COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..48231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 290..976 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186923.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene rpe CDS 1135..3498 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203850.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 3517..4803 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806952.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(4873..5973) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089665.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene hypE CDS complement(5970..7139) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene hypD CDS complement(7136..7405) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(7396..8754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(8793..9914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(9993..10340) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene hypA CDS complement(10367..10978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 11483..14341 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 14413..18231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 18228..19319 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 19381..21702 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550744.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 21831..22136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(22123..24249) product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014486102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(24571..25215) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931061.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene queE CDS complement(25212..26291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(26305..27018) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene queC CDS 27300..27803 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene rfaH CDS complement(27822..28271) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene rnhA CDS complement(28268..29083) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(29151..30101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(30259..30966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(31097..32095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(32104..32952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(33006..33257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(33272..33937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(33959..35380) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(35380..37542) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(37718..39301) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene ptsP CDS complement(39298..39567) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(39536..39991) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 40160..40672 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(40698..41027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 41377..41985 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(41998..42507) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064337.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(42628..42909) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene rpsQ CDS complement(42906..43118) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene rpmC CDS complement(43132..43548) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene rplP CDS complement(43563..44378) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene rpsC CDS complement(44395..44724) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925688.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene rplV CDS complement(44736..45011) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199273.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene rpsS CDS complement(45024..45848) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806907.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene rplB CDS complement(45851..46165) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199275.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene rplW CDS complement(46162..46725) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806905.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene rplD CDS complement(46725..47396) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene rplC CDS complement(47652..47963) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene rpsJ sequence002 source 1..36150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 458..1555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 1571..2203 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene coaE CDS 2172..2966 product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene zapD CDS complement(2974..3489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(3535..4431) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(4496..5725) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549958.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene argJ CDS complement(5788..8550) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194125.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene secA CDS complement(8737..8991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 9048..9275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 9272..9568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(9595..11490) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene glmS CDS 11609..12067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(12114..13685) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040718.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene glmU CDS 13750..14598 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522850.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene purU CDS 14655..15539 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530154.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 tRNA complement(15690..15764) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 15805..17310 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538734.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 17358..18563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(18560..19264) product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene yggS CDS 19298..20341 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene pilT CDS 20390..21526 product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 21533..22435 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(22499..23170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(23281..23772) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525681.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 23771..24721 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene rsmI CDS complement(24798..25187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 25329..25949 product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931044.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 25949..28621 product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(28709..29176) product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819714.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 29462..30016 product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 30257..31108 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(31102..31614) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene moaC CDS 31721..33301 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(33237..33875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(33902..34537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(34598..34912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(34933..35937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 sequence003 source 1..35907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(918..1412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(1409..1732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(1958..3439) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(3536..4927) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038750.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene trkA CDS complement(4924..7209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(7252..7749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(7770..8870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 note possible pseudo, frameshifted CDS complement(8834..9754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 note possible pseudo, frameshifted assembly_gap 8876..8943 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9931..11121) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(11176..11628) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660532.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(11762..12172) product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929528.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(12217..12741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 12923..14854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(14884..15642) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(15714..16466) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(16463..17062) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene gmhB CDS complement(17084..19303) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene glyS CDS complement(19330..20232) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene glyQ CDS complement(20362..22002) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040320.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene lnt CDS complement(22002..22820) product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(22895..23515) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 23739..25418 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027995529.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 25415..26404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(26442..27362) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886726.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene argC CDS 27755..28918 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene sucC CDS 28957..29472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 29469..29726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 29779..29979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 29976..30431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(30443..31294) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene pyrF CDS 31378..32148 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(33005..33433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(33402..34175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(34201..35907) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 sequence004 source 1..34519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(198..3374) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(3394..4581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(4584..5198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(5195..6352) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(6743..7087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(7163..8059) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930787.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene hflC CDS complement(8077..9474) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene hflK CDS complement(9551..10726) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene hflX CDS complement(10787..11032) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene hfq CDS complement(11114..12463) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene der CDS complement(12460..13536) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193323.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene bamB CDS 13439..13684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(13649..14383) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(14515..15810) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521334.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene hisS CDS complement(15803..17086) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene ispG CDS complement(17093..17962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(18033..18857) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209819.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene pilW CDS complement(18854..20050) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene rlmN CDS complement(20058..20483) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene ndk CDS complement(20546..21868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 note possible pseudo, frameshifted CDS complement(22000..22575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(22572..23618) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247551.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene rluD CDS 23652..24491 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813594.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(24532..25773) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(25930..27483) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(27621..28073) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene rplI CDS complement(28093..28374) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813094.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene rpsR CDS complement(28387..28740) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene priB CDS complement(28759..29121) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene rpsF CDS complement(29205..31283) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(31286..31558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(31558..32172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(32163..32471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(32560..33711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 33809..34363 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 sequence005 source 1..33808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..770 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030180.1:BREX-2 system adenine-specific DNA-methyltransferase PglX locus_tag LOCUS_01540 CDS 767..1255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 1255..2595 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390742.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 2592..4046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 4072..7761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031061.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 7758..10457 product BREX-2 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene pglZ CDS 10454..11764 product BREX system ATP-binding protein BrxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene brxD CDS 11761..13773 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031066.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 13795..14856 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012777536.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(14741..16090) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190165.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene miaB CDS complement(16152..17729) product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 17874..18791 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene argB CDS 18921..19529 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 19571..21367 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526128.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 21399..21854 product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 21934..24318 product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189629.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 24338..25573 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537877.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 25606..26487 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 26544..27308 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 27322..27816 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 27948..29465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 29800..30021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 30154..30474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815930.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(30468..30800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(30767..31774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(31784..32890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 misc_feature complement(32793..>33808) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946626.1:EAL domain-containing protein locus_tag LOCUS_01800 sequence006 source 1..33667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..439) product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201632.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 486..1448 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 1506..2702 product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene glcE CDS 2783..4075 product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene glcF CDS 4089..5255 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208091.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene alr CDS 5376..6131 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(6139..7779) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 7817..8113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(8378..8863) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(8893..9882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(9882..10493) product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(10490..10858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(10928..12220) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930578.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(12323..13294) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204885.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 13445..13870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(13894..15783) product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817018.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(16025..17869) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198363.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene recQ CDS complement(18044..18448) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528650.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(18453..19460) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene hemB CDS 19633..20283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(20258..22492) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 22670..23653 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(23678..24364) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031579.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 24559..25524 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 25694..26368 product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331451.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene ytfE CDS 26704..28407 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522947.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene argS CDS 28512..29087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 note possible pseudo, frameshifted CDS 29241..29882 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 30121..30789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 30786..31544 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815177.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene lptB CDS 31558..33309 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 sequence007 source 1..30252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1791..2570) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(2584..4191) product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201021.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(4335..5279) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065064.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene trxB CDS 5400..7943 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186104.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 8024..8785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 8808..10100 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930945.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(10121..10900) product IclR family transcriptional regulator PcaU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene pcaU CDS 11054..11983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 11980..12882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(12919..13752) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367002.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 14137..15156 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039422.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 15222..15716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 15716..17209 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(17237..18295) product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 18505..20043 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816835.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene lysS CDS complement(20115..21074) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195278.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene rpoH CDS complement(21271..21807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 21992..23101 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 23174..24607 product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763618.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(24633..25571) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(25571..26383) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 26512..26916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(26885..28105) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 28286..29620 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene ugpB sequence008 source 1..29365 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 334..1410 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452888.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene tilS CDS 1473..3038 product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087715.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 3035..3820 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 4011..5291 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 tRNA 5399..5491 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 5558..6334 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 6361..6879 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 6957..8792 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039964.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 8936..9904 product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 9936..11162 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088337.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(11213..12730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(12873..13376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(13403..13897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(13881..14495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 14614..15057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(15143..15781) product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(15765..16487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(16484..18301) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene nuoF CDS 18763..19278 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene msrA CDS 19328..20299 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531227.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(20391..22559) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene metG CDS 22754..23836 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene apbC CDS complement(23905..25269) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(25367..26509) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930437.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene bamC CDS complement(26584..27471) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene dapA CDS complement(27565..28755) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090686.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(29046..29174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(29171..29365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 sequence009 source 1..28927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(566..856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(1155..1328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(1636..4209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 note possible pseudo, internal stop codon, frameshifted CDS 4760..5737 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 5783..6079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 6282..6941 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 6969..7919 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687704.