 11281 12447 CDS product cyclic nucleotide-gated ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967190.1 protein_id gnl|my_center|LOCUS_31050 12444 13106 gene locus_tag LOCUS_31060 12444 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 13337 13618 gene locus_tag LOCUS_31070 13337 13618 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110276.1 protein_id gnl|my_center|LOCUS_31070 14233 13715 gene locus_tag LOCUS_31080 14233 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 <16277 15278 gene locus_tag LOCUS_31090 <16277 15278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088491.1:NADP-dependent isocitrate dehydrogenase >Feature sequence108 87 500 gene locus_tag LOCUS_31100 87 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 497 844 gene locus_tag LOCUS_31110 gene tnpB 497 844 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624622.1 protein_id gnl|my_center|LOCUS_31110 945 2525 gene locus_tag LOCUS_31120 945 2525 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037069003.1 protein_id gnl|my_center|LOCUS_31120 2522 3154 gene locus_tag LOCUS_31130 2522 3154 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388104.1 protein_id gnl|my_center|LOCUS_31130 5529 3526 gene locus_tag LOCUS_31140 5529 3526 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958113.1 protein_id gnl|my_center|LOCUS_31140 6899 5526 gene locus_tag LOCUS_31150 6899 5526 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528747.1 protein_id gnl|my_center|LOCUS_31150 7563 6886 gene locus_tag LOCUS_31160 7563 6886 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528748.1 protein_id gnl|my_center|LOCUS_31160 7803 7603 gene locus_tag LOCUS_31170 7803 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 8811 8290 gene locus_tag LOCUS_31180 8811 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545656.1 protein_id gnl|my_center|LOCUS_31180 9671 8856 gene locus_tag LOCUS_31190 9671 8856 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546505.1 protein_id gnl|my_center|LOCUS_31190 10594 9668 gene locus_tag LOCUS_31200 10594 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 10842 10600 gene locus_tag LOCUS_31210 10842 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 11835 11071 gene locus_tag LOCUS_31220 11835 11071 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_31220 12484 12131 gene locus_tag LOCUS_31230 12484 12131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 13199 12624 gene locus_tag LOCUS_31240 13199 12624 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531897.1 protein_id gnl|my_center|LOCUS_31240 13394 14065 gene locus_tag LOCUS_31250 13394 14065 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532483.1 protein_id gnl|my_center|LOCUS_31250 14950 14795 gene locus_tag LOCUS_31260 14950 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 15060 15848 gene locus_tag LOCUS_31270 15060 15848 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_31270 >Feature sequence109 1381 434 gene locus_tag LOCUS_31280 1381 434 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391451.1 protein_id gnl|my_center|LOCUS_31280 2294 1419 gene locus_tag LOCUS_31290 2294 1419 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090495.1 protein_id gnl|my_center|LOCUS_31290 3197 2463 gene locus_tag LOCUS_31300 3197 2463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173843.1 protein_id gnl|my_center|LOCUS_31300 3364 3215 gene locus_tag LOCUS_31310 3364 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3504 4247 gene locus_tag LOCUS_31320 3504 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 5848 4229 gene locus_tag LOCUS_31330 5848 4229 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440221.1 protein_id gnl|my_center|LOCUS_31330 5847 6047 gene locus_tag LOCUS_31340 5847 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 6102 7070 gene locus_tag LOCUS_31350 6102 7070 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965333.1 protein_id gnl|my_center|LOCUS_31350 7144 9450 gene locus_tag LOCUS_31360 7144 9450 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099653.1 protein_id gnl|my_center|LOCUS_31360 9462 9827 gene locus_tag LOCUS_31370 9462 9827 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084121.1 protein_id gnl|my_center|LOCUS_31370 10074 9835 gene locus_tag LOCUS_31380 10074 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 10211 11800 gene locus_tag LOCUS_31390 gene hpxW 10211 11800 CDS product oxamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705415.1 protein_id gnl|my_center|LOCUS_31390 11804 13009 gene locus_tag LOCUS_31400 11804 13009 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 protein_id gnl|my_center|LOCUS_31400 13159 13797 gene locus_tag LOCUS_31410 gene nthA 13159 13797 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879389.1 protein_id gnl|my_center|LOCUS_31410 13794 14453 gene locus_tag LOCUS_31420 gene nthB 13794 14453 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 protein_id gnl|my_center|LOCUS_31420 14440 14829 gene locus_tag LOCUS_31430 14440 14829 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531054.1 protein_id gnl|my_center|LOCUS_31430 15615 14956 gene locus_tag LOCUS_31440 15615 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 >Feature sequence110 1471 140 gene locus_tag LOCUS_31450 1471 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 1022 1083 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1416 2036 gene locus_tag LOCUS_31460 1416 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 2211 3221 gene locus_tag LOCUS_31470 2211 3221 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921554.1 protein_id gnl|my_center|LOCUS_31470 3231 3512 gene locus_tag LOCUS_31480 3231 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 3922 3701 gene locus_tag LOCUS_31490 3922 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 4103 5287 gene locus_tag LOCUS_31500 4103 5287 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085206.1 protein_id gnl|my_center|LOCUS_31500 5784 5380 gene locus_tag LOCUS_31510 5784 5380 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083039.1 protein_id gnl|my_center|LOCUS_31510 6302 5796 gene locus_tag LOCUS_31520 6302 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 7239 6316 gene locus_tag LOCUS_31530 7239 6316 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113238.1 protein_id gnl|my_center|LOCUS_31530 8631 7381 gene locus_tag LOCUS_31540 gene argJ 8631 7381 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529442.1 protein_id gnl|my_center|LOCUS_31540 8760 9002 gene locus_tag LOCUS_31550 8760 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 9019 9390 gene locus_tag LOCUS_31560 9019 9390 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968936.1 protein_id gnl|my_center|LOCUS_31560 10299 9454 gene locus_tag LOCUS_31570 10299 9454 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175805.1 protein_id gnl|my_center|LOCUS_31570 10581 13427 gene locus_tag LOCUS_31580 gene secA 10581 13427 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083036.1 protein_id gnl|my_center|LOCUS_31580 13672 14745 gene locus_tag LOCUS_31590 13672 14745 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111198133.1 protein_id gnl|my_center|LOCUS_31590 14900 15295 gene locus_tag LOCUS_31600 gene sdhC 14900 15295 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_31600 15307 15699 gene locus_tag LOCUS_31610 gene sdhD 15307 15699 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_31610 >Feature sequence111 414 902 gene locus_tag LOCUS_31620 414 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 785 800 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 916 2622 gene locus_tag LOCUS_31630 916 2622 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390579.1 protein_id gnl|my_center|LOCUS_31630 2619 2951 gene locus_tag LOCUS_31640 2619 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 3211 3014 gene locus_tag LOCUS_31650 3211 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 3664 3347 gene locus_tag LOCUS_31660 3664 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 3984 3646 gene locus_tag LOCUS_31670 3984 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 4201 4509 gene locus_tag LOCUS_31680 4201 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 4922 4833 gene locus_tag LOCUS_t00310 4922 4833 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5298 6479 gene locus_tag LOCUS_31690 5298 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 6528 7757 gene locus_tag LOCUS_31700 6528 7757 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967564.1 protein_id gnl|my_center|LOCUS_31700 7754 8416 gene locus_tag LOCUS_31710 gene tmk 7754 8416 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087289.1 protein_id gnl|my_center|LOCUS_31710 8483 9553 gene locus_tag LOCUS_31720 8483 9553 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087288.1 protein_id gnl|my_center|LOCUS_31720 9574 11133 gene locus_tag LOCUS_31730 gene metG 9574 11133 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097532087.1 protein_id gnl|my_center|LOCUS_31730 11133 11933 gene locus_tag LOCUS_31740 11133 11933 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528321.1 protein_id gnl|my_center|LOCUS_31740 11944 12750 gene locus_tag LOCUS_31750 11944 12750 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087285.1 protein_id gnl|my_center|LOCUS_31750 12999 12799 gene locus_tag LOCUS_31760 12999 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 13182 14159 gene locus_tag LOCUS_31770 13182 14159 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818532.1 protein_id gnl|my_center|LOCUS_31770 14753 14187 gene locus_tag LOCUS_31780 14753 14187 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 protein_id gnl|my_center|LOCUS_31780 15172 14753 gene locus_tag LOCUS_31790 gene arfB 15172 14753 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_31790 >Feature sequence112 1079 60 gene locus_tag LOCUS_31800 gene cobT 1079 60 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328572.1 protein_id gnl|my_center|LOCUS_31800 1161 1592 gene locus_tag LOCUS_31810 1161 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 1550 1987 gene locus_tag LOCUS_31820 1550 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31820 1984 2172 gene locus_tag LOCUS_31830 1984 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 2237 2479 gene locus_tag LOCUS_31840 2237 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 2999 2508 gene locus_tag LOCUS_31850 2999 2508 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061898.1 protein_id gnl|my_center|LOCUS_31850 3849 3016 gene locus_tag LOCUS_31860 3849 3016 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965087.1 protein_id gnl|my_center|LOCUS_31860 4450 4007 gene locus_tag LOCUS_31870 4450 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 4829 4476 gene locus_tag LOCUS_31880 4829 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 5338 4880 gene locus_tag LOCUS_31890 5338 4880 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_31890 6346 5345 gene locus_tag LOCUS_31900 gene dusA 6346 5345 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086515.1 protein_id gnl|my_center|LOCUS_31900 7508 6453 gene locus_tag LOCUS_31910 7508 6453 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090672.1 protein_id gnl|my_center|LOCUS_31910 7671 8540 gene locus_tag LOCUS_31920 7671 8540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 8537 9385 gene locus_tag LOCUS_31930 gene phnC 8537 9385 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113118.1 protein_id gnl|my_center|LOCUS_31930 9382 10188 gene locus_tag LOCUS_31940 9382 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 10833 10252 gene locus_tag LOCUS_31950 10833 10252 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528397.1 protein_id gnl|my_center|LOCUS_31950 11488 10856 gene locus_tag LOCUS_31960 gene ureG 11488 10856 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084276.1 protein_id gnl|my_center|LOCUS_31960 12411 11737 gene locus_tag LOCUS_31970 12411 11737 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084275.1 protein_id gnl|my_center|LOCUS_31970 13155 12421 gene locus_tag LOCUS_31980 13155 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 14543 13563 gene locus_tag LOCUS_31990 14543 13563 CDS product GSU2403 family nucleotidyltransferase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974555.1 protein_id gnl|my_center|LOCUS_31990 15174 14788 gene locus_tag LOCUS_32000 15174 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence113 353 1216 gene locus_tag LOCUS_32010 353 1216 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_32010 1213 2160 gene locus_tag LOCUS_32020 1213 2160 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_32020 2150 3289 gene locus_tag LOCUS_32030 2150 3289 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_32030 3310 4341 gene locus_tag LOCUS_32040 3310 4341 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_32040 4424 5881 gene locus_tag LOCUS_32050 4424 5881 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 protein_id gnl|my_center|LOCUS_32050 7035 6004 gene locus_tag LOCUS_32060 7035 6004 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_32060 8048 7116 gene locus_tag LOCUS_32070 8048 7116 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 protein_id gnl|my_center|LOCUS_32070 8259 9821 gene locus_tag LOCUS_32080 8259 9821 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973036.1 protein_id gnl|my_center|LOCUS_32080 9882 10874 gene locus_tag LOCUS_32090 9882 10874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064134.1 protein_id gnl|my_center|LOCUS_32090 10871 11701 gene locus_tag LOCUS_32100 10871 11701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173684.1 protein_id gnl|my_center|LOCUS_32100 11698 13431 gene locus_tag LOCUS_32110 11698 13431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389764.1 protein_id gnl|my_center|LOCUS_32110 13838 13748 gene locus_tag LOCUS_t00320 13838 13748 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14050 14125 gene locus_tag LOCUS_t00330 14050 14125 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence114 1592 576 gene locus_tag LOCUS_32120 1592 576 CDS product chlorophyllide a reductase iron protein subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390728.1 protein_id gnl|my_center|LOCUS_32120 2521 1589 gene locus_tag LOCUS_32130 gene bchC 2521 1589 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390729.1 protein_id gnl|my_center|LOCUS_32130 3763 2630 gene locus_tag LOCUS_32140 3763 2630 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390730.1 protein_id gnl|my_center|LOCUS_32140 4667 3855 gene locus_tag LOCUS_32150 4667 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32150 4769 6307 gene locus_tag LOCUS_32160 gene crtI 4769 6307 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390732.1 protein_id gnl|my_center|LOCUS_32160 6421 7170 gene locus_tag LOCUS_32170 6421 7170 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390733.1 protein_id gnl|my_center|LOCUS_32170 7336 7148 gene locus_tag LOCUS_32180 7336 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 8429 7353 gene locus_tag LOCUS_32190 8429 7353 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_32190 9954 8410 gene locus_tag LOCUS_32200 9954 8410 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388252.1 protein_id gnl|my_center|LOCUS_32200 10838 9948 gene locus_tag LOCUS_32210 10838 9948 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388246.1 protein_id gnl|my_center|LOCUS_32210 12513 10972 gene locus_tag LOCUS_32220 12513 10972 CDS product magnesium chelatase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388245.1 protein_id gnl|my_center|LOCUS_32220 13664 12510 gene locus_tag LOCUS_32230 gene bchI 13664 12510 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625950.1 protein_id gnl|my_center|LOCUS_32230 14647 13682 gene locus_tag LOCUS_32240 gene ispH 14647 13682 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470638.1 protein_id gnl|my_center|LOCUS_32240 <15270 14644 gene locus_tag LOCUS_32250 <15270 14644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971117.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence115 618 229 gene locus_tag LOCUS_32260 618 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 1285 800 gene locus_tag LOCUS_32270 1285 800 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241131.1 protein_id gnl|my_center|LOCUS_32270 2208 1336 gene locus_tag LOCUS_32280 2208 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 2380 2991 gene locus_tag LOCUS_32290 2380 2991 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084308.1 protein_id gnl|my_center|LOCUS_32290 3595 3005 gene locus_tag LOCUS_32300 3595 3005 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002888.1 protein_id gnl|my_center|LOCUS_32300 3813 3592 gene locus_tag LOCUS_32310 3813 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 4319 3870 gene locus_tag LOCUS_32320 4319 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 6672 4330 gene locus_tag LOCUS_32330 6672 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 7391 6792 gene locus_tag LOCUS_32340 7391 6792 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 protein_id gnl|my_center|LOCUS_32340 8745 7396 gene locus_tag LOCUS_32350 8745 7396 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327609.1 protein_id gnl|my_center|LOCUS_32350 10214 8742 gene locus_tag LOCUS_32360 gene thrC 10214 8742 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532761.1 protein_id gnl|my_center|LOCUS_32360 9884 9906 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11203 10433 gene locus_tag LOCUS_32370 11203 10433 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809264.1 protein_id gnl|my_center|LOCUS_32370 11574 11200 gene locus_tag LOCUS_32380 11574 11200 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503617.1 protein_id gnl|my_center|LOCUS_32380 12677 11820 gene locus_tag LOCUS_32390 12677 11820 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083994.1 protein_id gnl|my_center|LOCUS_32390 13341 12727 gene locus_tag LOCUS_32400 13341 12727 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083993.1 protein_id gnl|my_center|LOCUS_32400 13514 13341 gene locus_tag LOCUS_32410 13514 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 14458 13511 gene locus_tag LOCUS_32420 14458 13511 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974722.1 protein_id gnl|my_center|LOCUS_32420 <15266 14601 gene locus_tag LOCUS_32430 <15266 14601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064241142.1:cytochrome c oxidase subunit I >Feature sequence116 560 1426 gene locus_tag LOCUS_32440 560 1426 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_32440 2645 1455 gene locus_tag LOCUS_32450 2645 1455 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089330.1 protein_id gnl|my_center|LOCUS_32450 3544 2642 gene locus_tag LOCUS_32460 3544 2642 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328556.1 protein_id gnl|my_center|LOCUS_32460 4703 3564 gene locus_tag LOCUS_32470 gene solA 4703 3564 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_32470 4973 6676 gene locus_tag LOCUS_32480 4973 6676 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965394.1 protein_id gnl|my_center|LOCUS_32480 7464 6700 gene locus_tag LOCUS_32490 7464 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 8879 7716 gene locus_tag LOCUS_32500 8879 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 9456 8869 gene locus_tag LOCUS_32510 9456 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 10638 9580 gene locus_tag LOCUS_32520 gene moaA 10638 9580 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086533.1 protein_id gnl|my_center|LOCUS_32520 10781 11047 gene locus_tag LOCUS_32530 10781 11047 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314414.1 protein_id gnl|my_center|LOCUS_32530 11159 12121 gene locus_tag LOCUS_32540 gene phnD 11159 12121 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538257.1 protein_id gnl|my_center|LOCUS_32540 12186 13022 gene locus_tag LOCUS_32550 gene phnC 12186 13022 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_32550 13019 13816 gene locus_tag LOCUS_32560 gene phnE 13019 13816 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_32560 13816 14634 gene locus_tag LOCUS_32570 gene phnE 13816 14634 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_32570 15055 14651 gene locus_tag LOCUS_32580 gene hpxZ 15055 14651 CDS product oxalurate catabolism protein HpxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920468.1 protein_id gnl|my_center|LOCUS_32580 >Feature sequence117 <1 930 gene locus_tag LOCUS_32590 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969872.1:mannitol dehydrogenase family protein 986 1816 gene locus_tag LOCUS_32600 986 1816 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083951.1 protein_id gnl|my_center|LOCUS_32600 3099 1843 gene locus_tag LOCUS_32610 3099 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 3265 4971 gene locus_tag LOCUS_32620 3265 4971 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083952.1 protein_id gnl|my_center|LOCUS_32620 5090 5689 gene locus_tag LOCUS_32630 5090 5689 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173710.1 protein_id gnl|my_center|LOCUS_32630 6752 5706 gene locus_tag LOCUS_32640 6752 5706 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919312.1 protein_id gnl|my_center|LOCUS_32640 7950 6763 gene locus_tag LOCUS_32650 7950 6763 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033454214.1 protein_id gnl|my_center|LOCUS_32650 10079 7998 gene locus_tag LOCUS_32660 10079 7998 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090545.1 protein_id gnl|my_center|LOCUS_32660 10277 11020 gene locus_tag LOCUS_32670 10277 11020 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815313.1 protein_id gnl|my_center|LOCUS_32670 12590 11085 gene locus_tag LOCUS_32680 12590 11085 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 protein_id gnl|my_center|LOCUS_32680 13068 12601 gene locus_tag LOCUS_32690 13068 12601 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085834.1 protein_id gnl|my_center|LOCUS_32690 14171 13170 gene locus_tag LOCUS_32700 14171 13170 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 protein_id gnl|my_center|LOCUS_32700 >Feature sequence118 1460 786 gene locus_tag LOCUS_32710 gene hisG 1460 786 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390582.1 protein_id gnl|my_center|LOCUS_32710 1520 2572 gene locus_tag LOCUS_32720 1520 2572 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331425.1 protein_id gnl|my_center|LOCUS_32720 2723 2763 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4412 3108 gene locus_tag LOCUS_32730 4412 3108 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137931707.1 protein_id gnl|my_center|LOCUS_32730 4537 5151 gene locus_tag LOCUS_32740 4537 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32740 5506 5051 gene locus_tag LOCUS_32750 5506 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 5059 5070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7482 5950 gene locus_tag LOCUS_32760 7482 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 9210 7672 gene locus_tag LOCUS_32770 9210 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 10839 9346 gene locus_tag LOCUS_32780 10839 9346 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089866.1 protein_id gnl|my_center|LOCUS_32780 11053 12897 gene locus_tag LOCUS_32790 11053 12897 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173037.1 protein_id gnl|my_center|LOCUS_32790 14520 13000 gene locus_tag LOCUS_32800 14520 13000 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090470.