>Feature sequence001 290 976 gene locus_tag LOCUS_00010 gene rpe 290 976 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186923.1 protein_id gnl|my_center|LOCUS_00010 1135 3498 gene locus_tag LOCUS_00020 1135 3498 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203850.1 protein_id gnl|my_center|LOCUS_00020 3517 4803 gene locus_tag LOCUS_00030 3517 4803 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806952.1 protein_id gnl|my_center|LOCUS_00030 5973 4873 gene locus_tag LOCUS_00040 gene hypE 5973 4873 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089665.1 protein_id gnl|my_center|LOCUS_00040 7139 5970 gene locus_tag LOCUS_00050 gene hypD 7139 5970 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_00050 7405 7136 gene locus_tag LOCUS_00060 7405 7136 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_00060 8754 7396 gene locus_tag LOCUS_00070 8754 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9914 8793 gene locus_tag LOCUS_00080 9914 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10340 9993 gene locus_tag LOCUS_00090 gene hypA 10340 9993 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_00090 10978 10367 gene locus_tag LOCUS_00100 10978 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11483 14341 gene locus_tag LOCUS_00110 11483 14341 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809567.1 protein_id gnl|my_center|LOCUS_00110 14413 18231 gene locus_tag LOCUS_00120 14413 18231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 18228 19319 gene locus_tag LOCUS_00130 18228 19319 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_00130 19381 21702 gene locus_tag LOCUS_00140 19381 21702 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550744.1 protein_id gnl|my_center|LOCUS_00140 21831 22136 gene locus_tag LOCUS_00150 21831 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 24249 22123 gene locus_tag LOCUS_00160 24249 22123 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014486102.1 protein_id gnl|my_center|LOCUS_00160 25215 24571 gene locus_tag LOCUS_00170 gene queE 25215 24571 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931061.1 protein_id gnl|my_center|LOCUS_00170 26291 25212 gene locus_tag LOCUS_00180 26291 25212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 27018 26305 gene locus_tag LOCUS_00190 gene queC 27018 26305 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_00190 27300 27803 gene locus_tag LOCUS_00200 gene rfaH 27300 27803 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 protein_id gnl|my_center|LOCUS_00200 28271 27822 gene locus_tag LOCUS_00210 gene rnhA 28271 27822 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_00210 29083 28268 gene locus_tag LOCUS_00220 29083 28268 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_00220 30101 29151 gene locus_tag LOCUS_00230 30101 29151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30966 30259 gene locus_tag LOCUS_00240 30966 30259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 32095 31097 gene locus_tag LOCUS_00250 32095 31097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 32952 32104 gene locus_tag LOCUS_00260 32952 32104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 33257 33006 gene locus_tag LOCUS_00270 33257 33006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 33937 33272 gene locus_tag LOCUS_00280 33937 33272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 35380 33959 gene locus_tag LOCUS_00290 35380 33959 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 protein_id gnl|my_center|LOCUS_00290 37542 35380 gene locus_tag LOCUS_00300 37542 35380 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_00300 39301 37718 gene locus_tag LOCUS_00310 gene ptsP 39301 37718 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_00310 39567 39298 gene locus_tag LOCUS_00320 39567 39298 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_00320 39991 39536 gene locus_tag LOCUS_00330 39991 39536 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_00330 40160 40672 gene locus_tag LOCUS_00340 40160 40672 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 protein_id gnl|my_center|LOCUS_00340 41027 40698 gene locus_tag LOCUS_00350 41027 40698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41377 41985 gene locus_tag LOCUS_00360 41377 41985 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_00360 42507 41998 gene locus_tag LOCUS_00370 42507 41998 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064337.1 protein_id gnl|my_center|LOCUS_00370 42909 42628 gene locus_tag LOCUS_00380 gene rpsQ 42909 42628 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 protein_id gnl|my_center|LOCUS_00380 43118 42906 gene locus_tag LOCUS_00390 gene rpmC 43118 42906 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 protein_id gnl|my_center|LOCUS_00390 43548 43132 gene locus_tag LOCUS_00400 gene rplP 43548 43132 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_00400 44378 43563 gene locus_tag LOCUS_00410 gene rpsC 44378 43563 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_00410 44724 44395 gene locus_tag LOCUS_00420 gene rplV 44724 44395 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925688.1 protein_id gnl|my_center|LOCUS_00420 45011 44736 gene locus_tag LOCUS_00430 gene rpsS 45011 44736 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199273.1 protein_id gnl|my_center|LOCUS_00430 45848 45024 gene locus_tag LOCUS_00440 gene rplB 45848 45024 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806907.1 protein_id gnl|my_center|LOCUS_00440 46165 45851 gene locus_tag LOCUS_00450 gene rplW 46165 45851 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199275.1 protein_id gnl|my_center|LOCUS_00450 46725 46162 gene locus_tag LOCUS_00460 gene rplD 46725 46162 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806905.1 protein_id gnl|my_center|LOCUS_00460 47396 46725 gene locus_tag LOCUS_00470 gene rplC 47396 46725 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925687.1 protein_id gnl|my_center|LOCUS_00470 47963 47652 gene locus_tag LOCUS_00480 gene rpsJ 47963 47652 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_00480 >Feature sequence002 458 1555 gene locus_tag LOCUS_00490 458 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 1571 2203 gene locus_tag LOCUS_00500 gene coaE 1571 2203 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_00500 2172 2966 gene locus_tag LOCUS_00510 gene zapD 2172 2966 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_00510 3489 2974 gene locus_tag LOCUS_00520 3489 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 4431 3535 gene locus_tag LOCUS_00530 4431 3535 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_00530 5725 4496 gene locus_tag LOCUS_00540 gene argJ 5725 4496 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549958.1 protein_id gnl|my_center|LOCUS_00540 8550 5788 gene locus_tag LOCUS_00550 gene secA 8550 5788 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194125.1 protein_id gnl|my_center|LOCUS_00550 8991 8737 gene locus_tag LOCUS_00560 8991 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 9048 9275 gene locus_tag LOCUS_00570 9048 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 9272 9568 gene locus_tag LOCUS_00580 9272 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 11490 9595 gene locus_tag LOCUS_00590 gene glmS 11490 9595 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_00590 11609 12067 gene locus_tag LOCUS_00600 11609 12067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 13685 12114 gene locus_tag LOCUS_00610 gene glmU 13685 12114 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040718.1 protein_id gnl|my_center|LOCUS_00610 13750 14598 gene locus_tag LOCUS_00620 gene purU 13750 14598 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522850.1 protein_id gnl|my_center|LOCUS_00620 14655 15539 gene locus_tag LOCUS_00630 14655 15539 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530154.1 protein_id gnl|my_center|LOCUS_00630 15764 15690 gene locus_tag LOCUS_t00010 15764 15690 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15805 17310 gene locus_tag LOCUS_00640 15805 17310 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538734.1 protein_id gnl|my_center|LOCUS_00640 17358 18563 gene locus_tag LOCUS_00650 17358 18563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 19264 18560 gene locus_tag LOCUS_00660 gene yggS 19264 18560 CDS product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 protein_id gnl|my_center|LOCUS_00660 19298 20341 gene locus_tag LOCUS_00670 gene pilT 19298 20341 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_00670 20390 21526 gene locus_tag LOCUS_00680 20390 21526 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 protein_id gnl|my_center|LOCUS_00680 21533 22435 gene locus_tag LOCUS_00690 21533 22435 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 protein_id gnl|my_center|LOCUS_00690 23170 22499 gene locus_tag LOCUS_00700 23170 22499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 23772 23281 gene locus_tag LOCUS_00710 23772 23281 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525681.1 protein_id gnl|my_center|LOCUS_00710 23771 24721 gene locus_tag LOCUS_00720 gene rsmI 23771 24721 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525682.1 protein_id gnl|my_center|LOCUS_00720 25187 24798 gene locus_tag LOCUS_00730 25187 24798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 25329 25949 gene locus_tag LOCUS_00740 25329 25949 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931044.1 protein_id gnl|my_center|LOCUS_00740 25949 28621 gene locus_tag LOCUS_00750 25949 28621 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_00750 29176 28709 gene locus_tag LOCUS_00760 29176 28709 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819714.1 protein_id gnl|my_center|LOCUS_00760 29462 30016 gene locus_tag LOCUS_00770 29462 30016 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_00770 30257 31108 gene locus_tag LOCUS_00780 30257 31108 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 protein_id gnl|my_center|LOCUS_00780 31614 31102 gene locus_tag LOCUS_00790 gene moaC 31614 31102 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_00790 31721 33301 gene locus_tag LOCUS_00800 31721 33301 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 protein_id gnl|my_center|LOCUS_00800 33875 33237 gene locus_tag LOCUS_00810 33875 33237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 34537 33902 gene locus_tag LOCUS_00820 34537 33902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 34912 34598 gene locus_tag LOCUS_00830 34912 34598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 35937 34933 gene locus_tag LOCUS_00840 35937 34933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 >Feature sequence003 1412 918 gene locus_tag LOCUS_00850 1412 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 1732 1409 gene locus_tag LOCUS_00860 1732 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 3439 1958 gene locus_tag LOCUS_00870 3439 1958 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_00870 4927 3536 gene locus_tag LOCUS_00880 gene trkA 4927 3536 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038750.1 protein_id gnl|my_center|LOCUS_00880 7209 4924 gene locus_tag LOCUS_00890 7209 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 7749 7252 gene locus_tag LOCUS_00900 7749 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 8870 7770 gene locus_tag LOCUS_00910 8870 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00910 9754 8834 gene locus_tag LOCUS_00920 9754 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00920 8876 8943 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11121 9931 gene locus_tag LOCUS_00930 11121 9931 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_00930 11628 11176 gene locus_tag LOCUS_00940 11628 11176 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660532.1 protein_id gnl|my_center|LOCUS_00940 12172 11762 gene locus_tag LOCUS_00950 12172 11762 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929528.1 protein_id gnl|my_center|LOCUS_00950 12741 12217 gene locus_tag LOCUS_00960 12741 12217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 12923 14854 gene locus_tag LOCUS_00970 12923 14854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 15642 14884 gene locus_tag LOCUS_00980 15642 14884 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_00980 16466 15714 gene locus_tag LOCUS_00990 16466 15714 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_00990 17062 16463 gene locus_tag LOCUS_01000 gene gmhB 17062 16463 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_01000 19303 17084 gene locus_tag LOCUS_01010 gene glyS 19303 17084 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 protein_id gnl|my_center|LOCUS_01010 20232 19330 gene locus_tag LOCUS_01020 gene glyQ 20232 19330 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_01020 22002 20362 gene locus_tag LOCUS_01030 gene lnt 22002 20362 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040320.1 protein_id gnl|my_center|LOCUS_01030 22820 22002 gene locus_tag LOCUS_01040 22820 22002 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_01040 23515 22895 gene locus_tag LOCUS_01050 23515 22895 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202737.1 protein_id gnl|my_center|LOCUS_01050 23739 25418 gene locus_tag LOCUS_01060 23739 25418 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027995529.1 protein_id gnl|my_center|LOCUS_01060 25415 26404 gene locus_tag LOCUS_01070 25415 26404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 27362 26442 gene locus_tag LOCUS_01080 gene argC 27362 26442 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886726.1 protein_id gnl|my_center|LOCUS_01080 27755 28918 gene locus_tag LOCUS_01090 gene sucC 27755 28918 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 protein_id gnl|my_center|LOCUS_01090 28957 29472 gene locus_tag LOCUS_01100 28957 29472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 29469 29726 gene locus_tag LOCUS_01110 29469 29726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 29779 29979 gene locus_tag LOCUS_01120 29779 29979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 29976 30431 gene locus_tag LOCUS_01130 29976 30431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 31294 30443 gene locus_tag LOCUS_01140 gene pyrF 31294 30443 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_01140 31378 32148 gene locus_tag LOCUS_01150 31378 32148 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 protein_id gnl|my_center|LOCUS_01150 33433 33005 gene locus_tag LOCUS_01160 33433 33005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 34175 33402 gene locus_tag LOCUS_01170 34175 33402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 35907 34201 gene locus_tag LOCUS_01180 35907 34201 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 protein_id gnl|my_center|LOCUS_01180 >Feature sequence004 3374 198 gene locus_tag LOCUS_01190 3374 198 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_01190 4581 3394 gene locus_tag LOCUS_01200 4581 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 5198 4584 gene locus_tag LOCUS_01210 5198 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 6352 5195 gene locus_tag LOCUS_01220 6352 5195 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 protein_id gnl|my_center|LOCUS_01220 7087 6743 gene locus_tag LOCUS_01230 7087 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 8059 7163 gene locus_tag LOCUS_01240 gene hflC 8059 7163 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930787.1 protein_id gnl|my_center|LOCUS_01240 9474 8077 gene locus_tag LOCUS_01250 gene hflK 9474 8077 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_01250 10726 9551 gene locus_tag LOCUS_01260 gene hflX 10726 9551 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_01260 11032 10787 gene locus_tag LOCUS_01270 gene hfq 11032 10787 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 protein_id gnl|my_center|LOCUS_01270 12463 11114 gene locus_tag LOCUS_01280 gene der 12463 11114 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063931.1 protein_id gnl|my_center|LOCUS_01280 13536 12460 gene locus_tag LOCUS_01290 gene bamB 13536 12460 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193323.1 protein_id gnl|my_center|LOCUS_01290 13439 13684 gene locus_tag LOCUS_01300 13439 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 14383 13649 gene locus_tag LOCUS_01310 14383 13649 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_01310 15810 14515 gene locus_tag LOCUS_01320 gene hisS 15810 14515 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521334.1 protein_id gnl|my_center|LOCUS_01320 17086 15803 gene locus_tag LOCUS_01330 gene ispG 17086 15803 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527159.1 protein_id gnl|my_center|LOCUS_01330 17962 17093 gene locus_tag LOCUS_01340 17962 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 18857 18033 gene locus_tag LOCUS_01350 gene pilW 18857 18033 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209819.1 protein_id gnl|my_center|LOCUS_01350 20050 18854 gene locus_tag LOCUS_01360 gene rlmN 20050 18854 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192451.1 protein_id gnl|my_center|LOCUS_01360 20483 20058 gene locus_tag LOCUS_01370 gene ndk 20483 20058 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_01370 21868 20546 gene locus_tag LOCUS_01380 21868 20546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01380 22575 22000 gene locus_tag LOCUS_01390 22575 22000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 23618 22572 gene locus_tag LOCUS_01400 gene rluD 23618 22572 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247551.1 protein_id gnl|my_center|LOCUS_01400 23652 24491 gene locus_tag LOCUS_01410 23652 24491 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813594.1 protein_id gnl|my_center|LOCUS_01410 25773 24532 gene locus_tag LOCUS_01420 25773 24532 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_01420 27483 25930 gene locus_tag LOCUS_01430 27483 25930 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_01430 28073 27621 gene locus_tag LOCUS_01440 gene rplI 28073 27621 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 protein_id gnl|my_center|LOCUS_01440 28374 28093 gene locus_tag LOCUS_01450 gene rpsR 28374 28093 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813094.1 protein_id gnl|my_center|LOCUS_01450 28740 28387 gene locus_tag LOCUS_01460 gene priB 28740 28387 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 protein_id gnl|my_center|LOCUS_01460 29121 28759 gene locus_tag LOCUS_01470 gene rpsF 29121 28759 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 protein_id gnl|my_center|LOCUS_01470 31283 29205 gene locus_tag LOCUS_01480 31283 29205 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 protein_id gnl|my_center|LOCUS_01480 31558 31286 gene locus_tag LOCUS_01490 31558 31286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 32172 31558 gene locus_tag LOCUS_01500 32172 31558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 32471 32163 gene locus_tag LOCUS_01510 32471 32163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 33711 32560 gene locus_tag LOCUS_01520 33711 32560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 33809 34363 gene locus_tag LOCUS_01530 33809 34363 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_01530 >Feature sequence005 <1 770 gene locus_tag LOCUS_01540 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030180.1:BREX-2 system adenine-specific DNA-methyltransferase PglX 767 1255 gene locus_tag LOCUS_01550 767 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 1255 2595 gene locus_tag LOCUS_01560 1255 2595 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390742.1 protein_id gnl|my_center|LOCUS_01560 2592 4046 gene locus_tag LOCUS_01570 2592 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390741.1 protein_id gnl|my_center|LOCUS_01570 4072 7761 gene locus_tag LOCUS_01580 4072 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031061.1 protein_id gnl|my_center|LOCUS_01580 7758 10457 gene locus_tag LOCUS_01590 gene pglZ 7758 10457 CDS product BREX-2 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031062.1 protein_id gnl|my_center|LOCUS_01590 10454 11764 gene locus_tag LOCUS_01600 gene brxD 10454 11764 CDS product BREX system ATP-binding protein BrxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031065.1 protein_id gnl|my_center|LOCUS_01600 11761 13773 gene locus_tag LOCUS_01610 11761 13773 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031066.1 protein_id gnl|my_center|LOCUS_01610 13795 14856 gene locus_tag LOCUS_01620 13795 14856 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012777536.1 protein_id gnl|my_center|LOCUS_01620 16090 14741 gene locus_tag LOCUS_01630 gene miaB 16090 14741 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190165.1 protein_id gnl|my_center|LOCUS_01630 17729 16152 gene locus_tag LOCUS_01640 17729 16152 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_01640 17874 18791 gene locus_tag LOCUS_01650 gene argB 17874 18791 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_01650 18921 19529 gene locus_tag LOCUS_01660 18921 19529 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 protein_id gnl|my_center|LOCUS_01660 19571 21367 gene locus_tag LOCUS_01670 19571 21367 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526128.1 protein_id gnl|my_center|LOCUS_01670 21399 21854 gene locus_tag LOCUS_01680 21399 21854 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193599.1 protein_id gnl|my_center|LOCUS_01680 21934 24318 gene locus_tag LOCUS_01690 21934 24318 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189629.1 protein_id gnl|my_center|LOCUS_01690 24338 25573 gene locus_tag LOCUS_01700 24338 25573 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537877.1 protein_id gnl|my_center|LOCUS_01700 25606 26487 gene locus_tag LOCUS_01710 25606 26487 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087999.1 protein_id gnl|my_center|LOCUS_01710 26544 27308 gene locus_tag LOCUS_01720 26544 27308 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_01720 27322 27816 gene locus_tag LOCUS_01730 27322 27816 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_01730 27948 29465 gene locus_tag LOCUS_01740 27948 29465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 29800 30021 gene locus_tag LOCUS_01750 29800 30021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 30154 30474 gene locus_tag LOCUS_01760 30154 30474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815930.1 protein_id gnl|my_center|LOCUS_01760 30800 30468 gene locus_tag LOCUS_01770 30800 30468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 31774 30767 gene locus_tag LOCUS_01780 31774 30767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 32890 31784 gene locus_tag LOCUS_01790 32890 31784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 <33808 32793 gene locus_tag LOCUS_01800 <33808 32793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946626.1:EAL domain-containing protein >Feature sequence006 439 11 gene locus_tag LOCUS_01810 439 11 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201632.1 protein_id gnl|my_center|LOCUS_01810 486 1448 gene locus_tag LOCUS_01820 486 1448 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228493.1 protein_id gnl|my_center|LOCUS_01820 1506 2702 gene locus_tag LOCUS_01830 gene glcE 1506 2702 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_01830 2783 4075 gene locus_tag LOCUS_01840 gene glcF 2783 4075 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_01840 4089 5255 gene locus_tag LOCUS_01850 gene alr 4089 5255 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208091.1 protein_id gnl|my_center|LOCUS_01850 5376 6131 gene locus_tag LOCUS_01860 5376 6131 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039197.1 protein_id gnl|my_center|LOCUS_01860 7779 6139 gene locus_tag LOCUS_01870 7779 6139 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_01870 7817 8113 gene locus_tag LOCUS_01880 7817 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 8863 8378 gene locus_tag LOCUS_01890 8863 8378 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189275.1 protein_id gnl|my_center|LOCUS_01890 9882 8893 gene locus_tag LOCUS_01900 9882 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 10493 9882 gene locus_tag LOCUS_01910 10493 9882 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870051.1 protein_id gnl|my_center|LOCUS_01910 10858 10490 gene locus_tag LOCUS_01920 10858 10490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 12220 10928 gene locus_tag LOCUS_01930 12220 10928 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930578.1 protein_id gnl|my_center|LOCUS_01930 13294 12323 gene locus_tag LOCUS_01940 13294 12323 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204885.1 protein_id gnl|my_center|LOCUS_01940 13445 13870 gene locus_tag LOCUS_01950 13445 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 15783 13894 gene locus_tag LOCUS_01960 15783 13894 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817018.1 protein_id gnl|my_center|LOCUS_01960 17869 16025 gene locus_tag LOCUS_01970 gene recQ 17869 16025 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198363.1 protein_id gnl|my_center|LOCUS_01970 18448 18044 gene locus_tag LOCUS_01980 18448 18044 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528650.1 protein_id gnl|my_center|LOCUS_01980 19460 18453 gene locus_tag LOCUS_01990 gene hemB 19460 18453 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064749.1 protein_id gnl|my_center|LOCUS_01990 19633 20283 gene locus_tag LOCUS_02000 19633 20283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 22492 20258 gene locus_tag LOCUS_02010 22492 20258 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925701.1 protein_id gnl|my_center|LOCUS_02010 22670 23653 gene locus_tag LOCUS_02020 22670 23653 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_02020 24364 23678 gene locus_tag LOCUS_02030 24364 23678 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031579.1 protein_id gnl|my_center|LOCUS_02030 24559 25524 gene locus_tag LOCUS_02040 24559 25524 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206103.1 protein_id gnl|my_center|LOCUS_02040 25694 26368 gene locus_tag LOCUS_02050 gene ytfE 25694 26368 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331451.1 protein_id gnl|my_center|LOCUS_02050 26704 28407 gene locus_tag LOCUS_02060 gene argS 26704 28407 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522947.1 protein_id gnl|my_center|LOCUS_02060 28512 29087 gene locus_tag LOCUS_02070 28512 29087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02070 29241 29882 gene locus_tag LOCUS_02080 29241 29882 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_02080 30121 30789 gene locus_tag LOCUS_02090 30121 30789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 30786 31544 gene locus_tag LOCUS_02100 gene lptB 30786 31544 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815177.1 protein_id gnl|my_center|LOCUS_02100 31558 33309 gene locus_tag LOCUS_02110 31558 33309 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence007 2570 1791 gene locus_tag LOCUS_02120 2570 1791 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_02120 4191 2584 gene locus_tag LOCUS_02130 4191 2584 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201021.1 protein_id gnl|my_center|LOCUS_02130 5279 4335 gene locus_tag LOCUS_02140 gene trxB 5279 4335 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065064.1 protein_id gnl|my_center|LOCUS_02140 5400 7943 gene locus_tag LOCUS_02150 5400 7943 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186104.1 protein_id gnl|my_center|LOCUS_02150 8024 8785 gene locus_tag LOCUS_02160 8024 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 8808 10100 gene locus_tag LOCUS_02170 8808 10100 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930945.1 protein_id gnl|my_center|LOCUS_02170 10900 10121 gene locus_tag LOCUS_02180 gene pcaU 10900 10121 CDS product IclR family transcriptional regulator PcaU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120879.1 protein_id gnl|my_center|LOCUS_02180 11054 11983 gene locus_tag LOCUS_02190 11054 11983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 11980 12882 gene locus_tag LOCUS_02200 11980 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 13752 12919 gene locus_tag LOCUS_02210 13752 12919 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367002.1 protein_id gnl|my_center|LOCUS_02210 14137 15156 gene locus_tag LOCUS_02220 14137 15156 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039422.1 protein_id gnl|my_center|LOCUS_02220 15222 15716 gene locus_tag LOCUS_02230 15222 15716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 15716 17209 gene locus_tag LOCUS_02240 15716 17209 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 protein_id gnl|my_center|LOCUS_02240 18295 17237 gene locus_tag LOCUS_02250 18295 17237 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_02250 18505 20043 gene locus_tag LOCUS_02260 gene lysS 18505 20043 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816835.1 protein_id gnl|my_center|LOCUS_02260 21074 20115 gene locus_tag LOCUS_02270 gene rpoH 21074 20115 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195278.1 protein_id gnl|my_center|LOCUS_02270 21807 21271 gene locus_tag LOCUS_02280 21807 21271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 21992 23101 gene locus_tag LOCUS_02290 21992 23101 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_02290 23174 24607 gene locus_tag LOCUS_02300 23174 24607 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763618.1 protein_id gnl|my_center|LOCUS_02300 25571 24633 gene locus_tag LOCUS_02310 25571 24633 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196438.1 protein_id gnl|my_center|LOCUS_02310 26383 25571 gene locus_tag LOCUS_02320 26383 25571 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_02320 26512 26916 gene locus_tag LOCUS_02330 26512 26916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 28105 26885 gene locus_tag LOCUS_02340 28105 26885 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_02340 28286 29620 gene locus_tag LOCUS_02350 gene ugpB 28286 29620 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039943.1 protein_id gnl|my_center|LOCUS_02350 >Feature sequence008 334 1410 gene locus_tag LOCUS_02360 gene tilS 334 1410 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452888.1 protein_id gnl|my_center|LOCUS_02360 1473 3038 gene locus_tag LOCUS_02370 1473 3038 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087715.1 protein_id gnl|my_center|LOCUS_02370 3035 3820 gene locus_tag LOCUS_02380 3035 3820 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039912.1 protein_id gnl|my_center|LOCUS_02380 4011 5291 gene locus_tag LOCUS_02390 4011 5291 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191166.1 protein_id gnl|my_center|LOCUS_02390 5399 5491 gene locus_tag LOCUS_t00020 5399 5491 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5558 6334 gene locus_tag LOCUS_02400 5558 6334 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 protein_id gnl|my_center|LOCUS_02400 6361 6879 gene locus_tag LOCUS_02410 6361 6879 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 protein_id gnl|my_center|LOCUS_02410 6957 8792 gene locus_tag LOCUS_02420 