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene ylqF CDS 7928..8542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 tRNA 8564..8656 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 8680..9750 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526891.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 9808..10440 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene plsY CDS complement(10437..11411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(11422..11907) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 11952..12995 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene murB CDS 12989..14314 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040212.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 14734..15000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 15010..15249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(15286..16614) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688135.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene argG CDS complement(16628..16948) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 17138..18493 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528975.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene folC CDS 18560..19327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 19331..19816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 19836..21341 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene purF CDS 21348..22559 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 22556..23119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 note possible pseudo, frameshifted CDS 23127..23924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 note possible pseudo, frameshifted tRNA 24012..24087 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 24131..24206 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 24214..24290 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(24356..24775) product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene hicB CDS 24988..25284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 25547..26089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 26297..26452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 26780..28081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625898.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 sequence010 source 1..27574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(781..1464) product response regulator transcription factor EsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189647.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene esaR CDS complement(1493..3772) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(3864..5981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(5978..10189) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene rpoC CDS complement(10218..14336) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198365.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene rpoB CDS complement(14497..14874) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198366.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene rplL CDS complement(14920..15414) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199864.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene rplJ CDS complement(15714..16421) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene rplA CDS complement(16423..16854) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene rplK CDS 17150..18160 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 tRNA 18213..18289 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(18587..19225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098800.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(19245..20033) product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 20209..21810 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 21874..22578 product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 tRNA complement(22698..22773) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 22915..22990 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(23015..24478) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene purB CDS complement(24630..25118) product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(25111..25359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 misc_feature complement(25454..>27574) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939279.1:cation-transporting P-type ATPase locus_tag LOCUS_03100 sequence011 source 1..26674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(476..1585) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191705.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene lptG CDS complement(1591..2700) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene lptF CDS 2728..4296 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 4326..4814 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(4849..5283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(5509..6336) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813022.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(6689..7033) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192718.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(7030..7248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(7395..8822) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275136.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(8879..9217) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 9500..11062 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 11124..11267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 11267..13615 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(13621..16173) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197743.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene metH CDS complement(16384..17526) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene tyrS CDS 17756..19138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 19180..20283 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931222.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(20290..20655) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene erpA CDS complement(20882..21274) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene rpsI CDS complement(21271..21717) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene rplM CDS 21943..22884 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538077.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene rlmJ CDS complement(22956..23789) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene metF CDS complement(23904..25355) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038714.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene ahcY sequence012 source 1..26209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(158..1093) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(1103..2284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(2288..3460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(3438..5630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(5627..7084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(7354..8529) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191856.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(8595..9494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(9491..10630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(10764..11459) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930656.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(11478..12248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(12245..13543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(13557..14582) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(14599..15852) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(15968..17605) product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 17768..19036 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538218.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 19079..19516 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766799.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene msrB CDS 19513..19797 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240039.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 19799..20620 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(20680..21663) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037680.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(21660..22403) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(22528..22989) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(22982..24394) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813089.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(24467..25723) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene zapE CDS complement(25748..26209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 sequence013 source 1..25796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1118..1672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 1880..3268 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096859.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene zwf CDS 3355..4074 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene pgl CDS 4074..4484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 4481..5698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 5707..6426 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072451.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 6617..8119 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266656.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene pgi CDS 8143..10899 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene ppc CDS 10946..11695 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(11732..13447) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(13680..16277) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(16496..18205) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813682.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 18333..19316 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 19608..20510 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926448.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene prfB note possible pseudo, frameshifted CDS 20594..23326 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149504110.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene pepN CDS 23376..24425 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 24461..24676 product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193782.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 24754..25578 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 sequence014 source 1..25155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 1017..2567 product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535477.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene flhF CDS 2560..3300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 3359..3991 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(4021..4281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(4389..4712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(4816..5493) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene flgA CDS 5774..6202 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884694.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene flgB CDS 6215..6622 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene flgC CDS 6643..7299 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene flgD CDS 7331..8605 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767033.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene flgE CDS 8644..9387 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene flgF CDS 9418..10200 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197257.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene flgG CDS 10339..11013 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene flgH CDS 11190..12224 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817185.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 12227..12541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 12538..12930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 12943..14853 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene flgK CDS 14866..15816 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene flgL CDS complement(15932..17578) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene groL CDS complement(17622..18026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(18088..18651) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927521.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene ampD CDS 18801..19664 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186682.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene pssA CDS 19885..21435 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 21618..22904 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557110.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene pbpG CDS complement(22984..23790) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(23867..24718) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192823.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 sequence015 source 1..25137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 367..1542 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527290.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 1588..2949 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene rseP CDS 2963..5278 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene bamA CDS 5278..5826 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 5855..6895 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191858.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene lpxD CDS 6895..7347 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene fabZ CDS 7344..8183 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193051.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene lpxA CDS 8180..9124 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 9178..10275 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 10277..11467 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205135.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene lpxB CDS 11439..12071 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene rnhB CDS 12068..12838 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063752.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 12849..13001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 13002..14123 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene carA CDS 14116..17391 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene carB CDS 17517..17783 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185828.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene rpsO CDS 18017..20146 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene pnp CDS 20182..20943 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813996.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene tpiA CDS 20968..21351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 tRNA 21455..21539 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 21618..21977 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 22035..22514 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 22604..23185 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 23209..24462 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 24459..24998 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene nuoE sequence016 source 1..22819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039715.1:phosphoribosylformylglycinamidine synthase note possible pseudo, frameshifted locus_tag LOCUS_04280 CDS 1632..3344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 note possible pseudo, frameshifted CDS 3313..4170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(4122..5315) product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(5316..6368) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 6577..7584 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191597.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene mltG CDS 7581..8297 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene tmk CDS 8294..9301 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 9298..9663 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 9680..10510 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 10570..11136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 11299..11757 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064650.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 12134..13270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 note possible pseudo, frameshifted CDS 13392..14042 product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 14131..14958 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085932.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 14996..15658 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369874.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 15655..16368 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 16387..17166 product arginine/ornithine transport ATP-binding protein AotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085940.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene aotP CDS 17194..17844 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036216.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 17841..18629 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 19493..20743 product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036696.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 20743..20988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 note possible pseudo, frameshifted CDS complement(21295..21633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 21675..22415 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(22462..22818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 sequence017 source 1..22818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..1345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(1387..2964) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene rng CDS complement(3058..3687) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(3694..4161) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene rlmH CDS complement(4158..4502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 note possible pseudo, frameshifted CDS complement(4825..5598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(5595..6515) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526433.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene hemF CDS complement(6512..7804) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186246.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene purD CDS complement(7801..8529) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930861.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(8694..9023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(9020..9703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(9716..11749) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071676851.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(11840..13333) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123272.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene sbcB CDS 13505..14476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(14527..15471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(15452..16774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(16853..17191) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene clpS CDS complement(17283..18536) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814059.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene icd CDS 18663..19232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(19293..20501) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(20505..21269) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(21266..22639) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670439.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 sequence018 source 1..22685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..522 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193445.1:fatty acid desaturase locus_tag LOCUS_04750 CDS 735..2111 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(2124..2963) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 2975..4342 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 4390..5181 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 5308..6324 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 6324..7175 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945656.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 assembly_gap 6332..6366 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7193..8074 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240501.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(9030..10226) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(10259..11410) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene moaA CDS 11541..12080 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930982.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene ppa CDS 12126..14069 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 14236..14574 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 14577..15053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(15126..15752) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185518.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(15809..16768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 assembly_gap 16392..16406 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16987..18765 product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 18789..19280 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene ilvN CDS 19345..20361 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene ilvC CDS 20396..21151 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 sequence019 source 1..22373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2391..2690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 2766..4043 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209421240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene hemA CDS 4051..5166 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807618.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene prfA CDS 5348..6115 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036071.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene prmC CDS complement(6153..6569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 note possible pseudo, frameshifted CDS complement(6566..7624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 note possible pseudo, frameshifted CDS 7834..8046 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene rpsU CDS 8268..9158 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene murI CDS complement(9199..10530) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene pmbA CDS 10684..11355 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene yjgA CDS 11352..11951 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094685.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene mog CDS complement(12050..12823) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene cysE CDS complement(12835..13710) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 14148..14990 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(15058..15687) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036286.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 note possible pseudo, frameshifted CDS complement(15917..16099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 16098..18839 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene mutS CDS 18916..19614 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 19628..21100 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 misc_feature complement(21158..>22373) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193522.1:phosphoenolpyruvate synthase locus_tag LOCUS_05140 sequence020 source 1..22007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..576 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000992642.1:purine nucleoside phosphorylase YfiH locus_tag LOCUS_05150 CDS complement(493..951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 1499..2878 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene phaC note possible pseudo, frameshifted CDS 2920..4098 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 4137..4874 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(4901..6358) product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene hpnE CDS complement(6396..7262) product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene hpnD CDS complement(7310..10453) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(10475..11683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(11680..12603) product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene hpnC tRNA 12736..12822 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 12897..14207 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193941.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene tig CDS 14211..14822 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193408.