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence119 1262 393 gene locus_tag LOCUS_32810 1262 393 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090008.1 protein_id gnl|my_center|LOCUS_32810 2793 1744 gene locus_tag LOCUS_32820 2793 1744 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921653.1 protein_id gnl|my_center|LOCUS_32820 2984 3709 gene locus_tag LOCUS_32830 2984 3709 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974623.1 protein_id gnl|my_center|LOCUS_32830 4328 3723 gene locus_tag LOCUS_32840 gene recR 4328 3723 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090836.1 protein_id gnl|my_center|LOCUS_32840 4807 4487 gene locus_tag LOCUS_32850 4807 4487 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309920.1 protein_id gnl|my_center|LOCUS_32850 6683 4830 gene locus_tag LOCUS_32860 6683 4830 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527932.1 protein_id gnl|my_center|LOCUS_32860 7069 7203 gene locus_tag LOCUS_32870 gene rpmH 7069 7203 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008542748.1 protein_id gnl|my_center|LOCUS_32870 7271 7723 gene locus_tag LOCUS_32880 7271 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 7768 9651 gene locus_tag LOCUS_32890 gene yidC 7768 9651 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966085.1 protein_id gnl|my_center|LOCUS_32890 9694 10320 gene locus_tag LOCUS_32900 9694 10320 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391018.1 protein_id gnl|my_center|LOCUS_32900 10436 11149 gene locus_tag LOCUS_32910 gene yihA 10436 11149 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090821.1 protein_id gnl|my_center|LOCUS_32910 11200 12510 gene locus_tag LOCUS_32920 11200 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 12529 13296 gene locus_tag LOCUS_32930 12529 13296 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087476.1 protein_id gnl|my_center|LOCUS_32930 13298 13666 gene locus_tag LOCUS_32940 13298 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 13746 14645 gene locus_tag LOCUS_32950 gene argB 13746 14645 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090823.1 protein_id gnl|my_center|LOCUS_32950 >Feature sequence120 413 2173 gene locus_tag LOCUS_32960 gene argS 413 2173 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967253.1 protein_id gnl|my_center|LOCUS_32960 2273 3955 gene locus_tag LOCUS_32970 2273 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 4181 4609 gene locus_tag LOCUS_32980 4181 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 4811 5824 gene locus_tag LOCUS_32990 gene nagZ 4811 5824 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_32990 5884 6525 gene locus_tag LOCUS_33000 5884 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 6458 6477 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6522 6848 gene locus_tag LOCUS_33010 6522 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 6845 7525 gene locus_tag LOCUS_33020 gene scpB 6845 7525 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171841.1 protein_id gnl|my_center|LOCUS_33020 7686 8801 gene locus_tag LOCUS_33030 7686 8801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328224.1 protein_id gnl|my_center|LOCUS_33030 8869 9126 gene locus_tag LOCUS_33040 8869 9126 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531295.1 protein_id gnl|my_center|LOCUS_33040 9171 9677 gene locus_tag LOCUS_33050 9171 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 9674 10498 gene locus_tag LOCUS_33060 gene tatC 9674 10498 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087517.1 protein_id gnl|my_center|LOCUS_33060 10724 12232 gene locus_tag LOCUS_33070 gene serS 10724 12232 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919865.1 protein_id gnl|my_center|LOCUS_33070 12447 13208 gene locus_tag LOCUS_33080 gene surE 12447 13208 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171844.1 protein_id gnl|my_center|LOCUS_33080 13315 13977 gene locus_tag LOCUS_33090 13315 13977 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087512.1 protein_id gnl|my_center|LOCUS_33090 >Feature sequence121 732 229 gene locus_tag LOCUS_33100 732 229 CDS product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090150.1 protein_id gnl|my_center|LOCUS_33100 748 1113 gene locus_tag LOCUS_33110 748 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 1334 1107 gene locus_tag LOCUS_33120 1334 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 2262 1462 gene locus_tag LOCUS_33130 2262 1462 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966151.1 protein_id gnl|my_center|LOCUS_33130 2477 2701 gene locus_tag LOCUS_33140 2477 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 2688 3248 gene locus_tag LOCUS_33150 2688 3248 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529285.1 protein_id gnl|my_center|LOCUS_33150 3248 4900 gene locus_tag LOCUS_33160 3248 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 5805 4927 gene locus_tag LOCUS_33170 5805 4927 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_33170 6330 5965 gene locus_tag LOCUS_33180 6330 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 8148 6376 gene locus_tag LOCUS_33190 8148 6376 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972722.1 protein_id gnl|my_center|LOCUS_33190 8413 9171 gene locus_tag LOCUS_33200 8413 9171 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529286.1 protein_id gnl|my_center|LOCUS_33200 9448 10149 gene locus_tag LOCUS_33210 9448 10149 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598495.1 protein_id gnl|my_center|LOCUS_33210 10286 11503 gene locus_tag LOCUS_33220 10286 11503 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064885.1 protein_id gnl|my_center|LOCUS_33220 11657 12589 gene locus_tag LOCUS_33230 11657 12589 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531363.1 protein_id gnl|my_center|LOCUS_33230 >Feature sequence122 568 1953 gene locus_tag LOCUS_33240 568 1953 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086559.1 protein_id gnl|my_center|LOCUS_33240 2926 2036 gene locus_tag LOCUS_33250 2926 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 3079 4491 gene locus_tag LOCUS_33260 3079 4491 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086561.1 protein_id gnl|my_center|LOCUS_33260 4491 4685 gene locus_tag LOCUS_33270 4491 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 5894 4704 gene locus_tag LOCUS_33280 5894 4704 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974992.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33280 6118 5894 gene locus_tag LOCUS_33290 6118 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33290 6363 6160 gene locus_tag LOCUS_33300 6363 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 6362 7720 gene locus_tag LOCUS_33310 gene gltX 6362 7720 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531892.1 protein_id gnl|my_center|LOCUS_33310 8879 7749 gene locus_tag LOCUS_33320 8879 7749 CDS product DUF2865 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086569.1 protein_id gnl|my_center|LOCUS_33320 9245 10195 gene locus_tag LOCUS_33330 9245 10195 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972392.1 protein_id gnl|my_center|LOCUS_33330 10661 10281 gene locus_tag LOCUS_33340 10661 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 11778 10693 gene locus_tag LOCUS_33350 11778 10693 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086976.1 protein_id gnl|my_center|LOCUS_33350 11842 12657 gene locus_tag LOCUS_33360 11842 12657 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035835.1 protein_id gnl|my_center|LOCUS_33360 12736 13338 gene locus_tag LOCUS_33370 12736 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 13418 13930 gene locus_tag LOCUS_33380 13418 13930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence123 <1 879 gene locus_tag LOCUS_33390 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087464.1:DNA gyrase subunit A 2095 1103 gene locus_tag LOCUS_33400 2095 1103 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385781.1 protein_id gnl|my_center|LOCUS_33400 2273 2749 gene locus_tag LOCUS_33410 2273 2749 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198641.1 protein_id gnl|my_center|LOCUS_33410 3346 2810 gene locus_tag LOCUS_33420 3346 2810 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531834.1 protein_id gnl|my_center|LOCUS_33420 4250 3663 gene locus_tag LOCUS_33430 4250 3663 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973277.1 protein_id gnl|my_center|LOCUS_33430 5139 4336 gene locus_tag LOCUS_33440 5139 4336 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172853.1 protein_id gnl|my_center|LOCUS_33440 5394 6575 gene locus_tag LOCUS_33450 5394 6575 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083205.1 protein_id gnl|my_center|LOCUS_33450 6804 9455 gene locus_tag LOCUS_33460 gene uvrA 6804 9455 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087470.1 protein_id gnl|my_center|LOCUS_33460 10182 9595 gene locus_tag LOCUS_33470 10182 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 10856 10179 gene locus_tag LOCUS_33480 10856 10179 CDS product DUF5343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879177.1 protein_id gnl|my_center|LOCUS_33480 12432 12067 gene locus_tag LOCUS_33490 12432 12067 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855945.1 protein_id gnl|my_center|LOCUS_33490 12225 12246 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13127 13453 gene locus_tag LOCUS_33500 13127 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence124 1073 495 gene locus_tag LOCUS_33510 1073 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 1868 1173 gene locus_tag LOCUS_33520 1868 1173 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388419.1 protein_id gnl|my_center|LOCUS_33520 2242 2925 gene locus_tag LOCUS_33530 2242 2925 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973902.1 protein_id gnl|my_center|LOCUS_33530 4010 3054 gene locus_tag LOCUS_33540 4010 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33540 4051 4060 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4739 4182 gene locus_tag LOCUS_33550 gene rfbC 4739 4182 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387749.1 protein_id gnl|my_center|LOCUS_33550 5485 4742 gene locus_tag LOCUS_33560 5485 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33560 6664 5882 gene locus_tag LOCUS_33570 6664 5882 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087141.1 protein_id gnl|my_center|LOCUS_33570 8347 6707 gene locus_tag LOCUS_33580 8347 6707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388737.1 protein_id gnl|my_center|LOCUS_33580 9270 8344 gene locus_tag LOCUS_33590 9270 8344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388736.1 protein_id gnl|my_center|LOCUS_33590 10208 9267 gene locus_tag LOCUS_33600 10208 9267 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175416.1 protein_id gnl|my_center|LOCUS_33600 11807 10242 gene locus_tag LOCUS_33610 11807 10242 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088342.1 protein_id gnl|my_center|LOCUS_33610 13035 11899 gene locus_tag LOCUS_33620 13035 11899 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088343.1 protein_id gnl|my_center|LOCUS_33620 14081 13047 gene locus_tag LOCUS_33630 14081 13047 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088348.1 protein_id gnl|my_center|LOCUS_33630 >Feature sequence125 585 88 gene locus_tag LOCUS_33640 585 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 834 2243 gene locus_tag LOCUS_33650 834 2243 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173221.1 protein_id gnl|my_center|LOCUS_33650 3590 2307 gene locus_tag LOCUS_33660 3590 2307 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035843.1 protein_id gnl|my_center|LOCUS_33660 3957 4751 gene locus_tag LOCUS_33670 3957 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 4869 5936 gene locus_tag LOCUS_33680 4869 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 6041 6961 gene locus_tag LOCUS_33690 6041 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 7444 7070 gene locus_tag LOCUS_33700 7444 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 7835 12403 gene locus_tag LOCUS_33710 7835 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 11782 11874 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12497 14029 gene locus_tag LOCUS_33720 12497 14029 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_33720 >Feature sequence126 <1 803 gene locus_tag LOCUS_33730 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533539.1:carbamoyltransferase 2357 822 gene locus_tag LOCUS_33740 gene serA 2357 822 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090136.1 protein_id gnl|my_center|LOCUS_33740 3767 2589 gene locus_tag LOCUS_33750 3767 2589 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970159.1 protein_id gnl|my_center|LOCUS_33750 4899 4381 gene locus_tag LOCUS_33760 4899 4381 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930554.1 protein_id gnl|my_center|LOCUS_33760 5258 5521 gene locus_tag LOCUS_33770 5258 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 5794 6543 gene locus_tag LOCUS_33780 5794 6543 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973571.1 protein_id gnl|my_center|LOCUS_33780 6547 7677 gene locus_tag LOCUS_33790 6547 7677 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 protein_id gnl|my_center|LOCUS_33790 7674 8474 gene locus_tag LOCUS_33800 7674 8474 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 protein_id gnl|my_center|LOCUS_33800 9704 8730 gene locus_tag LOCUS_33810 gene ppk2 9704 8730 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241473.1 protein_id gnl|my_center|LOCUS_33810 9862 10920 gene locus_tag LOCUS_33820 9862 10920 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083910.1 protein_id gnl|my_center|LOCUS_33820 11043 11213 gene locus_tag LOCUS_33830 11043 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 11373 11975 gene locus_tag LOCUS_33840 11373 11975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 12108 12146 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12179 13150 gene locus_tag LOCUS_33850 gene pstC 12179 13150 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741620.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence127 <1 833 gene locus_tag LOCUS_33860 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085906.1:sensor histidine kinase 912 2015 gene locus_tag LOCUS_33870 gene ccmI 912 2015 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968988.1 protein_id gnl|my_center|LOCUS_33870 2012 2542 gene locus_tag LOCUS_33880 gene ccmE 2012 2542 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085910.1 protein_id gnl|my_center|LOCUS_33880 2550 4535 gene locus_tag LOCUS_33890 2550 4535 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968989.1 protein_id gnl|my_center|LOCUS_33890 4541 5020 gene locus_tag LOCUS_33900 4541 5020 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974838.1 protein_id gnl|my_center|LOCUS_33900 5104 6339 gene locus_tag LOCUS_33910 5104 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 6510 7193 gene locus_tag LOCUS_33920 6510 7193 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965709.1 protein_id gnl|my_center|LOCUS_33920 7177 8742 gene locus_tag LOCUS_33930 7177 8742 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_33930 8755 11709 gene locus_tag LOCUS_33940 8755 11709 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968993.1 protein_id gnl|my_center|LOCUS_33940 14010 11713 gene locus_tag LOCUS_33950 14010 11713 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085924.1 protein_id gnl|my_center|LOCUS_33950 >Feature sequence128 18 509 gene locus_tag LOCUS_33960 18 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 577 1503 gene locus_tag LOCUS_33970 577 1503 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_33970 1500 2387 gene locus_tag LOCUS_33980 1500 2387 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174518.1 protein_id gnl|my_center|LOCUS_33980 2390 3136 gene locus_tag LOCUS_33990 2390 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 3123 4040 gene locus_tag LOCUS_34000 3123 4040 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528834.1 protein_id gnl|my_center|LOCUS_34000 4170 5084 gene locus_tag LOCUS_34010 4170 5084 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089835.1 protein_id gnl|my_center|LOCUS_34010 5173 6003 gene locus_tag LOCUS_34020 5173 6003 CDS product DUF1932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494215.1 protein_id gnl|my_center|LOCUS_34020 6003 6989 gene locus_tag LOCUS_34030 6003 6989 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 protein_id gnl|my_center|LOCUS_34030 6994 8103 gene locus_tag LOCUS_34040 6994 8103 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969456.1 protein_id gnl|my_center|LOCUS_34040 8131 8856 gene locus_tag LOCUS_34050 8131 8856 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086622.1 protein_id gnl|my_center|LOCUS_34050 8853 9536 gene locus_tag LOCUS_34060 8853 9536 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 protein_id gnl|my_center|LOCUS_34060 9596 10636 gene locus_tag LOCUS_34070 9596 10636 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_34070 10640 11155 gene locus_tag LOCUS_34080 10640 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 11145 12464 gene locus_tag LOCUS_34090 11145 12464 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_34090 12489 13463 gene locus_tag LOCUS_34100 12489 13463 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 protein_id gnl|my_center|LOCUS_34100 >Feature sequence129 1078 302 gene locus_tag LOCUS_34110 1078 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 1427 1212 gene locus_tag LOCUS_34120 1427 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 1482 1664 gene locus_tag LOCUS_34130 1482 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 1661 3151 gene locus_tag LOCUS_34140 1661 3151 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970602.1 protein_id gnl|my_center|LOCUS_34140 3666 3127 gene locus_tag LOCUS_34150 3666 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 3665 4270 gene locus_tag LOCUS_34160 3665 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 4388 5941 gene locus_tag LOCUS_34170 4388 5941 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970606.1 protein_id gnl|my_center|LOCUS_34170 5967 6938 gene locus_tag LOCUS_34180 5967 6938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906119.1 protein_id gnl|my_center|LOCUS_34180 6941 7843 gene locus_tag LOCUS_34190 6941 7843 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815883.1 protein_id gnl|my_center|LOCUS_34190 7840 9327 gene locus_tag LOCUS_34200 7840 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34200 9579 10733 gene locus_tag LOCUS_34210 9579 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 11972 10743 gene locus_tag LOCUS_34220 11972 10743 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974080.1 protein_id gnl|my_center|LOCUS_34220 12846 12136 gene locus_tag LOCUS_34230 12846 12136 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971609.1 protein_id gnl|my_center|LOCUS_34230 >Feature sequence130 <1 759 gene locus_tag LOCUS_34240 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005170110.1:iron/manganese ABC transporter substrate-binding protein YfeA 789 1682 gene locus_tag LOCUS_34250 789 1682 CDS product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970361.1 protein_id gnl|my_center|LOCUS_34250 1679 2536 gene locus_tag LOCUS_34260 gene yfeC 1679 2536 CDS product iron/manganese ABC transporter permease subunit YfeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816221.1 protein_id gnl|my_center|LOCUS_34260 2742 3584 gene locus_tag LOCUS_34270 gene yfeD 2742 3584 CDS product iron/manganese ABC transporter permease subunit YfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170116.1 protein_id gnl|my_center|LOCUS_34270 4391 3585 gene locus_tag LOCUS_34280 4391 3585 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109099858.1 protein_id gnl|my_center|LOCUS_34280 5463 4456 gene locus_tag LOCUS_34290 5463 4456 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919823.1 protein_id gnl|my_center|LOCUS_34290 6348 5557 gene locus_tag LOCUS_34300 6348 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 6614 6345 gene locus_tag LOCUS_34310 6614 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 6781 7515 gene locus_tag LOCUS_34320 6781 7515 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089391.1 protein_id gnl|my_center|LOCUS_34320 7512 8855 gene locus_tag LOCUS_34330 7512 8855 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089392.1 protein_id gnl|my_center|LOCUS_34330 8925 9122 gene locus_tag LOCUS_34340 8925 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 10383 9127 gene locus_tag LOCUS_34350 gene serA 10383 9127 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175507.1 protein_id gnl|my_center|LOCUS_34350 10915 10475 gene locus_tag LOCUS_34360 10915 10475 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393537.1 protein_id gnl|my_center|LOCUS_34360 11703 10927 gene locus_tag LOCUS_34370 11703 10927 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090475.1 protein_id gnl|my_center|LOCUS_34370 >Feature sequence131 2355 538 gene locus_tag LOCUS_34380 2355 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 4320 2641 gene locus_tag LOCUS_34390 4320 2641 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970878.1 protein_id gnl|my_center|LOCUS_34390 5330 4317 gene locus_tag LOCUS_34400 5330 4317 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811185.1 protein_id gnl|my_center|LOCUS_34400 6639 5527 gene locus_tag LOCUS_34410 6639 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 7281 6787 gene locus_tag LOCUS_34420 7281 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 8728 7346 gene locus_tag LOCUS_34430 gene guaB 8728 7346 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086749.1 protein_id gnl|my_center|LOCUS_34430 9201 8890 gene locus_tag LOCUS_34440 9201 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 9445 10776 gene locus_tag LOCUS_34450 9445 10776 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086748.1 protein_id gnl|my_center|LOCUS_34450 10841 11092 gene locus_tag LOCUS_34460 10841 11092 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002804328.1 protein_id gnl|my_center|LOCUS_34460 11089 11484 gene locus_tag LOCUS_34470 11089 11484 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036811.1 protein_id gnl|my_center|LOCUS_34470 11560 12174 