6957 8792 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039964.1 protein_id gnl|my_center|LOCUS_02420 8936 9904 gene locus_tag LOCUS_02430 8936 9904 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_02430 9936 11162 gene locus_tag LOCUS_02440 9936 11162 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088337.1 protein_id gnl|my_center|LOCUS_02440 12730 11213 gene locus_tag LOCUS_02450 12730 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 13376 12873 gene locus_tag LOCUS_02460 13376 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 13897 13403 gene locus_tag LOCUS_02470 13897 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 14495 13881 gene locus_tag LOCUS_02480 14495 13881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 14614 15057 gene locus_tag LOCUS_02490 14614 15057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 15781 15143 gene locus_tag LOCUS_02500 15781 15143 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_02500 16487 15765 gene locus_tag LOCUS_02510 16487 15765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 18301 16484 gene locus_tag LOCUS_02520 gene nuoF 18301 16484 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_02520 18763 19278 gene locus_tag LOCUS_02530 gene msrA 18763 19278 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 protein_id gnl|my_center|LOCUS_02530 19328 20299 gene locus_tag LOCUS_02540 19328 20299 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531227.1 protein_id gnl|my_center|LOCUS_02540 22559 20391 gene locus_tag LOCUS_02550 gene metG 22559 20391 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039014.1 protein_id gnl|my_center|LOCUS_02550 22754 23836 gene locus_tag LOCUS_02560 gene apbC 22754 23836 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 protein_id gnl|my_center|LOCUS_02560 25269 23905 gene locus_tag LOCUS_02570 25269 23905 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769298.1 protein_id gnl|my_center|LOCUS_02570 26509 25367 gene locus_tag LOCUS_02580 gene bamC 26509 25367 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930437.1 protein_id gnl|my_center|LOCUS_02580 27471 26584 gene locus_tag LOCUS_02590 gene dapA 27471 26584 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 protein_id gnl|my_center|LOCUS_02590 28755 27565 gene locus_tag LOCUS_02600 28755 27565 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090686.1 protein_id gnl|my_center|LOCUS_02600 29174 29046 gene locus_tag LOCUS_02610 29174 29046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 29365 29171 gene locus_tag LOCUS_02620 29365 29171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence009 856 566 gene locus_tag LOCUS_02630 856 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 1328 1155 gene locus_tag LOCUS_02640 1328 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 4209 1636 gene locus_tag LOCUS_02650 4209 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02650 4760 5737 gene locus_tag LOCUS_02660 4760 5737 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_02660 5783 6079 gene locus_tag LOCUS_02670 5783 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 6282 6941 gene locus_tag LOCUS_02680 6282 6941 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_02680 6969 7919 gene locus_tag LOCUS_02690 gene ylqF 6969 7919 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687704.1 protein_id gnl|my_center|LOCUS_02690 7928 8542 gene locus_tag LOCUS_02700 7928 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 8564 8656 gene locus_tag LOCUS_t00030 8564 8656 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8680 9750 gene locus_tag LOCUS_02710 8680 9750 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526891.1 protein_id gnl|my_center|LOCUS_02710 9808 10440 gene locus_tag LOCUS_02720 gene plsY 9808 10440 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 protein_id gnl|my_center|LOCUS_02720 11411 10437 gene locus_tag LOCUS_02730 11411 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 11907 11422 gene locus_tag LOCUS_02740 11907 11422 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_02740 11952 12995 gene locus_tag LOCUS_02750 gene murB 11952 12995 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189377.1 protein_id gnl|my_center|LOCUS_02750 12989 14314 gene locus_tag LOCUS_02760 12989 14314 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040212.1 protein_id gnl|my_center|LOCUS_02760 14734 15000 gene locus_tag LOCUS_02770 14734 15000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 15010 15249 gene locus_tag LOCUS_02780 15010 15249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 16614 15286 gene locus_tag LOCUS_02790 gene argG 16614 15286 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688135.1 protein_id gnl|my_center|LOCUS_02790 16948 16628 gene locus_tag LOCUS_02800 16948 16628 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_02800 17138 18493 gene locus_tag LOCUS_02810 gene folC 17138 18493 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528975.1 protein_id gnl|my_center|LOCUS_02810 18560 19327 gene locus_tag LOCUS_02820 18560 19327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 19331 19816 gene locus_tag LOCUS_02830 19331 19816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 19836 21341 gene locus_tag LOCUS_02840 gene purF 19836 21341 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_02840 21348 22559 gene locus_tag LOCUS_02850 21348 22559 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_02850 22556 23119 gene locus_tag LOCUS_02860 22556 23119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02860 23127 23924 gene locus_tag LOCUS_02870 23127 23924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02870 24012 24087 gene locus_tag LOCUS_t00040 24012 24087 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 24131 24206 gene locus_tag LOCUS_t00050 24131 24206 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 24214 24290 gene locus_tag LOCUS_t00060 24214 24290 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 24775 24356 gene locus_tag LOCUS_02880 gene hicB 24775 24356 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_02880 24988 25284 gene locus_tag LOCUS_02890 24988 25284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 25547 26089 gene locus_tag LOCUS_02900 25547 26089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 26297 26452 gene locus_tag LOCUS_02910 26297 26452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 26780 28081 gene locus_tag LOCUS_02920 26780 28081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625898.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence010 1464 781 gene locus_tag LOCUS_02930 gene esaR 1464 781 CDS product response regulator transcription factor EsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189647.1 protein_id gnl|my_center|LOCUS_02930 3772 1493 gene locus_tag LOCUS_02940 3772 1493 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_02940 5981 3864 gene locus_tag LOCUS_02950 5981 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 10189 5978 gene locus_tag LOCUS_02960 gene rpoC 10189 5978 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 protein_id gnl|my_center|LOCUS_02960 14336 10218 gene locus_tag LOCUS_02970 gene rpoB 14336 10218 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198365.1 protein_id gnl|my_center|LOCUS_02970 14874 14497 gene locus_tag LOCUS_02980 gene rplL 14874 14497 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198366.1 protein_id gnl|my_center|LOCUS_02980 15414 14920 gene locus_tag LOCUS_02990 gene rplJ 15414 14920 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199864.1 protein_id gnl|my_center|LOCUS_02990 16421 15714 gene locus_tag LOCUS_03000 gene rplA 16421 15714 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 protein_id gnl|my_center|LOCUS_03000 16854 16423 gene locus_tag LOCUS_03010 gene rplK 16854 16423 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 protein_id gnl|my_center|LOCUS_03010 17150 18160 gene locus_tag LOCUS_03020 17150 18160 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 protein_id gnl|my_center|LOCUS_03020 18213 18289 gene locus_tag LOCUS_t00070 18213 18289 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19225 18587 gene locus_tag LOCUS_03030 19225 18587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098800.1 protein_id gnl|my_center|LOCUS_03030 20033 19245 gene locus_tag LOCUS_03040 20033 19245 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098801.1 protein_id gnl|my_center|LOCUS_03040 20209 21810 gene locus_tag LOCUS_03050 20209 21810 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_03050 21874 22578 gene locus_tag LOCUS_03060 21874 22578 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_03060 22773 22698 gene locus_tag LOCUS_t00080 22773 22698 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 22915 22990 gene locus_tag LOCUS_t00090 22915 22990 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24478 23015 gene locus_tag LOCUS_03070 gene purB 24478 23015 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951328.1 protein_id gnl|my_center|LOCUS_03070 25118 24630 gene locus_tag LOCUS_03080 25118 24630 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_03080 25359 25111 gene locus_tag LOCUS_03090 25359 25111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 <27574 25454 gene locus_tag LOCUS_03100 <27574 25454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939279.1:cation-transporting P-type ATPase >Feature sequence011 442 74 gene locus_tag LOCUS_03110 442 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 1585 476 gene locus_tag LOCUS_03120 gene lptG 1585 476 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191705.1 protein_id gnl|my_center|LOCUS_03120 2700 1591 gene locus_tag LOCUS_03130 gene lptF 2700 1591 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_03130 2728 4296 gene locus_tag LOCUS_03140 2728 4296 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522572.1 protein_id gnl|my_center|LOCUS_03140 4326 4814 gene locus_tag LOCUS_03150 4326 4814 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_03150 5283 4849 gene locus_tag LOCUS_03160 5283 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 6336 5509 gene locus_tag LOCUS_03170 6336 5509 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813022.1 protein_id gnl|my_center|LOCUS_03170 7033 6689 gene locus_tag LOCUS_03180 7033 6689 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192718.1 protein_id gnl|my_center|LOCUS_03180 7248 7030 gene locus_tag LOCUS_03190 7248 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 8822 7395 gene locus_tag LOCUS_03200 8822 7395 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275136.1 protein_id gnl|my_center|LOCUS_03200 9217 8879 gene locus_tag LOCUS_03210 9217 8879 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_03210 9500 11062 gene locus_tag LOCUS_03220 9500 11062 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_03220 11124 11267 gene locus_tag LOCUS_03230 11124 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 11267 13615 gene locus_tag LOCUS_03240 11267 13615 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_03240 16173 13621 gene locus_tag LOCUS_03250 gene metH 16173 13621 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197743.1 protein_id gnl|my_center|LOCUS_03250 17526 16384 gene locus_tag LOCUS_03260 gene tyrS 17526 16384 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194043.1 protein_id gnl|my_center|LOCUS_03260 17756 19138 gene locus_tag LOCUS_03270 17756 19138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 19180 20283 gene locus_tag LOCUS_03280 19180 20283 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931222.1 protein_id gnl|my_center|LOCUS_03280 20655 20290 gene locus_tag LOCUS_03290 gene erpA 20655 20290 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_03290 21274 20882 gene locus_tag LOCUS_03300 gene rpsI 21274 20882 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_03300 21717 21271 gene locus_tag LOCUS_03310 gene rplM 21717 21271 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_03310 21943 22884 gene locus_tag LOCUS_03320 gene rlmJ 21943 22884 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538077.1 protein_id gnl|my_center|LOCUS_03320 23789 22956 gene locus_tag LOCUS_03330 gene metF 23789 22956 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_03330 25355 23904 gene locus_tag LOCUS_03340 gene ahcY 25355 23904 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038714.1 protein_id gnl|my_center|LOCUS_03340 >Feature sequence012 1093 158 gene locus_tag LOCUS_03350 1093 158 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810987.1 protein_id gnl|my_center|LOCUS_03350 2284 1103 gene locus_tag LOCUS_03360 2284 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 3460 2288 gene locus_tag LOCUS_03370 3460 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 5630 3438 gene locus_tag LOCUS_03380 5630 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7084 5627 gene locus_tag LOCUS_03390 7084 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880130.1 protein_id gnl|my_center|LOCUS_03390 8529 7354 gene locus_tag LOCUS_03400 8529 7354 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191856.1 protein_id gnl|my_center|LOCUS_03400 9494 8595 gene locus_tag LOCUS_03410 9494 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 10630 9491 gene locus_tag LOCUS_03420 10630 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 11459 10764 gene locus_tag LOCUS_03430 11459 10764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930656.1 protein_id gnl|my_center|LOCUS_03430 12248 11478 gene locus_tag LOCUS_03440 12248 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 13543 12245 gene locus_tag LOCUS_03450 13543 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 14582 13557 gene locus_tag LOCUS_03460 14582 13557 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191272.1 protein_id gnl|my_center|LOCUS_03460 15852 14599 gene locus_tag LOCUS_03470 15852 14599 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_03470 17605 15968 gene locus_tag LOCUS_03480 17605 15968 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_03480 17768 19036 gene locus_tag LOCUS_03490 17768 19036 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538218.1 protein_id gnl|my_center|LOCUS_03490 19079 19516 gene locus_tag LOCUS_03500 gene msrB 19079 19516 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766799.1 protein_id gnl|my_center|LOCUS_03500 19513 19797 gene locus_tag LOCUS_03510 19513 19797 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240039.1 protein_id gnl|my_center|LOCUS_03510 19799 20620 gene locus_tag LOCUS_03520 19799 20620 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527206.1 protein_id gnl|my_center|LOCUS_03520 21663 20680 gene locus_tag LOCUS_03530 21663 20680 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037680.1 protein_id gnl|my_center|LOCUS_03530 22403 21660 gene locus_tag LOCUS_03540 22403 21660 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853488.1 protein_id gnl|my_center|LOCUS_03540 22989 22528 gene locus_tag LOCUS_03550 22989 22528 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_03550 24394 22982 gene locus_tag LOCUS_03560 24394 22982 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813089.1 protein_id gnl|my_center|LOCUS_03560 25723 24467 gene locus_tag LOCUS_03570 gene zapE 25723 24467 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 protein_id gnl|my_center|LOCUS_03570 26209 25748 gene locus_tag LOCUS_03580 26209 25748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence013 1118 1672 gene locus_tag LOCUS_03590 1118 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 1880 3268 gene locus_tag LOCUS_03600 gene zwf 1880 3268 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096859.1 protein_id gnl|my_center|LOCUS_03600 3355 4074 gene locus_tag LOCUS_03610 gene pgl 3355 4074 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266837.1 protein_id gnl|my_center|LOCUS_03610 4074 4484 gene locus_tag LOCUS_03620 4074 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 4481 5698 gene locus_tag LOCUS_03630 4481 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5707 6426 gene locus_tag LOCUS_03640 5707 6426 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072451.1 protein_id gnl|my_center|LOCUS_03640 6617 8119 gene locus_tag LOCUS_03650 gene pgi 6617 8119 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266656.1 protein_id gnl|my_center|LOCUS_03650 8143 10899 gene locus_tag LOCUS_03660 gene ppc 8143 10899 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 protein_id gnl|my_center|LOCUS_03660 10946 11695 gene locus_tag LOCUS_03670 10946 11695 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_03670 13447 11732 gene locus_tag LOCUS_03680 13447 11732 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_03680 16277 13680 gene locus_tag LOCUS_03690 16277 13680 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_03690 18205 16496 gene locus_tag LOCUS_03700 18205 16496 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813682.1 protein_id gnl|my_center|LOCUS_03700 18333 19316 gene locus_tag LOCUS_03710 18333 19316 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_03710 19608 20510 gene locus_tag LOCUS_03720 gene prfB 19608 20510 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926448.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03720 20594 23326 gene locus_tag LOCUS_03730 gene pepN 20594 23326 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149504110.1 protein_id gnl|my_center|LOCUS_03730 23376 24425 gene locus_tag LOCUS_03740 23376 24425 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_03740 24461 24676 gene locus_tag LOCUS_03750 24461 24676 CDS product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193782.1 protein_id gnl|my_center|LOCUS_03750 24754 25578 gene locus_tag LOCUS_03760 24754 25578 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence014 1 1020 gene locus_tag LOCUS_03770 1 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 1017 2567 gene locus_tag LOCUS_03780 gene flhF 1017 2567 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535477.1 protein_id gnl|my_center|LOCUS_03780 2560 3300 gene locus_tag LOCUS_03790 2560 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 3359 3991 gene locus_tag LOCUS_03800 3359 3991 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_03800 4281 4021 gene locus_tag LOCUS_03810 4281 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 4712 4389 gene locus_tag LOCUS_03820 4712 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 5493 4816 gene locus_tag LOCUS_03830 gene flgA 5493 4816 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 protein_id gnl|my_center|LOCUS_03830 5774 6202 gene locus_tag LOCUS_03840 gene flgB 5774 6202 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884694.1 protein_id gnl|my_center|LOCUS_03840 6215 6622 gene locus_tag LOCUS_03850 gene flgC 6215 6622 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817176.1 protein_id gnl|my_center|LOCUS_03850 6643 7299 gene locus_tag LOCUS_03860 gene flgD 6643 7299 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 protein_id gnl|my_center|LOCUS_03860 7331 8605 gene locus_tag LOCUS_03870 gene flgE 7331 8605 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767033.1 protein_id gnl|my_center|LOCUS_03870 8644 9387 gene locus_tag LOCUS_03880 gene flgF 8644 9387 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_03880 9418 10200 gene locus_tag LOCUS_03890 gene flgG 9418 10200 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197257.1 protein_id gnl|my_center|LOCUS_03890 10339 11013 gene locus_tag LOCUS_03900 gene flgH 10339 11013 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160434.1 protein_id gnl|my_center|LOCUS_03900 11190 12224 gene locus_tag LOCUS_03910 11190 12224 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817185.1 protein_id gnl|my_center|LOCUS_03910 12227 12541 gene locus_tag LOCUS_03920 12227 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 12538 12930 gene locus_tag LOCUS_03930 12538 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 12943 14853 gene locus_tag LOCUS_03940 gene flgK 12943 14853 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037108.1 protein_id gnl|my_center|LOCUS_03940 14866 15816 gene locus_tag LOCUS_03950 gene flgL 14866 15816 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212790.1 protein_id gnl|my_center|LOCUS_03950 17578 15932 gene locus_tag LOCUS_03960 gene groL 17578 15932 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_03960 18026 17622 gene locus_tag LOCUS_03970 18026 17622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 18651 18088 gene locus_tag LOCUS_03980 gene ampD 18651 18088 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927521.1 protein_id gnl|my_center|LOCUS_03980 18801 19664 gene locus_tag LOCUS_03990 gene pssA 18801 19664 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186682.1 protein_id gnl|my_center|LOCUS_03990 19885 21435 gene locus_tag LOCUS_04000 19885 21435 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_04000 21618 22904 gene locus_tag LOCUS_04010 gene pbpG 21618 22904 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557110.1 protein_id gnl|my_center|LOCUS_04010 23790 22984 gene locus_tag LOCUS_04020 23790 22984 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 protein_id gnl|my_center|LOCUS_04020 24718 23867 gene locus_tag LOCUS_04030 24718 23867 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192823.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence015 367 1542 gene locus_tag LOCUS_04040 367 1542 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527290.1 protein_id gnl|my_center|LOCUS_04040 1588 2949 gene locus_tag LOCUS_04050 gene rseP 1588 2949 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205137.1 protein_id gnl|my_center|LOCUS_04050 2963 5278 gene locus_tag LOCUS_04060 gene bamA 2963 5278 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_04060 5278 5826 gene locus_tag LOCUS_04070 5278 5826 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_04070 5855 6895 gene locus_tag LOCUS_04080 gene lpxD 5855 6895 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191858.1 protein_id gnl|my_center|LOCUS_04080 6895 7347 gene locus_tag LOCUS_04090 gene fabZ 6895 7347 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_04090 7344 8183 gene locus_tag LOCUS_04100 gene lpxA 7344 8183 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193051.1 protein_id gnl|my_center|LOCUS_04100 8180 9124 gene locus_tag LOCUS_04110 8180 9124 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_04110 9178 10275 gene locus_tag LOCUS_04120 9178 10275 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 protein_id gnl|my_center|LOCUS_04120 10277 11467 gene locus_tag LOCUS_04130 gene lpxB 10277 11467 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205135.1 protein_id gnl|my_center|LOCUS_04130 11439 12071 gene locus_tag LOCUS_04140 gene rnhB 11439 12071 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_04140 12068 12838 gene locus_tag LOCUS_04150 12068 12838 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063752.1 protein_id gnl|my_center|LOCUS_04150 12849 13001 gene locus_tag LOCUS_04160 12849 13001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 13002 14123 gene locus_tag LOCUS_04170 gene carA 13002 14123 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_04170 14116 17391 gene locus_tag LOCUS_04180 gene carB 14116 17391 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_04180 17517 17783 gene locus_tag LOCUS_04190 gene rpsO 17517 17783 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185828.1 protein_id gnl|my_center|LOCUS_04190 18017 20146 gene locus_tag LOCUS_04200 gene pnp 18017 20146 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 protein_id gnl|my_center|LOCUS_04200 20182 20943 gene locus_tag LOCUS_04210 gene tpiA 20182 20943 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813996.1 protein_id gnl|my_center|LOCUS_04210 20968 21351 gene locus_tag LOCUS_04220 20968 21351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 21455 21539 gene locus_tag LOCUS_t00100 21455 21539 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21618 21977 gene locus_tag LOCUS_04230 21618 21977 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 protein_id gnl|my_center|LOCUS_04230 22035 22514 gene locus_tag LOCUS_04240 22035 22514 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_04240 22604 23185 gene locus_tag LOCUS_04250 22604 23185 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_04250 23209 24462 gene locus_tag LOCUS_04260 23209 24462 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_04260 24459 24998 gene locus_tag LOCUS_04270 gene nuoE 24459 24998 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence016 <1 1720 gene locus_tag LOCUS_04280 <1 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039715.1:phosphoribosylformylglycinamidine synthase note possible pseudo, frameshifted 1632 3344 gene locus_tag LOCUS_04290 1632 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04290 3313 4170 gene locus_tag LOCUS_04300 3313 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 5315 4122 gene locus_tag LOCUS_04310 5315 4122 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_04310 6368 5316 gene locus_tag LOCUS_04320 6368 5316 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_04320 6577 7584 gene locus_tag LOCUS_04330 gene mltG 6577 7584 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191597.1 protein_id gnl|my_center|LOCUS_04330 7581 8297 gene locus_tag LOCUS_04340 gene tmk 7581 8297 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193022.1 protein_id gnl|my_center|LOCUS_04340 8294 9301 gene locus_tag LOCUS_04350 8294 9301 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_04350 9298 9663 gene locus_tag LOCUS_04360 9298 9663 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 protein_id gnl|my_center|LOCUS_04360 9680 10510 gene locus_tag LOCUS_04370 9680 10510 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_04370 10570 11136 gene locus_tag LOCUS_04380 10570 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 11299 11757 gene locus_tag LOCUS_04390 11299 11757 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064650.1 protein_id gnl|my_center|LOCUS_04390 12134 13270 gene locus_tag LOCUS_04400 12134 13270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04400 13392 14042 gene locus_tag LOCUS_04410 13392 14042 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971485.1 protein_id gnl|my_center|LOCUS_04410 14131 14958 gene locus_tag LOCUS_04420 14131 14958 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085932.1 protein_id gnl|my_center|LOCUS_04420 14996 15658 gene locus_tag LOCUS_04430 14996 15658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369874.1 protein_id gnl|my_center|LOCUS_04430 15655 16368 gene locus_tag LOCUS_04440 15655 16368 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 protein_id gnl|my_center|LOCUS_04440 16387 17166 gene locus_tag LOCUS_04450 gene aotP 16387 17166 CDS product arginine/ornithine transport ATP-binding protein AotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085940.1 protein_id gnl|my_center|LOCUS_04450 17194 17844 gene locus_tag LOCUS_04460 17194 17844 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036216.1 protein_id gnl|my_center|LOCUS_04460 17841 18629 gene locus_tag LOCUS_04470 17841 18629 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_04470 19493 20743 gene locus_tag LOCUS_04480 19493 20743 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036696.1 protein_id gnl|my_center|LOCUS_04480 20743 20988 gene locus_tag LOCUS_04490 20743 20988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04490 21633 21295 gene locus_tag LOCUS_04500 21633 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 21675 22415 gene locus_tag LOCUS_04510 21675 22415 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_04510 22818 22462 gene locus_tag LOCUS_04520 22818 22462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 >Feature sequence017 2 1345 gene locus_tag LOCUS_04530 2 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2964 1387 gene locus_tag LOCUS_04540 gene rng 2964 1387 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_04540 3687 3058 gene locus_tag LOCUS_04550 3687 3058 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 protein_id gnl|my_center|LOCUS_04550 4161 3694 gene locus_tag LOCUS_04560 gene rlmH 4161 3694 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_04560 4502 4158 gene locus_tag LOCUS_04570 4502 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04570 5598 4825 gene locus_tag LOCUS_04580 5598 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 6515 5595 gene locus_tag LOCUS_04590 gene hemF 6515 5595 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526433.1 protein_id gnl|my_center|LOCUS_04590 7804 6512 gene locus_tag LOCUS_04600 gene purD 7804 6512 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186246.1 protein_id gnl|my_center|LOCUS_04600 8529 7801 gene locus_tag LOCUS_04610 8529 7801 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930861.1 protein_id gnl|my_center|LOCUS_04610 9023 8694 gene locus_tag LOCUS_04620 9023 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 9703 9020 gene locus_tag LOCUS_04630 9703 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 11749 9716 gene locus_tag LOCUS_04640 11749 9716 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071676851.1 protein_id gnl|my_center|LOCUS_04640 13333 11840 gene locus_tag LOCUS_04650 gene sbcB 13333 11840 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123272.1 protein_id gnl|my_center|LOCUS_04650 13505 14476 gene locus_tag LOCUS_04660 13505 14476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 15471 14527 gene locus_tag LOCUS_04670 15471 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 16774 15452 gene locus_tag LOCUS_04680 16774 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 17191 16853 gene locus_tag LOCUS_04690 gene clpS 17191 16853 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_04690 18536 17283 gene locus_tag LOCUS_04700 gene icd 18536 17283 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814059.1 protein_id gnl|my_center|LOCUS_04700 18663 19232 gene locus_tag LOCUS_04710 18663 19232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 20501 19293 gene locus_tag LOCUS_04720 20501 19293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 protein_id gnl|my_center|LOCUS_04720 21269 20505 gene locus_tag LOCUS_04730 21269 20505 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_04730 22639 21266 gene locus_tag LOCUS_04740 22639 21266 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670439.