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene clpP CDS 14933..16204 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene clpX CDS 16343..18784 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene lon tRNA 18960..19035 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 19038..19111 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 19165..19240 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(19422..20963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 note possible pseudo, internal stop codon, frameshifted misc_feature complement(21076..>22007) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814736.1:hydroxyacylglutathione hydrolase locus_tag LOCUS_05300 sequence021 source 1..21974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1268..2614) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene glmM CDS complement(2646..3605) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene folP CDS complement(3602..5518) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809623.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene ftsH CDS complement(5641..6339) product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 6581..6730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 6797..8926 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(8931..9605) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene rpiA CDS 9795..10979 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193208.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(11086..12030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(12135..12824) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 13057..13614 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247882.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(13711..15093) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527146.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(15108..16523) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534924.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(16570..17826) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 17937..18263 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943418.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 18341..18796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 19052..19297 product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010433119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(19346..19609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 19509..21551 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065015.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene mutL sequence022 source 1..21047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..548 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000214241.1:ribosomal protein S18-alanine N-acetyltransferase locus_tag LOCUS_05500 CDS 545..1519 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(1543..2631) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(2628..3620) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(3634..4545) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815883.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(4568..5548) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065034.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(5709..7301) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814273.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(7414..7863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 note possible pseudo, frameshifted CDS complement(7860..9323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 note possible pseudo, frameshifted CDS complement(9587..10249) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(10268..12373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(12361..13056) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(13059..17240) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009241452.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 17333..20101 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522142.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene glnE CDS 20129..20428 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 misc_feature complement(20490..>21047) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931597.1:tripartite tricarboxylate transporter substrate binding protein locus_tag LOCUS_05650 sequence023 source 1..20870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(263..1477) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114990.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene chrA CDS complement(1538..2956) product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene umuC CDS complement(3004..3585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 3645..4484 product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382904.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 4481..5344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 5341..6072 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522050.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene mtgA CDS 6098..6646 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene ruvC CDS complement(6687..6878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(6892..7815) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814567.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene lpxC CDS complement(7905..8780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(8696..9028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 assembly_gap 8790..8816 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9069..10298) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene ftsA CDS complement(10312..11145) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(11150..12157) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(12154..13608) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene murC CDS complement(13605..14681) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039095.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene murG CDS complement(14678..15976) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene ftsW CDS complement(15973..17934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(17931..19109) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene mraY CDS complement(19099..20742) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene murF sequence024 source 1..20678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 544..651 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS 724..1779 product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204527.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 1787..2512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 2533..3402 product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010374294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 3572..3895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(3962..4945) product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974952.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(5054..6589) product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(6570..7244) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 7464..8522 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189458.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene recA CDS 8560..9063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 note possible pseudo, internal stop codon CDS complement(9064..10167) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184633.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 10296..11063 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667427.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 11060..13243 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930590.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(13247..14716) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524586.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene mnmE CDS complement(14738..16486) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524584.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene yidC CDS complement(16483..16767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(16760..17215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(17295..17768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 17819..19276 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040794.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene dnaA CDS 19432..20538 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene dnaN sequence025 source 1..20061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 669..1217 product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 1511..2521 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 2595..4226 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(4298..5161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 5373..6131 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537945.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 6250..7791 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138513118.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 7804..9903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 tRNA 10056..10143 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(10291..11895) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene purH CDS complement(11921..12169) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(12166..13224) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene dusB CDS 13452..13943 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815154.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(13970..14368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(14379..15182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(15254..16900) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814257.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene ettA CDS 17221..19050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 19061..19474 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688980.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene gloA misc_feature complement(19541..>20061) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065066.1:serine--tRNA ligase locus_tag LOCUS_06210 sequence026 source 1..20046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..989) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(1053..1517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(2149..3102) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084360451.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene prmA CDS complement(3092..4441) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194420.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene accC CDS complement(4455..4943) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene accB CDS 5092..6822 product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene pilB CDS 6867..8084 product type 4 pilus assembly protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216405.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene pilG CDS 8273..8407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 8558..10837 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161936834.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 10851..11930 product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 11927..13909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 13923..14768 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050725350.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(14796..16139) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(16136..17149) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(17156..17860) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(17857..18615) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(18747..20015) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 sequence027 source 1..19654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3..335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(386..640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(709..2811) product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(2808..3356) product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692554.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(3353..4045) product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(4078..4734) product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038334.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(4731..5669) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 6144..8462 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(8446..8781) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815340.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene cyaY CDS 9027..10319 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196768.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene lysA CDS complement(10330..11721) product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene ccsB CDS complement(11718..13880) product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(14059..14718) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 14855..15487 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene yihA tRNA complement(16012..16099) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 16502..17692 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925730.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene metK CDS complement(17776..18345) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene rfbC CDS complement(18395..19282) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene rfbA sequence028 source 1..19233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 773..1825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 1895..3721 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065097.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene lepA CDS 3736..4701 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene lepB CDS 4759..5103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 5103..5840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 5837..6991 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene era CDS 7000..7923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 8089..8805 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 8789..9040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 9022..10104 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193430.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene nagZ CDS complement(10197..11075) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene accD CDS complement(11117..11983) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene trpA CDS complement(11980..13248) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene trpB CDS complement(13221..14030) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528978.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(14031..17168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 17050..17337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(17465..18265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 note possible pseudo, frameshifted CDS complement(18247..18528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 note possible pseudo, frameshifted sequence029 source 1..18810 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1539..2414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(2296..3138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(3135..3497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(3494..4432) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938761.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene rsmH CDS complement(4443..4871) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene mraZ CDS complement(5155..6036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(6069..7406) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198316.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene hslU CDS complement(7410..7976) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene hslV CDS complement(7987..9606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(9772..10527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(10830..11930) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199061.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(12057..13070) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064714.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene xerC CDS complement(13190..13879) product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199066.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(14019..14927) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807183.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene dapF CDS complement(15009..15668) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927036.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 15852..16769 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532737.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(16759..18372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 sequence030 source 1..18728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(1046..3943) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190446.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene polA CDS 4025..4981 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 5014..5790 product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064051.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(5816..8170) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(8241..9059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(9056..9925) product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081090.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(10085..10468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(10528..11775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 note possible pseudo, frameshifted CDS 11834..12055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(12155..12745) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene orn CDS 12829..13926 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 13956..14864 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene rsgA CDS complement(14960..15901) product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(15965..16600) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550123.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 16748..17197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 17311..17622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(17673..18008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 sequence031 source 1..18376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1365..1568) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene rpoZ CDS complement(1607..2230) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070724.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene gmk CDS complement(2227..3132) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 3206..4219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 4216..5115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 5133..5921 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene rph CDS 5915..6547 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930449.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene rdgB CDS 6544..7764 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene hemW CDS 7885..8553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 8733..11510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(11507..13201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(13350..13871) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(13877..14500) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(14578..15159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 15434..16849 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene cysS CDS 16834..17478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 sequence032 source 1..18322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1683 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530052.1:thioredoxin family protein locus_tag LOCUS_07260 CDS 1691..2101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 2120..2554 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 2656..2847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 2886..4004 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene hemE CDS 4439..6628 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(6618..7640) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 7986..10055 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524472.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 10182..10658 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 10655..12559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(12573..12908) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(12905..13669) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(13671..14654) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene fmt CDS complement(14669..15235) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807300.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene def CDS 15522..16706 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 16713..17933 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene dprA sequence033 source 1..18274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 205..2325 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038717.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 2376..3323 product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 3419..3727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 3800..5128 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197240.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(5146..6321) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 6411..7202 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 7319..7543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 7825..8790 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene ttcA CDS complement(8814..9791) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 9884..10522 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(10572..11633) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene ruvB CDS complement(11646..12239) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814226.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene ruvA CDS 12270..13289 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 13286..13780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(13756..15792) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene mrdA note possible pseudo, frameshifted CDS complement(15822..16352) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene mreD CDS complement(16349..17287) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene mreC CDS complement(17307..17819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 sequence034 source 1..17710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 112..1803 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(2103..2576) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814554.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(2638..3561) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 3706..5349 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 5389..8421 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene uvrA CDS complement(8580..10397) product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 10627..12990 product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 13021..13851 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene otsB CDS 13848..14102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 14172..15365 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 15436..16986 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene gorA sequence035 source 1..17160 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..941 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816597.1:flagellar basal-body MS-ring/collar protein FliF locus_tag LOCUS_07710 CDS 983..1984 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene fliG CDS 1971..2687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 2743..4155 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene fliI CDS 4152..4622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 4619..5893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 6059..6601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 6650..7651 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene fliM CDS 7644..8054 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene fliN CDS 8100..8522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 8546..9319 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549847.