>Feature sequence01 1045 269 gene locus_tag LOCUS_00010 1045 269 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_00010 1717 1052 gene locus_tag LOCUS_00020 1717 1052 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 protein_id gnl|my_center|LOCUS_00020 2465 1776 gene locus_tag LOCUS_00030 gene zupT 2465 1776 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098748.1 protein_id gnl|my_center|LOCUS_00030 2999 2475 gene locus_tag LOCUS_00040 2999 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3113 3038 gene locus_tag LOCUS_t00010 3113 3038 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3752 3162 gene locus_tag LOCUS_00050 gene orn 3752 3162 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_00050 3893 3818 gene locus_tag LOCUS_t00020 3893 3818 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4026 4478 gene locus_tag LOCUS_00060 4026 4478 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976116.1 protein_id gnl|my_center|LOCUS_00060 4500 6170 gene locus_tag LOCUS_00070 gene ettA 4500 6170 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 protein_id gnl|my_center|LOCUS_00070 6163 6825 gene locus_tag LOCUS_00080 6163 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8519 6822 gene locus_tag LOCUS_00090 8519 6822 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_00090 8913 8530 gene locus_tag LOCUS_00100 8913 8530 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_00100 10440 8923 gene locus_tag LOCUS_00110 10440 8923 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_00110 11388 10495 gene locus_tag LOCUS_00120 11388 10495 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978023.1 protein_id gnl|my_center|LOCUS_00120 11459 11701 gene locus_tag LOCUS_00130 11459 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14254 11705 gene locus_tag LOCUS_00140 gene pepN 14254 11705 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_00140 14327 14923 gene locus_tag LOCUS_00150 14327 14923 CDS product Rv2466c family mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412664.1 protein_id gnl|my_center|LOCUS_00150 14932 15378 gene locus_tag LOCUS_00160 14932 15378 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323860.1 protein_id gnl|my_center|LOCUS_00160 15411 15463 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15634 15684 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15734 17002 gene locus_tag LOCUS_00170 gene tig 15734 17002 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_00170 17082 17717 gene locus_tag LOCUS_00180 17082 17717 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_00180 17718 18338 gene locus_tag LOCUS_00190 17718 18338 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_00190 18446 19714 gene locus_tag LOCUS_00200 gene clpX 18446 19714 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562779.1 protein_id gnl|my_center|LOCUS_00200 22031 19719 gene locus_tag LOCUS_00210 gene valS 22031 19719 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224259.1 protein_id gnl|my_center|LOCUS_00210 22305 23618 gene locus_tag LOCUS_00220 22305 23618 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_00220 23623 23979 gene locus_tag LOCUS_00230 23623 23979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24022 24432 gene locus_tag LOCUS_00240 gene ndk 24022 24432 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060204.1 protein_id gnl|my_center|LOCUS_00240 24458 25483 gene locus_tag LOCUS_00250 24458 25483 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_00250 25490 26356 gene locus_tag LOCUS_00260 gene mreC 25490 26356 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_00260 26360 26875 gene locus_tag LOCUS_00270 26360 26875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 26872 28992 gene locus_tag LOCUS_00280 gene mrdA 26872 28992 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_00280 28989 30164 gene locus_tag LOCUS_00290 gene rodA 28989 30164 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_00290 30630 30289 gene locus_tag LOCUS_00300 30630 30289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 30530 32482 gene locus_tag LOCUS_00310 30530 32482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00310 32581 32895 gene locus_tag LOCUS_00320 gene rplU 32581 32895 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775855.1 protein_id gnl|my_center|LOCUS_00320 32902 33150 gene locus_tag LOCUS_00330 gene rpmA 32902 33150 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060213.1 protein_id gnl|my_center|LOCUS_00330 33235 34620 gene locus_tag LOCUS_00340 gene obgE 33235 34620 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_00340 34617 35759 gene locus_tag LOCUS_00350 gene proB 34617 35759 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_00350 35756 37027 gene locus_tag LOCUS_00360 35756 37027 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_00360 37048 37206 gene locus_tag LOCUS_00370 37048 37206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37206 37853 gene locus_tag LOCUS_00380 gene nadD 37206 37853 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_00380 37850 38224 gene locus_tag LOCUS_00390 gene rsfS 37850 38224 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074555.1 protein_id gnl|my_center|LOCUS_00390 38225 38893 gene locus_tag LOCUS_00400 38225 38893 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_00400 38930 39003 gene locus_tag LOCUS_t00030 38930 39003 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 39080 40246 gene locus_tag LOCUS_00410 39080 40246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40144 40229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40368 41609 gene locus_tag LOCUS_00420 40368 41609 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_00420 42019 41606 gene locus_tag LOCUS_00430 42019 41606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 42100 44580 gene locus_tag LOCUS_00440 gene leuS 42100 44580 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_00440 44652 45230 gene locus_tag LOCUS_00450 44652 45230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 45227 47383 gene locus_tag LOCUS_00460 45227 47383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 