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence018 <1 522 gene locus_tag LOCUS_04750 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193445.1:fatty acid desaturase 735 2111 gene locus_tag LOCUS_04760 735 2111 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_04760 2963 2124 gene locus_tag LOCUS_04770 2963 2124 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814962.1 protein_id gnl|my_center|LOCUS_04770 2975 4342 gene locus_tag LOCUS_04780 2975 4342 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_04780 4390 5181 gene locus_tag LOCUS_04790 4390 5181 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 protein_id gnl|my_center|LOCUS_04790 5308 6324 gene locus_tag LOCUS_04800 5308 6324 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192815.1 protein_id gnl|my_center|LOCUS_04800 6324 7175 gene locus_tag LOCUS_04810 6324 7175 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945656.1 protein_id gnl|my_center|LOCUS_04810 6332 6366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7193 8074 gene locus_tag LOCUS_04820 7193 8074 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240501.1 protein_id gnl|my_center|LOCUS_04820 10226 9030 gene locus_tag LOCUS_04830 10226 9030 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192588.1 protein_id gnl|my_center|LOCUS_04830 11410 10259 gene locus_tag LOCUS_04840 gene moaA 11410 10259 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_04840 11541 12080 gene locus_tag LOCUS_04850 gene ppa 11541 12080 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930982.1 protein_id gnl|my_center|LOCUS_04850 12126 14069 gene locus_tag LOCUS_04860 12126 14069 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054176.1 protein_id gnl|my_center|LOCUS_04860 14236 14574 gene locus_tag LOCUS_04870 14236 14574 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_04870 14577 15053 gene locus_tag LOCUS_04880 14577 15053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 15752 15126 gene locus_tag LOCUS_04890 15752 15126 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185518.1 protein_id gnl|my_center|LOCUS_04890 16768 15809 gene locus_tag LOCUS_04900 16768 15809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 16392 16406 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16987 18765 gene locus_tag LOCUS_04910 16987 18765 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_04910 18789 19280 gene locus_tag LOCUS_04920 gene ilvN 18789 19280 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_04920 19345 20361 gene locus_tag LOCUS_04930 gene ilvC 19345 20361 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_04930 20396 21151 gene locus_tag LOCUS_04940 20396 21151 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence019 2690 2391 gene locus_tag LOCUS_04950 2690 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 2766 4043 gene locus_tag LOCUS_04960 gene hemA 2766 4043 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209421240.1 protein_id gnl|my_center|LOCUS_04960 4051 5166 gene locus_tag LOCUS_04970 gene prfA 4051 5166 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807618.1 protein_id gnl|my_center|LOCUS_04970 5348 6115 gene locus_tag LOCUS_04980 gene prmC 5348 6115 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036071.1 protein_id gnl|my_center|LOCUS_04980 6569 6153 gene locus_tag LOCUS_04990 6569 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04990 7624 6566 gene locus_tag LOCUS_05000 7624 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05000 7834 8046 gene locus_tag LOCUS_05010 gene rpsU 7834 8046 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_05010 8268 9158 gene locus_tag LOCUS_05020 gene murI 8268 9158 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_05020 10530 9199 gene locus_tag LOCUS_05030 gene pmbA 10530 9199 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 protein_id gnl|my_center|LOCUS_05030 10684 11355 gene locus_tag LOCUS_05040 gene yjgA 10684 11355 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522378.1 protein_id gnl|my_center|LOCUS_05040 11352 11951 gene locus_tag LOCUS_05050 gene mog 11352 11951 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094685.1 protein_id gnl|my_center|LOCUS_05050 12823 12050 gene locus_tag LOCUS_05060 gene cysE 12823 12050 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_05060 13710 12835 gene locus_tag LOCUS_05070 13710 12835 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193115.1 protein_id gnl|my_center|LOCUS_05070 14148 14990 gene locus_tag LOCUS_05080 14148 14990 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_05080 15687 15058 gene locus_tag LOCUS_05090 15687 15058 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036286.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05090 16099 15917 gene locus_tag LOCUS_05100 16099 15917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 16098 18839 gene locus_tag LOCUS_05110 gene mutS 16098 18839 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_05110 18916 19614 gene locus_tag LOCUS_05120 18916 19614 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_05120 19628 21100 gene locus_tag LOCUS_05130 19628 21100 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_05130 <22373 21158 gene locus_tag LOCUS_05140 <22373 21158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193522.1:phosphoenolpyruvate synthase >Feature sequence020 <1 576 gene locus_tag LOCUS_05150 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000992642.1:purine nucleoside phosphorylase YfiH 951 493 gene locus_tag LOCUS_05160 951 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 1499 2878 gene locus_tag LOCUS_05170 gene phaC 1499 2878 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191311.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05170 2920 4098 gene locus_tag LOCUS_05180 2920 4098 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_05180 4137 4874 gene locus_tag LOCUS_05190 4137 4874 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 protein_id gnl|my_center|LOCUS_05190 6358 4901 gene locus_tag LOCUS_05200 gene hpnE 6358 4901 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040124.1 protein_id gnl|my_center|LOCUS_05200 7262 6396 gene locus_tag LOCUS_05210 gene hpnD 7262 6396 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_05210 10453 7310 gene locus_tag LOCUS_05220 10453 7310 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_05220 11683 10475 gene locus_tag LOCUS_05230 11683 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 12603 11680 gene locus_tag LOCUS_05240 gene hpnC 12603 11680 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_05240 12736 12822 gene locus_tag LOCUS_t00110 12736 12822 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12897 14207 gene locus_tag LOCUS_05250 gene tig 12897 14207 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193941.1 protein_id gnl|my_center|LOCUS_05250 14211 14822 gene locus_tag LOCUS_05260 gene clpP 14211 14822 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193408.1 protein_id gnl|my_center|LOCUS_05260 14933 16204 gene locus_tag LOCUS_05270 gene clpX 14933 16204 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_05270 16343 18784 gene locus_tag LOCUS_05280 gene lon 16343 18784 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_05280 18960 19035 gene locus_tag LOCUS_t00120 18960 19035 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19038 19111 gene locus_tag LOCUS_t00130 19038 19111 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 19165 19240 gene locus_tag LOCUS_t00140 19165 19240 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20963 19422 gene locus_tag LOCUS_05290 20963 19422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05290 <22007 21076 gene locus_tag LOCUS_05300 <22007 21076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814736.1:hydroxyacylglutathione hydrolase >Feature sequence021 2614 1268 gene locus_tag LOCUS_05310 gene glmM 2614 1268 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_05310 3605 2646 gene locus_tag LOCUS_05320 gene folP 3605 2646 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_05320 5518 3602 gene locus_tag LOCUS_05330 gene ftsH 5518 3602 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809623.1 protein_id gnl|my_center|LOCUS_05330 6339 5641 gene locus_tag LOCUS_05340 6339 5641 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193119.1 protein_id gnl|my_center|LOCUS_05340 6581 6730 gene locus_tag LOCUS_05350 6581 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6797 8926 gene locus_tag LOCUS_05360 6797 8926 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191126.1 protein_id gnl|my_center|LOCUS_05360 9605 8931 gene locus_tag LOCUS_05370 gene rpiA 9605 8931 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192848.1 protein_id gnl|my_center|LOCUS_05370 9795 10979 gene locus_tag LOCUS_05380 9795 10979 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193208.1 protein_id gnl|my_center|LOCUS_05380 12030 11086 gene locus_tag LOCUS_05390 12030 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 12824 12135 gene locus_tag LOCUS_05400 12824 12135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_05400 13057 13614 gene locus_tag LOCUS_05410 13057 13614 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247882.1 protein_id gnl|my_center|LOCUS_05410 15093 13711 gene locus_tag LOCUS_05420 15093 13711 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527146.1 protein_id gnl|my_center|LOCUS_05420 16523 15108 gene locus_tag LOCUS_05430 16523 15108 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534924.1 protein_id gnl|my_center|LOCUS_05430 17826 16570 gene locus_tag LOCUS_05440 17826 16570 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_05440 17937 18263 gene locus_tag LOCUS_05450 17937 18263 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943418.1 protein_id gnl|my_center|LOCUS_05450 18341 18796 gene locus_tag LOCUS_05460 18341 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 19052 19297 gene locus_tag LOCUS_05470 19052 19297 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010433119.1 protein_id gnl|my_center|LOCUS_05470 19609 19346 gene locus_tag LOCUS_05480 19609 19346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 19509 21551 gene locus_tag LOCUS_05490 gene mutL 19509 21551 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065015.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence022 <1 548 gene locus_tag LOCUS_05500 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000214241.1:ribosomal protein S18-alanine N-acetyltransferase 545 1519 gene locus_tag LOCUS_05510 545 1519 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452148.1 protein_id gnl|my_center|LOCUS_05510 2631 1543 gene locus_tag LOCUS_05520 2631 1543 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 protein_id gnl|my_center|LOCUS_05520 3620 2628 gene locus_tag LOCUS_05530 3620 2628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814268.1 protein_id gnl|my_center|LOCUS_05530 4545 3634 gene locus_tag LOCUS_05540 4545 3634 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815883.1 protein_id gnl|my_center|LOCUS_05540 5548 4568 gene locus_tag LOCUS_05550 5548 4568 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065034.1 protein_id gnl|my_center|LOCUS_05550 7301 5709 gene locus_tag LOCUS_05560 7301 5709 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814273.1 protein_id gnl|my_center|LOCUS_05560 7863 7414 gene locus_tag LOCUS_05570 7863 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05570 9323 7860 gene locus_tag LOCUS_05580 9323 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05580 10249 9587 gene locus_tag LOCUS_05590 10249 9587 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 protein_id gnl|my_center|LOCUS_05590 12373 10268 gene locus_tag LOCUS_05600 12373 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 13056 12361 gene locus_tag LOCUS_05610 13056 12361 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 protein_id gnl|my_center|LOCUS_05610 17240 13059 gene locus_tag LOCUS_05620 17240 13059 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009241452.1 protein_id gnl|my_center|LOCUS_05620 17333 20101 gene locus_tag LOCUS_05630 gene glnE 17333 20101 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522142.1 protein_id gnl|my_center|LOCUS_05630 20129 20428 gene locus_tag LOCUS_05640 20129 20428 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201313.1 protein_id gnl|my_center|LOCUS_05640 <21047 20490 gene locus_tag LOCUS_05650 <21047 20490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931597.1:tripartite tricarboxylate transporter substrate binding protein >Feature sequence023 1477 263 gene locus_tag LOCUS_05660 gene chrA 1477 263 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114990.1 protein_id gnl|my_center|LOCUS_05660 2956 1538 gene locus_tag LOCUS_05670 gene umuC 2956 1538 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267005.1 protein_id gnl|my_center|LOCUS_05670 3585 3004 gene locus_tag LOCUS_05680 3585 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3645 4484 gene locus_tag LOCUS_05690 3645 4484 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382904.1 protein_id gnl|my_center|LOCUS_05690 4481 5344 gene locus_tag LOCUS_05700 4481 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 5341 6072 gene locus_tag LOCUS_05710 gene mtgA 5341 6072 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522050.1 protein_id gnl|my_center|LOCUS_05710 6098 6646 gene locus_tag LOCUS_05720 gene ruvC 6098 6646 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_05720 6878 6687 gene locus_tag LOCUS_05730 6878 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 7815 6892 gene locus_tag LOCUS_05740 gene lpxC 7815 6892 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814567.1 protein_id gnl|my_center|LOCUS_05740 8780 7905 gene locus_tag LOCUS_05750 8780 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 9028 8696 gene locus_tag LOCUS_05760 9028 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 8790 8816 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10298 9069 gene locus_tag LOCUS_05770 gene ftsA 10298 9069 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_05770 11145 10312 gene locus_tag LOCUS_05780 11145 10312 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_05780 12157 11150 gene locus_tag LOCUS_05790 12157 11150 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_05790 13608 12154 gene locus_tag LOCUS_05800 gene murC 13608 12154 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814572.1 protein_id gnl|my_center|LOCUS_05800 14681 13605 gene locus_tag LOCUS_05810 gene murG 14681 13605 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039095.1 protein_id gnl|my_center|LOCUS_05810 15976 14678 gene locus_tag LOCUS_05820 gene ftsW 15976 14678 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_05820 17934 15973 gene locus_tag LOCUS_05830 17934 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 19109 17931 gene locus_tag LOCUS_05840 gene mraY 19109 17931 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194370.1 protein_id gnl|my_center|LOCUS_05840 20742 19099 gene locus_tag LOCUS_05850 gene murF 20742 19099 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence024 544 651 gene locus_tag LOCUS_r00010 544 651 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 724 1779 gene locus_tag LOCUS_05860 724 1779 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204527.1 protein_id gnl|my_center|LOCUS_05860 1787 2512 gene locus_tag LOCUS_05870 1787 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2533 3402 gene locus_tag LOCUS_05880 2533 3402 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010374294.1 protein_id gnl|my_center|LOCUS_05880 3572 3895 gene locus_tag LOCUS_05890 3572 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 4945 3962 gene locus_tag LOCUS_05900 4945 3962 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974952.1 protein_id gnl|my_center|LOCUS_05900 6589 5054 gene locus_tag LOCUS_05910 6589 5054 CDS product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 protein_id gnl|my_center|LOCUS_05910 7244 6570 gene locus_tag LOCUS_05920 7244 6570 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_05920 7464 8522 gene locus_tag LOCUS_05930 gene recA 7464 8522 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189458.1 protein_id gnl|my_center|LOCUS_05930 8560 9063 gene locus_tag LOCUS_05940 8560 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05940 10167 9064 gene locus_tag LOCUS_05950 10167 9064 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184633.1 protein_id gnl|my_center|LOCUS_05950 10296 11063 gene locus_tag LOCUS_05960 10296 11063 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667427.1 protein_id gnl|my_center|LOCUS_05960 11060 13243 gene locus_tag LOCUS_05970 11060 13243 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930590.1 protein_id gnl|my_center|LOCUS_05970 14716 13247 gene locus_tag LOCUS_05980 gene mnmE 14716 13247 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524586.1 protein_id gnl|my_center|LOCUS_05980 16486 14738 gene locus_tag LOCUS_05990 gene yidC 16486 14738 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524584.1 protein_id gnl|my_center|LOCUS_05990 16767 16483 gene locus_tag LOCUS_06000 16767 16483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 17215 16760 gene locus_tag LOCUS_06010 17215 16760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 17768 17295 gene locus_tag LOCUS_06020 17768 17295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 17819 19276 gene locus_tag LOCUS_06030 gene dnaA 17819 19276 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040794.1 protein_id gnl|my_center|LOCUS_06030 19432 20538 gene locus_tag LOCUS_06040 gene dnaN 19432 20538 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence025 669 1217 gene locus_tag LOCUS_06050 669 1217 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_06050 1511 2521 gene locus_tag LOCUS_06060 1511 2521 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256232.1 protein_id gnl|my_center|LOCUS_06060 2595 4226 gene locus_tag LOCUS_06070 2595 4226 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256231.1 protein_id gnl|my_center|LOCUS_06070 5161 4298 gene locus_tag LOCUS_06080 5161 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 5373 6131 gene locus_tag LOCUS_06090 5373 6131 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537945.1 protein_id gnl|my_center|LOCUS_06090 6250 7791 gene locus_tag LOCUS_06100 6250 7791 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138513118.1 protein_id gnl|my_center|LOCUS_06100 7804 9903 gene locus_tag LOCUS_06110 7804 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 10056 10143 gene locus_tag LOCUS_t00150 10056 10143 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11895 10291 gene locus_tag LOCUS_06120 gene purH 11895 10291 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_06120 12169 11921 gene locus_tag LOCUS_06130 12169 11921 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_06130 13224 12166 gene locus_tag LOCUS_06140 gene dusB 13224 12166 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995141.1 protein_id gnl|my_center|LOCUS_06140 13452 13943 gene locus_tag LOCUS_06150 13452 13943 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815154.1 protein_id gnl|my_center|LOCUS_06150 14368 13970 gene locus_tag LOCUS_06160 14368 13970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 15182 14379 gene locus_tag LOCUS_06170 15182 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 16900 15254 gene locus_tag LOCUS_06180 gene ettA 16900 15254 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814257.1 protein_id gnl|my_center|LOCUS_06180 17221 19050 gene locus_tag LOCUS_06190 17221 19050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 19061 19474 gene locus_tag LOCUS_06200 gene gloA 19061 19474 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688980.1 protein_id gnl|my_center|LOCUS_06200 <20061 19541 gene locus_tag LOCUS_06210 <20061 19541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065066.1:serine--tRNA ligase >Feature sequence026 989 102 gene locus_tag LOCUS_06220 989 102 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 protein_id gnl|my_center|LOCUS_06220 1517 1053 gene locus_tag LOCUS_06230 1517 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 3102 2149 gene locus_tag LOCUS_06240 gene prmA 3102 2149 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084360451.1 protein_id gnl|my_center|LOCUS_06240 4441 3092 gene locus_tag LOCUS_06250 gene accC 4441 3092 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194420.1 protein_id gnl|my_center|LOCUS_06250 4943 4455 gene locus_tag LOCUS_06260 gene accB 4943 4455 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_06260 5092 6822 gene locus_tag LOCUS_06270 gene pilB 5092 6822 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_06270 6867 8084 gene locus_tag LOCUS_06280 gene pilG 6867 8084 CDS product type 4 pilus assembly protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216405.1 protein_id gnl|my_center|LOCUS_06280 8273 8407 gene locus_tag LOCUS_06290 8273 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 8558 10837 gene locus_tag LOCUS_06300 8558 10837 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161936834.1 protein_id gnl|my_center|LOCUS_06300 10851 11930 gene locus_tag LOCUS_06310 10851 11930 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187023.1 protein_id gnl|my_center|LOCUS_06310 11927 13909 gene locus_tag LOCUS_06320 11927 13909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 13923 14768 gene locus_tag LOCUS_06330 13923 14768 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050725350.1 protein_id gnl|my_center|LOCUS_06330 16139 14796 gene locus_tag LOCUS_06340 16139 14796 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 protein_id gnl|my_center|LOCUS_06340 17149 16136 gene locus_tag LOCUS_06350 17149 16136 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_06350 17860 17156 gene locus_tag LOCUS_06360 17860 17156 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_06360 18615 17857 gene locus_tag LOCUS_06370 18615 17857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_06370 20015 18747 gene locus_tag LOCUS_06380 20015 18747 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence027 335 3 gene locus_tag LOCUS_06390 335 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 640 386 gene locus_tag LOCUS_06400 640 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2811 709 gene locus_tag LOCUS_06410 2811 709 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 protein_id gnl|my_center|LOCUS_06410 3356 2808 gene locus_tag LOCUS_06420 3356 2808 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692554.1 protein_id gnl|my_center|LOCUS_06420 4045 3353 gene locus_tag LOCUS_06430 4045 3353 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_06430 4734 4078 gene locus_tag LOCUS_06440 4734 4078 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038334.1 protein_id gnl|my_center|LOCUS_06440 5669 4731 gene locus_tag LOCUS_06450 5669 4731 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_06450 6144 8462 gene locus_tag LOCUS_06460 6144 8462 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535017.1 protein_id gnl|my_center|LOCUS_06460 8781 8446 gene locus_tag LOCUS_06470 gene cyaY 8781 8446 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815340.1 protein_id gnl|my_center|LOCUS_06470 9027 10319 gene locus_tag LOCUS_06480 gene lysA 9027 10319 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196768.1 protein_id gnl|my_center|LOCUS_06480 11721 10330 gene locus_tag LOCUS_06490 gene ccsB 11721 10330 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806943.1 protein_id gnl|my_center|LOCUS_06490 13880 11718 gene locus_tag LOCUS_06500 13880 11718 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527907.1 protein_id gnl|my_center|LOCUS_06500 14718 14059 gene locus_tag LOCUS_06510 14718 14059 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_06510 14855 15487 gene locus_tag LOCUS_06520 gene yihA 14855 15487 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521909.1 protein_id gnl|my_center|LOCUS_06520 16099 16012 gene locus_tag LOCUS_t00160 16099 16012 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 16502 17692 gene locus_tag LOCUS_06530 gene metK 16502 17692 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925730.1 protein_id gnl|my_center|LOCUS_06530 18345 17776 gene locus_tag LOCUS_06540 gene rfbC 18345 17776 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185665.1 protein_id gnl|my_center|LOCUS_06540 19282 18395 gene locus_tag LOCUS_06550 gene rfbA 19282 18395 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence028 322 789 gene locus_tag LOCUS_06560 322 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 773 1825 gene locus_tag LOCUS_06570 773 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1895 3721 gene locus_tag LOCUS_06580 gene lepA 1895 3721 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065097.1 protein_id gnl|my_center|LOCUS_06580 3736 4701 gene locus_tag LOCUS_06590 gene lepB 3736 4701 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 protein_id gnl|my_center|LOCUS_06590 4759 5103 gene locus_tag LOCUS_06600 4759 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 5103 5840 gene locus_tag LOCUS_06610 5103 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5837 6991 gene locus_tag LOCUS_06620 gene era 5837 6991 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_06620 7000 7923 gene locus_tag LOCUS_06630 7000 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 8089 8805 gene locus_tag LOCUS_06640 8089 8805 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 protein_id gnl|my_center|LOCUS_06640 8789 9040 gene locus_tag LOCUS_06650 8789 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 9022 10104 gene locus_tag LOCUS_06660 gene nagZ 9022 10104 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193430.1 protein_id gnl|my_center|LOCUS_06660 11075 10197 gene locus_tag LOCUS_06670 gene accD 11075 10197 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_06670 11983 11117 gene locus_tag LOCUS_06680 gene trpA 11983 11117 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_06680 13248 11980 gene locus_tag LOCUS_06690 gene trpB 13248 11980 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 protein_id gnl|my_center|LOCUS_06690 14030 13221 gene locus_tag LOCUS_06700 14030 13221 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528978.1 protein_id gnl|my_center|LOCUS_06700 17168 14031 gene locus_tag LOCUS_06710 17168 14031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 17050 17337 gene locus_tag LOCUS_06720 17050 17337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 18265 17465 gene locus_tag LOCUS_06730 18265 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06730 18528 18247 gene locus_tag LOCUS_06740 18528 18247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06740 >Feature sequence029 2414 1539 gene locus_tag LOCUS_06750 2414 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 3138 2296 gene locus_tag LOCUS_06760 3138 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3497 3135 gene locus_tag LOCUS_06770 3497 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 4432 3494 gene locus_tag LOCUS_06780 gene rsmH 4432 3494 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938761.1 protein_id gnl|my_center|LOCUS_06780 4871 4443 gene locus_tag LOCUS_06790 gene mraZ 4871 4443 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194130.1 protein_id gnl|my_center|LOCUS_06790 6036 5155 gene locus_tag LOCUS_06800 6036 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 7406 6069 gene locus_tag LOCUS_06810 gene hslU 7406 6069 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198316.1 protein_id gnl|my_center|LOCUS_06810 7976 7410 gene locus_tag LOCUS_06820 gene hslV 7976 7410 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 protein_id gnl|my_center|LOCUS_06820 9606 7987 gene locus_tag LOCUS_06830 9606 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 10527 9772 gene locus_tag LOCUS_06840 10527 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 11930 10830 gene locus_tag LOCUS_06850 11930 10830 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199061.1 protein_id gnl|my_center|LOCUS_06850 13070 12057 gene locus_tag LOCUS_06860 gene xerC 13070 12057 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064714.1 protein_id gnl|my_center|LOCUS_06860 13879 13190 gene locus_tag LOCUS_06870 13879 13190 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199066.1 protein_id gnl|my_center|LOCUS_06870 14927 14019 gene locus_tag LOCUS_06880 gene dapF 14927 14019 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807183.1 protein_id gnl|my_center|LOCUS_06880 15668 15009 gene locus_tag LOCUS_06890 15668 15009 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927036.1 protein_id gnl|my_center|LOCUS_06890 15852 16769 gene locus_tag LOCUS_06900 15852 16769 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532737.1 protein_id gnl|my_center|LOCUS_06900 18372 16759 gene locus_tag LOCUS_06910 18372 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence030 322 990 gene locus_tag LOCUS_06920 322 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 3943 1046 gene locus_tag LOCUS_06930 gene polA 3943 1046 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190446.1 protein_id gnl|my_center|LOCUS_06930 4025 4981 gene locus_tag LOCUS_06940 4025 4981 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 protein_id gnl|my_center|LOCUS_06940 5014 5790 gene locus_tag LOCUS_06950 5014 5790 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064051.1 protein_id gnl|my_center|LOCUS_06950 8170 5816 gene locus_tag LOCUS_06960 8170 5816 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192721.1 protein_id gnl|my_center|LOCUS_06960 9059 8241 gene locus_tag LOCUS_06970 9059 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 9925 9056 gene locus_tag LOCUS_06980 9925 9056 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081090.1 protein_id gnl|my_center|LOCUS_06980 10468 10085 gene locus_tag LOCUS_06990 10468 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 11775 10528 gene locus_tag LOCUS_07000 11775 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07000 11834 12055 gene locus_tag LOCUS_07010 11834 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 12745 12155 gene locus_tag LOCUS_07020 gene orn 12745 12155 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_07020 12829 13926 gene locus_tag LOCUS_07030 12829 13926 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189931.1 protein_id gnl|my_center|LOCUS_07030 13956 14864 gene locus_tag LOCUS_07040 gene rsgA 13956 14864 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813309.1 protein_id gnl|my_center|LOCUS_07040 15901 14960 gene locus_tag LOCUS_07050 15901 14960 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_07050 16600 15965 gene locus_tag LOCUS_07060 16600 15965 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550123.1 protein_id gnl|my_center|LOCUS_07060 16748 17197 gene locus_tag LOCUS_07070 16748 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 17311 17622 gene locus_tag LOCUS_07080 17311 17622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 18008 17673 gene locus_tag LOCUS_07090 18008 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence031 1568 1365 gene locus_tag LOCUS_07100 gene rpoZ 1568 1365 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_07100 2230 1607 gene locus_tag LOCUS_07110 gene gmk 2230 1607 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070724.1 protein_id gnl|my_center|LOCUS_07110 3132 2227 gene locus_tag LOCUS_07120 3132 2227 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 protein_id gnl|my_center|LOCUS_07120 3206 4219 gene locus_tag LOCUS_07130 3206 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 4216 5115 gene locus_tag LOCUS_07140 4216 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 5133 5921 gene locus_tag LOCUS_07150 gene rph 5133 5921 