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene fliP CDS 9356..9625 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene fliQ CDS 9640..10419 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene fliR CDS complement(10458..11087) product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene rqpR CDS complement(11093..12184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 12376..12879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 12948..13310 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 13380..15659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 15685..16521 product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 16528..17154 product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene cheD sequence036 source 1..17133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(189..3068) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(3310..3591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(3660..6191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 6230..6589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 6586..6930 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(6952..8484) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(8520..9677) product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene meaB CDS complement(9677..10063) product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(10090..10431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(10489..12723) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene scpA CDS 12938..13591 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038701.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 13885..14283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 tRNA 14326..14402 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 14425..15627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 assembly_gap 15227..15301 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence037 source 1..16609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1817..2014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(2047..2730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(2754..4151) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene ffh CDS 4186..4986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 4983..5249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 5317..6948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(6985..7938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 8045..10267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 10312..13593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(13613..14425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(14481..14921) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene tolR CDS complement(14982..15704) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene tolQ CDS complement(15701..16150) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene ybgC sequence038 source 1..16193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(343..1287) product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194565.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(1389..1634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(1832..2038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(2119..2682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(2609..2971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 3149..3808 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218867.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 3867..4922 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 4924..5607 product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 5629..6657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 6608..7057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 7061..7939 product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 7954..8904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(8964..9494) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(9505..9780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 10023..10238 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 10254..11870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 11874..14579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 sequence039 source 1..15541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1250 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259342.1:deoxyribodipyrimidine photo-lyase locus_tag LOCUS_08340 CDS complement(1247..6505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(6568..8058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(8071..8652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(8669..9031) product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene pilH CDS complement(9047..9448) product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene pilG CDS complement(9517..9825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 9861..10739 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 10759..12060 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene hemL CDS complement(12067..12240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(12352..13197) product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(13200..14699) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812393.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(14702..15007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 repeat_region 15307..15519 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agggtctatccccgcttgcgcgggggaacc sequence040 source 1..15285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 643..975 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380053.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene trxA CDS 1336..2598 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810577.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene rho CDS 2752..3006 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818624.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 3101..4825 product UDP phosphate-alpha-4-amino-4-deoxy-L-arabinose arabinosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(4859..6175) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene phoR CDS complement(6175..6900) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene phoB CDS complement(6897..7604) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193271.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene phoU CDS complement(7601..7741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 7990..8652 product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123659.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 8769..10760 product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(12177..14372) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185934.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene parE sequence041 source 1..15154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 260..1048 product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 1065..2003 product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533957.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 2000..2821 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 3022..4437 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene glnA CDS 4473..5210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 5220..6314 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene glnL CDS 6404..8032 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192209.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene ntrC CDS complement(8053..8880) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene xth CDS 9172..13449 product BREX system serine/threonine kinase PglW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031052.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene pglW sequence042 source 1..15062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(384..1496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 note possible pseudo, frameshifted CDS 1699..3045 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene argA CDS 3175..3381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(3665..4762) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930435.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 4912..5403 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(5425..5874) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene dut CDS complement(5890..7671) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812634.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(7668..8291) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(8436..9578) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567739.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(9769..11628) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene dxs CDS complement(11644..12606) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813107.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(12618..12863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 13119..14279 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 misc_feature complement(14288..>15062) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056459.1:NDP-sugar synthase locus_tag LOCUS_08800 sequence043 source 1..14993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(152..226) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(280..353) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(425..510) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(548..1321) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(1318..1623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 note possible pseudo, frameshifted CDS 1712..2062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(2075..3127) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035722.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene trpD CDS complement(3175..3753) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815390.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(3766..4110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(4107..5609) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064890.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene trpE CDS 5804..6394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(6424..8415) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene htpG CDS 8815..9066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 9378..9659 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 9670..9969 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 10246..10587 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 10611..10895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(11153..12265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(12326..13006) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527999.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 sequence044 source 1..14856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(911..1396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(1311..2180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 assembly_gap 1406..1433 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2299..2979) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene cheZ CDS complement(2976..3359) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene cheY CDS complement(3422..3748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 3855..4409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(4427..5287) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene motA CDS complement(5346..5636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(5633..6037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(6062..6373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(6425..8224) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene aspS CDS complement(8353..8658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(8799..10313) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene ubiB CDS complement(10384..10857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(10906..11907) product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(11932..12663) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene ubiE CDS complement(12767..13303) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550872.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 misc_feature complement(13300..>14856) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815152.1:FAD/FMN-binding oxidoreductase locus_tag LOCUS_09140 sequence045 source 1..14782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(636..1811) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194129.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(1805..3100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 note possible pseudo, internal stop codon CDS complement(3167..4729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 note possible pseudo, internal stop codon CDS 5001..5456 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201279.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene hisI CDS 5471..5908 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202813.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 5905..6279 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 6310..6669 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 6848..7114 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene tatA CDS 7174..7704 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199901.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene tatB CDS 7722..8513 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene tatC CDS complement(8564..9733) product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 9843..10028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 10086..10886 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 10913..11905 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399975.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene pdxA CDS 12066..12662 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene petA CDS 12683..14044 product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 sequence046 source 1..14383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1291 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809310.1:formate dehydrogenase subunit alpha locus_tag LOCUS_09320 CDS 1288..1587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(1630..2976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 3129..3869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 3790..4830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 4827..5561 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688682.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 5808..7118 product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 7238..7708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 7739..8734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 8719..9414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 9601..10983 product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459021.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 sequence047 source 1..13959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(383..1303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(1300..1488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(2115..3134) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene hrcA CDS 3148..4191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 4097..5479 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930962.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene recN CDS 5464..6333 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene rapZ CDS complement(6330..7412) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene mutY CDS complement(7423..9366) product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(9480..10295) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene mutM CDS 10417..12264 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 12282..12845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 12878..13771 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931311.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene ispE sequence048 source 1..13812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039238.1:polyphosphate kinase 1 locus_tag LOCUS_09550 CDS 1023..1496 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene sixA CDS complement(1506..2990) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene ppx CDS 3245..3457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 3454..3696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(3604..3924) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338944.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(3928..4188) product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 4342..5475 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009920631.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene dusA CDS 5539..7884 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(7930..10749) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(10880..11140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(11137..11526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(11649..12680) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528683.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 misc_feature complement(12673..>13812) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528682.1:cytochrome ubiquinol oxidase subunit I locus_tag LOCUS_09680 sequence049 source 1..13618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..1648) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene glpK CDS 1920..3545 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931050.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 3744..4112 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197951.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene rplN CDS 4124..4444 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene rplX CDS 4441..4986 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202757.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene rplE CDS 4995..5300 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene rpsN CDS 5321..5716 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene rpsH CDS 5741..6274 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224773.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene rplF CDS 6286..6654 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene rplR CDS 6669..7187 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene rpsE CDS 7200..7382 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene rpmD CDS 7396..7830 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene rplO CDS 7857..9176 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197940.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene secY CDS 9178..9396 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806927.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene infA CDS 9560..9925 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene rpsM CDS 9947..10351 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806930.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene rpsK CDS 10559..11182 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197926.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene rpsD CDS 11297..12283 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene rpoA CDS 12369..12776 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene rplQ tRNA 12800..12876 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 misc_feature complement(12999..>13618) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090667.1:phosphonate ABC transporter, permease protein PhnE locus_tag LOCUS_09880 sequence050 source 1..13482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 133..1593 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene argH CDS 1665..2507 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 2544..3734 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 tRNA 3794..3868 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(3916..5163) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035604.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 5477..6589 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(6719..7699) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(7804..8007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 7991..8560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 8557..10020 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309942.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 10060..11148 product DUF3616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037817.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 11193..11807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 11903..12700 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(12705..13388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 sequence051 source 1..13369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(820..1764) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 1916..3337 product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 3391..3717 product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 3779..5503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 5689..6606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(6572..6883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 6990..7394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 7469..7762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(7734..9119) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089662.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(9189..10673) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338263.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(10670..11575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(11617..13128) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089663.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 sequence052 source 1..13274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1017 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813370.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene pheA CDS 1032..1943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 note possible pseudo, frameshifted CDS 1985..4054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 4177..5856 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene rpsA CDS 5864..6163 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928906.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 6243..6533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 6523..7671 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene lapB CDS 7717..9351 product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 9348..11000 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 misc_feature complement(11017..>13274) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115850.1:aminomethyl-transferring glycine dehydrogenase locus_tag LOCUS_10230 sequence053 source 1..13239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(390..1577) product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1672..2412) product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(2491..2733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 2733..3182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 3265..4530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 note possible pseudo, frameshifted CDS 4533..6029 product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529973.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 6869..7237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 7274..8200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 8460..9122 product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194286.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene coq7 CDS complement(9157..9606) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808444.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 9987..11582 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815155.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene ilvA CDS complement(11658..11828) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810296.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene rpmG CDS complement(11849..12082) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene rpmB CDS complement(12354..13238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 sequence054 source 1..13170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1124..1534) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(1552..2301) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525409.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(2311..2520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(3235..4182) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 4368..5030 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 5091..5651 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973634.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(5732..6052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 6195..9770 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522462.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene dnaE CDS 9806..10057 product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971060.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 10041..10307 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971059.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(10314..10700) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071144.