47404 48393 gene locus_tag LOCUS_00470 47404 48393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 48660 48394 gene locus_tag LOCUS_00480 gene rpsT 48660 48394 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899314.1 protein_id gnl|my_center|LOCUS_00480 48741 50624 gene locus_tag LOCUS_00490 gene lepA 48741 50624 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729920.1 protein_id gnl|my_center|LOCUS_00490 50694 52514 gene locus_tag LOCUS_00500 50694 52514 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_00500 52489 53703 gene locus_tag LOCUS_00510 gene hemW 52489 53703 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_00510 53757 54770 gene locus_tag LOCUS_00520 gene hrcA 53757 54770 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_00520 54780 55919 gene locus_tag LOCUS_00530 gene dnaJ 54780 55919 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_00530 55919 56644 gene locus_tag LOCUS_00540 55919 56644 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_00540 56641 56979 gene locus_tag LOCUS_00550 56641 56979 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140931.1 protein_id gnl|my_center|LOCUS_00550 57022 58026 gene locus_tag LOCUS_00560 57022 58026 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_00560 58023 58478 gene locus_tag LOCUS_00570 gene ybeY 58023 58478 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113111.1 protein_id gnl|my_center|LOCUS_00570 58475 59764 gene locus_tag LOCUS_00580 58475 59764 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895866.1 protein_id gnl|my_center|LOCUS_00580 59757 60644 gene locus_tag LOCUS_00590 59757 60644 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242581.1 protein_id gnl|my_center|LOCUS_00590 60644 61555 gene locus_tag LOCUS_00600 gene era 60644 61555 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_00600 62532 61552 gene locus_tag LOCUS_00610 62532 61552 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_00610 62680 64347 gene locus_tag LOCUS_00620 gene argS 62680 64347 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_00620 64916 64984 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65002 65757 gene locus_tag LOCUS_00630 65002 65757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00630 65822 67111 gene locus_tag LOCUS_00640 65822 67111 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_00640 67108 68190 gene locus_tag LOCUS_00650 gene thrC 67108 68190 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_00650 68193 69095 gene locus_tag LOCUS_00660 gene thrB 68193 69095 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_00660 69249 70931 gene locus_tag LOCUS_00670 69249 70931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 69601 69672 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 71010 71258 gene locus_tag LOCUS_00680 71010 71258 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 protein_id gnl|my_center|LOCUS_00680 71324 72397 gene locus_tag LOCUS_00690 gene prfA 71324 72397 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_00690 72394 73290 gene locus_tag LOCUS_00700 gene prmC 72394 73290 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730206.1 protein_id gnl|my_center|LOCUS_00700 73290 73946 gene locus_tag LOCUS_00710 73290 73946 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_00710 73939 74691 gene locus_tag LOCUS_00720 73939 74691 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_00720 74733 76004 gene locus_tag LOCUS_00730 74733 76004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 76007 77002 gene locus_tag LOCUS_00740 76007 77002 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_00740 76986 77861 gene locus_tag LOCUS_00750 76986 77861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_00750 77861 78613 gene locus_tag LOCUS_00760 77861 78613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_00760 79929 78685 gene locus_tag LOCUS_00770 79929 78685 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_00770 80156 81424 gene locus_tag LOCUS_00780 80156 81424 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_00780 81438 82526 gene locus_tag LOCUS_00790 81438 82526 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_00790 82523 82924 gene locus_tag LOCUS_00800 82523 82924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 82980 83228 gene locus_tag LOCUS_00810 82980 83228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 83360 84055 gene locus_tag LOCUS_00820 gene atpB 83360 84055 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854856.1 protein_id gnl|my_center|LOCUS_00820 84098 84322 gene locus_tag LOCUS_00830 84098 84322 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 protein_id gnl|my_center|LOCUS_00830 84354 84911 gene locus_tag LOCUS_00840 84354 84911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 84914 85720 gene locus_tag LOCUS_00850 84914 85720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 85758 87392 gene locus_tag LOCUS_00860 gene atpA 85758 87392 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973626.1 protein_id gnl|my_center|LOCUS_00860 87414 88346 gene locus_tag LOCUS_00870 87414 88346 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_00870 88352 89779 gene locus_tag LOCUS_00880 gene atpD 88352 89779 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973624.1 protein_id gnl|my_center|LOCUS_00880 89782 90150 gene locus_tag LOCUS_00890 89782 90150 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_00890 90168 90362 gene locus_tag LOCUS_00900 90168 90362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 90946 90377 gene locus_tag LOCUS_00910 90946 90377 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_00910 90999 92273 gene locus_tag LOCUS_00920 gene murA 90999 92273 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 protein_id gnl|my_center|LOCUS_00920 92532 92266 gene locus_tag LOCUS_00930 92532 92266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 92637 92945 gene locus_tag LOCUS_00940 92637 92945 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973605.1 protein_id gnl|my_center|LOCUS_00940 92947 93693 gene locus_tag LOCUS_00950 92947 93693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 94112 93690 