gene locus_tag LOCUS_34480 11560 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 12252 12539 gene locus_tag LOCUS_34490 gene yacA 12252 12539 CDS product type II toxin-antitoxin system antitoxin YacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079957.1 protein_id gnl|my_center|LOCUS_34490 12536 12820 gene locus_tag LOCUS_34500 12536 12820 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114441661.1 protein_id gnl|my_center|LOCUS_34500 >Feature sequence132 115 672 gene locus_tag LOCUS_34510 115 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 711 836 gene locus_tag LOCUS_34520 711 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 919 1752 gene locus_tag LOCUS_34530 919 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 1754 2317 gene locus_tag LOCUS_34540 1754 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 2314 2661 gene locus_tag LOCUS_34550 2314 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 2835 3053 gene locus_tag LOCUS_34560 2835 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 3198 4469 gene locus_tag LOCUS_34570 3198 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 4466 5143 gene locus_tag LOCUS_34580 4466 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 5415 5188 gene locus_tag LOCUS_34590 5415 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 6212 5412 gene locus_tag LOCUS_34600 6212 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 6864 6364 gene locus_tag LOCUS_34610 6864 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 7113 7036 gene locus_tag LOCUS_t00340 7113 7036 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7322 8140 gene locus_tag LOCUS_34620 7322 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 9372 8110 gene locus_tag LOCUS_34630 9372 8110 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966321.1 protein_id gnl|my_center|LOCUS_34630 10919 9369 gene locus_tag LOCUS_34640 10919 9369 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171667.1 protein_id gnl|my_center|LOCUS_34640 11447 11803 gene locus_tag LOCUS_34650 11447 11803 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_34650 11800 12138 gene locus_tag LOCUS_34660 11800 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 <13214 12143 gene locus_tag LOCUS_34670 <13214 12143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532221.1:glycosyltransferase family 4 protein >Feature sequence133 <1 1494 gene locus_tag LOCUS_34680 <1 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_142494290.1:cobyric acid synthase 1719 2315 gene locus_tag LOCUS_34690 1719 2315 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085211.1 protein_id gnl|my_center|LOCUS_34690 2386 4353 gene locus_tag LOCUS_34700 2386 4353 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967035.1 protein_id gnl|my_center|LOCUS_34700 5206 4277 gene locus_tag LOCUS_34710 5206 4277 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194784.1 protein_id gnl|my_center|LOCUS_34710 6222 5203 gene locus_tag LOCUS_34720 6222 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 6356 6823 gene locus_tag LOCUS_34730 gene mmcB 6356 6823 CDS product DNA repair putative endonuclease MmcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 protein_id gnl|my_center|LOCUS_34730 7420 6851 gene locus_tag LOCUS_34740 7420 6851 CDS product ActR/PrrA/RegA family redox response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463732.1 protein_id gnl|my_center|LOCUS_34740 8849 7494 gene locus_tag LOCUS_34750 8849 7494 CDS product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 protein_id gnl|my_center|LOCUS_34750 9035 10351 gene locus_tag LOCUS_34760 gene phaZ 9035 10351 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083730.1 protein_id gnl|my_center|LOCUS_34760 11887 10463 gene locus_tag LOCUS_34770 11887 10463 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528447.1 protein_id gnl|my_center|LOCUS_34770 12069 12857 gene locus_tag LOCUS_34780 12069 12857 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241590.1 protein_id gnl|my_center|LOCUS_34780 13175 13100 gene locus_tag LOCUS_t00350 13175 13100 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence134 277 1005 gene locus_tag LOCUS_34790 277 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 1177 1569 gene locus_tag LOCUS_34800 1177 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 2202 1636 gene locus_tag LOCUS_34810 2202 1636 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971907.1 protein_id gnl|my_center|LOCUS_34810 2609 2199 gene locus_tag LOCUS_34820 2609 2199 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331387.1 protein_id gnl|my_center|LOCUS_34820 2879 2610 gene locus_tag LOCUS_34830 2879 2610 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141679.1 protein_id gnl|my_center|LOCUS_34830 4218 2911 gene locus_tag LOCUS_34840 gene purB 4218 2911 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383544.1 protein_id gnl|my_center|LOCUS_34840 5049 4366 gene locus_tag LOCUS_34850 gene rpe 5049 4366 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085374.1 protein_id gnl|my_center|LOCUS_34850 5621 5190 gene locus_tag LOCUS_34860 5621 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 6646 5666 gene locus_tag LOCUS_34870 6646 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 6915 8165 gene locus_tag LOCUS_34880 6915 8165 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974548.1 protein_id gnl|my_center|LOCUS_34880 9044 8175 gene locus_tag LOCUS_34890 gene murI 9044 8175 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088448.1 protein_id gnl|my_center|LOCUS_34890 9190 10113 gene locus_tag LOCUS_34900 9190 10113 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081161075.1 protein_id gnl|my_center|LOCUS_34900 11529 10252 gene locus_tag LOCUS_34910 11529 10252 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083372.1 protein_id gnl|my_center|LOCUS_34910 >Feature sequence135 231 2156 gene locus_tag LOCUS_34920 gene ftsH 231 2156 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089881.1 protein_id gnl|my_center|LOCUS_34920 3924 2251 gene locus_tag LOCUS_34930 3924 2251 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396100.1 protein_id gnl|my_center|LOCUS_34930 4974 4291 gene locus_tag LOCUS_34940 4974 4291 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194030.1 protein_id gnl|my_center|LOCUS_34940 5149 5748 gene locus_tag LOCUS_34950 5149 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 6531 5773 gene locus_tag LOCUS_34960 6531 5773 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090289.1 protein_id gnl|my_center|LOCUS_34960 6633 8159 gene locus_tag LOCUS_34970 gene gpmI 6633 8159 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388989.1 protein_id gnl|my_center|LOCUS_34970 9139 8237 gene locus_tag LOCUS_34980 9139 8237 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174704.1 protein_id gnl|my_center|LOCUS_34980 10161 9484 gene locus_tag LOCUS_34990 10161 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 11633 10221 gene locus_tag LOCUS_35000 gene glnT 11633 10221 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_35000 12427 11648 gene locus_tag LOCUS_35010 12427 11648 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990032.1 protein_id gnl|my_center|LOCUS_35010 <13036 12434 gene locus_tag LOCUS_35020 <13036 12434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206340.1:ABC transporter ATP-binding protein >Feature sequence136 258 617 gene locus_tag LOCUS_35030 gene cpdR1 258 617 CDS product response regulator CpdR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531148.1 protein_id gnl|my_center|LOCUS_35030 770 844 gene locus_tag LOCUS_t00360 770 844 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1397 1014 gene locus_tag LOCUS_35040 1397 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 1699 1394 gene locus_tag LOCUS_35050 1699 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 2234 1914 gene locus_tag LOCUS_35060 2234 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 2428 2487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2942 3121 gene locus_tag LOCUS_35070 2942 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 3408 3118 gene locus_tag LOCUS_35080 3408 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 3745 4062 gene locus_tag LOCUS_35090 3745 4062 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003517402.1 protein_id gnl|my_center|LOCUS_35090 4125 4958 gene locus_tag LOCUS_35100 4125 4958 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394832.1 protein_id gnl|my_center|LOCUS_35100 6222 5446 gene locus_tag LOCUS_35110 6222 5446 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072701.1 protein_id gnl|my_center|LOCUS_35110 7085 6219 gene locus_tag LOCUS_35120 7085 6219 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086914.1 protein_id gnl|my_center|LOCUS_35120 8425 7154 gene locus_tag LOCUS_35130 8425 7154 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392994.1 protein_id gnl|my_center|LOCUS_35130 9334 8486 gene locus_tag LOCUS_35140 9334 8486 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310642.1 protein_id gnl|my_center|LOCUS_35140 10263 9334 gene locus_tag LOCUS_35150 10263 9334 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970865.1 protein_id gnl|my_center|LOCUS_35150 11384 10260 gene locus_tag LOCUS_35160 11384 10260 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992208.1 protein_id gnl|my_center|LOCUS_35160 11490 12386 gene locus_tag LOCUS_35170 11490 12386 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521379.1 protein_id gnl|my_center|LOCUS_35170 >Feature sequence137 502 1056 gene locus_tag LOCUS_35180 502 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086378.1 protein_id gnl|my_center|LOCUS_35180 1111 2535 gene locus_tag LOCUS_35190 gene tagH 1111 2535 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967723.1 protein_id gnl|my_center|LOCUS_35190 3080 2721 gene locus_tag LOCUS_35200 3080 2721 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526838.1 protein_id gnl|my_center|LOCUS_35200 3655 3155 gene locus_tag LOCUS_35210 3655 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 3833 5170 gene locus_tag LOCUS_35220 gene tssK 3833 5170 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548748.1 protein_id gnl|my_center|LOCUS_35220 5167 6435 gene locus_tag LOCUS_35230 5167 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 6451 10062 gene locus_tag LOCUS_35240 gene tssM 6451 10062 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086382.1 protein_id gnl|my_center|LOCUS_35240 10067 10774 gene locus_tag LOCUS_35250 gene tagF 10067 10774 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086383.1 protein_id gnl|my_center|LOCUS_35250 10771 11580 gene locus_tag LOCUS_35260 10771 11580 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525286.1 protein_id gnl|my_center|LOCUS_35260 >Feature sequence138 2025 1501 gene locus_tag LOCUS_35270 2025 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 3503 2061 gene locus_tag LOCUS_35280 gene ccoG 3503 2061 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085552.1 protein_id gnl|my_center|LOCUS_35280 4389 3505 gene locus_tag LOCUS_35290 gene ccoP 4389 3505 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085551.1 protein_id gnl|my_center|LOCUS_35290 4548 4393 gene locus_tag LOCUS_35300 4548 4393 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967315.1 protein_id gnl|my_center|LOCUS_35300 5324 4560 gene locus_tag LOCUS_35310 gene ccoO 5324 4560 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085549.1 protein_id gnl|my_center|LOCUS_35310 6094 5336 gene locus_tag LOCUS_35320 6094 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 6033 6830 gene locus_tag LOCUS_35330 6033 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 7321 7031 gene locus_tag LOCUS_35340 7321 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 7299 7664 gene locus_tag LOCUS_35350 7299 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 9509 7833 gene locus_tag LOCUS_35360 gene ggt 9509 7833 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392048.1 protein_id gnl|my_center|LOCUS_35360 10436 9609 gene locus_tag LOCUS_35370 10436 9609 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_35370 11290 10469 gene locus_tag LOCUS_35380 11290 10469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_35380 12243 11287 gene locus_tag LOCUS_35390 12243 11287 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095722.1 protein_id gnl|my_center|LOCUS_35390 >Feature sequence139 521 2503 gene locus_tag LOCUS_35400 521 2503 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400568.1 protein_id gnl|my_center|LOCUS_35400 2778 3092 gene locus_tag LOCUS_35410 2778 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 3345 3788 gene locus_tag LOCUS_35420 3345 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 3847 4614 gene locus_tag LOCUS_35430 gene hdhA 3847 4614 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483353.1 protein_id gnl|my_center|LOCUS_35430 4648 5442 gene locus_tag LOCUS_35440 4648 5442 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035669.1 protein_id gnl|my_center|LOCUS_35440 5481 6209 gene locus_tag LOCUS_35450 5481 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 6839 6432 gene locus_tag LOCUS_35460 6839 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35460 7977 6757 gene locus_tag LOCUS_35470 7977 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 8350 8036 gene locus_tag LOCUS_35480 gene groES 8350 8036 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530718.1 protein_id gnl|my_center|LOCUS_35480 8608 8877 gene locus_tag LOCUS_35490 8608 8877 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088370.1 protein_id gnl|my_center|LOCUS_35490 9150 8986 gene locus_tag LOCUS_35500 9150 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 9538 9320 gene locus_tag LOCUS_35510 9538 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 >Feature sequence140 787 173 gene locus_tag LOCUS_35520 gene soxX 787 173 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228665.1 protein_id gnl|my_center|LOCUS_35520 1634 801 gene locus_tag LOCUS_35530 gene soxA 1634 801 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228668.1 protein_id gnl|my_center|LOCUS_35530 1810 2274 gene locus_tag LOCUS_35540 1810 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 2326 2655 gene locus_tag LOCUS_35550 gene soxZ 2326 2655 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_35550 2933 4414 gene locus_tag LOCUS_35560 gene soxB 2933 4414 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086299.1 protein_id gnl|my_center|LOCUS_35560 4460 5737 gene locus_tag LOCUS_35570 gene soxC 4460 5737 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_35570 5721 6476 gene locus_tag LOCUS_35580 5721 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 6476 6805 gene locus_tag LOCUS_35590 6476 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 6841 7365 gene locus_tag LOCUS_35600 6841 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 7471 8721 gene locus_tag LOCUS_35610 7471 8721 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_35610 8818 9207 gene locus_tag LOCUS_35620 8818 9207 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090276.1 protein_id gnl|my_center|LOCUS_35620 10131 9229 gene locus_tag LOCUS_35630 10131 9229 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513572.1 protein_id gnl|my_center|LOCUS_35630 10343 10549 gene locus_tag LOCUS_35640 10343 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 10546 11979 gene locus_tag LOCUS_35650 10546 11979 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_35650 >Feature sequence141 <1 1094 gene locus_tag LOCUS_35660 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086586.1:aminotransferase 2491 1100 gene locus_tag LOCUS_35670 2491 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 2911 2561 gene locus_tag LOCUS_35680 2911 2561 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083946.1 protein_id gnl|my_center|LOCUS_35680 3439 2993 gene locus_tag LOCUS_35690 3439 2993 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337356.1 protein_id gnl|my_center|LOCUS_35690 4450 3491 gene locus_tag LOCUS_35700 gene coaA 4450 3491 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528342.1 protein_id gnl|my_center|LOCUS_35700 4837 4520 gene locus_tag LOCUS_35710 4837 4520 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311110.1 protein_id gnl|my_center|LOCUS_35710 5756 4995 gene locus_tag LOCUS_35720 gene hisF 5756 4995 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067464.1 protein_id gnl|my_center|LOCUS_35720 6626 5874 gene locus_tag LOCUS_35730 6626 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 6868 7518 gene locus_tag LOCUS_35740 6868 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 8419 7526 gene locus_tag LOCUS_35750 8419 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 9197 8430 gene locus_tag LOCUS_35760 9197 8430 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402690.1 protein_id gnl|my_center|LOCUS_35760 9280 10137 gene locus_tag LOCUS_35770 9280 10137 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976287.1 protein_id gnl|my_center|LOCUS_35770 10137 10907 gene locus_tag LOCUS_35780 10137 10907 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402699.1 protein_id gnl|my_center|LOCUS_35780 10904 11614 gene locus_tag LOCUS_35790 gene pcaH 10904 11614 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965195.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence142 2 493 gene locus_tag LOCUS_35800 2 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 540 1049 gene locus_tag LOCUS_35810 540 1049 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318983.1 protein_id gnl|my_center|LOCUS_35810 1060 1884 gene locus_tag LOCUS_35820 1060 1884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973997.1 protein_id gnl|my_center|LOCUS_35820 1887 2687 gene locus_tag LOCUS_35830 1887 2687 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787370.1 protein_id gnl|my_center|LOCUS_35830 2898 2746 gene locus_tag LOCUS_35840 2898 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35840 3095 3832 gene locus_tag LOCUS_35850 3095 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 5114 3810 gene locus_tag LOCUS_35860 5114 3810 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811061.1 protein_id gnl|my_center|LOCUS_35860 5725 5111 gene locus_tag LOCUS_35870 5725 5111 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811059.1 protein_id gnl|my_center|LOCUS_35870 7513 5858 gene locus_tag LOCUS_35880 7513 5858 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_35880 7914 7510 gene locus_tag LOCUS_35890 7914 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 9406 7940 gene locus_tag LOCUS_35900 9406 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 9804 11054 gene locus_tag LOCUS_35910 9804 11054 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976085.1 protein_id gnl|my_center|LOCUS_35910 11205 11837 gene locus_tag LOCUS_35920 gene cspD 11205 11837 CDS product stationary phase survival protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640225.1 protein_id gnl|my_center|LOCUS_35920 >Feature sequence143 440 1186 gene locus_tag LOCUS_35930 gene fliP 440 1186 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088559.1 protein_id gnl|my_center|LOCUS_35930 3331 1202 gene locus_tag LOCUS_35940 3331 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35940 4595 3357 gene locus_tag LOCUS_35950 4595 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 5564 4701 gene locus_tag LOCUS_35960 5564 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 6013 5561 gene locus_tag LOCUS_35970 6013 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 7157 6027 gene locus_tag LOCUS_35980 gene fliM 7157 6027 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088568.1 protein_id gnl|my_center|LOCUS_35980 7724 7206 gene locus_tag LOCUS_35990 7724 7206 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640398.1 protein_id gnl|my_center|LOCUS_35990 8015 8758 gene locus_tag LOCUS_36000 gene flgF 8015 8758 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088570.1 protein_id gnl|my_center|LOCUS_36000 8781 9572 gene locus_tag LOCUS_36010 gene flgG 8781 9572 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088571.1 protein_id gnl|my_center|LOCUS_36010 9590 10660 gene locus_tag LOCUS_36020 9590 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 10687 11469 gene locus_tag LOCUS_36030 gene flgH 10687 11469 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088573.1 protein_id gnl|my_center|LOCUS_36030 >Feature sequence144 557 2980 gene locus_tag LOCUS_36040 557 2980 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085599.1 protein_id gnl|my_center|LOCUS_36040 3422 3117 gene locus_tag LOCUS_36050 3422 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 4301 3513 gene locus_tag LOCUS_36060 4301 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 5389 4304 gene locus_tag LOCUS_36070 5389 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 5853 6887 gene locus_tag LOCUS_36080 5853 6887 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083332.1 protein_id gnl|my_center|LOCUS_36080 7047 7976 gene locus_tag LOCUS_36090 7047 7976 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174794.1 protein_id gnl|my_center|LOCUS_36090 7995 8627 gene locus_tag LOCUS_36100 7995 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 9025 9585 gene locus_tag LOCUS_36110 9025 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 9585 9869 gene locus_tag LOCUS_36120 9585 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 9968 10453 gene locus_tag LOCUS_36130 gene bfr 9968 10453 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089420.1 protein_id gnl|my_center|LOCUS_36130 10752 11294 gene locus_tag LOCUS_36140 10752 11294 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_36140 >Feature sequence145 1352 99 gene locus_tag LOCUS_36150 1352 99 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971979.1 protein_id gnl|my_center|LOCUS_36150 1571 1984 gene locus_tag LOCUS_36160 1571 1984 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316411.1 protein_id gnl|my_center|LOCUS_36160 3006 1981 gene locus_tag LOCUS_36170 3006 1981 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920455.1 protein_id gnl|my_center|LOCUS_36170 3823 3011 gene locus_tag LOCUS_36180 3823 3011 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971976.1 protein_id gnl|my_center|LOCUS_36180 4392 3820 gene locus_tag LOCUS_36190 4392 3820 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 protein_id gnl|my_center|LOCUS_36190 4931 4389 gene locus_tag LOCUS_36200 4931 4389 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_36200 5188 6540 gene locus_tag LOCUS_36210 5188 6540 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265823.1 protein_id gnl|my_center|LOCUS_36210 6537 7355 gene locus_tag LOCUS_36220 6537 7355 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_36220 7710 7387 gene locus_tag LOCUS_36230 7710 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 8044 7745 gene locus_tag LOCUS_36240 8044 7745 