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(10841..11590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 11550..11864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(11861..12265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(12280..12567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(12699..13169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 sequence055 source 1..13010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5885..6697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 6937..8517 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 8584..9486 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 9567..10124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(10217..11158) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene trxA CDS 11404..11895 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188932.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene purE sequence056 source 1..12683 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 271..882 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 895..1392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 tRNA 1407..1482 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 1556..1867 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene rplU CDS 1881..2156 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807460.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene rpmA CDS 2324..3367 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene obgE CDS 3416..4597 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene proB CDS 4727..5050 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925868.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(5231..5803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(5863..6525) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194263.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 6682..8427 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814636.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 8435..9079 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(9112..9447) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene grxD CDS complement(9519..10778) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249381.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(10807..11763) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064107.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene argF misc_feature complement(11787..>12683) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064106.1:aspartate aminotransferase family protein locus_tag LOCUS_10750 sequence057 source 1..12636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 108..1346 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1405..2715 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 2715..4145 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene thrC CDS 4212..5564 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 5816..6565 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 6582..7514 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 7613..9403 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 9487..10431 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 tRNA 9930..10022 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(10455..10958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 11122..11376 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene moaD CDS 11379..11702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 11675..12004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 sequence058 source 1..12411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(727..1395) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1448..2083) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(2100..2972) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470590.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(2983..3837) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 3955..5520 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064095.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene murJ CDS complement(5559..6611) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene purM CDS 6691..7860 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 7867..8562 product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929704.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene hda CDS 8626..9225 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 9222..10919 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene pcnB CDS 10947..11510 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(11527..12159) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814302.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene pdxH sequence059 source 1..12301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 157..1386 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1389..2516 product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 2597..3595 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 3592..4548 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205164.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 4553..5176 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 5187..5738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 5738..6121 product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524671.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 6111..6728 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 6739..8223 product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809435.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 8220..9215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 9154..10203 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 10547..11902 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039905.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(11904..12251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 note possible pseudo, frameshifted sequence060 source 1..11649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 237..653 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene nirD CDS 665..3604 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 3634..4611 product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195270.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene ybiB CDS 4615..5469 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198742.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene cobA CDS complement(5623..6588) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186453.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene ispH CDS complement(6588..7058) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 7072..7734 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185928.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene radC CDS complement(7756..9351) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389171.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene ahpF CDS complement(9428..9991) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene ahpC misc_feature complement(10138..>11649) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704254.1:CoA-acylating methylmalonate-semialdehyde dehydrogenase locus_tag LOCUS_11220 sequence061 source 1..11423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1255..2265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 2267..2740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 2737..6153 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(6198..8117) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(8158..8820) product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040404.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 9253..9591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 9935..10900 product IS1595-like element ISAhy1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706088.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 sequence062 source 1..11290 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2187 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814429.1:LPS-assembly protein LptD locus_tag LOCUS_11300 CDS 2180..3610 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 3626..4531 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189099.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene rsmA CDS complement(4528..5064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(5369..7696) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194063.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(7842..8747) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(8744..9313) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 9564..10376 product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 10456..10782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 sequence063 source 1..11196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1322..3271) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901007.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(3316..3729) product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331362.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene vapC CDS complement(3734..3985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(4104..5366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(5345..7525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 7548..7736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 7804..9252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 tRNA complement(8270..8357) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(9292..10551) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813884.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 misc_feature complement(10575..>11196) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199523.1:two-component system response regulator OmpR locus_tag LOCUS_11470 sequence064 source 1..11119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1481..2299 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192738.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 3554..5023 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720742.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(5102..6721) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(6723..6992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(7158..7874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(7861..8763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(8750..9880) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene cobT misc_feature complement(9913..>11119) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012695322.1:cobyric acid synthase locus_tag LOCUS_11550 sequence065 source 1..11115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 598..1011 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1023..1448 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190057.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene nikR CDS 1405..1692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1693..1920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 1956..2687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 2666..3391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 3391..4335 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 4332..5015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 5020..5301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 5298..5798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 note possible pseudo, frameshifted CDS 5802..6515 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(6617..6829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 6958..7362 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526841.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 tRNA 7418..7494 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 7720..8922 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene pcaF CDS complement(8942..10447) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063671.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 misc_feature complement(10475..>11115) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389759.1:CaiB/BaiF CoA-transferase family protein locus_tag LOCUS_11710 sequence066 source 1..10881 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 443..1639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1804..2733 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 3008..3778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(3791..4231) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389967.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(4235..4486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 4855..5685 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818606.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 5727..6539 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929635.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(6561..7733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 7939..8412 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 8436..9182 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 sequence067 source 1..10759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..816 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199069.1:methionine adenosyltransferase locus_tag LOCUS_11820 CDS 774..1901 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1974..2210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 2329..3192 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199935.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 3222..4328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 4444..4884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 4933..5898 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973815.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 5895..6692 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 6689..7453 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 7444..8643 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973818.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 8735..9931 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 sequence068 source 1..10624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(293..1855) product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 note possible pseudo, internal stop codon CDS complement(1856..2233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(2154..2654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(2690..2908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(2910..3698) product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(3749..4303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 note possible pseudo, frameshifted CDS complement(4255..5304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 note possible pseudo, frameshifted CDS complement(5301..6383) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(6367..7404) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(7406..9310) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535437.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 9435..10184 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene fabI CDS complement(10204..10575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 sequence069 source 1..10492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..488) product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(488..751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 924..1166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1163..1426 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 1601..3073 product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 3104..3862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(4032..4628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(4619..4933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 4826..7237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 note possible pseudo, internal stop codon, frameshifted CDS 7234..8487 product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(8541..9239) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(9279..9773) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398896.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(9787..10128) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811464.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 sequence070 source 1..10355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..672 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194308.1:thiamine-phosphate kinase locus_tag LOCUS_12180 CDS 875..1792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1789..2403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 2429..2926 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(3221..4141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(4294..5787) product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549996.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(5784..6641) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927035.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(6647..8860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(9035..9817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 misc_feature complement(9811..>10355) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039011.1:bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA locus_tag LOCUS_12270 sequence071 source 1..10335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(81..263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(326..778) product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(775..1017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 1010..1159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1127..3205) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706692.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(3202..3624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(3621..4193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(4430..4630) product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(4885..5112) product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(5268..5696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(5686..6276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(6487..6693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 note possible pseudo, frameshifted CDS complement(6645..6821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(6852..7247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(7247..7597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(7716..8336) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919360.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(8333..9382) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103695.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(9382..10146) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 sequence072 source 1..10324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(274..3150) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene ileS CDS complement(3225..4286) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 4498..5040 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 5194..7383 product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene katG CDS 7498..9555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 misc_feature complement(9557..>10324) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526465.1:acyl-CoA dehydrogenase locus_tag LOCUS_12510 sequence073 source 1..10237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(143..1006) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1071..2525) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886828.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(2589..7352) product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(7566..8255) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(8277..9467) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521919.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 misc_feature complement(9460..>10237) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003806948.1:3-dehydroquinate synthase locus_tag LOCUS_12570 sequence074 source 1..10017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..884 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 881..2830 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811551.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 3039..3572 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene iscR CDS 3575..4789 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 4832..5263 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene iscU CDS 5290..5613 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene iscA CDS 5621..6211 product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene hscB CDS 6221..8131 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930571.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene hscA CDS 8165..8503 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812453.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene fdx CDS 8511..9377 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene dnaQ tRNA complement(9451..9527) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 sequence075 source 1..9595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 74..460 product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 457..1662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 1813..4386 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 4509..4985 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 5379..6878 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 6922..8226 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194166.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(8289..8795) product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930687.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(8827..9132) product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526463.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 sequence076 source 1..9589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2..436) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene sdhC CDS complement(603..1394) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813656.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1521..2507 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 2540..4108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 4149..6758 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene acnB CDS complement(6841..8874) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388687.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 sequence077 source 1..9565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(12..830) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1149..1694) product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene flhC CDS complement(1738..2100) product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097770.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene flhD CDS complement(2299..2877) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 2984..4399 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064125.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 4396..7569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(7672..8652) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(8701..9474) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 sequence078 source 1..9478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 55..1227 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926823.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene mltB CDS 1232..2386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(2396..4939) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063648.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 5152..5631 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197479.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(5628..7994) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063976.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene parC CDS complement(8052..9062) product class 1 integron integrase IntI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845048.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene intI1 CDS complement(9210..9476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 sequence079 source 1..9246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1137 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096587.1:chromate efflux transporter locus_tag LOCUS_12970 CDS complement(1403..2221) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090581.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 2665..3255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 3375..5330 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194034.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene dnaK CDS 5447..6583 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene dnaJ CDS 6604..7968 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931030.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 sequence080 source 1..9209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(167..242) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(269..2215) product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 tRNA complement(2275..2350) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(2478..4418) product bifunctional anthranilate synthase component I family protein/class IV aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225844.