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_07150 5915 6547 gene locus_tag LOCUS_07160 gene rdgB 5915 6547 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930449.1 protein_id gnl|my_center|LOCUS_07160 6544 7764 gene locus_tag LOCUS_07170 gene hemW 6544 7764 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_07170 7885 8553 gene locus_tag LOCUS_07180 7885 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 8733 11510 gene locus_tag LOCUS_07190 8733 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 13201 11507 gene locus_tag LOCUS_07200 13201 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 13871 13350 gene locus_tag LOCUS_07210 13871 13350 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_07210 14500 13877 gene locus_tag LOCUS_07220 14500 13877 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 protein_id gnl|my_center|LOCUS_07220 15159 14578 gene locus_tag LOCUS_07230 15159 14578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 15434 16849 gene locus_tag LOCUS_07240 gene cysS 15434 16849 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192752.1 protein_id gnl|my_center|LOCUS_07240 16834 17478 gene locus_tag LOCUS_07250 16834 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence032 <1 1683 gene locus_tag LOCUS_07260 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530052.1:thioredoxin family protein 1691 2101 gene locus_tag LOCUS_07270 1691 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2120 2554 gene locus_tag LOCUS_07280 2120 2554 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_07280 2656 2847 gene locus_tag LOCUS_07290 2656 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2886 4004 gene locus_tag LOCUS_07300 gene hemE 2886 4004 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524502.1 protein_id gnl|my_center|LOCUS_07300 4439 6628 gene locus_tag LOCUS_07310 4439 6628 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205311.1 protein_id gnl|my_center|LOCUS_07310 7640 6618 gene locus_tag LOCUS_07320 7640 6618 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 protein_id gnl|my_center|LOCUS_07320 7986 10055 gene locus_tag LOCUS_07330 7986 10055 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524472.1 protein_id gnl|my_center|LOCUS_07330 10182 10658 gene locus_tag LOCUS_07340 10182 10658 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365842.1 protein_id gnl|my_center|LOCUS_07340 10655 12559 gene locus_tag LOCUS_07350 10655 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 12908 12573 gene locus_tag LOCUS_07360 12908 12573 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189842.1 protein_id gnl|my_center|LOCUS_07360 13669 12905 gene locus_tag LOCUS_07370 13669 12905 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931455.1 protein_id gnl|my_center|LOCUS_07370 14654 13671 gene locus_tag LOCUS_07380 gene fmt 14654 13671 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038739.1 protein_id gnl|my_center|LOCUS_07380 15235 14669 gene locus_tag LOCUS_07390 gene def 15235 14669 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807300.1 protein_id gnl|my_center|LOCUS_07390 15522 16706 gene locus_tag LOCUS_07400 15522 16706 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_07400 16713 17933 gene locus_tag LOCUS_07410 gene dprA 16713 17933 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence033 205 2325 gene locus_tag LOCUS_07420 205 2325 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038717.1 protein_id gnl|my_center|LOCUS_07420 2376 3323 gene locus_tag LOCUS_07430 2376 3323 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_07430 3419 3727 gene locus_tag LOCUS_07440 3419 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3800 5128 gene locus_tag LOCUS_07450 3800 5128 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197240.1 protein_id gnl|my_center|LOCUS_07450 6321 5146 gene locus_tag LOCUS_07460 6321 5146 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_07460 6411 7202 gene locus_tag LOCUS_07470 6411 7202 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_07470 7319 7543 gene locus_tag LOCUS_07480 7319 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 7825 8790 gene locus_tag LOCUS_07490 gene ttcA 7825 8790 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 protein_id gnl|my_center|LOCUS_07490 9791 8814 gene locus_tag LOCUS_07500 9791 8814 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168557.1 protein_id gnl|my_center|LOCUS_07500 9884 10522 gene locus_tag LOCUS_07510 9884 10522 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 protein_id gnl|my_center|LOCUS_07510 11633 10572 gene locus_tag LOCUS_07520 gene ruvB 11633 10572 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_07520 12239 11646 gene locus_tag LOCUS_07530 gene ruvA 12239 11646 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814226.1 protein_id gnl|my_center|LOCUS_07530 12270 13289 gene locus_tag LOCUS_07540 12270 13289 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189139.1 protein_id gnl|my_center|LOCUS_07540 13286 13780 gene locus_tag LOCUS_07550 13286 13780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 15792 13756 gene locus_tag LOCUS_07560 gene mrdA 15792 13756 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 16352 15822 gene locus_tag LOCUS_07570 gene mreD 16352 15822 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_07570 17287 16349 gene locus_tag LOCUS_07580 gene mreC 17287 16349 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_07580 17819 17307 gene locus_tag LOCUS_07590 17819 17307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence034 112 1803 gene locus_tag LOCUS_07600 112 1803 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_07600 2576 2103 gene locus_tag LOCUS_07610 2576 2103 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814554.1 protein_id gnl|my_center|LOCUS_07610 3561 2638 gene locus_tag LOCUS_07620 3561 2638 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_07620 3706 5349 gene locus_tag LOCUS_07630 3706 5349 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_07630 5389 8421 gene locus_tag LOCUS_07640 gene uvrA 5389 8421 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_07640 10397 8580 gene locus_tag LOCUS_07650 10397 8580 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_07650 10627 12990 gene locus_tag LOCUS_07660 10627 12990 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942973.1 protein_id gnl|my_center|LOCUS_07660 13021 13851 gene locus_tag LOCUS_07670 gene otsB 13021 13851 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942972.1 protein_id gnl|my_center|LOCUS_07670 13848 14102 gene locus_tag LOCUS_07680 13848 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 14172 15365 gene locus_tag LOCUS_07690 14172 15365 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_07690 15436 16986 gene locus_tag LOCUS_07700 gene gorA 15436 16986 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence035 <1 941 gene locus_tag LOCUS_07710 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816597.1:flagellar basal-body MS-ring/collar protein FliF 983 1984 gene locus_tag LOCUS_07720 gene fliG 983 1984 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_07720 1971 2687 gene locus_tag LOCUS_07730 1971 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 2743 4155 gene locus_tag LOCUS_07740 gene fliI 2743 4155 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_07740 4152 4622 gene locus_tag LOCUS_07750 4152 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 4619 5893 gene locus_tag LOCUS_07760 4619 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 6059 6601 gene locus_tag LOCUS_07770 6059 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 6650 7651 gene locus_tag LOCUS_07780 gene fliM 6650 7651 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 protein_id gnl|my_center|LOCUS_07780 7644 8054 gene locus_tag LOCUS_07790 gene fliN 7644 8054 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 protein_id gnl|my_center|LOCUS_07790 8100 8522 gene locus_tag LOCUS_07800 8100 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 8546 9319 gene locus_tag LOCUS_07810 gene fliP 8546 9319 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549847.1 protein_id gnl|my_center|LOCUS_07810 9356 9625 gene locus_tag LOCUS_07820 gene fliQ 9356 9625 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199882.1 protein_id gnl|my_center|LOCUS_07820 9640 10419 gene locus_tag LOCUS_07830 gene fliR 9640 10419 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_07830 11087 10458 gene locus_tag LOCUS_07840 gene rqpR 11087 10458 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_07840 12184 11093 gene locus_tag LOCUS_07850 12184 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 12376 12879 gene locus_tag LOCUS_07860 12376 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 12948 13310 gene locus_tag LOCUS_07870 12948 13310 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 protein_id gnl|my_center|LOCUS_07870 13380 15659 gene locus_tag LOCUS_07880 13380 15659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 15685 16521 gene locus_tag LOCUS_07890 15685 16521 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832274.1 protein_id gnl|my_center|LOCUS_07890 16528 17154 gene locus_tag LOCUS_07900 gene cheD 16528 17154 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence036 3068 189 gene locus_tag LOCUS_07910 3068 189 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_07910 3591 3310 gene locus_tag LOCUS_07920 3591 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6191 3660 gene locus_tag LOCUS_07930 6191 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 6230 6589 gene locus_tag LOCUS_07940 6230 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6586 6930 gene locus_tag LOCUS_07950 6586 6930 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_07950 8484 6952 gene locus_tag LOCUS_07960 8484 6952 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_07960 9677 8520 gene locus_tag LOCUS_07970 gene meaB 9677 8520 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_07970 10063 9677 gene locus_tag LOCUS_07980 10063 9677 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_07980 10431 10090 gene locus_tag LOCUS_07990 10431 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 12723 10489 gene locus_tag LOCUS_08000 gene scpA 12723 10489 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_08000 12938 13591 gene locus_tag LOCUS_08010 12938 13591 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038701.1 protein_id gnl|my_center|LOCUS_08010 13885 14283 gene locus_tag LOCUS_08020 13885 14283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 14326 14402 gene locus_tag LOCUS_t00170 14326 14402 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14425 15627 gene locus_tag LOCUS_08030 14425 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 15227 15301 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence037 2014 1817 gene locus_tag LOCUS_08040 2014 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2730 2047 gene locus_tag LOCUS_08050 2730 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 4151 2754 gene locus_tag LOCUS_08060 gene ffh 4151 2754 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_08060 4186 4986 gene locus_tag LOCUS_08070 4186 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4983 5249 gene locus_tag LOCUS_08080 4983 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5317 6948 gene locus_tag LOCUS_08090 5317 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 7938 6985 gene locus_tag LOCUS_08100 7938 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 8045 10267 gene locus_tag LOCUS_08110 8045 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 10312 13593 gene locus_tag LOCUS_08120 10312 13593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 14425 13613 gene locus_tag LOCUS_08130 14425 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 14921 14481 gene locus_tag LOCUS_08140 gene tolR 14921 14481 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_08140 15704 14982 gene locus_tag LOCUS_08150 gene tolQ 15704 14982 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_08150 16150 15701 gene locus_tag LOCUS_08160 gene ybgC 16150 15701 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence038 1287 343 gene locus_tag LOCUS_08170 1287 343 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194565.1 protein_id gnl|my_center|LOCUS_08170 1634 1389 gene locus_tag LOCUS_08180 1634 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 2038 1832 gene locus_tag LOCUS_08190 2038 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2682 2119 gene locus_tag LOCUS_08200 2682 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2971 2609 gene locus_tag LOCUS_08210 2971 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 3149 3808 gene locus_tag LOCUS_08220 3149 3808 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218867.1 protein_id gnl|my_center|LOCUS_08220 3867 4922 gene locus_tag LOCUS_08230 3867 4922 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_08230 4924 5607 gene locus_tag LOCUS_08240 4924 5607 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969451.1 protein_id gnl|my_center|LOCUS_08240 5629 6657 gene locus_tag LOCUS_08250 5629 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 6608 7057 gene locus_tag LOCUS_08260 6608 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 7061 7939 gene locus_tag LOCUS_08270 7061 7939 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_08270 7954 8904 gene locus_tag LOCUS_08280 7954 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 9494 8964 gene locus_tag LOCUS_08290 9494 8964 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401022.1 protein_id gnl|my_center|LOCUS_08290 9780 9505 gene locus_tag LOCUS_08300 9780 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 10023 10238 gene locus_tag LOCUS_08310 10023 10238 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_08310 10254 11870 gene locus_tag LOCUS_08320 10254 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 11874 14579 gene locus_tag LOCUS_08330 11874 14579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence039 <1 1250 gene locus_tag LOCUS_08340 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259342.1:deoxyribodipyrimidine photo-lyase 6505 1247 gene locus_tag LOCUS_08350 6505 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 8058 6568 gene locus_tag LOCUS_08360 8058 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 8652 8071 gene locus_tag LOCUS_08370 8652 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 9031 8669 gene locus_tag LOCUS_08380 gene pilH 9031 8669 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_08380 9448 9047 gene locus_tag LOCUS_08390 gene pilG 9448 9047 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_08390 9825 9517 gene locus_tag LOCUS_08400 9825 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 9861 10739 gene locus_tag LOCUS_08410 9861 10739 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929734.1 protein_id gnl|my_center|LOCUS_08410 10759 12060 gene locus_tag LOCUS_08420 gene hemL 10759 12060 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_08420 12240 12067 gene locus_tag LOCUS_08430 12240 12067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 13197 12352 gene locus_tag LOCUS_08440 13197 12352 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726751.1 protein_id gnl|my_center|LOCUS_08440 14699 13200 gene locus_tag LOCUS_08450 14699 13200 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812393.1 protein_id gnl|my_center|LOCUS_08450 15007 14702 gene locus_tag LOCUS_08460 15007 14702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 15307 15519 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agggtctatccccgcttgcgcgggggaacc >Feature sequence040 643 975 gene locus_tag LOCUS_08470 gene trxA 643 975 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380053.1 protein_id gnl|my_center|LOCUS_08470 1336 2598 gene locus_tag LOCUS_08480 gene rho 1336 2598 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810577.1 protein_id gnl|my_center|LOCUS_08480 2752 3006 gene locus_tag LOCUS_08490 2752 3006 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818624.1 protein_id gnl|my_center|LOCUS_08490 3101 4825 gene locus_tag LOCUS_08500 3101 4825 CDS product UDP phosphate-alpha-4-amino-4-deoxy-L-arabinose arabinosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521317.1 protein_id gnl|my_center|LOCUS_08500 6175 4859 gene locus_tag LOCUS_08510 gene phoR 6175 4859 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_08510 6900 6175 gene locus_tag LOCUS_08520 gene phoB 6900 6175 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192125.1 protein_id gnl|my_center|LOCUS_08520 7604 6897 gene locus_tag LOCUS_08530 gene phoU 7604 6897 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193271.1 protein_id gnl|my_center|LOCUS_08530 7741 7601 gene locus_tag LOCUS_08540 7741 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 7990 8652 gene locus_tag LOCUS_08550 7990 8652 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123659.1 protein_id gnl|my_center|LOCUS_08550 8769 10760 gene locus_tag LOCUS_08560 8769 10760 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_08560 14372 12177 gene locus_tag LOCUS_08570 gene parE 14372 12177 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185934.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence041 260 1048 gene locus_tag LOCUS_08580 260 1048 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_08580 1065 2003 gene locus_tag LOCUS_08590 1065 2003 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533957.1 protein_id gnl|my_center|LOCUS_08590 2000 2821 gene locus_tag LOCUS_08600 2000 2821 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_08600 3022 4437 gene locus_tag LOCUS_08610 gene glnA 3022 4437 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 protein_id gnl|my_center|LOCUS_08610 4473 5210 gene locus_tag LOCUS_08620 4473 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 5220 6314 gene locus_tag LOCUS_08630 gene glnL 5220 6314 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 protein_id gnl|my_center|LOCUS_08630 6404 8032 gene locus_tag LOCUS_08640 gene ntrC 6404 8032 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192209.1 protein_id gnl|my_center|LOCUS_08640 8880 8053 gene locus_tag LOCUS_08650 gene xth 8880 8053 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 protein_id gnl|my_center|LOCUS_08650 9172 13449 gene locus_tag LOCUS_08660 gene pglW 9172 13449 CDS product BREX system serine/threonine kinase PglW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031052.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence042 1496 384 gene locus_tag LOCUS_08670 1496 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08670 1699 3045 gene locus_tag LOCUS_08680 gene argA 1699 3045 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_08680 3175 3381 gene locus_tag LOCUS_08690 3175 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4762 3665 gene locus_tag LOCUS_08700 4762 3665 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930435.1 protein_id gnl|my_center|LOCUS_08700 4912 5403 gene locus_tag LOCUS_08710 4912 5403 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_08710 5874 5425 gene locus_tag LOCUS_08720 gene dut 5874 5425 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_08720 7671 5890 gene locus_tag LOCUS_08730 7671 5890 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812634.1 protein_id gnl|my_center|LOCUS_08730 8291 7668 gene locus_tag LOCUS_08740 8291 7668 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807402.1 protein_id gnl|my_center|LOCUS_08740 9578 8436 gene locus_tag LOCUS_08750 9578 8436 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567739.1 protein_id gnl|my_center|LOCUS_08750 11628 9769 gene locus_tag LOCUS_08760 gene dxs 11628 9769 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_08760 12606 11644 gene locus_tag LOCUS_08770 12606 11644 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813107.1 protein_id gnl|my_center|LOCUS_08770 12863 12618 gene locus_tag LOCUS_08780 12863 12618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 13119 14279 gene locus_tag LOCUS_08790 13119 14279 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_08790 <15062 14288 gene locus_tag LOCUS_08800 <15062 14288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056459.1:NDP-sugar synthase >Feature sequence043 226 152 gene locus_tag LOCUS_t00180 226 152 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 353 280 gene locus_tag LOCUS_t00190 353 280 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 510 425 gene locus_tag LOCUS_t00200 510 425 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1321 548 gene locus_tag LOCUS_08810 1321 548 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818450.1 protein_id gnl|my_center|LOCUS_08810 1623 1318 gene locus_tag LOCUS_08820 1623 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08820 1712 2062 gene locus_tag LOCUS_08830 1712 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 3127 2075 gene locus_tag LOCUS_08840 gene trpD 3127 2075 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035722.1 protein_id gnl|my_center|LOCUS_08840 3753 3175 gene locus_tag LOCUS_08850 3753 3175 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815390.1 protein_id gnl|my_center|LOCUS_08850 4110 3766 gene locus_tag LOCUS_08860 4110 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5609 4107 gene locus_tag LOCUS_08870 gene trpE 5609 4107 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064890.1 protein_id gnl|my_center|LOCUS_08870 5804 6394 gene locus_tag LOCUS_08880 5804 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 8415 6424 gene locus_tag LOCUS_08890 gene htpG 8415 6424 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208203.1 protein_id gnl|my_center|LOCUS_08890 8815 9066 gene locus_tag LOCUS_08900 8815 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 9378 9659 gene locus_tag LOCUS_08910 9378 9659 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_08910 9670 9969 gene locus_tag LOCUS_08920 9670 9969 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_08920 10246 10587 gene locus_tag LOCUS_08930 10246 10587 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_08930 10611 10895 gene locus_tag LOCUS_08940 10611 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 12265 11153 gene locus_tag LOCUS_08950 12265 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 13006 12326 gene locus_tag LOCUS_08960 13006 12326 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527999.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence044 1396 911 gene locus_tag LOCUS_08970 1396 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2180 1311 gene locus_tag LOCUS_08980 2180 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1406 1433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2979 2299 gene locus_tag LOCUS_08990 gene cheZ 2979 2299 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524402.1 protein_id gnl|my_center|LOCUS_08990 3359 2976 gene locus_tag LOCUS_09000 gene cheY 3359 2976 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 protein_id gnl|my_center|LOCUS_09000 3748 3422 gene locus_tag LOCUS_09010 3748 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3855 4409 gene locus_tag LOCUS_09020 3855 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 5287 4427 gene locus_tag LOCUS_09030 gene motA 5287 4427 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_09030 5636 5346 gene locus_tag LOCUS_09040 5636 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6037 5633 gene locus_tag LOCUS_09050 6037 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 6373 6062 gene locus_tag LOCUS_09060 6373 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 8224 6425 gene locus_tag LOCUS_09070 gene aspS 8224 6425 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_09070 8658 8353 gene locus_tag LOCUS_09080 8658 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 10313 8799 gene locus_tag LOCUS_09090 gene ubiB 10313 8799 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_09090 10857 10384 gene locus_tag LOCUS_09100 10857 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 11907 10906 gene locus_tag LOCUS_09110 11907 10906 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929656.1 protein_id gnl|my_center|LOCUS_09110 12663 11932 gene locus_tag LOCUS_09120 gene ubiE 12663 11932 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_09120 13303 12767 gene locus_tag LOCUS_09130 13303 12767 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550872.1 protein_id gnl|my_center|LOCUS_09130 <14856 13300 gene locus_tag LOCUS_09140 <14856 13300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815152.1:FAD/FMN-binding oxidoreductase >Feature sequence045 551 36 gene locus_tag LOCUS_09150 551 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1811 636 gene locus_tag LOCUS_09160 1811 636 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194129.1 protein_id gnl|my_center|LOCUS_09160 3100 1805 gene locus_tag LOCUS_09170 3100 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09170 4729 3167 gene locus_tag LOCUS_09180 4729 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09180 5001 5456 gene locus_tag LOCUS_09190 gene hisI 5001 5456 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201279.1 protein_id gnl|my_center|LOCUS_09190 5471 5908 gene locus_tag LOCUS_09200 5471 5908 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202813.1 protein_id gnl|my_center|LOCUS_09200 5905 6279 gene locus_tag LOCUS_09210 5905 6279 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 protein_id gnl|my_center|LOCUS_09210 6310 6669 gene locus_tag LOCUS_09220 6310 6669 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815807.1 protein_id gnl|my_center|LOCUS_09220 6848 7114 gene locus_tag LOCUS_09230 gene tatA 6848 7114 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_09230 7174 7704 gene locus_tag LOCUS_09240 gene tatB 7174 7704 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199901.1 protein_id gnl|my_center|LOCUS_09240 7722 8513 gene locus_tag LOCUS_09250 gene tatC 7722 8513 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_09250 9733 8564 gene locus_tag LOCUS_09260 9733 8564 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_09260 9843 10028 gene locus_tag LOCUS_09270 9843 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 10086 10886 gene locus_tag LOCUS_09280 10086 10886 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_09280 10913 11905 gene locus_tag LOCUS_09290 gene pdxA 10913 11905 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399975.1 protein_id gnl|my_center|LOCUS_09290 12066 12662 gene locus_tag LOCUS_09300 gene petA 12066 12662 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064798.1 protein_id gnl|my_center|LOCUS_09300 12683 14044 gene locus_tag LOCUS_09310 12683 14044 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815816.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence046 <1 1291 gene locus_tag LOCUS_09320 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809310.1:formate dehydrogenase subunit alpha 1288 1587 gene locus_tag LOCUS_09330 1288 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2976 1630 gene locus_tag LOCUS_09340 2976 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 3129 3869 gene locus_tag LOCUS_09350 3129 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3790 4830 gene locus_tag LOCUS_09360 3790 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 4827 5561 gene locus_tag LOCUS_09370 4827 5561 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688682.1 protein_id gnl|my_center|LOCUS_09370 5808 7118 gene locus_tag LOCUS_09380 5808 7118 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 protein_id gnl|my_center|LOCUS_09380 7238 7708 gene locus_tag LOCUS_09390 7238 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 7739 8734 gene locus_tag LOCUS_09400 7739 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 8719 9414 gene locus_tag LOCUS_09410 8719 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 9601 10983 gene locus_tag LOCUS_09420 9601 10983 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459021.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence047 1303 383 gene locus_tag LOCUS_09430 1303 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1488 1300 gene locus_tag LOCUS_09440 1488 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 3134 2115 gene locus_tag LOCUS_09450 gene hrcA 3134 2115 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_09450 3148 4191 gene locus_tag LOCUS_09460 3148 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4097 5479 gene locus_tag LOCUS_09470 gene recN 4097 5479 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930962.1 protein_id gnl|my_center|LOCUS_09470 5464 6333 gene locus_tag LOCUS_09480 gene rapZ 5464 6333 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815183.1 protein_id gnl|my_center|LOCUS_09480 7412 6330 gene locus_tag LOCUS_09490 gene mutY 7412 6330 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927127.1 protein_id gnl|my_center|LOCUS_09490 9366 7423 gene locus_tag LOCUS_09500 9366 7423 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_09500 10295 9480 gene locus_tag LOCUS_09510 gene mutM 10295 9480 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522858.1 protein_id gnl|my_center|LOCUS_09510 10417 12264 gene locus_tag LOCUS_09520 10417 12264 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_09520 12282 12845 gene locus_tag LOCUS_09530 12282 12845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 12878 13771 gene locus_tag LOCUS_09540 gene ispE 12878 13771 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931311.