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036600.1 protein_id gnl|my_center|LOCUS_36240 8427 8158 gene locus_tag LOCUS_36250 8427 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 9072 8644 gene locus_tag LOCUS_36260 9072 8644 CDS product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327799.1 protein_id gnl|my_center|LOCUS_36260 9551 9069 gene locus_tag LOCUS_36270 9551 9069 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085348.1 protein_id gnl|my_center|LOCUS_36270 10343 9567 gene locus_tag LOCUS_36280 10343 9567 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085409.1 protein_id gnl|my_center|LOCUS_36280 10924 10358 gene locus_tag LOCUS_36290 gene pdxH 10924 10358 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309812.1 protein_id gnl|my_center|LOCUS_36290 >Feature sequence146 1 543 gene locus_tag LOCUS_36300 1 543 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397340.1 protein_id gnl|my_center|LOCUS_36300 629 1441 gene locus_tag LOCUS_36310 629 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 1341 1420 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1603 1869 gene locus_tag LOCUS_36320 1603 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 2935 1931 gene locus_tag LOCUS_36330 2935 1931 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969967.1 protein_id gnl|my_center|LOCUS_36330 3103 3555 gene locus_tag LOCUS_36340 3103 3555 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844779.1 protein_id gnl|my_center|LOCUS_36340 5299 3647 gene locus_tag LOCUS_36350 gene ettA 5299 3647 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089425.1 protein_id gnl|my_center|LOCUS_36350 5474 6025 gene locus_tag LOCUS_36360 5474 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 6080 7042 gene locus_tag LOCUS_36370 6080 7042 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 protein_id gnl|my_center|LOCUS_36370 7159 7995 gene locus_tag LOCUS_36380 7159 7995 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337017.1 protein_id gnl|my_center|LOCUS_36380 10108 8300 gene locus_tag LOCUS_36390 10108 8300 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531870.1 protein_id gnl|my_center|LOCUS_36390 11135 10155 gene locus_tag LOCUS_36400 11135 10155 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965338.1 protein_id gnl|my_center|LOCUS_36400 >Feature sequence147 743 186 gene locus_tag LOCUS_36410 743 186 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088818.1 protein_id gnl|my_center|LOCUS_36410 1502 747 gene locus_tag LOCUS_36420 1502 747 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088823.1 protein_id gnl|my_center|LOCUS_36420 1736 4060 gene locus_tag LOCUS_36430 1736 4060 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_36430 4161 4499 gene locus_tag LOCUS_36440 4161 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 4634 5581 gene locus_tag LOCUS_36450 4634 5581 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257482.1 protein_id gnl|my_center|LOCUS_36450 5787 6962 gene locus_tag LOCUS_36460 5787 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 9313 7091 gene locus_tag LOCUS_36470 9313 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36470 10948 9818 gene locus_tag LOCUS_36480 10948 9818 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093151333.1 protein_id gnl|my_center|LOCUS_36480 >Feature sequence148 909 130 gene locus_tag LOCUS_36490 909 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36490 2676 1033 gene locus_tag LOCUS_36500 2676 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36500 2888 3340 gene locus_tag LOCUS_36510 2888 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 4564 3350 gene locus_tag LOCUS_36520 4564 3350 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086738.1 protein_id gnl|my_center|LOCUS_36520 5320 4622 gene locus_tag LOCUS_36530 gene phoB 5320 4622 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143479.1 protein_id gnl|my_center|LOCUS_36530 6164 5445 gene locus_tag LOCUS_36540 gene phoU 6164 5445 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083915.1 protein_id gnl|my_center|LOCUS_36540 6944 6207 gene locus_tag LOCUS_36550 gene pstB 6944 6207 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083914.1 protein_id gnl|my_center|LOCUS_36550 7018 7929 gene locus_tag LOCUS_36560 7018 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 8575 7886 gene locus_tag LOCUS_36570 8575 7886 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336382.1 protein_id gnl|my_center|LOCUS_36570 9689 8625 gene locus_tag LOCUS_36580 9689 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 <11416 9610 gene locus_tag LOCUS_36590 <11416 9610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151613585.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence149 <1 1211 gene locus_tag LOCUS_36600 <1 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531130.1:FAD-binding oxidoreductase 1214 1795 gene locus_tag LOCUS_36610 1214 1795 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173711.1 protein_id gnl|my_center|LOCUS_36610 1893 2288 gene locus_tag LOCUS_36620 1893 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 2421 3338 gene locus_tag LOCUS_36630 2421 3338 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081296127.1 protein_id gnl|my_center|LOCUS_36630 5536 3536 gene locus_tag LOCUS_36640 5536 3536 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921615.1 protein_id gnl|my_center|LOCUS_36640 6927 5653 gene locus_tag LOCUS_36650 gene ispG 6927 5653 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083758.1 protein_id gnl|my_center|LOCUS_36650 7489 6956 gene locus_tag LOCUS_36660 7489 6956 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083756.1 protein_id gnl|my_center|LOCUS_36660 7627 8412 gene locus_tag LOCUS_36670 7627 8412 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 protein_id gnl|my_center|LOCUS_36670 8409 9479 gene locus_tag LOCUS_36680 8409 9479 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 protein_id gnl|my_center|LOCUS_36680 9783 9493 gene locus_tag LOCUS_36690 9783 9493 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971677.1 protein_id gnl|my_center|LOCUS_36690 10045 9776 gene locus_tag LOCUS_36700 10045 9776 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971678.1 protein_id gnl|my_center|LOCUS_36700 10177 11088 gene locus_tag LOCUS_36710 10177 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 >Feature sequence150 668 525 gene locus_tag LOCUS_36720 668 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 2104 1115 gene locus_tag LOCUS_36730 2104 1115 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085408.1 protein_id gnl|my_center|LOCUS_36730 3043 2192 gene locus_tag LOCUS_36740 3043 2192 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 protein_id gnl|my_center|LOCUS_36740 4863 3040 gene locus_tag LOCUS_36750 4863 3040 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_36750 5051 6058 gene locus_tag LOCUS_36760 5051 6058 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085356.1 protein_id gnl|my_center|LOCUS_36760 6251 7153 gene locus_tag LOCUS_36770 6251 7153 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_36770 8146 7160 gene locus_tag LOCUS_36780 8146 7160 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085331.1 protein_id gnl|my_center|LOCUS_36780 9587 8343 gene locus_tag LOCUS_36790 9587 8343 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965920.1 protein_id gnl|my_center|LOCUS_36790 >Feature sequence151 1886 798 gene locus_tag LOCUS_36800 gene ugpC 1886 798 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975885.1 protein_id gnl|my_center|LOCUS_36800 1989 3020 gene locus_tag LOCUS_36810 gene cceR 1989 3020 CDS product LacI family DNA-binding transcriptional regulator CceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336932.1 protein_id gnl|my_center|LOCUS_36810 3169 3477 gene locus_tag LOCUS_36820 3169 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 3434 4360 gene locus_tag LOCUS_36830 3434 4360 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811668.1 protein_id gnl|my_center|LOCUS_36830 4501 4367 gene locus_tag LOCUS_36840 4501 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 5332 4586 gene locus_tag LOCUS_36850 5332 4586 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_36850 5444 6694 gene locus_tag LOCUS_36860 5444 6694 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170159.1 protein_id gnl|my_center|LOCUS_36860 8266 6833 gene locus_tag LOCUS_36870 8266 6833 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448980.1 protein_id gnl|my_center|LOCUS_36870 8764 8348 gene locus_tag LOCUS_36880 8764 8348 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331447.1 protein_id gnl|my_center|LOCUS_36880 8991 8761 gene locus_tag LOCUS_36890 8991 8761 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331446.1 protein_id gnl|my_center|LOCUS_36890 9775 9074 gene locus_tag LOCUS_36900 9775 9074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877732.1 protein_id gnl|my_center|LOCUS_36900 10527 9778 gene locus_tag LOCUS_36910 10527 9778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810082.1 protein_id gnl|my_center|LOCUS_36910 11102 10524 gene locus_tag LOCUS_36920 11102 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 >Feature sequence152 2395 1265 gene locus_tag LOCUS_36930 gene ribA 2395 1265 CDS product GTP cyclohydrolase II RibA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038822.1 protein_id gnl|my_center|LOCUS_36930 2678 3256 gene locus_tag LOCUS_36940 2678 3256 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037975.1 protein_id gnl|my_center|LOCUS_36940 4104 3265 gene locus_tag LOCUS_36950 4104 3265 CDS product trans-aconitate methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230076.1 protein_id gnl|my_center|LOCUS_36950 5168 4104 gene locus_tag LOCUS_36960 5168 4104 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168117700.1 protein_id gnl|my_center|LOCUS_36960 5566 5165 gene locus_tag LOCUS_36970 5566 5165 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031076.1 protein_id gnl|my_center|LOCUS_36970 6050 5598 gene locus_tag LOCUS_36980 6050 5598 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887982.1 protein_id gnl|my_center|LOCUS_36980 7080 6058 gene locus_tag LOCUS_36990 7080 6058 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_36990 7150 8985 gene locus_tag LOCUS_37000 gene mdoH 7150 8985 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919884.1 protein_id gnl|my_center|LOCUS_37000 8982 9740 gene locus_tag LOCUS_37010 8982 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 9753 10730 gene locus_tag LOCUS_37020 9753 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 >Feature sequence153 379 591 gene locus_tag LOCUS_37030 379 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 754 1209 gene locus_tag LOCUS_37040 754 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 1220 2626 gene locus_tag LOCUS_37050 1220 2626 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082900.1 protein_id gnl|my_center|LOCUS_37050 2724 3662 gene locus_tag LOCUS_37060 2724 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 3775 4767 gene locus_tag LOCUS_37070 3775 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 5147 4791 gene locus_tag LOCUS_37080 5147 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 5148 6119 gene locus_tag LOCUS_37090 5148 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 6229 7026 gene locus_tag LOCUS_37100 6229 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 9363 7549 gene locus_tag LOCUS_37110 9363 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 9557 9483 gene locus_tag LOCUS_t00370 9557 9483 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10801 9692 gene locus_tag LOCUS_37120 10801 9692 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036508.1 protein_id gnl|my_center|LOCUS_37120 >Feature sequence154 <1 525 gene locus_tag LOCUS_37130 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000723651.1:4-oxalomesaconate tautomerase 1858 725 gene locus_tag LOCUS_37140 1858 725 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385652.1 protein_id gnl|my_center|LOCUS_37140 2565 1966 gene locus_tag LOCUS_37150 2565 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 3560 2586 gene locus_tag LOCUS_37160 3560 2586 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808043.1 protein_id gnl|my_center|LOCUS_37160 4237 3683 gene locus_tag LOCUS_37170 4237 3683 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 protein_id gnl|my_center|LOCUS_37170 4461 4592 gene locus_tag LOCUS_37180 4461 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 4589 4816 gene locus_tag LOCUS_37190 4589 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 5641 4868 gene locus_tag LOCUS_37200 5641 4868 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 protein_id gnl|my_center|LOCUS_37200 5873 7075 gene locus_tag LOCUS_37210 5873 7075 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972134.1 protein_id gnl|my_center|LOCUS_37210 7181 7591 gene locus_tag LOCUS_37220 7181 7591 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338279.1 protein_id gnl|my_center|LOCUS_37220 7667 7876 gene locus_tag LOCUS_37230 7667 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 8522 7809 gene locus_tag LOCUS_37240 gene trmD 8522 7809 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528859.1 protein_id gnl|my_center|LOCUS_37240 9359 8658 gene locus_tag LOCUS_37250 9359 8658 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_37250 9873 9349 gene locus_tag LOCUS_37260 gene rimM 9873 9349 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528858.1 protein_id gnl|my_center|LOCUS_37260 10414 10055 gene locus_tag LOCUS_37270 gene rpsP 10414 10055 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529742.1 protein_id gnl|my_center|LOCUS_37270 10724 10461 gene locus_tag LOCUS_37280 10724 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 >Feature sequence155 538 1530 gene locus_tag LOCUS_37290 gene dusB 538 1530 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161537076.1 protein_id gnl|my_center|LOCUS_37290 1547 2689 gene locus_tag LOCUS_37300 1547 2689 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_37300 2710 3015 gene locus_tag LOCUS_37310 2710 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37310 3126 4139 gene locus_tag LOCUS_37320 3126 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37320 4409 4173 gene locus_tag LOCUS_37330 4409 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 4297 6480 gene locus_tag LOCUS_37340 4297 6480 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967572.1 protein_id gnl|my_center|LOCUS_37340 5523 5580 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6477 7844 gene locus_tag LOCUS_37350 6477 7844 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087262.1 protein_id gnl|my_center|LOCUS_37350 8054 8302 gene locus_tag LOCUS_37360 gene hfq 8054 8302 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007591126.1 protein_id gnl|my_center|LOCUS_37360 8308 9690 gene locus_tag LOCUS_37370 gene hflX 8308 9690 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967571.1 protein_id gnl|my_center|LOCUS_37370 >Feature sequence156 2112 1714 gene locus_tag LOCUS_37380 2112 1714 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_37380 2393 2112 gene locus_tag LOCUS_37390 2393 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 3082 2462 gene locus_tag LOCUS_37400 3082 2462 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889578.1 protein_id gnl|my_center|LOCUS_37400 3402 3079 gene locus_tag LOCUS_37410 3402 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 4267 3413 gene locus_tag LOCUS_37420 4267 3413 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969965.1 protein_id gnl|my_center|LOCUS_37420 5284 4391 gene locus_tag LOCUS_37430 5284 4391 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196715.1 protein_id gnl|my_center|LOCUS_37430 5532 5281 gene locus_tag LOCUS_37440 5532 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 6412 5963 gene locus_tag LOCUS_37450 gene gloA 6412 5963 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_37450 6566 8011 gene locus_tag LOCUS_37460 6566 8011 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085925.1 protein_id gnl|my_center|LOCUS_37460 8146 10791 gene locus_tag LOCUS_37470 gene pepN 8146 10791 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532626.1 protein_id gnl|my_center|LOCUS_37470 >Feature sequence157 741 391 gene locus_tag LOCUS_37480 741 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 2366 738 gene locus_tag LOCUS_37490 2366 738 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088540.1 protein_id gnl|my_center|LOCUS_37490 2976 2503 gene locus_tag LOCUS_37500 gene ptsN 2976 2503 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529589.1 protein_id gnl|my_center|LOCUS_37500 3635 3048 gene locus_tag LOCUS_37510 gene raiA 3635 3048 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083549.1 protein_id gnl|my_center|LOCUS_37510 5283 3754 gene locus_tag LOCUS_37520 gene rpoN 5283 3754 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083548.1 protein_id gnl|my_center|LOCUS_37520 6304 5507 gene locus_tag LOCUS_37530 gene lptB 6304 5507 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083547.1 protein_id gnl|my_center|LOCUS_37530 7163 6459 gene locus_tag LOCUS_37540 7163 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 7921 7160 gene locus_tag LOCUS_37550 7921 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 8294 8037 gene locus_tag LOCUS_37560 8294 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 8736 9215 gene locus_tag LOCUS_37570 8736 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 9158 10360 gene locus_tag LOCUS_37580 gene dapE 9158 10360 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968566.1 protein_id gnl|my_center|LOCUS_37580 >Feature sequence158 511 1827 gene locus_tag LOCUS_37590 511 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 2108 1947 gene locus_tag LOCUS_37600 2108 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975189.1 protein_id gnl|my_center|LOCUS_37600 4898 2481 gene locus_tag LOCUS_37610 4898 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 6063 4891 gene locus_tag LOCUS_37620 6063 4891 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_37620 7094 6141 gene locus_tag LOCUS_37630 7094 6141 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085322.1 protein_id gnl|my_center|LOCUS_37630 7294 7617 gene locus_tag LOCUS_37640 7294 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 7777 8091 gene locus_tag LOCUS_37650 7777 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 8672 8085 gene locus_tag LOCUS_37660 8672 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 8734 8760 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9050 8826 gene locus_tag LOCUS_37670 9050 8826 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974662.1 protein_id gnl|my_center|LOCUS_37670 9214 10242 gene locus_tag LOCUS_37680 9214 10242 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085318.1 protein_id gnl|my_center|LOCUS_37680 >Feature sequence159 1207 191 gene locus_tag LOCUS_37690 1207 191 CDS product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970909.1 protein_id gnl|my_center|LOCUS_37690 1421 1209 gene locus_tag LOCUS_37700 1421 1209 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970908.1 protein_id gnl|my_center|LOCUS_37700 1883 1437 gene locus_tag LOCUS_37710 1883 1437 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972635.1 protein_id gnl|my_center|LOCUS_37710 2075 1890 gene locus_tag LOCUS_37720 2075 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 2050 2361 gene locus_tag LOCUS_37730 2050 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 3285 2374 gene locus_tag LOCUS_37740 3285 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 3867 3487 gene locus_tag LOCUS_37750 3867 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 3955 4200 gene locus_tag LOCUS_37760 3955 4200 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037403109.1 protein_id gnl|my_center|LOCUS_37760 4303 4656 gene locus_tag LOCUS_37770 4303 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 6878 4662 gene locus_tag LOCUS_37780 6878 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 7312 7034 gene locus_tag LOCUS_37790 7312 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 7869 7363 gene locus_tag LOCUS_37800 7869 7363 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247634.1 protein_id gnl|my_center|LOCUS_37800 9436 7967 gene locus_tag LOCUS_37810 9436 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 9881 9531 gene locus_tag LOCUS_37820 9881 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 10402 9878 gene locus_tag LOCUS_37830 10402 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 10698 10402 gene locus_tag LOCUS_37840 10698 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 >Feature sequence160 4 840 gene locus_tag LOCUS_37850 gene xdhC 4 840 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528239.1 protein_id gnl|my_center|LOCUS_37850 990 2525 gene locus_tag LOCUS_37860 990 2525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339411.1 protein_id gnl|my_center|LOCUS_37860 2518 3582 gene locus_tag LOCUS_37870 2518 3582 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_37870 3839 4762 gene locus_tag LOCUS_37880 3839 4762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_37880 4793 5875 gene locus_tag LOCUS_37890 4793 5875 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_37890 6545 6093 gene locus_tag LOCUS_37900 6545 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 6448 7320 gene locus_tag LOCUS_37910 6448 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37910 7497 8423 gene locus_tag LOCUS_37920 7497 8423 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_37920 8420 9421 gene locus_tag LOCUS_37930 8420 9421 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_37930 9414 10163 gene locus_tag LOCUS_37940 9414 10163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_37940 >Feature sequence161 327 1562 gene locus_tag LOCUS_37950 327 1562 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088242.1 protein_id gnl|my_center|LOCUS_37950 1740 2555 gene locus_tag LOCUS_37960 1740 2555 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383471.1 protein_id gnl|my_center|LOCUS_37960 2560 3633 gene locus_tag LOCUS_37970 2560 3633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383472.1 protein_id gnl|my_center|LOCUS_37970 3675 4721 gene locus_tag LOCUS_37980 3675 4721 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383473.1 protein_id gnl|my_center|LOCUS_37980 4873 5745 gene locus_tag LOCUS_37990 4873 5745 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383474.1 protein_id gnl|my_center|LOCUS_37990 5826 6014 gene locus_tag LOCUS_38000 5826 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 6142 6783 gene locus_tag LOCUS_38010 6142 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 6858 7439 gene locus_tag LOCUS_38020 6858 7439 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529427.1 protein_id