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(4415..5614) product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085700.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(5632..6582) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257820.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(6638..7207) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene pgsA CDS complement(7251..9140) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192853.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene uvrC sequence081 source 1..9143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1618..2562) product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972822.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene aztC CDS complement(2567..3439) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(3439..4428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 4563..5072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 5069..5725 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 5722..6933 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864646.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 6940..7254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 7244..7855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(8168..8491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(8647..8928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 sequence082 source 1..8962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..807 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004557250.1:glutamate-5-semialdehyde dehydrogenase locus_tag LOCUS_13190 CDS 814..2145 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103404.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 2181..3431 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene mnmA CDS 3418..5151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 5333..6802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(6827..7450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 misc_feature complement(7384..>8962) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_070065546.1:enhanced entry virulence factor RtxA locus_tag LOCUS_13250 sequence083 source 1..8884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..805 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931319.1:phosphomannomutase/phosphoglucomutase note possible pseudo, frameshifted locus_tag LOCUS_13260 CDS 808..1869 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088671.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 1859..3328 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532247.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene waaA CDS complement(3348..3923) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064487.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 3978..6629 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene alaS CDS complement(6762..7505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(7600..8802) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186140.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene ribD sequence084 source 1..8442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 170..334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 436..1365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 1440..1742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1788..2507) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene fnr CDS 2657..4036 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064046.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene hemN CDS 4075..4785 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766954.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 5023..6354 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene aceA CDS 6522..6755 product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170066.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene vapB CDS 6757..7158 product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene vapC sequence085 source 1..8413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(680..1045) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971640.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene gcvH CDS complement(1128..2306) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113083.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene gcvT CDS complement(2486..2701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(2852..4540) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(4805..5980) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 6212..7060 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene surE CDS 7057..7905 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203980.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 sequence086 source 1..8316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(631..1506) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene kdsB CDS complement(1506..1712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(1827..3014) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064091.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene lpxK CDS complement(2986..3411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(3431..4069) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812889.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 4366..5583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 5681..6262 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931119.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene sodB CDS complement(6368..6853) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene smpB CDS 6913..7356 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811752.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 7353..7685 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(7698..8315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 sequence087 source 1..8314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1111 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193654.1:glutamine--tRNA ligase/YqeY domain fusion protein locus_tag LOCUS_13600 CDS 1211..2116 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936979.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 2113..2577 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087065.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene aroQ CDS complement(2597..3703) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene aroC CDS complement(3762..4223) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 4324..5625 product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 5630..6442 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(6443..7672) product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536360.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 7736..8242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 sequence088 source 1..8295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 353..1051 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene rimP CDS 1048..2565 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene nusA CDS 2595..5645 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197388.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene infB CDS 5678..6049 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene rbfA CDS 6051..7127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 sequence089 source 1..8293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 125..1519 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199381.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 1516..4038 product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529996.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(4111..5214) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene pyrC CDS complement(5211..7307) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 sequence090 source 1..8261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..736 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199929.1:lipid asymmetry maintenance ABC transporter permease subunit MlaE locus_tag LOCUS_13780 CDS 750..1235 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene mlaD CDS 1288..2118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 2191..2877 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815780.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 2893..3261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 3296..4228 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 4225..4980 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 5097..5348 product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 5412..6698 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene murA CDS 6695..7414 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene hisG sequence091 source 1..8246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 348..1397 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(1461..2441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(2476..2976) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 3168..4448 product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 4518..4916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 5024..7411 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037666.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(7416..7706) product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937389.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 misc_feature complement(7709..>8246) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389222.1:bifunctional enoyl-CoA hydratase/phosphate acetyltransferase locus_tag LOCUS_13950 sequence092 source 1..8188 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 30..506 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene greA CDS complement(484..1377) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene folD CDS complement(1374..1991) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(2047..4614) product oxygen sensor histidine kinase FixL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene fixL CDS 4823..7450 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811941.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene aceE tRNA 7940..8017 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 sequence093 source 1..7978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 439..786 product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 809..1453 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 1544..2740 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807138.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 2896..3993 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113628.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 4123..4518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 4781..5317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 5411..5788 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005017264.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene rpsL CDS 5969..6439 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene rpsG sequence094 source 1..7889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 118..1758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1755..2225 product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316621.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 2222..2656 product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 2653..4107 product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125097.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 4110..4460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 4457..4726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 4723..5085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(5153..6013) product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(6054..6608) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene efp CDS complement(6538..7776) product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766776.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene earP sequence095 source 1..7737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2492..2728 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140847.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 2725..3123 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140846.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 3154..3483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 3532..4302 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814010.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene yaaA CDS 4316..5005 product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038527.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 5005..6075 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526121.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene queF CDS 6127..6420 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390987.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 sequence096 source 1..7704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 575..648 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 712..1200 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1246..1638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1666..4095) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene pheT CDS complement(4153..5223) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene pheS CDS complement(5434..5754) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene rplT CDS complement(5839..6042) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191477.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene rpmI CDS complement(6166..6822) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene infC misc_feature complement(6819..>7704) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039633.1:threonine--tRNA ligase locus_tag LOCUS_14330 sequence097 source 1..7585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 419..1870 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098024.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1852..2223) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971500.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(2244..2810) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224592.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene dcd CDS 2952..3383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(3421..5739) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764917.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene dinG CDS 5921..6961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 sequence098 source 1..7515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..645 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550379.1:nitrous oxide reductase family maturation protein NosD locus_tag LOCUS_14400 CDS 626..1549 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539779.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 assembly_gap 1778..1801 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1802..2869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 note possible pseudo, frameshifted CDS 2899..3486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 3600..4013 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521401.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 4344..4856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(4864..5280) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524657.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 note possible pseudo, internal stop codon CDS complement(5404..5634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(6053..7276) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 sequence099 source 1..7431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(683..1759) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene rfbB CDS 1930..2187 product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 2316..3533 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(3482..4282) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(4333..5100) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene ugpQ CDS complement(5108..6115) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930289.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(6137..6997) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene ugpE sequence100 source 1..7336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 303..1088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 1085..1573 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186163.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene ruvX CDS 1570..2130 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene pyrR CDS 2127..3083 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 3105..4475 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 4495..5298 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(5359..7047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 sequence101 source 1..7291 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 113..367 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene grxC CDS 455..925 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198004.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene secB CDS 947..1957 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(1961..2836) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064922.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene panC CDS complement(2984..3859) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene panB CDS 4141..5085 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185611.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene nadC CDS 5297..7033 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene ilvD sequence102 source 1..7238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(527..1306) product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1315..1860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1919..4780) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810256.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene leuS CDS complement(4858..5670) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene dapB CDS complement(5761..6270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 note possible pseudo, frameshifted CDS 6397..6867 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene fur sequence103 source 1..7201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 86..358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(468..893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 1150..2514 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 2511..3095 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545692.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene metW CDS complement(3085..3723) product efflux system transcriptional repressor NalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene nalD CDS 3855..5081 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810338.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 sequence104 source 1..7201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 613..912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(933..1397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 1282..1536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1540..3807) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550537.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene rnr tRNA 3858..3942 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(4030..5457) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene rimO CDS complement(5530..6114) product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene phaR CDS 6298..6846 product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 sequence105 source 1..7070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 429..1340 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140013.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene pstC CDS 1347..2201 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene pstA assembly_gap 2727..2763 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2837..3163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 3311..4651 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390060.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 4683..5027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(5085..5678) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193537.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene recR CDS complement(5705..6037) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 misc_feature complement(6105..>7070) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930422.1:DNA polymerase III subunit gamma/tau locus_tag LOCUS_14960 sequence106 source 1..6856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..519 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525893.1:5-formyltetrahydrofolate cyclo-ligase locus_tag LOCUS_14970 CDS complement(538..3975) product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(4158..4877) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(4977..5810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 misc_feature complement(5807..>6856) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036061.1:ATP-binding protein locus_tag LOCUS_15010 sequence107 source 1..6810 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 360..1916 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene atpA CDS 1949..2818 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene atpG CDS 2860..4290 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene atpD CDS 4350..4757 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 4887..5927 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(6015..6437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 sequence108 source 1..6793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..636 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039713.1:alpha/beta hydrolase locus_tag LOCUS_15080 CDS 633..2921 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 tRNA 2959..3035 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 3736..4002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 4078..5175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 sequence109 source 1..6786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2686 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523124.1:indolepyruvate ferredoxin oxidoreductase family protein locus_tag LOCUS_15120 CDS 2756..3721 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032713612.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 3884..4201 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene yajC CDS 4279..6174 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809414.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene secD sequence110 source 1..6746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1346 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209166.1:McrB family protein locus_tag LOCUS_15160 CDS 1363..2736 product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209167.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 2733..4283 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022342.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(4220..5083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(5111..5980) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809384.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 sequence111 source 1..6667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(291..473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 562..1044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(1226..2131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 note possible pseudo, frameshifted CDS complement(2068..3348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 note possible pseudo, frameshifted CDS 3487..3963 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192504.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 3980..4900 product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 tRNA 5025..5114 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 sequence112 source 1..6625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..1116) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 1149..2099 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821521.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(2148..3146) product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818535.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(3143..3814) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(3823..4509) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene modB CDS complement(4537..5268) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195689.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene modA CDS 5516..5767 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523495.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 sequence113 source 1..6528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..909 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195243.1:ribose-phosphate pyrophosphokinase locus_tag LOCUS_15340 CDS 1029..1652 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 1680..2297 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene pth CDS complement(2364..2630) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808570.