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence048 <1 1020 gene locus_tag LOCUS_09550 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039238.1:polyphosphate kinase 1 1023 1496 gene locus_tag LOCUS_09560 gene sixA 1023 1496 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_09560 2990 1506 gene locus_tag LOCUS_09570 gene ppx 2990 1506 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_09570 3245 3457 gene locus_tag LOCUS_09580 3245 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 3454 3696 gene locus_tag LOCUS_09590 3454 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3924 3604 gene locus_tag LOCUS_09600 3924 3604 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338944.1 protein_id gnl|my_center|LOCUS_09600 4188 3928 gene locus_tag LOCUS_09610 4188 3928 CDS product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338945.1 protein_id gnl|my_center|LOCUS_09610 4342 5475 gene locus_tag LOCUS_09620 gene dusA 4342 5475 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009920631.1 protein_id gnl|my_center|LOCUS_09620 5539 7884 gene locus_tag LOCUS_09630 5539 7884 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065662.1 protein_id gnl|my_center|LOCUS_09630 10749 7930 gene locus_tag LOCUS_09640 10749 7930 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_09640 11140 10880 gene locus_tag LOCUS_09650 11140 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 11526 11137 gene locus_tag LOCUS_09660 11526 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 12680 11649 gene locus_tag LOCUS_09670 12680 11649 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528683.1 protein_id gnl|my_center|LOCUS_09670 <13812 12673 gene locus_tag LOCUS_09680 <13812 12673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528682.1:cytochrome ubiquinol oxidase subunit I >Feature sequence049 1648 152 gene locus_tag LOCUS_09690 gene glpK 1648 152 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815059.1 protein_id gnl|my_center|LOCUS_09690 1920 3545 gene locus_tag LOCUS_09700 1920 3545 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931050.1 protein_id gnl|my_center|LOCUS_09700 3744 4112 gene locus_tag LOCUS_09710 gene rplN 3744 4112 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197951.1 protein_id gnl|my_center|LOCUS_09710 4124 4444 gene locus_tag LOCUS_09720 gene rplX 4124 4444 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 protein_id gnl|my_center|LOCUS_09720 4441 4986 gene locus_tag LOCUS_09730 gene rplE 4441 4986 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202757.1 protein_id gnl|my_center|LOCUS_09730 4995 5300 gene locus_tag LOCUS_09740 gene rpsN 4995 5300 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197948.1 protein_id gnl|my_center|LOCUS_09740 5321 5716 gene locus_tag LOCUS_09750 gene rpsH 5321 5716 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_09750 5741 6274 gene locus_tag LOCUS_09760 gene rplF 5741 6274 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224773.1 protein_id gnl|my_center|LOCUS_09760 6286 6654 gene locus_tag LOCUS_09770 gene rplR 6286 6654 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 protein_id gnl|my_center|LOCUS_09770 6669 7187 gene locus_tag LOCUS_09780 gene rpsE 6669 7187 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_09780 7200 7382 gene locus_tag LOCUS_09790 gene rpmD 7200 7382 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_09790 7396 7830 gene locus_tag LOCUS_09800 gene rplO 7396 7830 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_09800 7857 9176 gene locus_tag LOCUS_09810 gene secY 7857 9176 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197940.1 protein_id gnl|my_center|LOCUS_09810 9178 9396 gene locus_tag LOCUS_09820 gene infA 9178 9396 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806927.1 protein_id gnl|my_center|LOCUS_09820 9560 9925 gene locus_tag LOCUS_09830 gene rpsM 9560 9925 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_09830 9947 10351 gene locus_tag LOCUS_09840 gene rpsK 9947 10351 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806930.1 protein_id gnl|my_center|LOCUS_09840 10559 11182 gene locus_tag LOCUS_09850 gene rpsD 10559 11182 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197926.1 protein_id gnl|my_center|LOCUS_09850 11297 12283 gene locus_tag LOCUS_09860 gene rpoA 11297 12283 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_09860 12369 12776 gene locus_tag LOCUS_09870 gene rplQ 12369 12776 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 protein_id gnl|my_center|LOCUS_09870 12800 12876 gene locus_tag LOCUS_t00210 12800 12876 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <13618 12999 gene locus_tag LOCUS_09880 <13618 12999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090667.1:phosphonate ABC transporter, permease protein PhnE >Feature sequence050 133 1593 gene locus_tag LOCUS_09890 gene argH 133 1593 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 protein_id gnl|my_center|LOCUS_09890 1665 2507 gene locus_tag LOCUS_09900 1665 2507 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 protein_id gnl|my_center|LOCUS_09900 2544 3734 gene locus_tag LOCUS_09910 2544 3734 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_09910 3794 3868 gene locus_tag LOCUS_t00220 3794 3868 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5163 3916 gene locus_tag LOCUS_09920 5163 3916 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035604.1 protein_id gnl|my_center|LOCUS_09920 5477 6589 gene locus_tag LOCUS_09930 5477 6589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_09930 7699 6719 gene locus_tag LOCUS_09940 7699 6719 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329741.1 protein_id gnl|my_center|LOCUS_09940 8007 7804 gene locus_tag LOCUS_09950 8007 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 7991 8560 gene locus_tag LOCUS_09960 7991 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 8557 10020 gene locus_tag LOCUS_09970 8557 10020 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309942.1 protein_id gnl|my_center|LOCUS_09970 10060 11148 gene locus_tag LOCUS_09980 10060 11148 CDS product DUF3616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037817.1 protein_id gnl|my_center|LOCUS_09980 11193 11807 gene locus_tag LOCUS_09990 11193 11807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 11903 12700 gene locus_tag LOCUS_10000 11903 12700 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813954.1 protein_id gnl|my_center|LOCUS_10000 13388 12705 gene locus_tag LOCUS_10010 13388 12705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence051 1764 820 gene locus_tag LOCUS_10020 1764 820 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_10020 1916 3337 gene locus_tag LOCUS_10030 1916 3337 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_10030 3391 3717 gene locus_tag LOCUS_10040 3391 3717 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_10040 3779 5503 gene locus_tag LOCUS_10050 3779 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 5689 6606 gene locus_tag LOCUS_10060 5689 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 6883 6572 gene locus_tag LOCUS_10070 6883 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 6990 7394 gene locus_tag LOCUS_10080 6990 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 7469 7762 gene locus_tag LOCUS_10090 7469 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 9119 7734 gene locus_tag LOCUS_10100 9119 7734 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089662.1 protein_id gnl|my_center|LOCUS_10100 10673 9189 gene locus_tag LOCUS_10110 10673 9189 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338263.1 protein_id gnl|my_center|LOCUS_10110 11575 10670 gene locus_tag LOCUS_10120 11575 10670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 13128 11617 gene locus_tag LOCUS_10130 13128 11617 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089663.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence052 1 1017 gene locus_tag LOCUS_10140 gene pheA 1 1017 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813370.1 protein_id gnl|my_center|LOCUS_10140 1032 1943 gene locus_tag LOCUS_10150 1032 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10150 1985 4054 gene locus_tag LOCUS_10160 1985 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 4177 5856 gene locus_tag LOCUS_10170 gene rpsA 4177 5856 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_10170 5864 6163 gene locus_tag LOCUS_10180 5864 6163 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928906.1 protein_id gnl|my_center|LOCUS_10180 6243 6533 gene locus_tag LOCUS_10190 6243 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 6523 7671 gene locus_tag LOCUS_10200 gene lapB 6523 7671 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930104.1 protein_id gnl|my_center|LOCUS_10200 7717 9351 gene locus_tag LOCUS_10210 7717 9351 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_10210 9348 11000 gene locus_tag LOCUS_10220 9348 11000 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_10220 <13274 11017 gene locus_tag LOCUS_10230 <13274 11017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115850.1:aminomethyl-transferring glycine dehydrogenase >Feature sequence053 1577 390 gene locus_tag LOCUS_10240 1577 390 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 protein_id gnl|my_center|LOCUS_10240 2412 1672 gene locus_tag LOCUS_10250 2412 1672 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_10250 2733 2491 gene locus_tag LOCUS_10260 2733 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 2733 3182 gene locus_tag LOCUS_10270 2733 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3265 4530 gene locus_tag LOCUS_10280 3265 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10280 4533 6029 gene locus_tag LOCUS_10290 4533 6029 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529973.1 protein_id gnl|my_center|LOCUS_10290 6869 7237 gene locus_tag LOCUS_10300 6869 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 7274 8200 gene locus_tag LOCUS_10310 7274 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 8460 9122 gene locus_tag LOCUS_10320 gene coq7 8460 9122 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194286.1 protein_id gnl|my_center|LOCUS_10320 9606 9157 gene locus_tag LOCUS_10330 9606 9157 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808444.1 protein_id gnl|my_center|LOCUS_10330 9987 11582 gene locus_tag LOCUS_10340 gene ilvA 9987 11582 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815155.1 protein_id gnl|my_center|LOCUS_10340 11828 11658 gene locus_tag LOCUS_10350 gene rpmG 11828 11658 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810296.1 protein_id gnl|my_center|LOCUS_10350 12082 11849 gene locus_tag LOCUS_10360 gene rpmB 12082 11849 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_10360 13238 12354 gene locus_tag LOCUS_10370 13238 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence054 1534 1124 gene locus_tag LOCUS_10380 1534 1124 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_10380 2301 1552 gene locus_tag LOCUS_10390 2301 1552 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525409.1 protein_id gnl|my_center|LOCUS_10390 2520 2311 gene locus_tag LOCUS_10400 2520 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 4182 3235 gene locus_tag LOCUS_10410 4182 3235 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811174.1 protein_id gnl|my_center|LOCUS_10410 4368 5030 gene locus_tag LOCUS_10420 4368 5030 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_10420 5091 5651 gene locus_tag LOCUS_10430 5091 5651 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973634.1 protein_id gnl|my_center|LOCUS_10430 6052 5732 gene locus_tag LOCUS_10440 6052 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 6195 9770 gene locus_tag LOCUS_10450 gene dnaE 6195 9770 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522462.1 protein_id gnl|my_center|LOCUS_10450 9806 10057 gene locus_tag LOCUS_10460 9806 10057 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971060.1 protein_id gnl|my_center|LOCUS_10460 10041 10307 gene locus_tag LOCUS_10470 10041 10307 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971059.1 protein_id gnl|my_center|LOCUS_10470 10700 10314 gene locus_tag LOCUS_10480 10700 10314 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071144.1 protein_id gnl|my_center|LOCUS_10480 11590 10841 gene locus_tag LOCUS_10490 11590 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 11550 11864 gene locus_tag LOCUS_10500 11550 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 12265 11861 gene locus_tag LOCUS_10510 12265 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 12567 12280 gene locus_tag LOCUS_10520 12567 12280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 13169 12699 gene locus_tag LOCUS_10530 13169 12699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence055 6697 5885 gene locus_tag LOCUS_10540 6697 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 6937 8517 gene locus_tag LOCUS_10550 6937 8517 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063734.1 protein_id gnl|my_center|LOCUS_10550 8584 9486 gene locus_tag LOCUS_10560 8584 9486 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_10560 9567 10124 gene locus_tag LOCUS_10570 9567 10124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 11158 10217 gene locus_tag LOCUS_10580 gene trxA 11158 10217 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 protein_id gnl|my_center|LOCUS_10580 11404 11895 gene locus_tag LOCUS_10590 gene purE 11404 11895 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188932.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence056 2 151 gene locus_tag LOCUS_10600 2 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 271 882 gene locus_tag LOCUS_10610 271 882 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_10610 895 1392 gene locus_tag LOCUS_10620 895 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1407 1482 gene locus_tag LOCUS_t00230 1407 1482 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1556 1867 gene locus_tag LOCUS_10630 gene rplU 1556 1867 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_10630 1881 2156 gene locus_tag LOCUS_10640 gene rpmA 1881 2156 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807460.1 protein_id gnl|my_center|LOCUS_10640 2324 3367 gene locus_tag LOCUS_10650 gene obgE 2324 3367 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_10650 3416 4597 gene locus_tag LOCUS_10660 gene proB 3416 4597 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_10660 4727 5050 gene locus_tag LOCUS_10670 4727 5050 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925868.1 protein_id gnl|my_center|LOCUS_10670 5803 5231 gene locus_tag LOCUS_10680 5803 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 6525 5863 gene locus_tag LOCUS_10690 6525 5863 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194263.1 protein_id gnl|my_center|LOCUS_10690 6682 8427 gene locus_tag LOCUS_10700 6682 8427 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814636.1 protein_id gnl|my_center|LOCUS_10700 8435 9079 gene locus_tag LOCUS_10710 8435 9079 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_10710 9447 9112 gene locus_tag LOCUS_10720 gene grxD 9447 9112 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 protein_id gnl|my_center|LOCUS_10720 10778 9519 gene locus_tag LOCUS_10730 10778 9519 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249381.1 protein_id gnl|my_center|LOCUS_10730 11763 10807 gene locus_tag LOCUS_10740 gene argF 11763 10807 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064107.1 protein_id gnl|my_center|LOCUS_10740 <12683 11787 gene locus_tag LOCUS_10750 <12683 11787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064106.1:aspartate aminotransferase family protein >Feature sequence057 108 1346 gene locus_tag LOCUS_10760 108 1346 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_10760 1405 2715 gene locus_tag LOCUS_10770 1405 2715 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_10770 2715 4145 gene locus_tag LOCUS_10780 gene thrC 2715 4145 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_10780 4212 5564 gene locus_tag LOCUS_10790 4212 5564 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192374.1 protein_id gnl|my_center|LOCUS_10790 5816 6565 gene locus_tag LOCUS_10800 5816 6565 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_10800 6582 7514 gene locus_tag LOCUS_10810 6582 7514 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 protein_id gnl|my_center|LOCUS_10810 7613 9403 gene locus_tag LOCUS_10820 7613 9403 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_10820 9487 10431 gene locus_tag LOCUS_10830 9487 10431 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_10830 9930 10022 gene locus_tag LOCUS_t00240 9930 10022 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 10958 10455 gene locus_tag LOCUS_10840 10958 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 11122 11376 gene locus_tag LOCUS_10850 gene moaD 11122 11376 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 protein_id gnl|my_center|LOCUS_10850 11379 11702 gene locus_tag LOCUS_10860 11379 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 11675 12004 gene locus_tag LOCUS_10870 11675 12004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence058 1395 727 gene locus_tag LOCUS_10880 1395 727 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192745.1 protein_id gnl|my_center|LOCUS_10880 2083 1448 gene locus_tag LOCUS_10890 2083 1448 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_10890 2972 2100 gene locus_tag LOCUS_10900 2972 2100 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470590.1 protein_id gnl|my_center|LOCUS_10900 3837 2983 gene locus_tag LOCUS_10910 3837 2983 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_10910 3955 5520 gene locus_tag LOCUS_10920 gene murJ 3955 5520 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064095.1 protein_id gnl|my_center|LOCUS_10920 6611 5559 gene locus_tag LOCUS_10930 gene purM 6611 5559 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065013.1 protein_id gnl|my_center|LOCUS_10930 6691 7860 gene locus_tag LOCUS_10940 6691 7860 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_10940 7867 8562 gene locus_tag LOCUS_10950 gene hda 7867 8562 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929704.1 protein_id gnl|my_center|LOCUS_10950 8626 9225 gene locus_tag LOCUS_10960 8626 9225 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 protein_id gnl|my_center|LOCUS_10960 9222 10919 gene locus_tag LOCUS_10970 gene pcnB 9222 10919 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194112.1 protein_id gnl|my_center|LOCUS_10970 10947 11510 gene locus_tag LOCUS_10980 10947 11510 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065009.1 protein_id gnl|my_center|LOCUS_10980 12159 11527 gene locus_tag LOCUS_10990 gene pdxH 12159 11527 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814302.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence059 157 1386 gene locus_tag LOCUS_11000 157 1386 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195784.1 protein_id gnl|my_center|LOCUS_11000 1389 2516 gene locus_tag LOCUS_11010 1389 2516 CDS product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195787.1 protein_id gnl|my_center|LOCUS_11010 2597 3595 gene locus_tag LOCUS_11020 2597 3595 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_11020 3592 4548 gene locus_tag LOCUS_11030 3592 4548 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205164.1 protein_id gnl|my_center|LOCUS_11030 4553 5176 gene locus_tag LOCUS_11040 4553 5176 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184853.1 protein_id gnl|my_center|LOCUS_11040 5187 5738 gene locus_tag LOCUS_11050 5187 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 5738 6121 gene locus_tag LOCUS_11060 5738 6121 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524671.1 protein_id gnl|my_center|LOCUS_11060 6111 6728 gene locus_tag LOCUS_11070 6111 6728 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186908.1 protein_id gnl|my_center|LOCUS_11070 6739 8223 gene locus_tag LOCUS_11080 6739 8223 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809435.1 protein_id gnl|my_center|LOCUS_11080 8220 9215 gene locus_tag LOCUS_11090 8220 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 9154 10203 gene locus_tag LOCUS_11100 9154 10203 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_11100 10547 11902 gene locus_tag LOCUS_11110 10547 11902 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039905.1 protein_id gnl|my_center|LOCUS_11110 12251 11904 gene locus_tag LOCUS_11120 12251 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11120 >Feature sequence060 237 653 gene locus_tag LOCUS_11130 gene nirD 237 653 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_11130 665 3604 gene locus_tag LOCUS_11140 665 3604 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113578.1 protein_id gnl|my_center|LOCUS_11140 3634 4611 gene locus_tag LOCUS_11150 gene ybiB 3634 4611 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195270.1 protein_id gnl|my_center|LOCUS_11150 4615 5469 gene locus_tag LOCUS_11160 gene cobA 4615 5469 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198742.1 protein_id gnl|my_center|LOCUS_11160 6588 5623 gene locus_tag LOCUS_11170 gene ispH 6588 5623 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186453.1 protein_id gnl|my_center|LOCUS_11170 7058 6588 gene locus_tag LOCUS_11180 7058 6588 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 protein_id gnl|my_center|LOCUS_11180 7072 7734 gene locus_tag LOCUS_11190 gene radC 7072 7734 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185928.1 protein_id gnl|my_center|LOCUS_11190 9351 7756 gene locus_tag LOCUS_11200 gene ahpF 9351 7756 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389171.1 protein_id gnl|my_center|LOCUS_11200 9991 9428 gene locus_tag LOCUS_11210 gene ahpC 9991 9428 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036070.1 protein_id gnl|my_center|LOCUS_11210 <11649 10138 gene locus_tag LOCUS_11220 <11649 10138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704254.1:CoA-acylating methylmalonate-semialdehyde dehydrogenase >Feature sequence061 1255 2265 gene locus_tag LOCUS_11230 1255 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2267 2740 gene locus_tag LOCUS_11240 2267 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 2737 6153 gene locus_tag LOCUS_11250 2737 6153 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_11250 8117 6198 gene locus_tag LOCUS_11260 8117 6198 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 protein_id gnl|my_center|LOCUS_11260 8820 8158 gene locus_tag LOCUS_11270 8820 8158 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040404.1 protein_id gnl|my_center|LOCUS_11270 9253 9591 gene locus_tag LOCUS_11280 9253 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 9935 10900 gene locus_tag LOCUS_11290 9935 10900 CDS product IS1595-like element ISAhy1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706088.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence062 <1 2187 gene locus_tag LOCUS_11300 <1 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814429.1:LPS-assembly protein LptD 2180 3610 gene locus_tag LOCUS_11310 2180 3610 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_11310 3626 4531 gene locus_tag LOCUS_11320 gene rsmA 3626 4531 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189099.1 protein_id gnl|my_center|LOCUS_11320 5064 4528 gene locus_tag LOCUS_11330 5064 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 7696 5369 gene locus_tag LOCUS_11340 7696 5369 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194063.1 protein_id gnl|my_center|LOCUS_11340 8747 7842 gene locus_tag LOCUS_11350 8747 7842 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110400.1 protein_id gnl|my_center|LOCUS_11350 9313 8744 gene locus_tag LOCUS_11360 9313 8744 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_11360 9564 10376 gene locus_tag LOCUS_11370 9564 10376 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_11370 10456 10782 gene locus_tag LOCUS_11380 10456 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence063 3271 1322 gene locus_tag LOCUS_11390 3271 1322 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901007.1 protein_id gnl|my_center|LOCUS_11390 3729 3316 gene locus_tag LOCUS_11400 gene vapC 3729 3316 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331362.1 protein_id gnl|my_center|LOCUS_11400 3985 3734 gene locus_tag LOCUS_11410 3985 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5366 4104 gene locus_tag LOCUS_11420 5366 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 7525 5345 gene locus_tag LOCUS_11430 7525 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 7548 7736 gene locus_tag LOCUS_11440 7548 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 7804 9252 gene locus_tag LOCUS_11450 7804 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 8357 8270 gene locus_tag LOCUS_t00250 8357 8270 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10551 9292 gene locus_tag LOCUS_11460 10551 9292 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813884.1 protein_id gnl|my_center|LOCUS_11460 <11196 10575 gene locus_tag LOCUS_11470 <11196 10575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199523.1:two-component system response regulator OmpR >Feature sequence064 1481 2299 gene locus_tag LOCUS_11480 1481 2299 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192738.1 protein_id gnl|my_center|LOCUS_11480 3554 5023 gene locus_tag LOCUS_11490 3554 5023 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720742.1 protein_id gnl|my_center|LOCUS_11490 6721 5102 gene locus_tag LOCUS_11500 6721 5102 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121878.1 protein_id gnl|my_center|LOCUS_11500 6992 6723 gene locus_tag LOCUS_11510 6992 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 7874 7158 gene locus_tag LOCUS_11520 7874 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 8763 7861 gene locus_tag LOCUS_11530 8763 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 9880 8750 gene locus_tag LOCUS_11540 gene cobT 9880 8750 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 protein_id gnl|my_center|LOCUS_11540 <11119 9913 gene locus_tag LOCUS_11550 <11119 9913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012695322.1:cobyric acid synthase >Feature sequence065 598 1011 gene locus_tag LOCUS_11560 598 1011 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821377.1 protein_id gnl|my_center|LOCUS_11560 1023 1448 gene locus_tag LOCUS_11570 gene nikR 1023 1448 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190057.1 protein_id gnl|my_center|LOCUS_11570 1405 1692 gene locus_tag LOCUS_11580 1405 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1693 1920 gene locus_tag LOCUS_11590 1693 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1956 2687 gene locus_tag LOCUS_11600 1956 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2666 3391 gene locus_tag LOCUS_11610 2666 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3391 4335 gene locus_tag LOCUS_11620 3391 4335 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_11620 4332 5015 gene locus_tag LOCUS_11630 4332 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 5020 5301 gene locus_tag LOCUS_11640 5020 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 5298 5798 gene locus_tag LOCUS_11650 5298 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11650 5802 6515 gene locus_tag LOCUS_11660 5802 6515 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385806.1 protein_id gnl|my_center|LOCUS_11660 6829 6617 gene locus_tag LOCUS_11670 6829 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 6958 7362 gene locus_tag LOCUS_11680 6958 7362 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526841.1 protein_id gnl|my_center|LOCUS_11680 7418 7494 gene locus_tag LOCUS_t00260 7418 7494 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7720 8922 gene locus_tag LOCUS_11690 gene pcaF 7720 8922 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 protein_id gnl|my_center|LOCUS_11690 10447 8942 gene locus_tag LOCUS_11700 10447 8942 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063671.1 protein_id gnl|my_center|LOCUS_11700 <11115 10475 gene locus_tag LOCUS_11710 <11115 10475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389759.1:CaiB/BaiF CoA-transferase family protein >Feature sequence066 443 1639 gene locus_tag LOCUS_11720 443 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1804 2733 gene locus_tag LOCUS_11730 1804 2733 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568579.1 protein_id gnl|my_center|LOCUS_11730 3008 3778 gene locus_tag LOCUS_11740 3008 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4231 3791 gene locus_tag LOCUS_11750 4231 3791 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389967.1 protein_id gnl|my_center|LOCUS_11750 4486 4235 gene locus_tag LOCUS_11760 4486 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4855 5685 gene locus_tag LOCUS_11770 4855 5685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818606.1 protein_id gnl|my_center|LOCUS_11770 5727 6539 gene locus_tag LOCUS_11780 5727 6539 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929635.1 protein_id gnl|my_center|LOCUS_11780 7733 6561 gene locus_tag LOCUS_11790 7733 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 7939 8412 gene locus_tag LOCUS_11800 7939 8412 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_11800 8436 9182 gene locus_tag LOCUS_11810 8436 9182 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence067 <1 816 gene locus_tag LOCUS_11820 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199069.1:methionine adenosyltransferase 774 1901 gene locus_tag LOCUS_11830 774 1901 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199940.1 protein_id gnl|my_center|LOCUS_11830 1974 2210 gene locus_tag LOCUS_11840 1974 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2329 3192 gene locus_tag LOCUS_11850 2329 3192 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199935.1 protein_id gnl|my_center|LOCUS_11850 3222 4328 gene locus_tag LOCUS_11860 3222 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 4444 4884 gene locus_tag LOCUS_11870 4444 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 4933 5898 gene locus_tag LOCUS_11880 4933 5898 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973815.1 protein_id gnl|my_center|LOCUS_11880 5895 6692 gene locus_tag LOCUS_11890 5895 6692 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 protein_id gnl|my_center|LOCUS_11890 6689 7453 gene locus_tag LOCUS_11900 6689 7453 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 protein_id gnl|my_center|LOCUS_11900 7444 8643 gene locus_tag LOCUS_11910 7444 8643 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973818.1 protein_id gnl|my_center|LOCUS_11910 8735 9931 gene locus_tag LOCUS_11920 8735 9931 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198124.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence068 1855 293 gene locus_tag LOCUS_11930 1855 293 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11930 2233 1856 gene locus_tag LOCUS_11940 2233 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2654 2154 gene locus_tag LOCUS_11950 2654 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2908 2690 gene locus_tag LOCUS_11960 2908 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3698 2910 gene locus_tag LOCUS_11970 3698 2910 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337887.1 protein_id gnl|my_center|LOCUS_11970 4303 3749 gene locus_tag LOCUS_11980 4303 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11980 5304 4255 gene locus_tag LOCUS_11990 5304 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11990 6383 5301 gene locus_tag LOCUS_12000 6383 5301 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 protein_id gnl|my_center|LOCUS_12000 7404 6367 gene locus_tag LOCUS_12010 7404 6367 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 protein_id gnl|my_center|LOCUS_12010 9310 7406 gene locus_tag LOCUS_12020 9310 7406 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535437.1 protein_id gnl|my_center|LOCUS_12020 9435 10184 gene locus_tag LOCUS_12030 gene fabI 9435 10184 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191586.1 protein_id gnl|my_center|LOCUS_12030 10575 10204 gene locus_tag LOCUS_12040 10575 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence069 488 171 gene locus_tag LOCUS_12050 488 171 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529164.1 protein_id gnl|my_center|LOCUS_12050 751 488 gene locus_tag LOCUS_12060 751 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 924 1166 gene locus_tag LOCUS_12070 924 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1163 1426 gene locus_tag LOCUS_12080 1163 1426 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_12080 1601 3073 gene locus_tag LOCUS_12090 1601 3073 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_12090 3104 3862 gene locus_tag LOCUS_12100 3104 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 4628 4032 gene locus_tag LOCUS_12110 4628 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4933 4619 gene locus_tag LOCUS_12120 4933 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 4826 7237 gene locus_tag LOCUS_12130 4826 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12130 7234 8487 gene locus_tag LOCUS_12140 7234 8487 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_12140 9239 8541 gene locus_tag LOCUS_12150 9239 8541 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_12150 9773 9279 gene locus_tag LOCUS_12160 9773 9279 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398896.1 protein_id gnl|my_center|LOCUS_12160 10128 9787 gene locus_tag LOCUS_12170 10128 9787 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811464.