gnl|my_center|LOCUS_38020 7448 8143 gene locus_tag LOCUS_38030 7448 8143 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066752.1 protein_id gnl|my_center|LOCUS_38030 8321 9070 gene locus_tag LOCUS_38040 8321 9070 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084195.1 protein_id gnl|my_center|LOCUS_38040 9075 10022 gene locus_tag LOCUS_38050 9075 10022 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084196.1 protein_id gnl|my_center|LOCUS_38050 >Feature sequence162 1389 1850 gene locus_tag LOCUS_38060 1389 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 1847 2830 gene locus_tag LOCUS_38070 1847 2830 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083614.1 protein_id gnl|my_center|LOCUS_38070 2830 4425 gene locus_tag LOCUS_38080 gene lnt 2830 4425 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 protein_id gnl|my_center|LOCUS_38080 4548 4961 gene locus_tag LOCUS_38090 4548 4961 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083612.1 protein_id gnl|my_center|LOCUS_38090 5083 6336 gene locus_tag LOCUS_38100 gene metK 5083 6336 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527900.1 protein_id gnl|my_center|LOCUS_38100 6478 7170 gene locus_tag LOCUS_38110 6478 7170 CDS product tRNA (guanosine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015007103.1 protein_id gnl|my_center|LOCUS_38110 8191 7145 gene locus_tag LOCUS_38120 8191 7145 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083306.1 protein_id gnl|my_center|LOCUS_38120 8573 9259 gene locus_tag LOCUS_38130 gene rimP 8573 9259 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083608.1 protein_id gnl|my_center|LOCUS_38130 >Feature sequence163 4133 1923 gene locus_tag LOCUS_38140 gene glyS 4133 1923 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384808.1 protein_id gnl|my_center|LOCUS_38140 4332 4982 gene locus_tag LOCUS_38150 4332 4982 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 protein_id gnl|my_center|LOCUS_38150 5466 4987 gene locus_tag LOCUS_38160 5466 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 6260 5463 gene locus_tag LOCUS_38170 6260 5463 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_38170 6999 6304 gene locus_tag LOCUS_38180 6999 6304 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_38180 7012 7069 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7747 7079 gene locus_tag LOCUS_38190 7747 7079 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920924.1 protein_id gnl|my_center|LOCUS_38190 7737 7904 gene locus_tag LOCUS_38200 7737 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 8018 8806 gene locus_tag LOCUS_38210 8018 8806 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480304.1 protein_id gnl|my_center|LOCUS_38210 9174 8803 gene locus_tag LOCUS_38220 9174 8803 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 protein_id gnl|my_center|LOCUS_38220 9820 9521 gene locus_tag LOCUS_38230 9820 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 10250 9882 gene locus_tag LOCUS_38240 10250 9882 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109280.1 protein_id gnl|my_center|LOCUS_38240 >Feature sequence164 409 1308 gene locus_tag LOCUS_38250 gene mutM 409 1308 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968531.1 protein_id gnl|my_center|LOCUS_38250 1869 1318 gene locus_tag LOCUS_38260 1869 1318 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974209.1 protein_id gnl|my_center|LOCUS_38260 2051 2824 gene locus_tag LOCUS_38270 2051 2824 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_38270 2832 3827 gene locus_tag LOCUS_38280 2832 3827 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186291.1 protein_id gnl|my_center|LOCUS_38280 4011 4277 gene locus_tag LOCUS_38290 gene rpsT 4011 4277 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241581.1 protein_id gnl|my_center|LOCUS_38290 5061 6596 gene locus_tag LOCUS_38300 gene dnaA 5061 6596 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083652.1 protein_id gnl|my_center|LOCUS_38300 6747 7862 gene locus_tag LOCUS_38310 gene dnaN 6747 7862 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083651.1 protein_id gnl|my_center|LOCUS_38310 7875 8999 gene locus_tag LOCUS_38320 gene recF 7875 8999 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083649.1 protein_id gnl|my_center|LOCUS_38320 >Feature sequence165 265 474 gene locus_tag LOCUS_38330 265 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 413 787 gene locus_tag LOCUS_38340 413 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 1020 1415 gene locus_tag LOCUS_38350 1020 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 4837 1430 gene locus_tag LOCUS_38360 4837 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 2479 2511 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5668 5054 gene locus_tag LOCUS_38370 5668 5054 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_38370 5936 6226 gene locus_tag LOCUS_38380 5936 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 6260 6805 gene locus_tag LOCUS_38390 6260 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 7197 6829 gene locus_tag LOCUS_38400 7197 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 7589 7233 gene locus_tag LOCUS_38410 7589 7233 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920807.1 protein_id gnl|my_center|LOCUS_38410 8158 7754 gene locus_tag LOCUS_38420 8158 7754 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974418.1 protein_id gnl|my_center|LOCUS_38420 8423 10072 gene locus_tag LOCUS_38430 gene pgm 8423 10072 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967369.1 protein_id gnl|my_center|LOCUS_38430 >Feature sequence166 674 1588 gene locus_tag LOCUS_38440 674 1588 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243788.1 protein_id gnl|my_center|LOCUS_38440 1807 2667 gene locus_tag LOCUS_38450 1807 2667 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 protein_id gnl|my_center|LOCUS_38450 2737 3030 gene locus_tag LOCUS_38460 2737 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 3818 3042 gene locus_tag LOCUS_38470 3818 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 4245 3889 gene locus_tag LOCUS_38480 4245 3889 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036007.1 protein_id gnl|my_center|LOCUS_38480 4573 4313 gene locus_tag LOCUS_38490 4573 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 4701 5885 gene locus_tag LOCUS_38500 4701 5885 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082409.1 protein_id gnl|my_center|LOCUS_38500 5979 6368 gene locus_tag LOCUS_38510 5979 6368 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090486.1 protein_id gnl|my_center|LOCUS_38510 6454 7563 gene locus_tag LOCUS_38520 gene leuB 6454 7563 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083334.1 protein_id gnl|my_center|LOCUS_38520 7783 8739 gene locus_tag LOCUS_38530 gene msrP 7783 8739 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_38530 8780 9355 gene locus_tag LOCUS_38540 8780 9355 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286291.1 protein_id gnl|my_center|LOCUS_38540 9429 9983 gene locus_tag LOCUS_38550 9429 9983 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390831.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence167 3096 1690 gene locus_tag LOCUS_38560 3096 1690 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339612.1 protein_id gnl|my_center|LOCUS_38560 3610 3089 gene locus_tag LOCUS_38570 3610 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 4218 5156 gene locus_tag LOCUS_38580 4218 5156 CDS product DUF4238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921407.1 protein_id gnl|my_center|LOCUS_38580 6692 5280 gene locus_tag LOCUS_38590 6692 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 6942 6673 gene locus_tag LOCUS_38600 6942 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 7359 7024 gene locus_tag LOCUS_38610 7359 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 7577 7359 gene locus_tag LOCUS_38620 7577 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 7953 7720 gene locus_tag LOCUS_38630 7953 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 8815 7961 gene locus_tag LOCUS_38640 8815 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 9252 9620 gene locus_tag LOCUS_38650 9252 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 >Feature sequence168 <1 991 gene locus_tag LOCUS_38660 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067399.1:acetate--CoA ligase 1007 1717 gene locus_tag LOCUS_38670 1007 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 4462 1727 gene locus_tag LOCUS_38680 4462 1727 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917916.1 protein_id gnl|my_center|LOCUS_38680 6053 4638 gene locus_tag LOCUS_38690 6053 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 6568 6050 gene locus_tag LOCUS_38700 6568 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 6896 7945 gene locus_tag LOCUS_38710 6896 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 <9617 7974 gene locus_tag LOCUS_38720 <9617 7974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640463.1:long-chain-acyl-CoA synthetase >Feature sequence169 1655 360 gene locus_tag LOCUS_38730 1655 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 2435 1917 gene locus_tag LOCUS_38740 2435 1917 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085233.1 protein_id gnl|my_center|LOCUS_38740 3096 2527 gene locus_tag LOCUS_38750 gene efp 3096 2527 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968469.1 protein_id gnl|my_center|LOCUS_38750 3211 4275 gene locus_tag LOCUS_38760 gene epmA 3211 4275 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918606.1 protein_id gnl|my_center|LOCUS_38760 4272 5339 gene locus_tag LOCUS_38770 4272 5339 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398801.1 protein_id gnl|my_center|LOCUS_38770 5393 5638 gene locus_tag LOCUS_38780 5393 5638 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 protein_id gnl|my_center|LOCUS_38780 5635 6021 gene locus_tag LOCUS_38790 5635 6021 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_38790 6036 6680 gene locus_tag LOCUS_38800 6036 6680 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971856.1 protein_id gnl|my_center|LOCUS_38800 6728 7468 gene locus_tag LOCUS_38810 gene pyrF 6728 7468 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083509.1 protein_id gnl|my_center|LOCUS_38810 7506 7793 gene locus_tag LOCUS_38820 7506 7793 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528591.1 protein_id gnl|my_center|LOCUS_38820 7795 8103 gene locus_tag LOCUS_38830 7795 8103 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083510.1 protein_id gnl|my_center|LOCUS_38830 8130 9230 gene locus_tag LOCUS_38840 8130 9230 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389784.1 protein_id gnl|my_center|LOCUS_38840 >Feature sequence170 392 1129 gene locus_tag LOCUS_38850 392 1129 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 protein_id gnl|my_center|LOCUS_38850 1131 3725 gene locus_tag LOCUS_38860 1131 3725 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083292.1 protein_id gnl|my_center|LOCUS_38860 3946 4722 gene locus_tag LOCUS_38870 3946 4722 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174871.1 protein_id gnl|my_center|LOCUS_38870 4823 5359 gene locus_tag LOCUS_38880 4823 5359 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083294.1 protein_id gnl|my_center|LOCUS_38880 5743 5375 gene locus_tag LOCUS_38890 5743 5375 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083295.1 protein_id gnl|my_center|LOCUS_38890 6394 6107 gene locus_tag LOCUS_38900 6394 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38900 6724 6419 gene locus_tag LOCUS_38910 6724 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38910 >Feature sequence171 563 1408 gene locus_tag LOCUS_38920 gene ntrB 563 1408 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967199.1 protein_id gnl|my_center|LOCUS_38920 1413 2297 gene locus_tag LOCUS_38930 1413 2297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 protein_id gnl|my_center|LOCUS_38930 2447 2935 gene locus_tag LOCUS_38940 gene cynS 2447 2935 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088475.1 protein_id gnl|my_center|LOCUS_38940 4288 2954 gene locus_tag LOCUS_38950 4288 2954 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089683.1 protein_id gnl|my_center|LOCUS_38950 4507 4301 gene locus_tag LOCUS_38960 4507 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 4639 5004 gene locus_tag LOCUS_38970 4639 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38970 5105 5614 gene locus_tag LOCUS_38980 5105 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 5581 5586 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5965 6891 gene locus_tag LOCUS_38990 5965 6891 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_38990 6888 7679 gene locus_tag LOCUS_39000 6888 7679 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 protein_id gnl|my_center|LOCUS_39000 <9235 7872 gene locus_tag LOCUS_39010 <9235 7872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389048.1:methyl-accepting chemotaxis protein >Feature sequence172 1060 713 gene locus_tag LOCUS_39020 1060 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 971 1717 gene locus_tag LOCUS_39030 971 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 1721 4201 gene locus_tag LOCUS_39040 1721 4201 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 protein_id gnl|my_center|LOCUS_39040 4249 4761 gene locus_tag LOCUS_39050 4249 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 5205 5876 gene locus_tag LOCUS_39060 5205 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 5934 6839 gene locus_tag LOCUS_39070 5934 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 6842 7285 gene locus_tag LOCUS_39080 6842 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211354814.1 protein_id gnl|my_center|LOCUS_39080 7282 8433 gene locus_tag LOCUS_39090 7282 8433 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368633.1 protein_id gnl|my_center|LOCUS_39090 8562 8927 gene locus_tag LOCUS_39100 8562 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 >Feature sequence173 827 4561 gene locus_tag LOCUS_39110 827 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 4857 7709 gene locus_tag LOCUS_39120 4857 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 7655 8383 gene locus_tag LOCUS_39130 7655 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 >Feature sequence174 212 925 gene locus_tag LOCUS_39140 212 925 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087915.1 protein_id gnl|my_center|LOCUS_39140 2308 995 gene locus_tag LOCUS_39150 2308 995 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087914.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39150 2666 2220 gene locus_tag LOCUS_39160 2666 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39160 2954 3316 gene locus_tag LOCUS_39170 2954 3316 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531776.1 protein_id gnl|my_center|LOCUS_39170 3507 3719 gene locus_tag LOCUS_39180 3507 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 3719 4102 gene locus_tag LOCUS_39190 3719 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 4209 5786 gene locus_tag LOCUS_39200 4209 5786 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973343.1 protein_id gnl|my_center|LOCUS_39200 5871 6263 gene locus_tag LOCUS_39210 5871 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 7562 6378 gene locus_tag LOCUS_39220 7562 6378 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969980.1 protein_id gnl|my_center|LOCUS_39220 7859 7617 gene locus_tag LOCUS_39230 7859 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 7756 8469 gene locus_tag LOCUS_39240 7756 8469 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_39240 >Feature sequence175 827 126 gene locus_tag LOCUS_39250 827 126 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 protein_id gnl|my_center|LOCUS_39250 1839 790 gene locus_tag LOCUS_39260 1839 790 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119543.1 protein_id gnl|my_center|LOCUS_39260 2938 1829 gene locus_tag LOCUS_39270 2938 1829 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243015.1 protein_id gnl|my_center|LOCUS_39270 3945 2935 gene locus_tag LOCUS_39280 3945 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 4181 5191 gene locus_tag LOCUS_39290 gene siaP 4181 5191 CDS product sialic acid TRAP transporter solute-binding subunit SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849284.1 protein_id gnl|my_center|LOCUS_39290 5195 5728 gene locus_tag LOCUS_39300 5195 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 5673 6875 gene locus_tag LOCUS_39310 5673 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39310 6772 6969 gene locus_tag LOCUS_39320 6772 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39320 7762 7412 gene locus_tag LOCUS_39330 7762 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 >Feature sequence176 1276 62 gene locus_tag LOCUS_39340 1276 62 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088989.1 protein_id gnl|my_center|LOCUS_39340 2058 1324 gene locus_tag LOCUS_39350 gene rutB 2058 1324 CDS product pyrimidine utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004443492.1 protein_id gnl|my_center|LOCUS_39350 2234 5059 gene locus_tag LOCUS_39360 2234 5059 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172711.1 protein_id gnl|my_center|LOCUS_39360 5260 6840 gene locus_tag LOCUS_39370 5260 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 6851 7525 gene locus_tag LOCUS_39380 6851 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 7753 7839 gene locus_tag LOCUS_t00380 7753 7839 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8531 7857 gene locus_tag LOCUS_39390 8531 7857 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965227.1 protein_id gnl|my_center|LOCUS_39390 >Feature sequence177 769 1716 gene locus_tag LOCUS_39400 769 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 1858 2094 gene locus_tag LOCUS_39410 1858 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39410 2765 2334 gene locus_tag LOCUS_39420 2765 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 3389 2769 gene locus_tag LOCUS_39430 3389 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 4324 3386 gene locus_tag LOCUS_39440 4324 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 4924 4391 gene locus_tag LOCUS_39450 4924 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 5408 4911 gene locus_tag LOCUS_39460 5408 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 6074 5925 gene locus_tag LOCUS_39470 6074 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 8053 8364 gene locus_tag LOCUS_39480 8053 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 >Feature sequence178 1096 233 gene locus_tag LOCUS_39490 1096 233 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815929.1 protein_id gnl|my_center|LOCUS_39490 1971 1093 gene locus_tag LOCUS_39500 1971 1093 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 protein_id gnl|my_center|LOCUS_39500 3283 1991 gene locus_tag LOCUS_39510 3283 1991 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 protein_id gnl|my_center|LOCUS_39510 4378 3335 gene locus_tag LOCUS_39520 4378 3335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940419.1 protein_id gnl|my_center|LOCUS_39520 5647 4502 gene locus_tag LOCUS_39530 gene pmi 5647 4502 CDS product mannose-6-phosphate isomerase Pmi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067084.1 protein_id gnl|my_center|LOCUS_39530 7810 5837 gene locus_tag LOCUS_39540 7810 5837 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253032.1 protein_id gnl|my_center|LOCUS_39540 8377 8180 gene locus_tag LOCUS_39550 8377 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 >Feature sequence179 1845 688 gene locus_tag LOCUS_39560 1845 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 2097 3626 gene locus_tag LOCUS_39570 gene glpK 2097 3626 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084227.1 protein_id gnl|my_center|LOCUS_39570 5304 3682 gene locus_tag LOCUS_39580 5304 3682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389764.1 protein_id gnl|my_center|LOCUS_39580 6131 5301 gene locus_tag LOCUS_39590 6131 5301 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389765.1 protein_id gnl|my_center|LOCUS_39590 7113 6136 gene locus_tag LOCUS_39600 7113 6136 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389766.1 protein_id gnl|my_center|LOCUS_39600 <8567 7143 gene locus_tag LOCUS_39610 <8567 7143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389767.1:ABC transporter substrate-binding protein >Feature sequence180 26 1594 gene locus_tag LOCUS_39620 26 1594 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061615.1 protein_id gnl|my_center|LOCUS_39620 1702 2559 gene locus_tag LOCUS_39630 1702 2559 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967356.1 protein_id gnl|my_center|LOCUS_39630 4027 2708 gene locus_tag LOCUS_39640 gene guaD 4027 2708 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975653.1 protein_id gnl|my_center|LOCUS_39640 4310 5899 gene locus_tag LOCUS_39650 gene xdhA 4310 5899 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255385.1 protein_id gnl|my_center|LOCUS_39650 5892 8246 gene locus_tag LOCUS_39660 gene xdhB 5892 8246 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975647.1 protein_id gnl|my_center|LOCUS_39660 >Feature sequence181 992 2164 gene locus_tag LOCUS_39670 992 2164 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844473.1 protein_id gnl|my_center|LOCUS_39670 3340 2174 gene locus_tag LOCUS_39680 3340 2174 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729558.1 protein_id gnl|my_center|LOCUS_39680 4463 3492 gene locus_tag LOCUS_39690 4463 3492 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531656.1 protein_id gnl|my_center|LOCUS_39690 4724 5773 gene locus_tag LOCUS_39700 4724 5773 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265893.1 protein_id gnl|my_center|LOCUS_39700 5911 6240 gene locus_tag LOCUS_39710 gene hspQ 5911 6240 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975546.1 protein_id gnl|my_center|LOCUS_39710 7098 6325 gene locus_tag LOCUS_39720 7098 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 >Feature sequence182 <1 3095 gene locus_tag LOCUS_39730 <1 3095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085810.1:error-prone DNA polymerase 3315 4967 gene locus_tag LOCUS_39740 3315 4967 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173726.1 protein_id gnl|my_center|LOCUS_39740 5166 6776 gene locus_tag LOCUS_39750 5166 6776 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173726.1 protein_id gnl|my_center|LOCUS_39750 5313 5359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5401 5482 gene locus_tag LOCUS_t00390 5401 5482 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6946 8022 gene locus_tag LOCUS_39760 6946 8022 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090644.1 protein_id gnl|my_center|LOCUS_39760 >Feature sequence183 <1 783 gene locus_tag LOCUS_39770 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891622.1:plasmid partitioning protein RepA 780 1781 