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(2644..3192) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene coaD CDS complement(3282..3917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(3914..5269) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 note possible pseudo, internal stop codon misc_feature complement(5266..>6528) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948371.1:pitrilysin family protein locus_tag LOCUS_15410 sequence114 source 1..6437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 16..1170 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1177..1476) product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene soxZ CDS complement(1570..1971) product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene soxY CDS complement(2173..2877) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene lolD CDS complement(2870..3094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 note possible pseudo, frameshifted CDS complement(3070..4074) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 note possible pseudo, frameshifted CDS complement(4219..4878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 sequence115 source 1..6391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(684..1124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 1217..1495 product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312252.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 1771..2046 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(2239..2691) product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 2831..3055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(3061..3279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(3283..3558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 3762..4025 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 4012..4293 product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 4655..4960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 4957..5424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 5560..5697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 sequence116 source 1..6372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 702..2588 product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553995.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 2585..3085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 3082..3873 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 3870..4817 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene cysD CDS 4819..6231 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813322.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 sequence117 source 1..6324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(258..1328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1325..4903) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114484320.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene smc CDS 5091..5924 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812536.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene dapD sequence118 source 1..6236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..647 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007247571.1:IS5-like element ISPssy family transposase locus_tag LOCUS_15690 CDS complement(1121..1777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(1807..2418) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200146.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(2447..3010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 note possible pseudo, frameshifted CDS 3052..3453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 3582..4127 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446416.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 4207..4719 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191562.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 4722..6047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 sequence119 source 1..6234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(503..1156) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706154.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 1250..2728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(2779..3660) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418111.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(3670..3933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 note possible pseudo, frameshifted CDS 4019..4525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 misc_feature complement(4564..>6234) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200734.1:DNA topoisomerase III locus_tag LOCUS_15830 sequence120 source 1..6205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..649) product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(693..1331) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 1400..2017 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(2037..2546) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene trmL CDS complement(2569..5226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(5228..5608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 sequence121 source 1..6104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1128..1970) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214281.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(1990..2883) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530774.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(2943..4046) product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene potA CDS complement(4182..5312) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201742.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(5434..5964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 sequence122 source 1..6064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1494..2516 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199104.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene tsaB CDS 2635..3009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 note possible pseudo, frameshifted CDS complement(3017..4489) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(4643..5335) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969922.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(5335..6024) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 sequence123 source 1..6036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 215..1309 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 1331..3448 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene recG CDS 3553..4515 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194383.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 4512..5393 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene ubiA misc_feature complement(5329..>6036) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522133.1:pyrroline-5-carboxylate reductase locus_tag LOCUS_16040 sequence124 source 1..5946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..793 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063889.1:tripartite tricarboxylate transporter substrate binding protein BugE locus_tag LOCUS_16050 CDS 941..1888 product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814324.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 assembly_gap 1606..1611 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1953..2342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(2432..3715) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065136.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene eno CDS complement(3771..4064) product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065135.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(4082..4939) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene kdsA misc_feature complement(4946..>5946) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813705.1:CTP synthase locus_tag LOCUS_16110 sequence125 source 1..5924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1309..2028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(2215..2547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(2709..4109) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene radA CDS 4155..4562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 note possible pseudo, frameshifted CDS 4547..5245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 note possible pseudo, frameshifted sequence126 source 1..5898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1541..2854) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065159.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(2918..3205) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528990.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(3224..3928) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187935.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(3962..5773) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940953.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene sdhA sequence127 source 1..5897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(594..893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(912..2006) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040076.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene hisC CDS 2120..2707 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene hisB CDS 2778..3455 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene hisH CDS 3524..4264 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199906.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene hisA CDS 4280..5080 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene hisF CDS complement(5046..5684) product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 sequence128 source 1..5874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 640..2562 product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010226.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene prpE CDS 2621..4096 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene bioA CDS 4062..5291 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene bioF sequence129 source 1..5675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 31..1125 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene ychF CDS complement(1122..4223) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967993.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(4220..5299) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035674.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 sequence130 source 1..5633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 530..1531 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1563..2348) product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene hexR CDS complement(2418..3383) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene tal CDS complement(3380..4069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 4133..5125 product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162835061.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 sequence131 source 1..5559 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1079..1399) product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(1447..2442) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 2702..3262 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(3345..4109) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(4151..5260) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 sequence132 source 1..5554 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1033 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444647.1:alpha/beta fold hydrolase locus_tag LOCUS_16440 CDS complement(1021..2271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(2329..2604) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 2811..3461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(3471..5021) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121241671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 sequence133 source 1..5493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1284 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089807.1:esterase-like activity of phytase family protein locus_tag LOCUS_16490 CDS complement(1293..2204) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 2372..4744 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764814.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene metE CDS 4741..4950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 sequence134 source 1..5450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1049 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812548.1:fatty acid desaturase locus_tag LOCUS_16530 CDS 1088..1456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1450..1809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 misc_feature complement(1859..>5450) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009939035.1:excinuclease ABC subunit UvrA locus_tag LOCUS_16560 sequence135 source 1..5428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(876..1676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(1673..2296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(2293..4320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(4351..5178) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040310.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene fabI sequence136 source 1..5393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1653..2198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(2254..3531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 3631..4578 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 misc_feature complement(4556..>5393) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188973.1:pyruvate kinase locus_tag LOCUS_16640 sequence137 source 1..5335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(6..81) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 218..1876 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1873..3468 product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387848.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 3508..4149 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(4162..4968) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 sequence138 source 1..5293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 343..921 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014408000.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 918..3485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 3379..3723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 sequence139 source 1..5241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1327 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:EAL domain-containing protein locus_tag LOCUS_16720 CDS complement(1334..1615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 2632..4824 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190933.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene rpoD sequence140 source 1..5177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(525..764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 891..1214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(1455..2783) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039889.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(2780..3094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(3802..4263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 sequence141 source 1..5125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..1059) product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194565.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 1284..1955 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906339.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 2016..2366 product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169659.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene ychN CDS 2495..3493 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921602.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 note possible pseudo, frameshifted CDS complement(3791..4363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 4369..4683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 4691..4999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 sequence142 source 1..5113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1025 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002117074.1:AI-2E family transporter locus_tag LOCUS_16870 CDS complement(1062..2477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 sequence143 source 1..5109 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1403..2605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(2654..3208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(3245..3832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 note possible pseudo, frameshifted misc_feature complement(4215..>5109) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005169210.1:long-chain-fatty-acid--CoA ligase FadD locus_tag LOCUS_16920 sequence144 source 1..5024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(320..1135) product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921089.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(1122..1532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 note possible pseudo, frameshifted CDS complement(1529..2062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 note possible pseudo, frameshifted CDS complement(2179..2484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(2785..3165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 3101..3538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 3705..4898 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 sequence145 source 1..4930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 496..1407 product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(1427..2218) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 2303..3028 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene pyrE CDS 3040..3603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 misc_feature complement(3605..>4930) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552444.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB locus_tag LOCUS_17040 sequence146 source 1..4923 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2781..3218) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530565.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(3263..3436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(3585..4502) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 sequence147 source 1..4917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(627..1187) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene frr CDS complement(1279..1989) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene pyrH CDS complement(2139..2477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 note possible pseudo, frameshifted CDS complement(2462..3082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 note possible pseudo, frameshifted CDS complement(3192..3941) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene rpsB sequence148 source 1..4795 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3417..4622) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene dapE sequence149 source 1..4768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1509..2132) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970934.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(2129..3322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 3427..4497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 sequence150 source 1..4630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1226 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186553.1:L-aspartate oxidase note possible pseudo, frameshifted locus_tag LOCUS_17170 CDS 1115..1540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 note possible pseudo, frameshifted CDS complement(1553..1933) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(2036..3967) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193963.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene thiC misc_feature complement(4121..>4630) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185886.1:quinolinate synthase NadA locus_tag LOCUS_17210 sequence151 source 1..4512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 465..806 product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707500.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(840..1181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 1425..2969 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(2997..3332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(3432..4160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 sequence152 source 1..4411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 110..1216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 1484..1855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 1871..3157 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 misc_feature complement(3201..>4411) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974597.1:DUF3422 family protein locus_tag LOCUS_17300 sequence153 source 1..4394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(529..1836) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1968..2696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 2773..3327 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064038.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene purN misc_feature complement(3324..>4394) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815895.1:peptide chain release factor 3 locus_tag LOCUS_17340 sequence154 source 1..4326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 265..1041 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(1117..2733) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193192.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene guaA CDS complement(2821..4290) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene guaB sequence155 source 1..4318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 314..928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 935..2590 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265692.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 2683..3396 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919170.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 3417..3887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 sequence156 source 1..4285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..956 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 1044..2378 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 sequence157 source 1..4283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 86..508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 598..1629 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193185.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene hemC CDS 1711..2340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 2231..2509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 2767..3837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 sequence158 source 1..4202 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1182 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014905419.1:NADP-specific glutamate dehydrogenase locus_tag LOCUS_17490 CDS 1212..2441 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261548.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 2438..3475 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene miaA CDS complement(3472..4188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 sequence159 source 1..4113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 772..1614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 tRNA complement(1719..1795) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 1990..2889 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene rdgC misc_feature complement(2895..>4113) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186216.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC locus_tag LOCUS_17550 sequence160 source 1..4101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 548..1513 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392222.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 1620..2108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 2145..3635 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529613.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 sequence161 source 1..4095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..744 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063727.1:dihydrolipoyllysine-residue acetyltransferase locus_tag LOCUS_17590 CDS 757..2574 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930129.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene lpdA sequence162 source 1..3950 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 269..1801 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene narH CDS 1803..2507 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971854.