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence070 <1 672 gene locus_tag LOCUS_12180 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194308.1:thiamine-phosphate kinase 875 1792 gene locus_tag LOCUS_12190 875 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1789 2403 gene locus_tag LOCUS_12200 1789 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2429 2926 gene locus_tag LOCUS_12210 2429 2926 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 protein_id gnl|my_center|LOCUS_12210 4141 3221 gene locus_tag LOCUS_12220 4141 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 5787 4294 gene locus_tag LOCUS_12230 5787 4294 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549996.1 protein_id gnl|my_center|LOCUS_12230 6641 5784 gene locus_tag LOCUS_12240 6641 5784 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927035.1 protein_id gnl|my_center|LOCUS_12240 8860 6647 gene locus_tag LOCUS_12250 8860 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 9817 9035 gene locus_tag LOCUS_12260 9817 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 <10355 9811 gene locus_tag LOCUS_12270 <10355 9811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039011.1:bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA >Feature sequence071 263 81 gene locus_tag LOCUS_12280 263 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 778 326 gene locus_tag LOCUS_12290 778 326 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_12290 1017 775 gene locus_tag LOCUS_12300 1017 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1010 1159 gene locus_tag LOCUS_12310 1010 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3205 1127 gene locus_tag LOCUS_12320 3205 1127 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706692.1 protein_id gnl|my_center|LOCUS_12320 3624 3202 gene locus_tag LOCUS_12330 3624 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4193 3621 gene locus_tag LOCUS_12340 4193 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 4630 4430 gene locus_tag LOCUS_12350 4630 4430 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_12350 5112 4885 gene locus_tag LOCUS_12360 5112 4885 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106997.1 protein_id gnl|my_center|LOCUS_12360 5696 5268 gene locus_tag LOCUS_12370 5696 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 6276 5686 gene locus_tag LOCUS_12380 6276 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 6693 6487 gene locus_tag LOCUS_12390 6693 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12390 6821 6645 gene locus_tag LOCUS_12400 6821 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 7247 6852 gene locus_tag LOCUS_12410 7247 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 7597 7247 gene locus_tag LOCUS_12420 7597 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 8336 7716 gene locus_tag LOCUS_12430 8336 7716 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919360.1 protein_id gnl|my_center|LOCUS_12430 9382 8333 gene locus_tag LOCUS_12440 9382 8333 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103695.1 protein_id gnl|my_center|LOCUS_12440 10146 9382 gene locus_tag LOCUS_12450 10146 9382 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535747.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence072 3150 274 gene locus_tag LOCUS_12460 gene ileS 3150 274 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185348.1 protein_id gnl|my_center|LOCUS_12460 4286 3225 gene locus_tag LOCUS_12470 4286 3225 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_12470 4498 5040 gene locus_tag LOCUS_12480 4498 5040 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_12480 5194 7383 gene locus_tag LOCUS_12490 gene katG 5194 7383 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_12490 7498 9555 gene locus_tag LOCUS_12500 7498 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_12500 <10324 9557 gene locus_tag LOCUS_12510 <10324 9557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526465.1:acyl-CoA dehydrogenase >Feature sequence073 1006 143 gene locus_tag LOCUS_12520 1006 143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_12520 2525 1071 gene locus_tag LOCUS_12530 2525 1071 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886828.1 protein_id gnl|my_center|LOCUS_12530 7352 2589 gene locus_tag LOCUS_12540 7352 2589 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_12540 8255 7566 gene locus_tag LOCUS_12550 8255 7566 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 protein_id gnl|my_center|LOCUS_12550 9467 8277 gene locus_tag LOCUS_12560 9467 8277 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521919.1 protein_id gnl|my_center|LOCUS_12560 <10237 9460 gene locus_tag LOCUS_12570 <10237 9460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003806948.1:3-dehydroquinate synthase >Feature sequence074 228 884 gene locus_tag LOCUS_12580 228 884 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 protein_id gnl|my_center|LOCUS_12580 881 2830 gene locus_tag LOCUS_12590 881 2830 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811551.1 protein_id gnl|my_center|LOCUS_12590 3039 3572 gene locus_tag LOCUS_12600 gene iscR 3039 3572 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_12600 3575 4789 gene locus_tag LOCUS_12610 3575 4789 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_12610 4832 5263 gene locus_tag LOCUS_12620 gene iscU 4832 5263 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_12620 5290 5613 gene locus_tag LOCUS_12630 gene iscA 5290 5613 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_12630 5621 6211 gene locus_tag LOCUS_12640 gene hscB 5621 6211 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_12640 6221 8131 gene locus_tag LOCUS_12650 gene hscA 6221 8131 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930571.1 protein_id gnl|my_center|LOCUS_12650 8165 8503 gene locus_tag LOCUS_12660 gene fdx 8165 8503 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812453.1 protein_id gnl|my_center|LOCUS_12660 8511 9377 gene locus_tag LOCUS_12670 gene dnaQ 8511 9377 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_12670 9527 9451 gene locus_tag LOCUS_t00270 9527 9451 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence075 74 460 gene locus_tag LOCUS_12680 74 460 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_12680 457 1662 gene locus_tag LOCUS_12690 457 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1813 4386 gene locus_tag LOCUS_12700 1813 4386 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_12700 4509 4985 gene locus_tag LOCUS_12710 4509 4985 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_12710 5379 6878 gene locus_tag LOCUS_12720 5379 6878 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206399.1 protein_id gnl|my_center|LOCUS_12720 6922 8226 gene locus_tag LOCUS_12730 6922 8226 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194166.1 protein_id gnl|my_center|LOCUS_12730 8795 8289 gene locus_tag LOCUS_12740 8795 8289 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930687.1 protein_id gnl|my_center|LOCUS_12740 9132 8827 gene locus_tag LOCUS_12750 9132 8827 CDS product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526463.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence076 436 2 gene locus_tag LOCUS_12760 gene sdhC 436 2 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536542.1 protein_id gnl|my_center|LOCUS_12760 1394 603 gene locus_tag LOCUS_12770 1394 603 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813656.1 protein_id gnl|my_center|LOCUS_12770 1521 2507 gene locus_tag LOCUS_12780 1521 2507 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_12780 2540 4108 gene locus_tag LOCUS_12790 2540 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4149 6758 gene locus_tag LOCUS_12800 gene acnB 4149 6758 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064143.1 protein_id gnl|my_center|LOCUS_12800 8874 6841 gene locus_tag LOCUS_12810 8874 6841 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388687.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence077 830 12 gene locus_tag LOCUS_12820 830 12 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522973.1 protein_id gnl|my_center|LOCUS_12820 1694 1149 gene locus_tag LOCUS_12830 gene flhC 1694 1149 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_12830 2100 1738 gene locus_tag LOCUS_12840 gene flhD 2100 1738 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097770.1 protein_id gnl|my_center|LOCUS_12840 2877 2299 gene locus_tag LOCUS_12850 2877 2299 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_12850 2984 4399 gene locus_tag LOCUS_12860 2984 4399 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064125.1 protein_id gnl|my_center|LOCUS_12860 4396 7569 gene locus_tag LOCUS_12870 4396 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 8652 7672 gene locus_tag LOCUS_12880 8652 7672 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806881.1 protein_id gnl|my_center|LOCUS_12880 9474 8701 gene locus_tag LOCUS_12890 9474 8701 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence078 55 1227 gene locus_tag LOCUS_12900 gene mltB 55 1227 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926823.1 protein_id gnl|my_center|LOCUS_12900 1232 2386 gene locus_tag LOCUS_12910 1232 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4939 2396 gene locus_tag LOCUS_12920 4939 2396 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063648.1 protein_id gnl|my_center|LOCUS_12920 5152 5631 gene locus_tag LOCUS_12930 5152 5631 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197479.1 protein_id gnl|my_center|LOCUS_12930 7994 5628 gene locus_tag LOCUS_12940 gene parC 7994 5628 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063976.1 protein_id gnl|my_center|LOCUS_12940 9062 8052 gene locus_tag LOCUS_12950 gene intI1 9062 8052 CDS product class 1 integron integrase IntI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845048.1 protein_id gnl|my_center|LOCUS_12950 9476 9210 gene locus_tag LOCUS_12960 9476 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence079 <1 1137 gene locus_tag LOCUS_12970 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096587.1:chromate efflux transporter 2221 1403 gene locus_tag LOCUS_12980 2221 1403 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090581.1 protein_id gnl|my_center|LOCUS_12980 2665 3255 gene locus_tag LOCUS_12990 2665 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 3375 5330 gene locus_tag LOCUS_13000 gene dnaK 3375 5330 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194034.1 protein_id gnl|my_center|LOCUS_13000 5447 6583 gene locus_tag LOCUS_13010 gene dnaJ 5447 6583 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_13010 6604 7968 gene locus_tag LOCUS_13020 6604 7968 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931030.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence080 242 167 gene locus_tag LOCUS_t00280 242 167 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2215 269 gene locus_tag LOCUS_13030 2215 269 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039990.1 protein_id gnl|my_center|LOCUS_13030 2350 2275 gene locus_tag LOCUS_t00290 2350 2275 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4418 2478 gene locus_tag LOCUS_13040 4418 2478 CDS product bifunctional anthranilate synthase component I family protein/class IV aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225844.1 protein_id gnl|my_center|LOCUS_13040 5614 4415 gene locus_tag LOCUS_13050 5614 4415 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085700.1 protein_id gnl|my_center|LOCUS_13050 6582 5632 gene locus_tag LOCUS_13060 6582 5632 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257820.1 protein_id gnl|my_center|LOCUS_13060 7207 6638 gene locus_tag LOCUS_13070 gene pgsA 7207 6638 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_13070 9140 7251 gene locus_tag LOCUS_13080 gene uvrC 9140 7251 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192853.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence081 2562 1618 gene locus_tag LOCUS_13090 gene aztC 2562 1618 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972822.1 protein_id gnl|my_center|LOCUS_13090 3439 2567 gene locus_tag LOCUS_13100 3439 2567 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391450.1 protein_id gnl|my_center|LOCUS_13100 4428 3439 gene locus_tag LOCUS_13110 4428 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4563 5072 gene locus_tag LOCUS_13120 4563 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5069 5725 gene locus_tag LOCUS_13130 5069 5725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_13130 5722 6933 gene locus_tag LOCUS_13140 5722 6933 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864646.1 protein_id gnl|my_center|LOCUS_13140 6940 7254 gene locus_tag LOCUS_13150 6940 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 7244 7855 gene locus_tag LOCUS_13160 7244 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 8491 8168 gene locus_tag LOCUS_13170 8491 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 8928 8647 gene locus_tag LOCUS_13180 8928 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence082 <1 807 gene locus_tag LOCUS_13190 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004557250.1:glutamate-5-semialdehyde dehydrogenase 814 2145 gene locus_tag LOCUS_13200 814 2145 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103404.1 protein_id gnl|my_center|LOCUS_13200 2181 3431 gene locus_tag LOCUS_13210 gene mnmA 2181 3431 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039549.1 protein_id gnl|my_center|LOCUS_13210 3418 5151 gene locus_tag LOCUS_13220 3418 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 5333 6802 gene locus_tag LOCUS_13230 5333 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 7450 6827 gene locus_tag LOCUS_13240 7450 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 <8962 7384 gene locus_tag LOCUS_13250 <8962 7384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_070065546.1:enhanced entry virulence factor RtxA >Feature sequence083 <1 805 gene locus_tag LOCUS_13260 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931319.1:phosphomannomutase/phosphoglucomutase note possible pseudo, frameshifted 808 1869 gene locus_tag LOCUS_13270 808 1869 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088671.1 protein_id gnl|my_center|LOCUS_13270 1859 3328 gene locus_tag LOCUS_13280 gene waaA 1859 3328 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532247.1 protein_id gnl|my_center|LOCUS_13280 3923 3348 gene locus_tag LOCUS_13290 3923 3348 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064487.1 protein_id gnl|my_center|LOCUS_13290 3978 6629 gene locus_tag LOCUS_13300 gene alaS 3978 6629 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_13300 7505 6762 gene locus_tag LOCUS_13310 7505 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 8802 7600 gene locus_tag LOCUS_13320 gene ribD 8802 7600 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186140.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence084 170 334 gene locus_tag LOCUS_13330 170 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 436 1365 gene locus_tag LOCUS_13340 436 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1440 1742 gene locus_tag LOCUS_13350 1440 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 2507 1788 gene locus_tag LOCUS_13360 gene fnr 2507 1788 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 protein_id gnl|my_center|LOCUS_13360 2657 4036 gene locus_tag LOCUS_13370 gene hemN 2657 4036 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064046.1 protein_id gnl|my_center|LOCUS_13370 4075 4785 gene locus_tag LOCUS_13380 4075 4785 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766954.1 protein_id gnl|my_center|LOCUS_13380 5023 6354 gene locus_tag LOCUS_13390 gene aceA 5023 6354 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 protein_id gnl|my_center|LOCUS_13390 6522 6755 gene locus_tag LOCUS_13400 gene vapB 6522 6755 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170066.1 protein_id gnl|my_center|LOCUS_13400 6757 7158 gene locus_tag LOCUS_13410 gene vapC 6757 7158 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170069.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence085 1045 680 gene locus_tag LOCUS_13420 gene gcvH 1045 680 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971640.1 protein_id gnl|my_center|LOCUS_13420 2306 1128 gene locus_tag LOCUS_13430 gene gcvT 2306 1128 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113083.1 protein_id gnl|my_center|LOCUS_13430 2701 2486 gene locus_tag LOCUS_13440 2701 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4540 2852 gene locus_tag LOCUS_13450 4540 2852 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 protein_id gnl|my_center|LOCUS_13450 5980 4805 gene locus_tag LOCUS_13460 5980 4805 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_13460 6212 7060 gene locus_tag LOCUS_13470 gene surE 6212 7060 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811017.1 protein_id gnl|my_center|LOCUS_13470 7057 7905 gene locus_tag LOCUS_13480 7057 7905 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203980.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence086 1506 631 gene locus_tag LOCUS_13490 gene kdsB 1506 631 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_13490 1712 1506 gene locus_tag LOCUS_13500 1712 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3014 1827 gene locus_tag LOCUS_13510 gene lpxK 3014 1827 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064091.1 protein_id gnl|my_center|LOCUS_13510 3411 2986 gene locus_tag LOCUS_13520 3411 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 4069 3431 gene locus_tag LOCUS_13530 4069 3431 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812889.1 protein_id gnl|my_center|LOCUS_13530 4366 5583 gene locus_tag LOCUS_13540 4366 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 5681 6262 gene locus_tag LOCUS_13550 gene sodB 5681 6262 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931119.1 protein_id gnl|my_center|LOCUS_13550 6853 6368 gene locus_tag LOCUS_13560 gene smpB 6853 6368 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_13560 6913 7356 gene locus_tag LOCUS_13570 6913 7356 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811752.1 protein_id gnl|my_center|LOCUS_13570 7353 7685 gene locus_tag LOCUS_13580 7353 7685 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811750.1 protein_id gnl|my_center|LOCUS_13580 8315 7698 gene locus_tag LOCUS_13590 8315 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence087 <1 1111 gene locus_tag LOCUS_13600 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193654.1:glutamine--tRNA ligase/YqeY domain fusion protein 1211 2116 gene locus_tag LOCUS_13610 1211 2116 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936979.1 protein_id gnl|my_center|LOCUS_13610 2113 2577 gene locus_tag LOCUS_13620 gene aroQ 2113 2577 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087065.1 protein_id gnl|my_center|LOCUS_13620 3703 2597 gene locus_tag LOCUS_13630 gene aroC 3703 2597 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 protein_id gnl|my_center|LOCUS_13630 4223 3762 gene locus_tag LOCUS_13640 4223 3762 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_13640 4324 5625 gene locus_tag LOCUS_13650 4324 5625 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_13650 5630 6442 gene locus_tag LOCUS_13660 5630 6442 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_13660 7672 6443 gene locus_tag LOCUS_13670 7672 6443 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536360.1 protein_id gnl|my_center|LOCUS_13670 7736 8242 gene locus_tag LOCUS_13680 7736 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence088 353 1051 gene locus_tag LOCUS_13690 gene rimP 353 1051 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193908.1 protein_id gnl|my_center|LOCUS_13690 1048 2565 gene locus_tag LOCUS_13700 gene nusA 1048 2565 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 protein_id gnl|my_center|LOCUS_13700 2595 5645 gene locus_tag LOCUS_13710 gene infB 2595 5645 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197388.1 protein_id gnl|my_center|LOCUS_13710 5678 6049 gene locus_tag LOCUS_13720 gene rbfA 5678 6049 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199441.1 protein_id gnl|my_center|LOCUS_13720 6051 7127 gene locus_tag LOCUS_13730 6051 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence089 125 1519 gene locus_tag LOCUS_13740 125 1519 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199381.1 protein_id gnl|my_center|LOCUS_13740 1516 4038 gene locus_tag LOCUS_13750 1516 4038 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529996.1 protein_id gnl|my_center|LOCUS_13750 5214 4111 gene locus_tag LOCUS_13760 gene pyrC 5214 4111 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_13760 7307 5211 gene locus_tag LOCUS_13770 7307 5211 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence090 <1 736 gene locus_tag LOCUS_13780 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199929.1:lipid asymmetry maintenance ABC transporter permease subunit MlaE 750 1235 gene locus_tag LOCUS_13790 gene mlaD 750 1235 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_13790 1288 2118 gene locus_tag LOCUS_13800 1288 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2191 2877 gene locus_tag LOCUS_13810 2191 2877 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815780.1 protein_id gnl|my_center|LOCUS_13810 2893 3261 gene locus_tag LOCUS_13820 2893 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3296 4228 gene locus_tag LOCUS_13830 3296 4228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_13830 4225 4980 gene locus_tag LOCUS_13840 4225 4980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_13840 5097 5348 gene locus_tag LOCUS_13850 5097 5348 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_13850 5412 6698 gene locus_tag LOCUS_13860 gene murA 5412 6698 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 protein_id gnl|my_center|LOCUS_13860 6695 7414 gene locus_tag LOCUS_13870 gene hisG 6695 7414 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence091 348 1397 gene locus_tag LOCUS_13880 348 1397 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 protein_id gnl|my_center|LOCUS_13880 2441 1461 gene locus_tag LOCUS_13890 2441 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2976 2476 gene locus_tag LOCUS_13900 2976 2476 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_13900 3168 4448 gene locus_tag LOCUS_13910 3168 4448 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967075.1 protein_id gnl|my_center|LOCUS_13910 4518 4916 gene locus_tag LOCUS_13920 4518 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 5024 7411 gene locus_tag LOCUS_13930 5024 7411 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037666.1 protein_id gnl|my_center|LOCUS_13930 7706 7416 gene locus_tag LOCUS_13940 7706 7416 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937389.1 protein_id gnl|my_center|LOCUS_13940 <8246 7709 gene locus_tag LOCUS_13950 <8246 7709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389222.1:bifunctional enoyl-CoA hydratase/phosphate acetyltransferase >Feature sequence092 30 506 gene locus_tag LOCUS_13960 gene greA 30 506 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 protein_id gnl|my_center|LOCUS_13960 1377 484 gene locus_tag LOCUS_13970 gene folD 1377 484 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_13970 1991 1374 gene locus_tag LOCUS_13980 1991 1374 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930126.1 protein_id gnl|my_center|LOCUS_13980 4614 2047 gene locus_tag LOCUS_13990 gene fixL 4614 2047 CDS product oxygen sensor histidine kinase FixL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557112.1 protein_id gnl|my_center|LOCUS_13990 4823 7450 gene locus_tag LOCUS_14000 gene aceE 4823 7450 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811941.1 protein_id gnl|my_center|LOCUS_14000 7940 8017 gene locus_tag LOCUS_t00300 7940 8017 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence093 439 786 gene locus_tag LOCUS_14010 439 786 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_14010 809 1453 gene locus_tag LOCUS_14020 809 1453 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 protein_id gnl|my_center|LOCUS_14020 1544 2740 gene locus_tag LOCUS_14030 1544 2740 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807138.1 protein_id gnl|my_center|LOCUS_14030 2896 3993 gene locus_tag LOCUS_14040 2896 3993 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113628.1 protein_id gnl|my_center|LOCUS_14040 4123 4518 gene locus_tag LOCUS_14050 4123 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 4781 5317 gene locus_tag LOCUS_14060 4781 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 5411 5788 gene locus_tag LOCUS_14070 gene rpsL 5411 5788 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005017264.1 protein_id gnl|my_center|LOCUS_14070 5969 6439 gene locus_tag LOCUS_14080 gene rpsG 5969 6439 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence094 118 1758 gene locus_tag LOCUS_14090 118 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1755 2225 gene locus_tag LOCUS_14100 1755 2225 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316621.1 protein_id gnl|my_center|LOCUS_14100 2222 2656 gene locus_tag LOCUS_14110 2222 2656 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316622.1 protein_id gnl|my_center|LOCUS_14110 2653 4107 gene locus_tag LOCUS_14120 2653 4107 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125097.1 protein_id gnl|my_center|LOCUS_14120 4110 4460 gene locus_tag LOCUS_14130 4110 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 4457 4726 gene locus_tag LOCUS_14140 4457 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 4723 5085 gene locus_tag LOCUS_14150 4723 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 6013 5153 gene locus_tag LOCUS_14160 6013 5153 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 protein_id gnl|my_center|LOCUS_14160 6608 6054 gene locus_tag LOCUS_14170 gene efp 6608 6054 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_14170 7776 6538 gene locus_tag LOCUS_14180 gene earP 7776 6538 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766776.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence095 2492 2728 gene locus_tag LOCUS_14190 2492 2728 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140847.1 protein_id gnl|my_center|LOCUS_14190 2725 3123 gene locus_tag LOCUS_14200 2725 3123 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140846.1 protein_id gnl|my_center|LOCUS_14200 3154 3483 gene locus_tag LOCUS_14210 3154 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3532 4302 gene locus_tag LOCUS_14220 gene yaaA 3532 4302 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814010.1 protein_id gnl|my_center|LOCUS_14220 4316 5005 gene locus_tag LOCUS_14230 4316 5005 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038527.1 protein_id gnl|my_center|LOCUS_14230 5005 6075 gene locus_tag LOCUS_14240 gene queF 5005 6075 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526121.1 protein_id gnl|my_center|LOCUS_14240 6127 6420 gene locus_tag LOCUS_14250 6127 6420 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390987.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence096 575 648 gene locus_tag LOCUS_t00310 575 648 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 712 1200 gene locus_tag LOCUS_14260 712 1200 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017896.1 protein_id gnl|my_center|LOCUS_14260 1638 1246 gene locus_tag LOCUS_14270 1638 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4095 1666 gene locus_tag LOCUS_14280 gene pheT 4095 1666 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_14280 5223 4153 gene locus_tag LOCUS_14290 gene pheS 5223 4153 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 protein_id gnl|my_center|LOCUS_14290 5754 5434 gene locus_tag LOCUS_14300 gene rplT 5754 5434 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_14300 6042 5839 gene locus_tag LOCUS_14310 gene rpmI 6042 5839 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191477.1 protein_id gnl|my_center|LOCUS_14310 6822 6166 gene locus_tag LOCUS_14320 gene infC 6822 6166 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_14320 <7704 6819 gene locus_tag LOCUS_14330 <7704 6819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039633.1:threonine--tRNA ligase >Feature sequence097 419 1870 gene locus_tag LOCUS_14340 419 1870 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098024.1 protein_id gnl|my_center|LOCUS_14340 2223 1852 gene locus_tag LOCUS_14350 2223 1852 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971500.1 protein_id gnl|my_center|LOCUS_14350 2810 2244 gene locus_tag LOCUS_14360 gene dcd 2810 2244 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224592.1 protein_id gnl|my_center|LOCUS_14360 2952 3383 gene locus_tag LOCUS_14370 2952 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 5739 3421 gene locus_tag LOCUS_14380 gene dinG 5739 3421 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764917.1 protein_id gnl|my_center|LOCUS_14380 5921 6961 gene locus_tag LOCUS_14390 5921 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence098 <1 645 gene locus_tag LOCUS_14400 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550379.1:nitrous oxide reductase family maturation protein NosD 626 1549 gene locus_tag LOCUS_14410 626 1549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539779.1 protein_id gnl|my_center|LOCUS_14410 1778 1801 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1802 2869 gene locus_tag LOCUS_14420 1802 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14420 2899 3486 gene locus_tag LOCUS_14430 2899 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3600 4013 gene locus_tag LOCUS_14440 3600 4013 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521401.1 protein_id gnl|my_center|LOCUS_14440 4344 4856 gene locus_tag LOCUS_14450 4344 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5280 4864 gene locus_tag LOCUS_14460 5280 4864 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524657.