gene locus_tag LOCUS_39780 gene repB 780 1781 CDS product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974971.1 protein_id gnl|my_center|LOCUS_39780 1995 3224 gene locus_tag LOCUS_39790 gene repC 1995 3224 CDS product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974840.1 protein_id gnl|my_center|LOCUS_39790 3585 3352 gene locus_tag LOCUS_39800 3585 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 3894 4157 gene locus_tag LOCUS_39810 3894 4157 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970757.1 protein_id gnl|my_center|LOCUS_39810 4284 4556 gene locus_tag LOCUS_39820 gene hupB 4284 4556 CDS product DNA-binding protein HupB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312721.1 protein_id gnl|my_center|LOCUS_39820 4724 5191 gene locus_tag LOCUS_39830 4724 5191 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533377.1 protein_id gnl|my_center|LOCUS_39830 6468 5269 gene locus_tag LOCUS_39840 6468 5269 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970303.1 protein_id gnl|my_center|LOCUS_39840 6882 6469 gene locus_tag LOCUS_39850 6882 6469 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970304.1 protein_id gnl|my_center|LOCUS_39850 7136 6879 gene locus_tag LOCUS_39860 7136 6879 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186447696.1 protein_id gnl|my_center|LOCUS_39860 7577 7347 gene locus_tag LOCUS_39870 7577 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 >Feature sequence184 220 1185 gene locus_tag LOCUS_39880 220 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 1245 2252 gene locus_tag LOCUS_39890 1245 2252 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086616.1 protein_id gnl|my_center|LOCUS_39890 2435 3613 gene locus_tag LOCUS_39900 gene zapE 2435 3613 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528845.1 protein_id gnl|my_center|LOCUS_39900 3823 4422 gene locus_tag LOCUS_39910 3823 4422 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140192.1 protein_id gnl|my_center|LOCUS_39910 5293 5389 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5709 6905 gene locus_tag LOCUS_39920 gene sucC 5709 6905 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083287.1 protein_id gnl|my_center|LOCUS_39920 6909 7133 gene locus_tag LOCUS_39930 6909 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 7133 8017 gene locus_tag LOCUS_39940 gene sucD 7133 8017 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083285.1 protein_id gnl|my_center|LOCUS_39940 >Feature sequence185 524 126 gene locus_tag LOCUS_39950 524 126 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532615.1 protein_id gnl|my_center|LOCUS_39950 778 1047 gene locus_tag LOCUS_39960 778 1047 CDS product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532614.1 protein_id gnl|my_center|LOCUS_39960 1159 1581 gene locus_tag LOCUS_39970 gene ndk 1159 1581 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086893.1 protein_id gnl|my_center|LOCUS_39970 2015 1671 gene locus_tag LOCUS_39980 2015 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 2578 2024 gene locus_tag LOCUS_39990 2578 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39990 2730 4817 gene locus_tag LOCUS_40000 2730 4817 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088785.1 protein_id gnl|my_center|LOCUS_40000 4918 5280 gene locus_tag LOCUS_40010 4918 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 5986 5264 gene locus_tag LOCUS_40020 5986 5264 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090573.1 protein_id gnl|my_center|LOCUS_40020 6102 6890 gene locus_tag LOCUS_40030 6102 6890 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090575.1 protein_id gnl|my_center|LOCUS_40030 <8076 7230 gene locus_tag LOCUS_40040 <8076 7230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006312859.1:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence186 <1 1186 gene locus_tag LOCUS_40050 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004533992.1:deoxyribodipyrimidine photo-lyase 1991 1197 gene locus_tag LOCUS_40060 1991 1197 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975520.1 protein_id gnl|my_center|LOCUS_40060 2188 2904 gene locus_tag LOCUS_40070 2188 2904 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_40070 2963 3820 gene locus_tag LOCUS_40080 gene sseA 2963 3820 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_40080 4005 5552 gene locus_tag LOCUS_40090 4005 5552 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070148.1 protein_id gnl|my_center|LOCUS_40090 5613 6125 gene locus_tag LOCUS_40100 5613 6125 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061809.1 protein_id gnl|my_center|LOCUS_40100 7275 6151 gene locus_tag LOCUS_40110 7275 6151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 protein_id gnl|my_center|LOCUS_40110 7936 7268 gene locus_tag LOCUS_40120 gene modB 7936 7268 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 protein_id gnl|my_center|LOCUS_40120 >Feature sequence187 785 363 gene locus_tag LOCUS_40130 785 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 1225 782 gene locus_tag LOCUS_40140 1225 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 1581 1222 gene locus_tag LOCUS_40150 1581 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 2098 1565 gene locus_tag LOCUS_40160 2098 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338065.1 protein_id gnl|my_center|LOCUS_40160 3693 2098 gene locus_tag LOCUS_40170 3693 2098 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140144.1 protein_id gnl|my_center|LOCUS_40170 4099 3668 gene locus_tag LOCUS_40180 4099 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 4244 4429 gene locus_tag LOCUS_40190 4244 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 4775 4407 gene locus_tag LOCUS_40200 4775 4407 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140048.1 protein_id gnl|my_center|LOCUS_40200 5146 4772 gene locus_tag LOCUS_40210 5146 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 5775 5146 gene locus_tag LOCUS_40220 5775 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 6246 5896 gene locus_tag LOCUS_40230 6246 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975493.1 protein_id gnl|my_center|LOCUS_40230 7416 6259 gene locus_tag LOCUS_40240 7416 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 7928 7428 gene locus_tag LOCUS_40250 7928 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 >Feature sequence188 231 581 gene locus_tag LOCUS_40260 231 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 2256 598 gene locus_tag LOCUS_40270 2256 598 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918921.1 protein_id gnl|my_center|LOCUS_40270 3665 2268 gene locus_tag LOCUS_40280 3665 2268 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918922.1 protein_id gnl|my_center|LOCUS_40280 3619 3768 gene locus_tag LOCUS_40290 3619 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 5035 3776 gene locus_tag LOCUS_40300 gene tyrS 5035 3776 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532167.1 protein_id gnl|my_center|LOCUS_40300 5417 5707 gene locus_tag LOCUS_40310 5417 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 6522 5704 gene locus_tag LOCUS_40320 6522 5704 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921367.1 protein_id gnl|my_center|LOCUS_40320 6846 6541 gene locus_tag LOCUS_40330 6846 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 7664 6876 gene locus_tag LOCUS_40340 7664 6876 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615265.1 protein_id gnl|my_center|LOCUS_40340 >Feature sequence189 2008 1214 gene locus_tag LOCUS_40350 2008 1214 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975597.1 protein_id gnl|my_center|LOCUS_40350 2248 3129 gene locus_tag LOCUS_40360 2248 3129 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808761.1 protein_id gnl|my_center|LOCUS_40360 4062 3166 gene locus_tag LOCUS_40370 4062 3166 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084956.1 protein_id gnl|my_center|LOCUS_40370 4278 5030 gene locus_tag LOCUS_40380 4278 5030 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084957.1 protein_id gnl|my_center|LOCUS_40380 5023 5859 gene locus_tag LOCUS_40390 5023 5859 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084958.1 protein_id gnl|my_center|LOCUS_40390 5856 6869 gene locus_tag LOCUS_40400 5856 6869 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497715.1 protein_id gnl|my_center|LOCUS_40400 7837 6866 gene locus_tag LOCUS_40410 7837 6866 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974036.1 protein_id gnl|my_center|LOCUS_40410 >Feature sequence190 116 343 gene locus_tag LOCUS_40420 116 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 348 2375 gene locus_tag LOCUS_40430 348 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 2260 3048 gene locus_tag LOCUS_40440 2260 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 2588 2604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3048 3500 gene locus_tag LOCUS_40450 3048 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 3576 3908 gene locus_tag LOCUS_40460 3576 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 4423 4022 gene locus_tag LOCUS_40470 4423 4022 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689781.1 protein_id gnl|my_center|LOCUS_40470 4901 4542 gene locus_tag LOCUS_40480 4901 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 4969 5193 gene locus_tag LOCUS_40490 4969 5193 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090956.1 protein_id gnl|my_center|LOCUS_40490 6135 5194 gene locus_tag LOCUS_40500 6135 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 6509 6135 gene locus_tag LOCUS_40510 6509 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 6811 6509 gene locus_tag LOCUS_40520 6811 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 7041 6820 gene locus_tag LOCUS_40530 7041 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 >Feature sequence191 1302 454 gene locus_tag LOCUS_40540 gene cysE 1302 454 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531333.1 protein_id gnl|my_center|LOCUS_40540 2247 1480 gene locus_tag LOCUS_40550 2247 1480 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967757.1 protein_id gnl|my_center|LOCUS_40550 2344 3327 gene locus_tag LOCUS_40560 2344 3327 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971701.1 protein_id gnl|my_center|LOCUS_40560 3401 3652 gene locus_tag LOCUS_40570 3401 3652 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602543.1 protein_id gnl|my_center|LOCUS_40570 3749 4942 gene locus_tag LOCUS_40580 3749 4942 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088337.1 protein_id gnl|my_center|LOCUS_40580 5983 4985 gene locus_tag LOCUS_40590 5983 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 5360 5380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6605 6012 gene locus_tag LOCUS_40600 6605 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 <7654 6605 gene locus_tag LOCUS_40610 <7654 6605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973285.1:hemolysin family protein >Feature sequence192 684 406 gene locus_tag LOCUS_40620 684 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 1025 951 gene locus_tag LOCUS_t00400 1025 951 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1196 1269 gene locus_tag LOCUS_t00410 1196 1269 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2156 1341 gene locus_tag LOCUS_40630 2156 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 2362 3060 gene locus_tag LOCUS_40640 2362 3060 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967576.1 protein_id gnl|my_center|LOCUS_40640 3223 4620 gene locus_tag LOCUS_40650 3223 4620 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087245.1 protein_id gnl|my_center|LOCUS_40650 4844 5398 gene locus_tag LOCUS_40660 4844 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 5647 5417 gene locus_tag LOCUS_40670 5647 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 6132 5647 gene locus_tag LOCUS_40680 6132 5647 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869958.1 protein_id gnl|my_center|LOCUS_40680 >Feature sequence193 506 111 gene locus_tag LOCUS_40690 506 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 2050 503 gene locus_tag LOCUS_40700 2050 503 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921433.1 protein_id gnl|my_center|LOCUS_40700 2846 1956 gene locus_tag LOCUS_40710 2846 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085808.1 protein_id gnl|my_center|LOCUS_40710 3244 2951 gene locus_tag LOCUS_40720 3244 2951 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390987.1 protein_id gnl|my_center|LOCUS_40720 3535 3245 gene locus_tag LOCUS_40730 3535 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 4639 3599 gene locus_tag LOCUS_40740 4639 3599 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_40740 4973 5680 gene locus_tag LOCUS_40750 4973 5680 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339223.1 protein_id gnl|my_center|LOCUS_40750 5749 7068 gene locus_tag LOCUS_40760 5749 7068 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086628.1 protein_id gnl|my_center|LOCUS_40760 >Feature sequence194 <1 595 gene locus_tag LOCUS_40770 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920956.1:efflux RND transporter permease subunit 634 1917 gene locus_tag LOCUS_40780 634 1917 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080787.1 protein_id gnl|my_center|LOCUS_40780 2114 3511 gene locus_tag LOCUS_40790 2114 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 3872 3522 gene locus_tag LOCUS_40800 3872 3522 CDS product DUF2185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921943.1 protein_id gnl|my_center|LOCUS_40800 4174 5073 gene locus_tag LOCUS_40810 4174 5073 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40810 6258 5119 gene locus_tag LOCUS_40820 6258 5119 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257505.1 protein_id gnl|my_center|LOCUS_40820 7235 6258 gene locus_tag LOCUS_40830 7235 6258 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 protein_id gnl|my_center|LOCUS_40830 >Feature sequence195 1224 304 gene locus_tag LOCUS_40840 1224 304 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_40840 1338 1889 gene locus_tag LOCUS_40850 1338 1889 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947825.1 protein_id gnl|my_center|LOCUS_40850 2353 2817 gene locus_tag LOCUS_40860 2353 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40860 2980 3444 gene locus_tag LOCUS_40870 2980 3444 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_40870 4388 3504 gene locus_tag LOCUS_40880 4388 3504 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113260.1 protein_id gnl|my_center|LOCUS_40880 4489 5100 gene locus_tag LOCUS_40890 gene gstA 4489 5100 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103353.1 protein_id gnl|my_center|LOCUS_40890 5097 5486 gene locus_tag LOCUS_40900 5097 5486 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920811.1 protein_id gnl|my_center|LOCUS_40900 5490 5747 gene locus_tag LOCUS_40910 5490 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 6137 5760 gene locus_tag LOCUS_40920 6137 5760 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640344.1 protein_id gnl|my_center|LOCUS_40920 6225 6545 gene locus_tag LOCUS_40930 6225 6545 CDS product YdhR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265742.1 protein_id gnl|my_center|LOCUS_40930 6581 7159 gene locus_tag LOCUS_40940 6581 7159 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 protein_id gnl|my_center|LOCUS_40940 >Feature sequence196 180 2093 gene locus_tag LOCUS_40950 180 2093 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087576.1 protein_id gnl|my_center|LOCUS_40950 3156 3428 gene locus_tag LOCUS_40960 3156 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 3820 3314 gene locus_tag LOCUS_40970 3820 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40970 4107 4589 gene locus_tag LOCUS_40980 4107 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 4697 5068 gene locus_tag LOCUS_40990 4697 5068 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084165.1 protein_id gnl|my_center|LOCUS_40990 5065 5793 gene locus_tag LOCUS_41000 5065 5793 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084166.1 protein_id gnl|my_center|LOCUS_41000 5808 6662 gene locus_tag LOCUS_41010 5808 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 6990 6628 gene locus_tag LOCUS_41020 6990 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 >Feature sequence197 2014 230 gene locus_tag LOCUS_41030 2014 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 3109 2093 gene locus_tag LOCUS_41040 3109 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 3543 4610 gene locus_tag LOCUS_41050 3543 4610 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763402.1 protein_id gnl|my_center|LOCUS_41050 4610 7219 gene locus_tag LOCUS_41060 4610 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 5937 5962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence198 1712 1467 gene locus_tag LOCUS_41070 1712 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 1711 2268 gene locus_tag LOCUS_41080 1711 2268 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965381.1 protein_id gnl|my_center|LOCUS_41080 2316 2981 gene locus_tag LOCUS_41090 2316 2981 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382970.1 protein_id gnl|my_center|LOCUS_41090 3002 3628 gene locus_tag LOCUS_41100 3002 3628 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528284.1 protein_id gnl|my_center|LOCUS_41100 3709 4767 gene locus_tag LOCUS_41110 3709 4767 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965071.1 protein_id gnl|my_center|LOCUS_41110 5737 4796 gene locus_tag LOCUS_41120 5737 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 5892 6776 gene locus_tag LOCUS_41130 gene dapF 5892 6776 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083308.1 protein_id gnl|my_center|LOCUS_41130 >Feature sequence199 <1 2047 gene locus_tag LOCUS_41140 <1 2047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087127.1:DNA topoisomerase IV subunit B 2435 2486 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3319 2624 gene locus_tag LOCUS_41150 3319 2624 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265848.1 protein_id gnl|my_center|LOCUS_41150 3482 5077 gene locus_tag LOCUS_41160 3482 5077 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087120.1 protein_id gnl|my_center|LOCUS_41160 5263 6321 gene locus_tag LOCUS_41170 5263 6321 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_41170 6726 6346 gene locus_tag LOCUS_41180 6726 6346 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 protein_id gnl|my_center|LOCUS_41180 >Feature sequence200 85 1209 gene locus_tag LOCUS_41190 85 1209 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456661.1 protein_id gnl|my_center|LOCUS_41190 1410 2249 gene locus_tag LOCUS_41200 gene fghA 1410 2249 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532024.1 protein_id gnl|my_center|LOCUS_41200 2360 2728 gene locus_tag LOCUS_41210 2360 2728 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_41210 2728 3972 gene locus_tag LOCUS_41220 2728 3972 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528639.1 protein_id gnl|my_center|LOCUS_41220 4771 4004 gene locus_tag LOCUS_41230 4771 4004 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530852.1 protein_id gnl|my_center|LOCUS_41230 5036 6073 gene locus_tag LOCUS_41240 5036 6073 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088034.1 protein_id gnl|my_center|LOCUS_41240 >Feature sequence201 2172 1003 gene locus_tag LOCUS_41250 2172 1003 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172666.1 protein_id gnl|my_center|LOCUS_41250 2398 3882 gene locus_tag LOCUS_41260 gene gatB 2398 3882 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975137.1 protein_id gnl|my_center|LOCUS_41260 4116 4622 gene locus_tag LOCUS_41270 4116 4622 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240736.1 protein_id gnl|my_center|LOCUS_41270 4731 5885 gene locus_tag LOCUS_41280 4731 5885 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967895.1 protein_id gnl|my_center|LOCUS_41280 5923 6414 gene locus_tag LOCUS_41290 5923 6414 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223560.1 protein_id gnl|my_center|LOCUS_41290 >Feature sequence202 1455 1461 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1577 2689 gene locus_tag LOCUS_41300 1577 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41300 2693 4135 gene locus_tag LOCUS_41310 2693 4135 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087315.1 protein_id gnl|my_center|LOCUS_41310 4140 5708 gene locus_tag LOCUS_41320 4140 5708 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087315.1 protein_id gnl|my_center|LOCUS_41320 5711 6307 gene locus_tag LOCUS_41330 5711 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 >Feature sequence203 <1 1030 gene locus_tag LOCUS_41340 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967063.1:DegQ family serine endoprotease 1118 2359 gene locus_tag LOCUS_41350 1118 2359 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531441.1 protein_id gnl|my_center|LOCUS_41350 2387 4375 gene locus_tag LOCUS_41360 2387 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 4604 4840 gene locus_tag LOCUS_41370 4604 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 6346 5018 gene locus_tag LOCUS_41380 6346 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 6487 6870 gene locus_tag LOCUS_41390 6487 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 6867 7058 gene locus_tag LOCUS_41400 6867 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 >Feature sequence204 204 1244 gene locus_tag LOCUS_41410 204 1244 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_41410 1362 1580 gene locus_tag LOCUS_41420 1362 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 1681 2007 gene locus_tag LOCUS_41430 1681 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 2447 2668 gene locus_tag LOCUS_41440 2447 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 4082 3051 gene locus_tag LOCUS_41450 gene cceR 4082 3051 CDS product LacI family DNA-binding transcriptional regulator CceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336932.1 protein_id gnl|my_center|LOCUS_41450 4185 5273 gene locus_tag LOCUS_41460 gene ugpC 4185 5273 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244133.1 protein_id gnl|my_center|LOCUS_41460 5297 6628 gene locus_tag LOCUS_41470 5297 6628 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832539.1 protein_id gnl|my_center|LOCUS_41470 >Feature sequence205 524 348 gene locus_tag LOCUS_41480 524 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 690 1100 gene locus_tag LOCUS_41490 690 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 1577 1182 gene locus_tag LOCUS_41500 gene rplS 1577 1182 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083318.1 protein_id gnl|my_center|LOCUS_41500 1943 2212 gene locus_tag LOCUS_41510 1943 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41510 2134 2643 gene locus_tag LOCUS_41520 2134 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41520 2747 3838 gene locus_tag LOCUS_41530 2747 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 3417 3495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4508 6217 gene locus_tag LOCUS_41540 4508 6217 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527788.1 protein_id gnl|my_center|LOCUS_41540 <6893 6272 gene locus_tag LOCUS_41550 <6893 6272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338605.