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene narJ assembly_gap 2954..3037 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence163 source 1..3935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 98..823 product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(836..1621) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene moeB CDS complement(1634..3088) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543824.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 misc_feature complement(3230..>3935) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198007.1:2,3-diphosphoglycerate-dependent phosphoglycerate mutase locus_tag LOCUS_17660 sequence164 source 1..3848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(323..619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(588..2432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 assembly_gap 658..666 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2435..2806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(2931..3848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 sequence165 source 1..3840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..861) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 tRNA 1002..1077 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(1013..2203) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189719.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene queG CDS 2174..2734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 sequence166 source 1..3805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2793 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926826.1:DNA gyrase subunit A locus_tag LOCUS_17740 sequence167 source 1..3776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1803..2066 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 2115..2405 product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811547.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene nadS CDS complement(2537..3430) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807185.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 sequence168 source 1..3717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2293 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196276.1:DNA topoisomerase (ATP-hydrolyzing) subunit B locus_tag LOCUS_17780 sequence169 source 1..3709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 538..2685 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene ligA misc_feature complement(2751..>3709) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197089.1:[protein-PII] uridylyltransferase locus_tag LOCUS_17800 sequence170 source 1..3702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1276..1352) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(1441..2223) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 misc_feature complement(2263..>3702) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527796.1:PDZ domain-containing protein locus_tag LOCUS_17820 sequence171 source 1..3547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1097..1357 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene rpsP CDS 1397..1981 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527496.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene rimM CDS 1978..2763 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063943.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene trmD CDS 2918..3274 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217809.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene rplS sequence172 source 1..3521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1043..1270 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366461.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 assembly_gap 1558..1630 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1703..2443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 2471..3283 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185427.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene minD sequence173 source 1..3491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 293..613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 607..825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 1091..1603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(1624..3024) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene rlmD sequence174 source 1..3438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(416..1609) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(1634..2689) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394435.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(2801..3079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 sequence175 source 1..3399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..1129) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 tRNA complement(1198..1285) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 1487..2362 product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene cysM CDS 2436..2663 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 misc_feature complement(2680..>3399) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521705.1:valine--tRNA ligase locus_tag LOCUS_18000 sequence176 source 1..3390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 244..1272 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943025.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 sequence177 source 1..3375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 383..1177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 note possible pseudo, internal stop codon CDS complement(1083..2285) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064322.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene tgt sequence178 source 1..3368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 646..2340 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527788.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 2353..3108 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064708.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 sequence179 source 1..3319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(755..1849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(1938..2852) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247635.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(2865..3131) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402372.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 sequence180 source 1..3302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2190..2633 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530565.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 misc_feature complement(2640..>3302) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191241.1:prolipoprotein diacylglyceryl transferase locus_tag LOCUS_18100 sequence181 source 1..3274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 note possible pseudo, internal stop codon, frameshifted CDS 864..2294 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809058.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 2307..2822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 sequence182 source 1..3263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(105..254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(312..545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 sequence183 source 1..3133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 495..1466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 1554..2798 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 sequence184 source 1..3098 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 358..1203 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene fdhD CDS 1217..1735 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064347.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 sequence185 source 1..3065 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 256..1470 product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815378.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 1679..2377 product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 sequence186 source 1..2994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..1203 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200023.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(1232..1987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 sequence187 source 1..2957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1160..2305) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 misc_feature complement(2316..>2957) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107720.1:Crp/Fnr family transcriptional regulator locus_tag LOCUS_18260 sequence188 source 1..2872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 sequence189 source 1..2863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(401..1489) product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926819.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1486..2334) product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene cysW misc_feature complement(2331..>2863) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942000.1:sulfate ABC transporter permease subunit CysT locus_tag LOCUS_18300 sequence190 source 1..2838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 266..2251 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 sequence191 source 1..2815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 19..94 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(180..371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 497..1000 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 sequence192 source 1..2780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1182 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202033.1:ATP-dependent RNA helicase HrpA locus_tag LOCUS_18340 CDS complement(1270..2493) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 sequence193 source 1..2751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence194 source 1..2735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(28..1263) product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene clsB CDS complement(1260..1991) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811372.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(1999..2187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 sequence195 source 1..2733 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(172..567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 781..1950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 misc_feature complement(2137..>2733) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003818284.1:16S rRNA (guanine(527)-N(7))-methyltransferase RsmG locus_tag LOCUS_18410 sequence196 source 1..2731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 454..2376 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150913023.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 sequence197 source 1..2722 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 31..1506 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247436.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 1708..2310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 sequence198 source 1..2711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 353..1159 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065092.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene fabG CDS 1298..1537 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197638.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene acpP sequence199 source 1..2708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(453..1586) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009921779.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene ribBA CDS complement(1583..2203) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(2210..2659) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185666.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene nrdR sequence200 source 1..2702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(615..1520) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 sequence201 source 1..2699 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..675 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004203577.1:site-specific tyrosine recombinase XerD locus_tag LOCUS_18520 CDS 763..1311 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 1304..2320 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550203.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene hslO sequence202 source 1..2630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(998..>2630) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004203476.1:heavy metal translocating P-type ATPase locus_tag LOCUS_18550 sequence203 source 1..2506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 175..1287 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930156.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene queA CDS 1294..2031 product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704843.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 sequence204 source 1..2477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 787..1230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 1288..2139 product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 sequence205 source 1..2419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(546..1619) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene plsX CDS complement(1753..1935) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214744.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene rpmF sequence206 source 1..2400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(470..1246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 sequence207 source 1..2377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 139..2118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 note possible pseudo, frameshifted sequence208 source 1..2361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..1038) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(1067..2080) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816840.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 sequence209 source 1..2339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1036..1839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 sequence210 source 1..2314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence211 source 1..2301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 308..1315 product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525849.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(1306..1956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 sequence212 source 1..2281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..724 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194871.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase locus_tag LOCUS_18700 CDS complement(663..968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 1380..2213 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524730.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 sequence213 source 1..2280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 171..470 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189769.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene gatC CDS 467..1993 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene gatA sequence214 source 1..2278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1193..>2278) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813930.1:NADH-quinone oxidoreductase subunit NuoF locus_tag LOCUS_18750 sequence215 source 1..2275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(471..1289) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene ybgF CDS complement(1289..1900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 sequence216 source 1..2256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 198..977 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366937.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(1034..1807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 sequence217 source 1..2247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..1068 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene htpX sequence218 source 1..2214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..1636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 sequence219 source 1..2162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 224..982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 note possible pseudo, internal stop codon CDS complement(1031..2137) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene bioB sequence220 source 1..2121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 947..1252 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene rpsT CDS complement(1438..1782) product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189028.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 sequence221 source 1..1998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(464..1102) product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813726.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(1120..1824) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065123.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 sequence222 source 1..1917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 297..1031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 note possible pseudo, frameshifted sequence223 source 1..1910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 224..1237 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186469.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene gluQRS sequence224 source 1..1909 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence225 source 1..1863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(315..1046) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene nth sequence226 source 1..1849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(451..1767) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 sequence227 source 1..1817 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 sequence228 source 1..1767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(950..1660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 sequence229 source 1..1747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 311..1096 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 sequence230 source 1..1745 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1007 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038299.1:type I glyceraldehyde-3-phosphate dehydrogenase locus_tag LOCUS_18950 sequence231 source 1..1726 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 186..1184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 sequence232 source 1..1642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence233 source 1..1630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence234 source 1..1581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5..1357) product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 sequence235 source 1..1558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 498..1232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 sequence236 source 1..1534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1083 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194083.1:class I SAM-dependent RNA methyltransferase locus_tag LOCUS_18990 sequence237 source 1..1496 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 398..769 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 769..1437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 sequence238 source 1..1459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(505..1101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 sequence239 source 1..1458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..872 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193515.1:aldehyde dehydrogenase family protein locus_tag LOCUS_19030 CDS complement(850..1092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 note possible pseudo, frameshifted sequence240 source 1..1424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 sequence241 source 1..1397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence242 source 1..1368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence243 source 1..1363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(623..>1363) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005767010.1:flagellin domain-containing protein locus_tag LOCUS_19060 sequence244 source 1..1323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1141 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000608644.1:IS1380-like element ISEcp1 family transposase locus_tag LOCUS_19070 sequence245 source 1..1322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(58..>1322) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530105.1:chromate efflux transporter locus_tag LOCUS_19080 sequence246 source 1..1320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 97..567 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene ptsN sequence247 source 1..1313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(342..>1313) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810554.1:translational GTPase TypA locus_tag LOCUS_19100 sequence248 source 1..1299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence249 source 1..1259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..501 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187693.1:3-isopropylmalate dehydrogenase locus_tag LOCUS_19110 CDS 546..1163 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042599338.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 sequence250 source 1..1256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence251 source 1..1246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 sequence252 source 1..1234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..687 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813377.1:OmpA family protein locus_tag LOCUS_19140 sequence253 source 1..1216 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence254 source 1..1214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..847 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926108.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 sequence255 source 1..1211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(29..>1211) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186393.1:NADH-quinone oxidoreductase subunit NuoG locus_tag LOCUS_19160 sequence256 source 1..1201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence257 source 1..1195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence258 source 1..1191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(166..930) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene istB sequence259 source 1..1167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 347..781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 sequence260 source 1..1165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(670..1164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 sequence261 source 1..1155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1116 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088624.1:NAD(P)/FAD-dependent oxidoreductase locus_tag LOCUS_19200 sequence262 source 1..1154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(224..>1154) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194871.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase locus_tag LOCUS_19210 sequence263 source 1..1128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence264 source 1..1127 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..937 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811013.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD locus_tag LOCUS_19220 sequence265 source 1..1124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 sequence266 source 1..1093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 298..786 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene ssb sequence267 source 1..1089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence268 source 1..1077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(548..1075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 sequence269 source 1..1070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence270 source 1..1062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(157..597) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213216.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 sequence271 source 1..1041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 sequence272 source 1..1026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 344..628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 621..1001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 sequence273 source 1..1025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence274 source 1..1024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(306..932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 sequence275 source 1..1019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence276 source 1..1001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 314..622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 733..930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320