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14460 5634 5404 gene locus_tag LOCUS_14470 5634 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 7276 6053 gene locus_tag LOCUS_14480 7276 6053 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence099 1759 683 gene locus_tag LOCUS_14490 gene rfbB 1759 683 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_14490 1930 2187 gene locus_tag LOCUS_14500 1930 2187 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 protein_id gnl|my_center|LOCUS_14500 2316 3533 gene locus_tag LOCUS_14510 2316 3533 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 protein_id gnl|my_center|LOCUS_14510 4282 3482 gene locus_tag LOCUS_14520 4282 3482 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_14520 5100 4333 gene locus_tag LOCUS_14530 gene ugpQ 5100 4333 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815363.1 protein_id gnl|my_center|LOCUS_14530 6115 5108 gene locus_tag LOCUS_14540 6115 5108 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930289.1 protein_id gnl|my_center|LOCUS_14540 6997 6137 gene locus_tag LOCUS_14550 gene ugpE 6997 6137 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence100 303 1088 gene locus_tag LOCUS_14560 303 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1085 1573 gene locus_tag LOCUS_14570 gene ruvX 1085 1573 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186163.1 protein_id gnl|my_center|LOCUS_14570 1570 2130 gene locus_tag LOCUS_14580 gene pyrR 1570 2130 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_14580 2127 3083 gene locus_tag LOCUS_14590 2127 3083 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_14590 3105 4475 gene locus_tag LOCUS_14600 3105 4475 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_14600 4495 5298 gene locus_tag LOCUS_14610 4495 5298 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_14610 7047 5359 gene locus_tag LOCUS_14620 7047 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence101 113 367 gene locus_tag LOCUS_14630 gene grxC 113 367 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208977.1 protein_id gnl|my_center|LOCUS_14630 455 925 gene locus_tag LOCUS_14640 gene secB 455 925 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198004.1 protein_id gnl|my_center|LOCUS_14640 947 1957 gene locus_tag LOCUS_14650 947 1957 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_14650 2836 1961 gene locus_tag LOCUS_14660 gene panC 2836 1961 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064922.1 protein_id gnl|my_center|LOCUS_14660 3859 2984 gene locus_tag LOCUS_14670 gene panB 3859 2984 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_14670 4141 5085 gene locus_tag LOCUS_14680 gene nadC 4141 5085 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185611.1 protein_id gnl|my_center|LOCUS_14680 5297 7033 gene locus_tag LOCUS_14690 gene ilvD 5297 7033 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence102 1306 527 gene locus_tag LOCUS_14700 1306 527 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_14700 1860 1315 gene locus_tag LOCUS_14710 1860 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4780 1919 gene locus_tag LOCUS_14720 gene leuS 4780 1919 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810256.1 protein_id gnl|my_center|LOCUS_14720 5670 4858 gene locus_tag LOCUS_14730 gene dapB 5670 4858 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065058.1 protein_id gnl|my_center|LOCUS_14730 6270 5761 gene locus_tag LOCUS_14740 6270 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14740 6397 6867 gene locus_tag LOCUS_14750 gene fur 6397 6867 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence103 86 358 gene locus_tag LOCUS_14760 86 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 893 468 gene locus_tag LOCUS_14770 893 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1150 2514 gene locus_tag LOCUS_14780 1150 2514 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_14780 2511 3095 gene locus_tag LOCUS_14790 gene metW 2511 3095 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545692.1 protein_id gnl|my_center|LOCUS_14790 3723 3085 gene locus_tag LOCUS_14800 gene nalD 3723 3085 CDS product efflux system transcriptional repressor NalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 protein_id gnl|my_center|LOCUS_14800 3855 5081 gene locus_tag LOCUS_14810 3855 5081 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810338.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence104 613 912 gene locus_tag LOCUS_14820 613 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1397 933 gene locus_tag LOCUS_14830 1397 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1282 1536 gene locus_tag LOCUS_14840 1282 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3807 1540 gene locus_tag LOCUS_14850 gene rnr 3807 1540 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550537.1 protein_id gnl|my_center|LOCUS_14850 3858 3942 gene locus_tag LOCUS_t00320 3858 3942 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5457 4030 gene locus_tag LOCUS_14860 gene rimO 5457 4030 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521351.1 protein_id gnl|my_center|LOCUS_14860 6114 5530 gene locus_tag LOCUS_14870 gene phaR 6114 5530 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 protein_id gnl|my_center|LOCUS_14870 6298 6846 gene locus_tag LOCUS_14880 6298 6846 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence105 429 1340 gene locus_tag LOCUS_14890 gene pstC 429 1340 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140013.1 protein_id gnl|my_center|LOCUS_14890 1347 2201 gene locus_tag LOCUS_14900 gene pstA 1347 2201 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_14900 2727 2763 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2837 3163 gene locus_tag LOCUS_14910 2837 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3311 4651 gene locus_tag LOCUS_14920 3311 4651 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390060.1 protein_id gnl|my_center|LOCUS_14920 4683 5027 gene locus_tag LOCUS_14930 4683 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 5678 5085 gene locus_tag LOCUS_14940 gene recR 5678 5085 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193537.1 protein_id gnl|my_center|LOCUS_14940 6037 5705 gene locus_tag LOCUS_14950 6037 5705 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 protein_id gnl|my_center|LOCUS_14950 <7070 6105 gene locus_tag LOCUS_14960 <7070 6105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930422.1:DNA polymerase III subunit gamma/tau >Feature sequence106 <1 519 gene locus_tag LOCUS_14970 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525893.1:5-formyltetrahydrofolate cyclo-ligase 3975 538 gene locus_tag LOCUS_14980 3975 538 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_14980 4877 4158 gene locus_tag LOCUS_14990 4877 4158 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_14990 5810 4977 gene locus_tag LOCUS_15000 5810 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 <6856 5807 gene locus_tag LOCUS_15010 <6856 5807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036061.1:ATP-binding protein >Feature sequence107 360 1916 gene locus_tag LOCUS_15020 gene atpA 360 1916 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_15020 1949 2818 gene locus_tag LOCUS_15030 gene atpG 1949 2818 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_15030 2860 4290 gene locus_tag LOCUS_15040 gene atpD 2860 4290 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 protein_id gnl|my_center|LOCUS_15040 4350 4757 gene locus_tag LOCUS_15050 4350 4757 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_15050 4887 5927 gene locus_tag LOCUS_15060 4887 5927 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_15060 6437 6015 gene locus_tag LOCUS_15070 6437 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence108 <1 636 gene locus_tag LOCUS_15080 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039713.1:alpha/beta hydrolase 633 2921 gene locus_tag LOCUS_15090 633 2921 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521683.1 protein_id gnl|my_center|LOCUS_15090 2959 3035 gene locus_tag LOCUS_t00330 2959 3035 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3736 4002 gene locus_tag LOCUS_15100 3736 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 4078 5175 gene locus_tag LOCUS_15110 4078 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence109 <1 2686 gene locus_tag LOCUS_15120 <1 2686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523124.1:indolepyruvate ferredoxin oxidoreductase family protein 2756 3721 gene locus_tag LOCUS_15130 2756 3721 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032713612.1 protein_id gnl|my_center|LOCUS_15130 3884 4201 gene locus_tag LOCUS_15140 gene yajC 3884 4201 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_15140 4279 6174 gene locus_tag LOCUS_15150 gene secD 4279 6174 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809414.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence110 <1 1346 gene locus_tag LOCUS_15160 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209166.1:McrB family protein 1363 2736 gene locus_tag LOCUS_15170 1363 2736 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209167.1 protein_id gnl|my_center|LOCUS_15170 2733 4283 gene locus_tag LOCUS_15180 2733 4283 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022342.1 protein_id gnl|my_center|LOCUS_15180 5083 4220 gene locus_tag LOCUS_15190 5083 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 5980 5111 gene locus_tag LOCUS_15200 5980 5111 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809384.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence111 473 291 gene locus_tag LOCUS_15210 473 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 562 1044 gene locus_tag LOCUS_15220 562 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 2131 1226 gene locus_tag LOCUS_15230 2131 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15230 3348 2068 gene locus_tag LOCUS_15240 3348 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15240 3487 3963 gene locus_tag LOCUS_15250 3487 3963 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192504.1 protein_id gnl|my_center|LOCUS_15250 3980 4900 gene locus_tag LOCUS_15260 3980 4900 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 protein_id gnl|my_center|LOCUS_15260 5025 5114 gene locus_tag LOCUS_t00340 5025 5114 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence112 1116 193 gene locus_tag LOCUS_15270 1116 193 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_15270 1149 2099 gene locus_tag LOCUS_15280 1149 2099 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821521.1 protein_id gnl|my_center|LOCUS_15280 3146 2148 gene locus_tag LOCUS_15290 3146 2148 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818535.1 protein_id gnl|my_center|LOCUS_15290 3814 3143 gene locus_tag LOCUS_15300 3814 3143 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 protein_id gnl|my_center|LOCUS_15300 4509 3823 gene locus_tag LOCUS_15310 gene modB 4509 3823 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190258.1 protein_id gnl|my_center|LOCUS_15310 5268 4537 gene locus_tag LOCUS_15320 gene modA 5268 4537 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195689.1 protein_id gnl|my_center|LOCUS_15320 5516 5767 gene locus_tag LOCUS_15330 5516 5767 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523495.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence113 <1 909 gene locus_tag LOCUS_15340 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195243.1:ribose-phosphate pyrophosphokinase 1029 1652 gene locus_tag LOCUS_15350 1029 1652 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_15350 1680 2297 gene locus_tag LOCUS_15360 gene pth 1680 2297 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_15360 2630 2364 gene locus_tag LOCUS_15370 2630 2364 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808570.1 protein_id gnl|my_center|LOCUS_15370 3192 2644 gene locus_tag LOCUS_15380 gene coaD 3192 2644 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 protein_id gnl|my_center|LOCUS_15380 3917 3282 gene locus_tag LOCUS_15390 3917 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 5269 3914 gene locus_tag LOCUS_15400 5269 3914 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15400 <6528 5266 gene locus_tag LOCUS_15410 <6528 5266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948371.1:pitrilysin family protein >Feature sequence114 16 1170 gene locus_tag LOCUS_15420 16 1170 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040791.1 protein_id gnl|my_center|LOCUS_15420 1476 1177 gene locus_tag LOCUS_15430 gene soxZ 1476 1177 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_15430 1971 1570 gene locus_tag LOCUS_15440 gene soxY 1971 1570 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_15440 2877 2173 gene locus_tag LOCUS_15450 gene lolD 2877 2173 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_15450 3094 2870 gene locus_tag LOCUS_15460 3094 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15460 4074 3070 gene locus_tag LOCUS_15470 4074 3070 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15470 4878 4219 gene locus_tag LOCUS_15480 4878 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence115 1124 684 gene locus_tag LOCUS_15490 1124 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1217 1495 gene locus_tag LOCUS_15500 1217 1495 CDS product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312252.1 protein_id gnl|my_center|LOCUS_15500 1771 2046 gene locus_tag LOCUS_15510 1771 2046 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971266.1 protein_id gnl|my_center|LOCUS_15510 2691 2239 gene locus_tag LOCUS_15520 2691 2239 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 protein_id gnl|my_center|LOCUS_15520 2831 3055 gene locus_tag LOCUS_15530 2831 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 3279 3061 gene locus_tag LOCUS_15540 3279 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3558 3283 gene locus_tag LOCUS_15550 3558 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3762 4025 gene locus_tag LOCUS_15560 3762 4025 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971266.1 protein_id gnl|my_center|LOCUS_15560 4012 4293 gene locus_tag LOCUS_15570 4012 4293 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277238.1 protein_id gnl|my_center|LOCUS_15570 4655 4960 gene locus_tag LOCUS_15580 4655 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 4957 5424 gene locus_tag LOCUS_15590 4957 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 5560 5697 gene locus_tag LOCUS_15600 5560 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence116 702 2588 gene locus_tag LOCUS_15610 702 2588 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553995.1 protein_id gnl|my_center|LOCUS_15610 2585 3085 gene locus_tag LOCUS_15620 2585 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3082 3873 gene locus_tag LOCUS_15630 3082 3873 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 protein_id gnl|my_center|LOCUS_15630 3870 4817 gene locus_tag LOCUS_15640 gene cysD 3870 4817 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_15640 4819 6231 gene locus_tag LOCUS_15650 4819 6231 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813322.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence117 1328 258 gene locus_tag LOCUS_15660 1328 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 4903 1325 gene locus_tag LOCUS_15670 gene smc 4903 1325 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114484320.1 protein_id gnl|my_center|LOCUS_15670 5091 5924 gene locus_tag LOCUS_15680 gene dapD 5091 5924 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812536.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence118 <1 647 gene locus_tag LOCUS_15690 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007247571.1:IS5-like element ISPssy family transposase 1777 1121 gene locus_tag LOCUS_15700 1777 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2418 1807 gene locus_tag LOCUS_15710 2418 1807 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200146.1 protein_id gnl|my_center|LOCUS_15710 3010 2447 gene locus_tag LOCUS_15720 3010 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15720 3052 3453 gene locus_tag LOCUS_15730 3052 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3582 4127 gene locus_tag LOCUS_15740 3582 4127 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446416.1 protein_id gnl|my_center|LOCUS_15740 4207 4719 gene locus_tag LOCUS_15750 4207 4719 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191562.1 protein_id gnl|my_center|LOCUS_15750 4722 6047 gene locus_tag LOCUS_15760 4722 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence119 3 512 gene locus_tag LOCUS_15770 3 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1156 503 gene locus_tag LOCUS_15780 1156 503 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706154.1 protein_id gnl|my_center|LOCUS_15780 1250 2728 gene locus_tag LOCUS_15790 1250 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 3660 2779 gene locus_tag LOCUS_15800 3660 2779 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418111.1 protein_id gnl|my_center|LOCUS_15800 3933 3670 gene locus_tag LOCUS_15810 3933 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15810 4019 4525 gene locus_tag LOCUS_15820 4019 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 <6234 4564 gene locus_tag LOCUS_15830 <6234 4564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200734.1:DNA topoisomerase III >Feature sequence120 649 197 gene locus_tag LOCUS_15840 649 197 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_15840 1331 693 gene locus_tag LOCUS_15850 1331 693 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 protein_id gnl|my_center|LOCUS_15850 1400 2017 gene locus_tag LOCUS_15860 1400 2017 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_15860 2546 2037 gene locus_tag LOCUS_15870 gene trmL 2546 2037 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185046.1 protein_id gnl|my_center|LOCUS_15870 5226 2569 gene locus_tag LOCUS_15880 5226 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 5608 5228 gene locus_tag LOCUS_15890 5608 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence121 1970 1128 gene locus_tag LOCUS_15900 1970 1128 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214281.1 protein_id gnl|my_center|LOCUS_15900 2883 1990 gene locus_tag LOCUS_15910 2883 1990 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530774.1 protein_id gnl|my_center|LOCUS_15910 4046 2943 gene locus_tag LOCUS_15920 gene potA 4046 2943 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525494.1 protein_id gnl|my_center|LOCUS_15920 5312 4182 gene locus_tag LOCUS_15930 5312 4182 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201742.1 protein_id gnl|my_center|LOCUS_15930 5964 5434 gene locus_tag LOCUS_15940 5964 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence122 1494 2516 gene locus_tag LOCUS_15950 gene tsaB 1494 2516 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199104.1 protein_id gnl|my_center|LOCUS_15950 2635 3009 gene locus_tag LOCUS_15960 2635 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15960 4489 3017 gene locus_tag LOCUS_15970 4489 3017 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982178.1 protein_id gnl|my_center|LOCUS_15970 5335 4643 gene locus_tag LOCUS_15980 5335 4643 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969922.1 protein_id gnl|my_center|LOCUS_15980 6024 5335 gene locus_tag LOCUS_15990 6024 5335 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence123 215 1309 gene locus_tag LOCUS_16000 215 1309 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_16000 1331 3448 gene locus_tag LOCUS_16010 gene recG 1331 3448 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 protein_id gnl|my_center|LOCUS_16010 3553 4515 gene locus_tag LOCUS_16020 3553 4515 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194383.1 protein_id gnl|my_center|LOCUS_16020 4512 5393 gene locus_tag LOCUS_16030 gene ubiA 4512 5393 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_16030 <6036 5329 gene locus_tag LOCUS_16040 <6036 5329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522133.1:pyrroline-5-carboxylate reductase >Feature sequence124 <1 793 gene locus_tag LOCUS_16050 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063889.1:tripartite tricarboxylate transporter substrate binding protein BugE 941 1888 gene locus_tag LOCUS_16060 941 1888 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814324.1 protein_id gnl|my_center|LOCUS_16060 1606 1611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2342 1953 gene locus_tag LOCUS_16070 2342 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3715 2432 gene locus_tag LOCUS_16080 gene eno 3715 2432 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065136.1 protein_id gnl|my_center|LOCUS_16080 4064 3771 gene locus_tag LOCUS_16090 4064 3771 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065135.1 protein_id gnl|my_center|LOCUS_16090 4939 4082 gene locus_tag LOCUS_16100 gene kdsA 4939 4082 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193658.1 protein_id gnl|my_center|LOCUS_16100 <5946 4946 gene locus_tag LOCUS_16110 <5946 4946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813705.1:CTP synthase >Feature sequence125 2028 1309 gene locus_tag LOCUS_16120 2028 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2547 2215 gene locus_tag LOCUS_16130 2547 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4109 2709 gene locus_tag LOCUS_16140 gene radA 4109 2709 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_16140 4155 4562 gene locus_tag LOCUS_16150 4155 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16150 4547 5245 gene locus_tag LOCUS_16160 4547 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16160 >Feature sequence126 2854 1541 gene locus_tag LOCUS_16170 2854 1541 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065159.1 protein_id gnl|my_center|LOCUS_16170 3205 2918 gene locus_tag LOCUS_16180 3205 2918 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528990.1 protein_id gnl|my_center|LOCUS_16180 3928 3224 gene locus_tag LOCUS_16190 3928 3224 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187935.1 protein_id gnl|my_center|LOCUS_16190 5773 3962 gene locus_tag LOCUS_16200 gene sdhA 5773 3962 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940953.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence127 893 594 gene locus_tag LOCUS_16210 893 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2006 912 gene locus_tag LOCUS_16220 gene hisC 2006 912 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040076.1 protein_id gnl|my_center|LOCUS_16220 2120 2707 gene locus_tag LOCUS_16230 gene hisB 2120 2707 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 protein_id gnl|my_center|LOCUS_16230 2778 3455 gene locus_tag LOCUS_16240 gene hisH 2778 3455 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_16240 3524 4264 gene locus_tag LOCUS_16250 gene hisA 3524 4264 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199906.1 protein_id gnl|my_center|LOCUS_16250 4280 5080 gene locus_tag LOCUS_16260 gene hisF 4280 5080 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_16260 5684 5046 gene locus_tag LOCUS_16270 5684 5046 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence128 640 2562 gene locus_tag LOCUS_16280 gene prpE 640 2562 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010226.1 protein_id gnl|my_center|LOCUS_16280 2621 4096 gene locus_tag LOCUS_16290 gene bioA 2621 4096 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525973.1 protein_id gnl|my_center|LOCUS_16290 4062 5291 gene locus_tag LOCUS_16300 gene bioF 4062 5291 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence129 31 1125 gene locus_tag LOCUS_16310 gene ychF 31 1125 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 protein_id gnl|my_center|LOCUS_16310 4223 1122 gene locus_tag LOCUS_16320 4223 1122 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967993.1 protein_id gnl|my_center|LOCUS_16320 5299 4220 gene locus_tag LOCUS_16330 5299 4220 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035674.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence130 530 1531 gene locus_tag LOCUS_16340 530 1531 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 protein_id gnl|my_center|LOCUS_16340 2348 1563 gene locus_tag LOCUS_16350 gene hexR 2348 1563 CDS product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 protein_id gnl|my_center|LOCUS_16350 3383 2418 gene locus_tag LOCUS_16360 gene tal 3383 2418 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930364.1 protein_id gnl|my_center|LOCUS_16360 4069 3380 gene locus_tag LOCUS_16370 4069 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 4133 5125 gene locus_tag LOCUS_16380 4133 5125 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162835061.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence131 1399 1079 gene locus_tag LOCUS_16390 1399 1079 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813037.1 protein_id gnl|my_center|LOCUS_16390 2442 1447 gene locus_tag LOCUS_16400 2442 1447 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 protein_id gnl|my_center|LOCUS_16400 2702 3262 gene locus_tag LOCUS_16410 2702 3262 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 protein_id gnl|my_center|LOCUS_16410 4109 3345 gene locus_tag LOCUS_16420 4109 3345 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_16420 5260 4151 gene locus_tag LOCUS_16430 5260 4151 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540965.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence132 <1 1033 gene locus_tag LOCUS_16440 <1 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444647.1:alpha/beta fold hydrolase 2271 1021 gene locus_tag LOCUS_16450 2271 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2604 2329 gene locus_tag LOCUS_16460 2604 2329 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_16460 2811 3461 gene locus_tag LOCUS_16470 2811 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 5021 3471 gene locus_tag LOCUS_16480 5021 3471 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121241671.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence133 <1 1284 gene locus_tag LOCUS_16490 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089807.1:esterase-like activity of phytase family protein 2204 1293 gene locus_tag LOCUS_16500 2204 1293 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_16500 2372 4744 gene locus_tag LOCUS_16510 gene metE 2372 4744 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764814.1 protein_id gnl|my_center|LOCUS_16510 4741 4950 gene locus_tag LOCUS_16520 4741 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence134 <1 1049 gene locus_tag LOCUS_16530 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812548.1:fatty acid desaturase 1088 1456 gene locus_tag LOCUS_16540 1088 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1809 1450 gene locus_tag LOCUS_16550 1809 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 <5450 1859 gene locus_tag LOCUS_16560 <5450 1859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009939035.1:excinuclease ABC subunit UvrA >Feature sequence135 1676 876 gene locus_tag LOCUS_16570 1676 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2296 1673 gene locus_tag LOCUS_16580 2296 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 4320 2293 gene locus_tag LOCUS_16590 4320 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085303.1 protein_id gnl|my_center|LOCUS_16590 5178 4351 gene locus_tag LOCUS_16600 gene fabI 5178 4351 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040310.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence136 2198 1653 gene locus_tag LOCUS_16610 2198 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3531 2254 gene locus_tag LOCUS_16620 3531 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3631 4578 gene locus_tag LOCUS_16630 3631 4578 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 protein_id gnl|my_center|LOCUS_16630 <5393 4556 gene locus_tag LOCUS_16640 <5393 4556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188973.1:pyruvate kinase >Feature sequence137 81 6 gene locus_tag LOCUS_t00350 81 6 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 218 1876 gene locus_tag LOCUS_16650 218 1876 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_16650 1873 3468 gene locus_tag LOCUS_16660 1873 3468 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387848.1 protein_id gnl|my_center|LOCUS_16660 3508 4149 gene locus_tag LOCUS_16670 3508 4149 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072952.1 protein_id gnl|my_center|LOCUS_16670 4968 4162 gene locus_tag LOCUS_16680 4968 4162 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence138 343 921 gene locus_tag LOCUS_16690 343 921 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014408000.1 protein_id gnl|my_center|LOCUS_16690 918 3485 gene locus_tag LOCUS_16700 918 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 3379 3723 gene locus_tag LOCUS_16710 3379 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence139 <1 1327 gene locus_tag LOCUS_16720 <1 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:EAL domain-containing protein 1615 1334 gene locus_tag LOCUS_16730 1615 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2632 4824 gene locus_tag LOCUS_16740 gene rpoD 2632 4824 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190933.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence140 764 525 gene locus_tag LOCUS_16750 764 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 891 1214 gene locus_tag LOCUS_16760 891 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2783 1455 gene locus_tag LOCUS_16770 2783 1455 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039889.1 protein_id gnl|my_center|LOCUS_16770 3094 2780 gene locus_tag LOCUS_16780 3094 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 4263 3802 gene locus_tag LOCUS_16790 4263 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence141 1059 115 gene locus_tag LOCUS_16800 1059 115 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194565.1 protein_id gnl|my_center|LOCUS_16800 1284 1955 gene locus_tag LOCUS_16810 1284 1955 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906339.1 protein_id gnl|my_center|LOCUS_16810 2016 2366 gene locus_tag LOCUS_16820 gene ychN 2016 2366 CDS product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169659.1 protein_id gnl|my_center|LOCUS_16820 2495 3493 gene locus_tag LOCUS_16830 2495 3493 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921602.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16830 4363 3791 gene locus_tag LOCUS_16840 4363 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4369 4683 gene locus_tag LOCUS_16850 4369 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 4691 4999 gene locus_tag LOCUS_16860 4691 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence142 <1 1025 gene locus_tag LOCUS_16870 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002117074.1:AI-2E family transporter 2477 1062 gene locus_tag LOCUS_16880 2477 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence143 1403 2605 gene locus_tag LOCUS_16890 1403 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3208 2654 gene locus_tag LOCUS_16900 3208 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3832 3245 gene locus_tag LOCUS_16910 3832 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16910 <5109 4215 gene locus_tag LOCUS_16920 <5109 4215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005169210.1:long-chain-fatty-acid--CoA ligase FadD >Feature sequence144 1135 320 gene locus_tag LOCUS_16930 1135 320 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921089.1 protein_id gnl|my_center|LOCUS_16930 1532 1122 gene locus_tag LOCUS_16940 1532 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16940 2062 1529 gene locus_tag LOCUS_16950 2062 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16950 2484 2179 gene locus_tag LOCUS_16960 2484 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 3165 2785 gene locus_tag LOCUS_16970 3165 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3101 3538 gene locus_tag LOCUS_16980 3101 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 3705 4898 gene locus_tag LOCUS_16990 3705 4898 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence145 496 1407 gene locus_tag LOCUS_17000 496 1407 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_17000 2218 1427 gene locus_tag LOCUS_17010 2218 1427 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815212.1 protein_id gnl|my_center|LOCUS_17010 2303 3028 gene locus_tag LOCUS_17020 gene pyrE 2303 3028 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_17020 3040 3603 gene locus_tag LOCUS_17030 3040 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 <4930 3605 gene locus_tag LOCUS_17040 <4930 3605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552444.