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence206 646 801 gene locus_tag LOCUS_41560 646 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 970 2376 gene locus_tag LOCUS_41570 gene trmFO 970 2376 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531313.1 protein_id gnl|my_center|LOCUS_41570 3420 2524 gene locus_tag LOCUS_41580 3420 2524 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393387.1 protein_id gnl|my_center|LOCUS_41580 3940 3563 gene locus_tag LOCUS_41590 3940 3563 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975345.1 protein_id gnl|my_center|LOCUS_41590 4907 3960 gene locus_tag LOCUS_41600 gene secF 4907 3960 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087502.1 protein_id gnl|my_center|LOCUS_41600 6548 4938 gene locus_tag LOCUS_41610 gene secD 6548 4938 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087503.1 protein_id gnl|my_center|LOCUS_41610 >Feature sequence207 456 2483 gene locus_tag LOCUS_41620 456 2483 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965357.1 protein_id gnl|my_center|LOCUS_41620 2593 3510 gene locus_tag LOCUS_41630 2593 3510 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531227.1 protein_id gnl|my_center|LOCUS_41630 4413 3517 gene locus_tag LOCUS_41640 gene gluQRS 4413 3517 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970092.1 protein_id gnl|my_center|LOCUS_41640 4539 5180 gene locus_tag LOCUS_41650 4539 5180 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084189.1 protein_id gnl|my_center|LOCUS_41650 5970 5191 gene locus_tag LOCUS_41660 5970 5191 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532125.1 protein_id gnl|my_center|LOCUS_41660 6459 6136 gene locus_tag LOCUS_41670 6459 6136 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_41670 >Feature sequence208 1767 3323 gene locus_tag LOCUS_41680 1767 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 3328 4461 gene locus_tag LOCUS_41690 3328 4461 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256870.1 protein_id gnl|my_center|LOCUS_41690 4452 5150 gene locus_tag LOCUS_41700 4452 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41700 >Feature sequence209 1389 547 gene locus_tag LOCUS_41710 1389 547 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085968.1 protein_id gnl|my_center|LOCUS_41710 2794 1553 gene locus_tag LOCUS_41720 2794 1553 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 protein_id gnl|my_center|LOCUS_41720 3073 4239 gene locus_tag LOCUS_41730 3073 4239 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172832172.1 protein_id gnl|my_center|LOCUS_41730 4349 5506 gene locus_tag LOCUS_41740 4349 5506 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525155.1 protein_id gnl|my_center|LOCUS_41740 5521 6360 gene locus_tag LOCUS_41750 5521 6360 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089982.1 protein_id gnl|my_center|LOCUS_41750 >Feature sequence210 1913 297 gene locus_tag LOCUS_41760 gene rtcR 1913 297 CDS product DNA-binding transcriptional regulator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232919.1 protein_id gnl|my_center|LOCUS_41760 2291 3703 gene locus_tag LOCUS_41770 2291 3703 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_41770 4486 4070 gene locus_tag LOCUS_41780 4486 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972701.1 protein_id gnl|my_center|LOCUS_41780 5265 4606 gene locus_tag LOCUS_41790 5265 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 5344 6282 gene locus_tag LOCUS_41800 5344 6282 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_41800 >Feature sequence211 1088 210 gene locus_tag LOCUS_41810 1088 210 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528449.1 protein_id gnl|my_center|LOCUS_41810 1680 1186 gene locus_tag LOCUS_41820 1680 1186 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086610.1 protein_id gnl|my_center|LOCUS_41820 1863 3053 gene locus_tag LOCUS_41830 1863 3053 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086611.1 protein_id gnl|my_center|LOCUS_41830 3065 3652 gene locus_tag LOCUS_41840 3065 3652 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530297.1 protein_id gnl|my_center|LOCUS_41840 3697 4281 gene locus_tag LOCUS_41850 3697 4281 CDS product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086605.1 protein_id gnl|my_center|LOCUS_41850 5818 4397 gene locus_tag LOCUS_41860 5818 4397 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965348.1 protein_id gnl|my_center|LOCUS_41860 6345 5938 gene locus_tag LOCUS_41870 gene cueR 6345 5938 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816523.1 protein_id gnl|my_center|LOCUS_41870 >Feature sequence212 198 1460 gene locus_tag LOCUS_41880 198 1460 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089972.1 protein_id gnl|my_center|LOCUS_41880 1465 2682 gene locus_tag LOCUS_41890 1465 2682 CDS product URC4/urg3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089973.1 protein_id gnl|my_center|LOCUS_41890 2802 3443 gene locus_tag LOCUS_41900 gene upp 2802 3443 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089974.1 protein_id gnl|my_center|LOCUS_41900 4079 3564 gene locus_tag LOCUS_41910 4079 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 4467 4135 gene locus_tag LOCUS_41920 4467 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 5610 4639 gene locus_tag LOCUS_41930 5610 4639 CDS product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089253.1 protein_id gnl|my_center|LOCUS_41930 <6461 5675 gene locus_tag LOCUS_41940 <6461 5675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089254.1:tripartite tricarboxylate transporter permease >Feature sequence213 343 642 gene locus_tag LOCUS_41950 343 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 717 1070 gene locus_tag LOCUS_41960 717 1070 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008063.1 protein_id gnl|my_center|LOCUS_41960 1485 2990 gene locus_tag LOCUS_41970 1485 2990 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267691.1 protein_id gnl|my_center|LOCUS_41970 3062 5914 gene locus_tag LOCUS_41980 3062 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 6276 5974 gene locus_tag LOCUS_41990 6276 5974 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087513.1 protein_id gnl|my_center|LOCUS_41990 >Feature sequence214 439 1044 gene locus_tag LOCUS_42000 439 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 2388 1357 gene locus_tag LOCUS_42010 2388 1357 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811393.1 protein_id gnl|my_center|LOCUS_42010 2690 3718 gene locus_tag LOCUS_42020 2690 3718 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_42020 3795 5660 gene locus_tag LOCUS_42030 3795 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 >Feature sequence215 144 890 gene locus_tag LOCUS_42040 144 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 1321 1641 gene locus_tag LOCUS_42050 1321 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 2793 2020 gene locus_tag LOCUS_42060 2793 2020 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251864.1 protein_id gnl|my_center|LOCUS_42060 4382 2790 gene locus_tag LOCUS_42070 4382 2790 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970559.1 protein_id gnl|my_center|LOCUS_42070 5481 4408 gene locus_tag LOCUS_42080 5481 4408 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529706.1 protein_id gnl|my_center|LOCUS_42080 >Feature sequence216 1592 741 gene locus_tag LOCUS_42090 gene coxB 1592 741 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083989.1 protein_id gnl|my_center|LOCUS_42090 2034 2543 gene locus_tag LOCUS_42100 2034 2543 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185888.1 protein_id gnl|my_center|LOCUS_42100 2540 3151 gene locus_tag LOCUS_42110 2540 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 3526 4683 gene locus_tag LOCUS_42120 gene gcvT 3526 4683 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390799.1 protein_id gnl|my_center|LOCUS_42120 4720 5094 gene locus_tag LOCUS_42130 gene gcvH 4720 5094 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088496.1 protein_id gnl|my_center|LOCUS_42130 >Feature sequence217 <1 810 gene locus_tag LOCUS_42140 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967134.1:TRAP transporter large permease subunit 869 1864 gene locus_tag LOCUS_42150 869 1864 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647844.1 protein_id gnl|my_center|LOCUS_42150 1864 2532 gene locus_tag LOCUS_42160 1864 2532 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902513.1 protein_id gnl|my_center|LOCUS_42160 3337 2546 gene locus_tag LOCUS_42170 3337 2546 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_42170 4243 3350 gene locus_tag LOCUS_42180 4243 3350 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_42180 4712 4263 gene locus_tag LOCUS_42190 4712 4263 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 protein_id gnl|my_center|LOCUS_42190 5152 4721 gene locus_tag LOCUS_42200 5152 4721 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_42200 5373 5149 gene locus_tag LOCUS_42210 5373 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 5428 5778 gene locus_tag LOCUS_42220 5428 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 6221 5817 gene locus_tag LOCUS_42230 6221 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 >Feature sequence218 238 549 gene locus_tag LOCUS_42240 238 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 573 1973 gene locus_tag LOCUS_42250 gene lpdA 573 1973 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083281.1 protein_id gnl|my_center|LOCUS_42250 3170 1989 gene locus_tag LOCUS_42260 3170 1989 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_42260 4122 3253 gene locus_tag LOCUS_42270 gene folD 4122 3253 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388315.1 protein_id gnl|my_center|LOCUS_42270 4475 5803 gene locus_tag LOCUS_42280 4475 5803 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_42280 >Feature sequence219 736 95 gene locus_tag LOCUS_42290 736 95 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338458.1 protein_id gnl|my_center|LOCUS_42290 1617 733 gene locus_tag LOCUS_42300 1617 733 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085341.1 protein_id gnl|my_center|LOCUS_42300 1821 3158 gene locus_tag LOCUS_42310 1821 3158 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145923747.1 protein_id gnl|my_center|LOCUS_42310 3927 3418 gene locus_tag LOCUS_42320 3927 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 4050 5162 gene locus_tag LOCUS_42330 4050 5162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707669.1 protein_id gnl|my_center|LOCUS_42330 >Feature sequence220 195 644 gene locus_tag LOCUS_42340 195 644 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038729.1 protein_id gnl|my_center|LOCUS_42340 732 824 gene locus_tag LOCUS_t00420 732 824 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1036 1356 gene locus_tag LOCUS_42350 1036 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 1887 1441 gene locus_tag LOCUS_42360 gene rnhA 1887 1441 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532769.1 protein_id gnl|my_center|LOCUS_42360 3002 2037 gene locus_tag LOCUS_42370 3002 2037 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974730.1 protein_id gnl|my_center|LOCUS_42370 3980 3015 gene locus_tag LOCUS_42380 gene ispH 3980 3015 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084132.1 protein_id gnl|my_center|LOCUS_42380 4216 5571 gene locus_tag LOCUS_42390 4216 5571 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072019.1 protein_id gnl|my_center|LOCUS_42390 >Feature sequence221 1403 156 gene locus_tag LOCUS_42400 1403 156 CDS product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083432.1 protein_id gnl|my_center|LOCUS_42400 1469 2422 gene locus_tag LOCUS_42410 gene tesB 1469 2422 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067256.1 protein_id gnl|my_center|LOCUS_42410 2660 2998 gene locus_tag LOCUS_42420 2660 2998 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528889.1 protein_id gnl|my_center|LOCUS_42420 3031 4497 gene locus_tag LOCUS_42430 3031 4497 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965116.1 protein_id gnl|my_center|LOCUS_42430 >Feature sequence222 285 210 gene locus_tag LOCUS_t00430 285 210 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2816 411 gene locus_tag LOCUS_42440 2816 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 4017 2851 gene locus_tag LOCUS_42450 4017 2851 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_42450 4757 4341 gene locus_tag LOCUS_42460 4757 4341 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386170.1 protein_id gnl|my_center|LOCUS_42460 <5871 4848 gene locus_tag LOCUS_42470 <5871 4848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088354.1:methionine synthase >Feature sequence223 473 784 gene locus_tag LOCUS_42480 473 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 957 1295 gene locus_tag LOCUS_42490 957 1295 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529180.1 protein_id gnl|my_center|LOCUS_42490 1659 2255 gene locus_tag LOCUS_42500 1659 2255 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532582.1 protein_id gnl|my_center|LOCUS_42500 3287 2418 gene locus_tag LOCUS_42510 3287 2418 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971021.1 protein_id gnl|my_center|LOCUS_42510 4897 3419 gene locus_tag LOCUS_42520 4897 3419 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000324.1 protein_id gnl|my_center|LOCUS_42520 5717 4902 gene locus_tag LOCUS_42530 5717 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 5746 5822 gene locus_tag LOCUS_t00440 5746 5822 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence224 147 1304 gene locus_tag LOCUS_42540 147 1304 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265996.1 protein_id gnl|my_center|LOCUS_42540 1333 2907 gene locus_tag LOCUS_42550 1333 2907 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973887.1 protein_id gnl|my_center|LOCUS_42550 3678 2923 gene locus_tag LOCUS_42560 3678 2923 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529286.1 protein_id gnl|my_center|LOCUS_42560 3985 4662 gene locus_tag LOCUS_42570 3985 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 >Feature sequence225 1907 486 gene locus_tag LOCUS_42580 1907 486 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090196.1 protein_id gnl|my_center|LOCUS_42580 2665 1940 gene locus_tag LOCUS_42590 2665 1940 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090195.1 protein_id gnl|my_center|LOCUS_42590 3251 2745 gene locus_tag LOCUS_42600 3251 2745 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000365.1 protein_id gnl|my_center|LOCUS_42600 3454 4341 gene locus_tag LOCUS_42610 3454 4341 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 protein_id gnl|my_center|LOCUS_42610 5548 4472 gene locus_tag LOCUS_42620 5548 4472 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037017.1 protein_id gnl|my_center|LOCUS_42620 >Feature sequence226 3575 3994 gene locus_tag LOCUS_42630 gene mscL 3575 3994 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533610.1 protein_id gnl|my_center|LOCUS_42630 4117 5307 gene locus_tag LOCUS_42640 4117 5307 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968655.1 protein_id gnl|my_center|LOCUS_42640 >Feature sequence227 224 2209 gene locus_tag LOCUS_42650 224 2209 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532612.1 protein_id gnl|my_center|LOCUS_42650 3119 2349 gene locus_tag LOCUS_42660 3119 2349 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958120.1 protein_id gnl|my_center|LOCUS_42660 3335 3772 gene locus_tag LOCUS_42670 3335 3772 CDS product DUF1489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087921.1 protein_id gnl|my_center|LOCUS_42670 <5642 3828 gene locus_tag LOCUS_42680 <5642 3828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530233.1:VWA domain-containing protein 4994 5037 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence228 <1 3078 gene locus_tag LOCUS_42690 <1 3078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974882.1:lactate dehydrogenase 3361 5049 gene locus_tag LOCUS_42700 3361 5049 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974797.1 protein_id gnl|my_center|LOCUS_42700 5144 5617 gene locus_tag LOCUS_42710 5144 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974883.1 protein_id gnl|my_center|LOCUS_42710 >Feature sequence229 2718 2116 gene locus_tag LOCUS_42720 2718 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 4298 2805 gene locus_tag LOCUS_42730 4298 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 >Feature sequence230 1968 679 gene locus_tag LOCUS_42740 1968 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 2609 3367 gene locus_tag LOCUS_42750 2609 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 3364 3756 gene locus_tag LOCUS_42760 3364 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 4249 3839 gene locus_tag LOCUS_42770 4249 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 4552 4256 gene locus_tag LOCUS_42780 4552 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 5301 4552 gene locus_tag LOCUS_42790 5301 4552 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029046.1 protein_id gnl|my_center|LOCUS_42790 5516 5301 gene locus_tag LOCUS_42800 5516 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 >Feature sequence231 97 600 gene locus_tag LOCUS_42810 97 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 611 1648 gene locus_tag LOCUS_42820 611 1648 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973464.1 protein_id gnl|my_center|LOCUS_42820 2095 1667 gene locus_tag LOCUS_42830 2095 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 2753 2172 gene locus_tag LOCUS_42840 2753 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839432.1 protein_id gnl|my_center|LOCUS_42840 2817 3371 gene locus_tag LOCUS_42850 2817 3371 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456626.1 protein_id gnl|my_center|LOCUS_42850 3738 3388 gene locus_tag LOCUS_42860 3738 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 3849 5018 gene locus_tag LOCUS_42870 3849 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 >Feature sequence232 1027 392 gene locus_tag LOCUS_42880 1027 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 1599 1195 gene locus_tag LOCUS_42890 1599 1195 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372681.1 protein_id gnl|my_center|LOCUS_42890 3443 1812 gene locus_tag LOCUS_42900 3443 1812 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966695.1 protein_id gnl|my_center|LOCUS_42900 4626 3463 gene locus_tag LOCUS_42910 4626 3463 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_42910 <5476 4783 gene locus_tag LOCUS_42920 <5476 4783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088822.1:enoyl-CoA hydratase family protein >Feature sequence233 1263 667 gene locus_tag LOCUS_42930 1263 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42930 1318 1455 gene locus_tag LOCUS_42940 1318 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 3476 1470 gene locus_tag LOCUS_42950 3476 1470 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_42950 4461 3586 gene locus_tag LOCUS_42960 4461 3586 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193666682.1 protein_id gnl|my_center|LOCUS_42960 4957 4469 gene locus_tag LOCUS_42970 4957 4469 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 protein_id gnl|my_center|LOCUS_42970 5279 5022 gene locus_tag LOCUS_42980 gene grxC 5279 5022 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096057.1 protein_id gnl|my_center|LOCUS_42980 >Feature sequence234 677 1003 gene locus_tag LOCUS_42990 677 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 1029 1223 gene locus_tag LOCUS_43000 1029 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 1405 2223 gene locus_tag LOCUS_43010 1405 2223 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528003.1 protein_id gnl|my_center|LOCUS_43010 2234 3106 gene locus_tag LOCUS_43020 2234 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43020 3015 3605 gene locus_tag LOCUS_43030 3015 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43030 3758 4123 gene locus_tag LOCUS_43040 3758 4123 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398909.1 protein_id gnl|my_center|LOCUS_43040 >Feature sequence235 2904 3536 gene locus_tag LOCUS_43050 2904 3536 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328424.1 protein_id gnl|my_center|LOCUS_43050 3644 4210 gene locus_tag LOCUS_43060 3644 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 4549 4217 gene locus_tag LOCUS_43070 4549 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 <5329 4634 gene locus_tag LOCUS_43080 <5329 4634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289504.1:homoserine O-acetyltransferase >Feature sequence236 385 711 gene locus_tag LOCUS_43090 gene soxZ 385 711 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085518.1 protein_id gnl|my_center|LOCUS_43090 708 1202 gene locus_tag LOCUS_43100 708 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43100 1165 1488 gene locus_tag LOCUS_43110 1165 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43110 1168 1192 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2769 1492 gene locus_tag LOCUS_43120 2769 1492 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_43120 3444 2773 gene locus_tag LOCUS_43130 3444 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43130 3676 3714 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4772 3894 gene locus_tag LOCUS_43140 4772 3894 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063905.1 protein_id gnl|my_center|LOCUS_43140 >Feature sequence237 <1 997 gene locus_tag LOCUS_43150 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035256894.1:siroheme synthase CysG note possible pseudo, frameshifted 970 1251 gene locus_tag LOCUS_43160 970 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43160 1339 1773 gene locus_tag LOCUS_43170 1339 1773 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401957.1 protein_id gnl|my_center|LOCUS_43170 1770 2636 gene locus_tag LOCUS_43180 1770 2636 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850619.1 protein_id gnl|my_center|LOCUS_43180 2746 4065 gene locus_tag LOCUS_43190 gene rimO 2746 4065 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531645.1 protein_id gnl|my_center|LOCUS_43190 4520 4161 gene locus_tag LOCUS_43200 4520 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 >Feature sequence238 1746 160 gene locus_tag LOCUS_43210 1746 160 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088347.1 protein_id gnl|my_center|LOCUS_43210 2640 1867 gene locus_tag LOCUS_43220 2640 1867 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086612.1 protein_id gnl|my_center|LOCUS_43220 2908 4146 gene locus_tag LOCUS_43230 gene pepT 2908 4146 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170089.1 protein_id gnl|my_center|LOCUS_43230 4266 4652 gene locus_tag LOCUS_43240 4266 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 >Feature sequence239 2228 153 gene locus_tag LOCUS_43250 gene fusA 2228 153 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088153.1 protein_id gnl|my_center|LOCUS_43250 2735 2265 gene locus_tag LOCUS_43260 gene rpsG 2735 2265 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088154.1 protein_id gnl|my_center|LOCUS_43260 3177 2806 gene locus_tag LOCUS_43270 gene rpsL 3177 2806 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507760.1 protein_id gnl|my_center|LOCUS_43270 <5040 3708 gene locus_tag LOCUS_43280 <5040 3708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088158.1:DNA-directed RNA polymerase subunit beta' >Feature sequence240 1313 411 gene locus_tag LOCUS_43290 1313 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 1532 2314 gene locus_tag LOCUS_43300 1532 2314 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258845.1 protein_id gnl|my_center|LOCUS_43300 3007 2354 gene locus_tag LOCUS_43310 3007 2354 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089829.1 protein_id gnl|my_center|LOCUS_43310 3725 3021 gene locus_tag LOCUS_43320 3725 3021 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089830.1 protein_id gnl|my_center|LOCUS_43320 <5006 3939 gene locus_tag LOCUS_43330 <5006 3939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339362.1:caspase family protein >Feature sequence241 1361 1083 gene locus_tag LOCUS_43340 1361 1083 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970463.1 protein_id gnl|my_center|LOCUS_43340 1469 1858 gene locus_tag LOCUS_43350 1469 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 1909 2637 gene locus_tag LOCUS_43360 1909 2637 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 protein_id gnl|my_center|LOCUS_43360 2652 3314 gene locus_tag LOCUS_43370 2652 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_43370 3394 4038 gene locus_tag LOCUS_43380 3394 4038 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 protein_id gnl|my_center|LOCUS_43380 >Feature sequence242 1126 275 gene locus_tag LOCUS_43390 1126 275 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085492.1 protein_id gnl|my_center|LOCUS_43390 1443 2771 gene locus_tag LOCUS_43400 1443 2771 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390624.1 protein_id gnl|my_center|LOCUS_43400 3056 2983 gene locus_tag LOCUS_t00450 3056 2983 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3587 4132 gene locus_tag LOCUS_43410 3587 4132 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243986.1 protein_id gnl|my_center|LOCUS_43410 >Feature sequence243 374 1330 gene locus_tag LOCUS_43420 gene speB 374 1330 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055970141.1 protein_id gnl|my_center|LOCUS_43420 2532 1333 gene locus_tag LOCUS_43430 gene lhgO 2532 1333 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198032110.1 protein_id gnl|my_center|LOCUS_43430 3685 2714 gene locus_tag LOCUS_43440 3685 2714 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268235.1 protein_id gnl|my_center|LOCUS_43440 >Feature sequence244 706 2988 gene locus_tag LOCUS_43450 gene qqaR 706 2988 CDS product N-acyl homoserine lactone acylase QqaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_43450 3223 3147 gene locus_tag LOCUS_t00460 3223 3147 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3642 3268 gene locus_tag LOCUS_43460 3642 3268 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090561.1 protein_id gnl|my_center|LOCUS_43460 <4598 3635 gene locus_tag LOCUS_43470 <4598 3635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001082704.1:alcohol dehydrogenase catalytic domain-containing protein >Feature sequence245 518 330 gene locus_tag LOCUS_43480 518 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 1942 929 gene locus_tag LOCUS_43490 1942 929 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243032.1 protein_id gnl|my_center|LOCUS_43490 2931 2137 gene locus_tag LOCUS_43500 gene eutC 2931 2137 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037405.1 protein_id gnl|my_center|LOCUS_43500 4316 2928 gene locus_tag LOCUS_43510 4316 2928 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965750.1 protein_id gnl|my_center|LOCUS_43510 >Feature sequence246 2372 1878 gene locus_tag LOCUS_43520 2372 1878 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185819.1 protein_id gnl|my_center|LOCUS_43520 4441 2372 gene locus_tag LOCUS_43530 4441 2372 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389153.1 protein_id gnl|my_center|LOCUS_43530 >Feature sequence247 167 3124 gene locus_tag LOCUS_43540 167 3124 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083284.1 protein_id gnl|my_center|LOCUS_43540 3174 4412 gene locus_tag LOCUS_43550 gene odhB 3174 4412 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067151.1 protein_id gnl|my_center|LOCUS_43550 >Feature sequence248 789 328 gene locus_tag LOCUS_43560 gene rplM 789 328 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087726.1 protein_id gnl|my_center|LOCUS_43560 1491 1048 gene locus_tag LOCUS_43570 1491 1048 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975057.1 protein_id gnl|my_center|LOCUS_43570 1610 2422 gene locus_tag LOCUS_43580 1610 2422 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966315.1 protein_id gnl|my_center|LOCUS_43580 2494 3024 gene locus_tag LOCUS_43590 2494 3024 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_43590 >Feature sequence249 <1 1646 gene locus_tag LOCUS_43600 <1 1646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119558.1:FtsK/SpoIIIE domain-containing protein 2041 2496 gene locus_tag LOCUS_43610 2041 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 2483 3535 gene locus_tag LOCUS_43620 2483 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 3691 4035 gene locus_tag LOCUS_43630 3691 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 >Feature sequence250 157 1611 gene locus_tag LOCUS_43640 157 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 1638 2069 gene locus_tag LOCUS_43650 1638 2069 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197050165.1 protein_id gnl|my_center|LOCUS_43650 2291 2121 gene locus_tag LOCUS_43660 2291 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 2738 3652 gene locus_tag LOCUS_43670 2738 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 4080 3889 gene locus_tag LOCUS_43680 4080 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 >Feature sequence251 937 110 gene locus_tag LOCUS_43690 937 110 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971574.1 protein_id gnl|my_center|LOCUS_43690 1692 934 gene locus_tag LOCUS_43700 1692 934 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087625.1 protein_id gnl|my_center|LOCUS_43700 2314 1751 gene locus_tag LOCUS_43710 gene frr 2314 1751 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171750.1 protein_id gnl|my_center|LOCUS_43710 3204 2476 gene locus_tag LOCUS_43720 gene pyrH 3204 2476 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919787.1 protein_id gnl|my_center|LOCUS_43720 3592 3350 gene locus_tag LOCUS_43730 3592 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43730 <4185 3562 gene locus_tag LOCUS_43740 <4185 3562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006312544.1:translation elongation factor Ts note possible pseudo, frameshifted >Feature sequence252 38 691 gene locus_tag LOCUS_43750 38 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 1334 768 gene locus_tag LOCUS_43760 1334 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170077.1 protein_id gnl|my_center|LOCUS_43760 1964 1392 gene locus_tag LOCUS_43770 1964 1392 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456626.1 protein_id gnl|my_center|LOCUS_43770 3284 1968 gene locus_tag LOCUS_43780 3284 1968 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_43780 3608 3330 gene locus_tag LOCUS_43790 3608 3330 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970463.1 protein_id gnl|my_center|LOCUS_43790 3714 4103 gene locus_tag LOCUS_43800 3714 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 >Feature sequence253 3432 2281 gene locus_tag LOCUS_43810 gene rseP 3432 2281 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087622.1 protein_id gnl|my_center|LOCUS_43810 <4122 3454 gene locus_tag LOCUS_43820 <4122 3454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087623.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase >Feature sequence254 1838 558 gene locus_tag LOCUS_43830 1838 558 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972785.1 protein_id gnl|my_center|LOCUS_43830 2375 1842 gene locus_tag LOCUS_43840 2375 1842 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061677.1 protein_id gnl|my_center|LOCUS_43840 3435 2452 gene locus_tag LOCUS_43850 3435 2452 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529042.1 protein_id gnl|my_center|LOCUS_43850 3869 3528 gene locus_tag LOCUS_43860 3869 3528 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529048.1 protein_id gnl|my_center|LOCUS_43860 >Feature sequence255 1860 781 gene locus_tag LOCUS_43870 1860 781 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 protein_id gnl|my_center|LOCUS_43870 2944 1871 gene locus_tag LOCUS_43880 2944 1871 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719438.1 protein_id gnl|my_center|LOCUS_43880 <3937 3084 gene locus_tag LOCUS_43890 <3937 3084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009566968.1:ABC transporter ATP-binding protein >Feature sequence256 339 536 gene locus_tag LOCUS_43900 339 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 557 1474 gene locus_tag LOCUS_43910 557 1474 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064007.1 protein_id gnl|my_center|LOCUS_43910 1491 2171 gene locus_tag LOCUS_43920 1491 2171 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 protein_id gnl|my_center|LOCUS_43920 3186 2194 gene locus_tag LOCUS_43930 3186 2194 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923336.1 protein_id gnl|my_center|LOCUS_43930 3481 3885 gene locus_tag LOCUS_43940 3481 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 >Feature sequence257 760 1761 gene locus_tag LOCUS_43950 760 1761 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087139.1 protein_id gnl|my_center|LOCUS_43950 2391 1768 gene locus_tag LOCUS_43960 2391 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 >Feature sequence258 146 1285 gene locus_tag LOCUS_43970 146 1285 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975616.1 protein_id gnl|my_center|LOCUS_43970 1282 2052 gene locus_tag LOCUS_43980 1282 2052 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061519.1 protein_id gnl|my_center|LOCUS_43980 2120 2404 gene locus_tag LOCUS_43990 2120 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 >Feature sequence259 973 161 gene locus_tag LOCUS_44000 973 161 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_44000 1289 1017 gene locus_tag LOCUS_44010 1289 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 2126 1422 gene locus_tag LOCUS_44020 gene ubiE 2126 1422 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083584.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44020 1464 1498 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2592 2275 gene locus_tag LOCUS_44030 2592 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 <3772 2701 gene locus_tag LOCUS_44040 <3772 2701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084017.1:PAS domain-containing hybrid sensor histidine kinase/response regulator >Feature sequence260 268 603 gene locus_tag LOCUS_44050 268 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 724 3162 gene locus_tag LOCUS_44060 gene gyrB 724 3162 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390482.1 protein_id gnl|my_center|LOCUS_44060 <3712 3196 gene locus_tag LOCUS_44070 <3712 3196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072186.1:methyl-accepting chemotaxis protein >Feature sequence261 <1 718 gene locus_tag LOCUS_44080 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941616.1:ABC transporter permease 720 1421 gene locus_tag LOCUS_44090 720 1421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_44090 1643 2287 gene locus_tag LOCUS_44100 1643 2287 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 protein_id gnl|my_center|LOCUS_44100 3078 2356 gene locus_tag LOCUS_44110 3078 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 3144 3380 gene locus_tag LOCUS_44120 3144 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 >Feature sequence262 254 1672 gene locus_tag LOCUS_44130 254 1672 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943578.1 protein_id gnl|my_center|LOCUS_44130 2211 1780 gene locus_tag LOCUS_44140 2211 1780 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389405.1 protein_id gnl|my_center|LOCUS_44140 1826 1852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2344 2366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2913 2596 gene locus_tag LOCUS_44150 gene bigR 2913 2596 CDS product sulfite-sensing transcriptional repressor BigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967551.1 protein_id gnl|my_center|LOCUS_44150 >Feature sequence263 1228 365 gene locus_tag LOCUS_44160 1228 365 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393187.1 protein_id gnl|my_center|LOCUS_44160 2042 1380 gene locus_tag LOCUS_44170 2042 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 3227 2199 gene locus_tag LOCUS_44180 3227 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 >Feature sequence264 <1 1951 gene locus_tag LOCUS_44190 <1 1951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064243811.1:calcium-binding protein note possible pseudo, internal stop codon, frameshifted >Feature sequence265 1499 201 gene locus_tag LOCUS_44200 1499 201 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086762.1 protein_id gnl|my_center|LOCUS_44200 1675 1712 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1945 3093 gene locus_tag LOCUS_44210 1945 3093 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_44210 >Feature sequence266 541 567 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2309 1776 gene locus_tag LOCUS_44220 gene nusG 2309 1776 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707742.1 protein_id gnl|my_center|LOCUS_44220 2518 2324 gene locus_tag LOCUS_44230 gene secE 2518 2324 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007611620.1 protein_id gnl|my_center|LOCUS_44230 2891 2816 gene locus_tag LOCUS_t00470 2891 2816 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence267 18 2072 gene locus_tag LOCUS_44240 18 2072 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087902.1 protein_id gnl|my_center|LOCUS_44240 1618 1638 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence268 2197 11 gene locus_tag LOCUS_44250 2197 11 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085521.1 protein_id gnl|my_center|LOCUS_44250 2394 2212 gene locus_tag LOCUS_44260 2394 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44260 >Feature sequence269 <2903 911 gene locus_tag LOCUS_44270 <2903 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162491196.1:hydantoinase/oxoprolinase family protein >Feature sequence270 96 1772 gene locus_tag LOCUS_44280 96 1772 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389048.1 protein_id gnl|my_center|LOCUS_44280 >Feature sequence271 <1 533 gene locus_tag LOCUS_44290 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038966.1:FAD-containing oxidoreductase 657 1076 gene locus_tag LOCUS_44300 657 1076 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171645.1 protein_id gnl|my_center|LOCUS_44300 1184 2365 gene locus_tag LOCUS_44310 1184 2365 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087760.1 protein_id gnl|my_center|LOCUS_44310 >Feature sequence272 76 1062 gene locus_tag LOCUS_44320 76 1062 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966990.1 protein_id gnl|my_center|LOCUS_44320 1210 1752 gene locus_tag LOCUS_44330 1210 1752 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966991.1 protein_id gnl|my_center|LOCUS_44330 >Feature sequence273 466 573 gene locus_tag LOCUS_r00010 466 573 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 689 765 gene locus_tag LOCUS_t00480 689 765 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1047 1817 gene locus_tag LOCUS_44340 1047 1817 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338609.1 protein_id gnl|my_center|LOCUS_44340 2306 1827 gene locus_tag LOCUS_44350 2306 1827 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086914.1 protein_id gnl|my_center|LOCUS_44350 >Feature sequence274 4 825 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgttccccgcatgcgcggggatgaaccg 854 1129 gene locus_tag LOCUS_44360 854 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 1168 1344 gene locus_tag LOCUS_44370 1168 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 1396 1914 gene locus_tag LOCUS_44380 1396 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 >Feature sequence275 <1 725 gene locus_tag LOCUS_44390 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975791.1:c-type cytochrome >Feature sequence276 >Feature sequence277 <1 1074 gene locus_tag LOCUS_44400 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528868.1:3-isopropylmalate dehydratase large subunit 1120 1365 gene locus_tag LOCUS_44410 1120 1365 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_44410 1337 1603 gene locus_tag LOCUS_44420 1337 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 1600 1845 gene locus_tag LOCUS_44430 1600 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 1845 2297 gene locus_tag LOCUS_44440 1845 2297 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965074.1 protein_id gnl|my_center|LOCUS_44440 >Feature sequence278 >Feature sequence279 <1 585 gene locus_tag LOCUS_44450 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389044.1:alkaline phosphatase 531 1079 gene locus_tag LOCUS_44460 531 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 1193 1684 gene locus_tag LOCUS_44470 1193 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389045.1 protein_id gnl|my_center|LOCUS_44470 >Feature sequence280 609 741 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence281 1265 246 gene locus_tag LOCUS_44480 1265 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 <2045 1278 gene locus_tag LOCUS_44490 <2045 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967416.1:extracellular solute-binding protein >Feature sequence282 <1 1018 gene locus_tag LOCUS_44500 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037047.1:methyl-accepting chemotaxis protein >Feature sequence283 735 106 gene locus_tag LOCUS_44510 735 106 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087827.1 protein_id gnl|my_center|LOCUS_44510 1463 879 gene locus_tag LOCUS_44520 gene pyrE 1463 879 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919429.1 protein_id gnl|my_center|LOCUS_44520 1821 1549 gene locus_tag LOCUS_44530 1821 1549 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003468.1 protein_id gnl|my_center|LOCUS_44530 >Feature sequence284 <1849 325 gene locus_tag LOCUS_44540 <1849 325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530149.1:RNA polymerase sigma factor RpoD >Feature sequence285 <1 646 gene locus_tag LOCUS_44550 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109982274.1:methyl-accepting chemotaxis protein <1748 758 gene locus_tag LOCUS_44560 <1748 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389402.1:PAS domain-containing methyl-accepting chemotaxis protein >Feature sequence286 117 1307 gene locus_tag LOCUS_44570 117 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44570 1304 1558 gene locus_tag LOCUS_44580 1304 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44580 >Feature sequence287 >Feature sequence288 <1 542 gene locus_tag LOCUS_44590 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086608.1:ABC transporter ATP-binding protein 544 1248 gene locus_tag LOCUS_44600 544 1248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552530.1 protein_id gnl|my_center|LOCUS_44600 >Feature sequence289 >Feature sequence290 <1520 646 gene locus_tag LOCUS_44610 <1520 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162992307.1:Nramp family divalent metal transporter >Feature sequence291 233 934 gene locus_tag LOCUS_44620 233 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44620 >Feature sequence292 293 697 gene locus_tag LOCUS_44630 293 697 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_44630 1028 720 gene locus_tag LOCUS_44640 1028 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 >Feature sequence293 441 1214 gene locus_tag LOCUS_44650 441 1214 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383856.1 protein_id gnl|my_center|LOCUS_44650 >Feature sequence294 <1398 689 gene locus_tag LOCUS_44660 <1398 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530002.1:LysR family transcriptional regulator >Feature sequence295 <1362 177 gene locus_tag LOCUS_44670 <1362 177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946170.1:sugar porter family MFS transporter >Feature sequence296 >Feature sequence297 <1 988 gene locus_tag LOCUS_44680 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973486.1:copper oxidase >Feature sequence298 883 617 gene locus_tag LOCUS_44690 883 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44690 1119 940 gene locus_tag LOCUS_44700 1119 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 >Feature sequence299 <1259 662 gene locus_tag LOCUS_44710 <1259 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090670.1:phosphonate ABC transporter ATP-binding protein >Feature sequence300 466 44 gene locus_tag LOCUS_44720 466 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 1011 490 gene locus_tag LOCUS_44730 1011 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 >Feature sequence301 >Feature sequence302 <1242 408 gene locus_tag LOCUS_44740 <1242 408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531683.1:phage/plasmid primase, P4 family >Feature sequence303 >Feature sequence304 >Feature sequence305 >Feature sequence306 <1 986 gene locus_tag LOCUS_44750 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015367555.1:glutathione ABC transporter substrate-binding protein GsiB >Feature sequence307 1065 682 gene locus_tag LOCUS_44760 1065 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 >Feature sequence308 <1066 88 gene locus_tag LOCUS_44770 <1066 88 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391930.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein >Feature sequence309 >Feature sequence310 <1033 523 gene locus_tag LOCUS_44780 <1033 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967542.1:TolC family protein >Feature sequence311 <1 508 gene locus_tag LOCUS_44790 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967542.1:TolC family protein >Feature sequence312 <1 698 gene locus_tag LOCUS_44800 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529973.1:copper oxidase