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence146 3218 2781 gene locus_tag LOCUS_17050 3218 2781 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530565.1 protein_id gnl|my_center|LOCUS_17050 3436 3263 gene locus_tag LOCUS_17060 3436 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 4502 3585 gene locus_tag LOCUS_17070 4502 3585 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence147 1187 627 gene locus_tag LOCUS_17080 gene frr 1187 627 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_17080 1989 1279 gene locus_tag LOCUS_17090 gene pyrH 1989 1279 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_17090 2477 2139 gene locus_tag LOCUS_17100 2477 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17100 3082 2462 gene locus_tag LOCUS_17110 3082 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17110 3941 3192 gene locus_tag LOCUS_17120 gene rpsB 3941 3192 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence148 4622 3417 gene locus_tag LOCUS_17130 gene dapE 4622 3417 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812538.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence149 2132 1509 gene locus_tag LOCUS_17140 2132 1509 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970934.1 protein_id gnl|my_center|LOCUS_17140 3322 2129 gene locus_tag LOCUS_17150 3322 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 3427 4497 gene locus_tag LOCUS_17160 3427 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence150 <1 1226 gene locus_tag LOCUS_17170 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186553.1:L-aspartate oxidase note possible pseudo, frameshifted 1115 1540 gene locus_tag LOCUS_17180 1115 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17180 1933 1553 gene locus_tag LOCUS_17190 1933 1553 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_17190 3967 2036 gene locus_tag LOCUS_17200 gene thiC 3967 2036 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193963.1 protein_id gnl|my_center|LOCUS_17200 <4630 4121 gene locus_tag LOCUS_17210 <4630 4121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185886.1:quinolinate synthase NadA >Feature sequence151 465 806 gene locus_tag LOCUS_17220 465 806 CDS product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707500.1 protein_id gnl|my_center|LOCUS_17220 1181 840 gene locus_tag LOCUS_17230 1181 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1425 2969 gene locus_tag LOCUS_17240 1425 2969 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_17240 3332 2997 gene locus_tag LOCUS_17250 3332 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 4160 3432 gene locus_tag LOCUS_17260 4160 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence152 110 1216 gene locus_tag LOCUS_17270 110 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1484 1855 gene locus_tag LOCUS_17280 1484 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1871 3157 gene locus_tag LOCUS_17290 1871 3157 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_17290 <4411 3201 gene locus_tag LOCUS_17300 <4411 3201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974597.1:DUF3422 family protein >Feature sequence153 1836 529 gene locus_tag LOCUS_17310 1836 529 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_17310 2696 1968 gene locus_tag LOCUS_17320 2696 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2773 3327 gene locus_tag LOCUS_17330 gene purN 2773 3327 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064038.1 protein_id gnl|my_center|LOCUS_17330 <4394 3324 gene locus_tag LOCUS_17340 <4394 3324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815895.1:peptide chain release factor 3 >Feature sequence154 265 1041 gene locus_tag LOCUS_17350 265 1041 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564704.1 protein_id gnl|my_center|LOCUS_17350 2733 1117 gene locus_tag LOCUS_17360 gene guaA 2733 1117 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193192.1 protein_id gnl|my_center|LOCUS_17360 4290 2821 gene locus_tag LOCUS_17370 gene guaB 4290 2821 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence155 314 928 gene locus_tag LOCUS_17380 314 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_17380 935 2590 gene locus_tag LOCUS_17390 935 2590 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265692.1 protein_id gnl|my_center|LOCUS_17390 2683 3396 gene locus_tag LOCUS_17400 2683 3396 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919170.1 protein_id gnl|my_center|LOCUS_17400 3417 3887 gene locus_tag LOCUS_17410 3417 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence156 3 956 gene locus_tag LOCUS_17420 3 956 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_17420 1044 2378 gene locus_tag LOCUS_17430 1044 2378 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence157 86 508 gene locus_tag LOCUS_17440 86 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 598 1629 gene locus_tag LOCUS_17450 gene hemC 598 1629 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193185.1 protein_id gnl|my_center|LOCUS_17450 1711 2340 gene locus_tag LOCUS_17460 1711 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2231 2509 gene locus_tag LOCUS_17470 2231 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2767 3837 gene locus_tag LOCUS_17480 2767 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence158 <1 1182 gene locus_tag LOCUS_17490 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014905419.1:NADP-specific glutamate dehydrogenase 1212 2441 gene locus_tag LOCUS_17500 1212 2441 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261548.1 protein_id gnl|my_center|LOCUS_17500 2438 3475 gene locus_tag LOCUS_17510 gene miaA 2438 3475 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065014.1 protein_id gnl|my_center|LOCUS_17510 4188 3472 gene locus_tag LOCUS_17520 4188 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence159 772 1614 gene locus_tag LOCUS_17530 772 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1795 1719 gene locus_tag LOCUS_t00360 1795 1719 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1990 2889 gene locus_tag LOCUS_17540 gene rdgC 1990 2889 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160563.1 protein_id gnl|my_center|LOCUS_17540 <4113 2895 gene locus_tag LOCUS_17550 <4113 2895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186216.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC >Feature sequence160 548 1513 gene locus_tag LOCUS_17560 548 1513 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392222.1 protein_id gnl|my_center|LOCUS_17560 1620 2108 gene locus_tag LOCUS_17570 1620 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2145 3635 gene locus_tag LOCUS_17580 2145 3635 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529613.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence161 <1 744 gene locus_tag LOCUS_17590 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063727.1:dihydrolipoyllysine-residue acetyltransferase 757 2574 gene locus_tag LOCUS_17600 gene lpdA 757 2574 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930129.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence162 269 1801 gene locus_tag LOCUS_17610 gene narH 269 1801 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_17610 1803 2507 gene locus_tag LOCUS_17620 gene narJ 1803 2507 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971854.1 protein_id gnl|my_center|LOCUS_17620 2954 3037 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence163 98 823 gene locus_tag LOCUS_17630 98 823 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 protein_id gnl|my_center|LOCUS_17630 1621 836 gene locus_tag LOCUS_17640 gene moeB 1621 836 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 protein_id gnl|my_center|LOCUS_17640 3088 1634 gene locus_tag LOCUS_17650 3088 1634 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543824.1 protein_id gnl|my_center|LOCUS_17650 <3935 3230 gene locus_tag LOCUS_17660 <3935 3230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198007.1:2,3-diphosphoglycerate-dependent phosphoglycerate mutase >Feature sequence164 619 323 gene locus_tag LOCUS_17670 619 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2432 588 gene locus_tag LOCUS_17680 2432 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 658 666 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2806 2435 gene locus_tag LOCUS_17690 2806 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 3848 2931 gene locus_tag LOCUS_17700 3848 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence165 861 28 gene locus_tag LOCUS_17710 861 28 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_17710 1002 1077 gene locus_tag LOCUS_t00370 1002 1077 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2203 1013 gene locus_tag LOCUS_17720 gene queG 2203 1013 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189719.1 protein_id gnl|my_center|LOCUS_17720 2174 2734 gene locus_tag LOCUS_17730 2174 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence166 <1 2793 gene locus_tag LOCUS_17740 <1 2793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926826.1:DNA gyrase subunit A >Feature sequence167 1803 2066 gene locus_tag LOCUS_17750 1803 2066 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_17750 2115 2405 gene locus_tag LOCUS_17760 gene nadS 2115 2405 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811547.1 protein_id gnl|my_center|LOCUS_17760 3430 2537 gene locus_tag LOCUS_17770 3430 2537 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807185.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence168 <1 2293 gene locus_tag LOCUS_17780 <1 2293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196276.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence169 538 2685 gene locus_tag LOCUS_17790 gene ligA 538 2685 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931538.1 protein_id gnl|my_center|LOCUS_17790 <3709 2751 gene locus_tag LOCUS_17800 <3709 2751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197089.1:[protein-PII] uridylyltransferase >Feature sequence170 1352 1276 gene locus_tag LOCUS_t00380 1352 1276 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2223 1441 gene locus_tag LOCUS_17810 2223 1441 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_17810 <3702 2263 gene locus_tag LOCUS_17820 <3702 2263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527796.1:PDZ domain-containing protein >Feature sequence171 1097 1357 gene locus_tag LOCUS_17830 gene rpsP 1097 1357 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189402.1 protein_id gnl|my_center|LOCUS_17830 1397 1981 gene locus_tag LOCUS_17840 gene rimM 1397 1981 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527496.1 protein_id gnl|my_center|LOCUS_17840 1978 2763 gene locus_tag LOCUS_17850 gene trmD 1978 2763 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063943.1 protein_id gnl|my_center|LOCUS_17850 2918 3274 gene locus_tag LOCUS_17860 gene rplS 2918 3274 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217809.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence172 1043 1270 gene locus_tag LOCUS_17870 1043 1270 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366461.1 protein_id gnl|my_center|LOCUS_17870 1558 1630 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1703 2443 gene locus_tag LOCUS_17880 1703 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2471 3283 gene locus_tag LOCUS_17890 gene minD 2471 3283 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185427.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence173 293 613 gene locus_tag LOCUS_17900 293 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 607 825 gene locus_tag LOCUS_17910 607 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1091 1603 gene locus_tag LOCUS_17920 1091 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 3024 1624 gene locus_tag LOCUS_17930 gene rlmD 3024 1624 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence174 1609 416 gene locus_tag LOCUS_17940 1609 416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_17940 2689 1634 gene locus_tag LOCUS_17950 2689 1634 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394435.1 protein_id gnl|my_center|LOCUS_17950 3079 2801 gene locus_tag LOCUS_17960 3079 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence175 1129 134 gene locus_tag LOCUS_17970 1129 134 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_17970 1285 1198 gene locus_tag LOCUS_t00390 1285 1198 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1487 2362 gene locus_tag LOCUS_17980 gene cysM 1487 2362 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_17980 2436 2663 gene locus_tag LOCUS_17990 2436 2663 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_17990 <3399 2680 gene locus_tag LOCUS_18000 <3399 2680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521705.1:valine--tRNA ligase >Feature sequence176 244 1272 gene locus_tag LOCUS_18010 244 1272 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943025.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence177 383 1177 gene locus_tag LOCUS_18020 383 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18020 2285 1083 gene locus_tag LOCUS_18030 gene tgt 2285 1083 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064322.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence178 646 2340 gene locus_tag LOCUS_18040 646 2340 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527788.1 protein_id gnl|my_center|LOCUS_18040 2353 3108 gene locus_tag LOCUS_18050 2353 3108 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064708.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence179 1849 755 gene locus_tag LOCUS_18060 1849 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2852 1938 gene locus_tag LOCUS_18070 2852 1938 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247635.1 protein_id gnl|my_center|LOCUS_18070 3131 2865 gene locus_tag LOCUS_18080 3131 2865 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402372.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence180 2190 2633 gene locus_tag LOCUS_18090 2190 2633 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530565.1 protein_id gnl|my_center|LOCUS_18090 <3302 2640 gene locus_tag LOCUS_18100 <3302 2640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191241.1:prolipoprotein diacylglyceryl transferase >Feature sequence181 711 91 gene locus_tag LOCUS_18110 711 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18110 864 2294 gene locus_tag LOCUS_18120 864 2294 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809058.1 protein_id gnl|my_center|LOCUS_18120 2307 2822 gene locus_tag LOCUS_18130 2307 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence182 254 105 gene locus_tag LOCUS_18140 254 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 545 312 gene locus_tag LOCUS_18150 545 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence183 495 1466 gene locus_tag LOCUS_18160 495 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1554 2798 gene locus_tag LOCUS_18170 1554 2798 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence184 358 1203 gene locus_tag LOCUS_18180 gene fdhD 358 1203 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 protein_id gnl|my_center|LOCUS_18180 1217 1735 gene locus_tag LOCUS_18190 1217 1735 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064347.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence185 1 207 gene locus_tag LOCUS_18200 1 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 256 1470 gene locus_tag LOCUS_18210 256 1470 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815378.1 protein_id gnl|my_center|LOCUS_18210 1679 2377 gene locus_tag LOCUS_18220 1679 2377 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence186 124 1203 gene locus_tag LOCUS_18230 124 1203 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200023.1 protein_id gnl|my_center|LOCUS_18230 1987 1232 gene locus_tag LOCUS_18240 1987 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence187 2305 1160 gene locus_tag LOCUS_18250 2305 1160 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_18250 <2957 2316 gene locus_tag LOCUS_18260 <2957 2316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107720.1:Crp/Fnr family transcriptional regulator >Feature sequence188 2 670 gene locus_tag LOCUS_18270 2 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence189 1489 401 gene locus_tag LOCUS_18280 1489 401 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926819.1 protein_id gnl|my_center|LOCUS_18280 2334 1486 gene locus_tag LOCUS_18290 gene cysW 2334 1486 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 protein_id gnl|my_center|LOCUS_18290 <2863 2331 gene locus_tag LOCUS_18300 <2863 2331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942000.1:sulfate ABC transporter permease subunit CysT >Feature sequence190 266 2251 gene locus_tag LOCUS_18310 266 2251 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence191 19 94 gene locus_tag LOCUS_t00400 19 94 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 371 180 gene locus_tag LOCUS_18320 371 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 497 1000 gene locus_tag LOCUS_18330 497 1000 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085870.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence192 <1 1182 gene locus_tag LOCUS_18340 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202033.1:ATP-dependent RNA helicase HrpA 2493 1270 gene locus_tag LOCUS_18350 2493 1270 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence193 >Feature sequence194 1263 28 gene locus_tag LOCUS_18360 gene clsB 1263 28 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_18360 1991 1260 gene locus_tag LOCUS_18370 1991 1260 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811372.1 protein_id gnl|my_center|LOCUS_18370 2187 1999 gene locus_tag LOCUS_18380 2187 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence195 567 172 gene locus_tag LOCUS_18390 567 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 781 1950 gene locus_tag LOCUS_18400 781 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 <2733 2137 gene locus_tag LOCUS_18410 <2733 2137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003818284.1:16S rRNA (guanine(527)-N(7))-methyltransferase RsmG >Feature sequence196 454 2376 gene locus_tag LOCUS_18420 454 2376 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150913023.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence197 31 1506 gene locus_tag LOCUS_18430 31 1506 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247436.1 protein_id gnl|my_center|LOCUS_18430 1708 2310 gene locus_tag LOCUS_18440 1708 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence198 1 273 gene locus_tag LOCUS_18450 1 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 353 1159 gene locus_tag LOCUS_18460 gene fabG 353 1159 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065092.1 protein_id gnl|my_center|LOCUS_18460 1298 1537 gene locus_tag LOCUS_18470 gene acpP 1298 1537 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197638.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence199 1586 453 gene locus_tag LOCUS_18480 gene ribBA 1586 453 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009921779.1 protein_id gnl|my_center|LOCUS_18480 2203 1583 gene locus_tag LOCUS_18490 2203 1583 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_18490 2659 2210 gene locus_tag LOCUS_18500 gene nrdR 2659 2210 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185666.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence200 1520 615 gene locus_tag LOCUS_18510 1520 615 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence201 <1 675 gene locus_tag LOCUS_18520 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004203577.1:site-specific tyrosine recombinase XerD 763 1311 gene locus_tag LOCUS_18530 763 1311 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 protein_id gnl|my_center|LOCUS_18530 1304 2320 gene locus_tag LOCUS_18540 gene hslO 1304 2320 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550203.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence202 <2630 998 gene locus_tag LOCUS_18550 <2630 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004203476.1:heavy metal translocating P-type ATPase >Feature sequence203 175 1287 gene locus_tag LOCUS_18560 gene queA 175 1287 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930156.1 protein_id gnl|my_center|LOCUS_18560 1294 2031 gene locus_tag LOCUS_18570 1294 2031 CDS product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704843.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence204 787 1230 gene locus_tag LOCUS_18580 787 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1288 2139 gene locus_tag LOCUS_18590 1288 2139 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence205 1619 546 gene locus_tag LOCUS_18600 gene plsX 1619 546 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_18600 1935 1753 gene locus_tag LOCUS_18610 gene rpmF 1935 1753 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214744.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence206 557 150 gene locus_tag LOCUS_18620 557 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1246 470 gene locus_tag LOCUS_18630 1246 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence207 139 2118 gene locus_tag LOCUS_18640 139 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 >Feature sequence208 1038 115 gene locus_tag LOCUS_18650 1038 115 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_18650 2080 1067 gene locus_tag LOCUS_18660 2080 1067 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816840.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence209 1036 1839 gene locus_tag LOCUS_18670 1036 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence210 >Feature sequence211 308 1315 gene locus_tag LOCUS_18680 308 1315 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525849.1 protein_id gnl|my_center|LOCUS_18680 1956 1306 gene locus_tag LOCUS_18690 1956 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence212 <1 724 gene locus_tag LOCUS_18700 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194871.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 968 663 gene locus_tag LOCUS_18710 968 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1380 2213 gene locus_tag LOCUS_18720 1380 2213 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524730.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence213 171 470 gene locus_tag LOCUS_18730 gene gatC 171 470 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189769.1 protein_id gnl|my_center|LOCUS_18730 467 1993 gene locus_tag LOCUS_18740 gene gatA 467 1993 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence214 <2278 1193 gene locus_tag LOCUS_18750 <2278 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813930.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence215 1289 471 gene locus_tag LOCUS_18760 gene ybgF 1289 471 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_18760 1900 1289 gene locus_tag LOCUS_18770 1900 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence216 198 977 gene locus_tag LOCUS_18780 198 977 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366937.1 protein_id gnl|my_center|LOCUS_18780 1807 1034 gene locus_tag LOCUS_18790 1807 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence217 196 1068 gene locus_tag LOCUS_18800 gene htpX 196 1068 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence218 1636 287 gene locus_tag LOCUS_18810 1636 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence219 224 982 gene locus_tag LOCUS_18820 224 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18820 2137 1031 gene locus_tag LOCUS_18830 gene bioB 2137 1031 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence220 947 1252 gene locus_tag LOCUS_18840 gene rpsT 947 1252 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_18840 1782 1438 gene locus_tag LOCUS_18850 1782 1438 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189028.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence221 1102 464 gene locus_tag LOCUS_18860 1102 464 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813726.1 protein_id gnl|my_center|LOCUS_18860 1824 1120 gene locus_tag LOCUS_18870 1824 1120 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065123.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence222 297 1031 gene locus_tag LOCUS_18880 297 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18880 >Feature sequence223 224 1237 gene locus_tag LOCUS_18890 gene gluQRS 224 1237 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186469.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence224 >Feature sequence225 1046 315 gene locus_tag LOCUS_18900 gene nth 1046 315 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence226 1767 451 gene locus_tag LOCUS_18910 1767 451 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338577.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence227 580 149 gene locus_tag LOCUS_18920 580 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence228 1660 950 gene locus_tag LOCUS_18930 1660 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence229 311 1096 gene locus_tag LOCUS_18940 311 1096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence230 <1 1007 gene locus_tag LOCUS_18950 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038299.1:type I glyceraldehyde-3-phosphate dehydrogenase >Feature sequence231 186 1184 gene locus_tag LOCUS_18960 186 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence232 >Feature sequence233 >Feature sequence234 1357 5 gene locus_tag LOCUS_18970 1357 5 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence235 498 1232 gene locus_tag LOCUS_18980 498 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence236 <1 1083 gene locus_tag LOCUS_18990 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194083.1:class I SAM-dependent RNA methyltransferase >Feature sequence237 398 769 gene locus_tag LOCUS_19000 398 769 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_19000 769 1437 gene locus_tag LOCUS_19010 769 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence238 1101 505 gene locus_tag LOCUS_19020 1101 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence239 <1 872 gene locus_tag LOCUS_19030 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193515.1:aldehyde dehydrogenase family protein 1092 850 gene locus_tag LOCUS_19040 1092 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19040 >Feature sequence240 892 107 gene locus_tag LOCUS_19050 892 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence241 >Feature sequence242 >Feature sequence243 <1363 623 gene locus_tag LOCUS_19060 <1363 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005767010.1:flagellin domain-containing protein >Feature sequence244 <1 1141 gene locus_tag LOCUS_19070 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000608644.1:IS1380-like element ISEcp1 family transposase >Feature sequence245 <1322 58 gene locus_tag LOCUS_19080 <1322 58 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530105.1:chromate efflux transporter >Feature sequence246 97 567 gene locus_tag LOCUS_19090 gene ptsN 97 567 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence247 <1313 342 gene locus_tag LOCUS_19100 <1313 342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810554.1:translational GTPase TypA >Feature sequence248 >Feature sequence249 <1 501 gene locus_tag LOCUS_19110 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187693.1:3-isopropylmalate dehydrogenase 546 1163 gene locus_tag LOCUS_19120 546 1163 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042599338.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence250 >Feature sequence251 2 931 gene locus_tag LOCUS_19130 2 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence252 <1 687 gene locus_tag LOCUS_19140 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813377.1:OmpA family protein >Feature sequence253 >Feature sequence254 2 847 gene locus_tag LOCUS_19150 2 847 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926108.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence255 <1211 29 gene locus_tag LOCUS_19160 <1211 29 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186393.1:NADH-quinone oxidoreductase subunit NuoG >Feature sequence256 >Feature sequence257 >Feature sequence258 930 166 gene locus_tag LOCUS_19170 gene istB 930 166 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence259 347 781 gene locus_tag LOCUS_19180 347 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence260 1164 670 gene locus_tag LOCUS_19190 1164 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence261 <1 1116 gene locus_tag LOCUS_19200 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088624.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence262 <1154 224 gene locus_tag LOCUS_19210 <1154 224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194871.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence263 >Feature sequence264 <1 937 gene locus_tag LOCUS_19220 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811013.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD >Feature sequence265 2 427 gene locus_tag LOCUS_19230 2 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence266 298 786 gene locus_tag LOCUS_19240 gene ssb 298 786 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence267 >Feature sequence268 1075 548 gene locus_tag LOCUS_19250 1075 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence269 >Feature sequence270 597 157 gene locus_tag LOCUS_19260 597 157 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213216.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence271 119 682 gene locus_tag LOCUS_19270 119 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence272 344 628 gene locus_tag LOCUS_19280 344 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 621 1001 gene locus_tag LOCUS_19290 621 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence273 >Feature sequence274 932 306 gene locus_tag LOCUS_19300 932 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence275 >Feature sequence276 314 622 gene locus_tag LOCUS_19310 314 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 733 930 gene locus_tag LOCUS_19320 733 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320