gene locus_tag LOCUS_00960 gene mce 94112 93690 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_00960 94164 95360 gene locus_tag LOCUS_00970 94164 95360 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_00970 95378 96088 gene locus_tag LOCUS_00980 95378 96088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 96085 96951 gene locus_tag LOCUS_00990 96085 96951 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_00990 96994 98181 gene locus_tag LOCUS_01000 96994 98181 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_01000 98178 99254 gene locus_tag LOCUS_01010 gene mnmA 98178 99254 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223558.1 protein_id gnl|my_center|LOCUS_01010 99317 100480 gene locus_tag LOCUS_01020 99317 100480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 100572 102734 gene locus_tag LOCUS_01030 gene ligA 100572 102734 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728295.1 protein_id gnl|my_center|LOCUS_01030 102745 103041 gene locus_tag LOCUS_01040 gene gatC 102745 103041 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_01040 103042 104532 gene locus_tag LOCUS_01050 gene gatA 103042 104532 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_01050 104529 106037 gene locus_tag LOCUS_01060 gene gatB 104529 106037 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223571.1 protein_id gnl|my_center|LOCUS_01060 106057 107730 gene locus_tag LOCUS_01070 gene ilvD 106057 107730 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908989.1 protein_id gnl|my_center|LOCUS_01070 107955 109715 gene locus_tag LOCUS_01080 107955 109715 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973484.1 protein_id gnl|my_center|LOCUS_01080 109712 110236 gene locus_tag LOCUS_01090 gene ilvN 109712 110236 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_01090 110275 111303 gene locus_tag LOCUS_01100 gene ilvC 110275 111303 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_01100 111303 111494 gene locus_tag LOCUS_01110 111303 111494 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070876731.1 protein_id gnl|my_center|LOCUS_01110 111585 113174 gene locus_tag LOCUS_01120 gene serA 111585 113174 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_01120 113280 113993 gene locus_tag LOCUS_01130 113280 113993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 113867 113930 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 115871 114135 gene locus_tag LOCUS_01140 gene leuA 115871 114135 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_01140 116074 117087 gene locus_tag LOCUS_01150 116074 117087 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_01150 117090 118178 gene locus_tag LOCUS_01160 117090 118178 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284299.1 protein_id gnl|my_center|LOCUS_01160 118178 119761 gene locus_tag LOCUS_01170 gene cimA 118178 119761 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_01170 119802 120566 gene locus_tag LOCUS_01180 119802 120566 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_01180 120559 122034 gene locus_tag LOCUS_01190 gene gltX 120559 122034 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_01190 122092 122164 gene locus_tag LOCUS_t00040 122092 122164 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 122179 122252 gene locus_tag LOCUS_t00050 122179 122252 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 122346 123746 gene locus_tag LOCUS_01200 gene leuC 122346 123746 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_01200 123757 124347 gene locus_tag LOCUS_01210 gene leuD 123757 124347 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223620.1 protein_id gnl|my_center|LOCUS_01210 124464 124748 gene locus_tag LOCUS_01220 124464 124748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 124848 125585 gene locus_tag LOCUS_01230 124848 125585 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_01230 126717 125608 gene locus_tag LOCUS_01240 126717 125608 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257747.1 protein_id gnl|my_center|LOCUS_01240 126760 127797 gene locus_tag LOCUS_01250 126760 127797 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_01250 128097 127777 gene locus_tag LOCUS_01260 128097 127777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 128247 129191 gene locus_tag LOCUS_01270 128247 129191 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_01270 129372 129181 gene locus_tag LOCUS_01280 gene rpmB 129372 129181 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_01280 129478 131694 gene locus_tag LOCUS_01290 gene recG 129478 131694 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_01290 131691 132236 gene locus_tag LOCUS_01300 gene rsmD 131691 132236 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104349.1 protein_id gnl|my_center|LOCUS_01300 132233 132739 gene locus_tag LOCUS_01310 gene coaD 132233 132739 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056942.1 protein_id gnl|my_center|LOCUS_01310 132711 133211 gene locus_tag LOCUS_01320 132711 133211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 133286 133813 gene locus_tag LOCUS_01330 133286 133813 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_01330 133832 134008 gene locus_tag LOCUS_01340 133832 134008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 134011 134760 gene locus_tag LOCUS_01350 134011 134760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 134753 135610 gene locus_tag LOCUS_01360 gene mutM 134753 135610 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_01360 135659 139237 gene locus_tag LOCUS_01370 gene smc 135659 139237 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_01370 139234 139629 gene locus_tag LOCUS_01380 139234 139629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 139626 140492 gene locus_tag LOCUS_01390 139626 140492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 140610 141893 gene locus_tag LOCUS_01400 140610 141893 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 protein_id gnl|my_center|LOCUS_01400 141896 142234 gene locus_tag LOCUS_01410 141896 142234 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_01410 142324 144606 gene locus_tag LOCUS_01420 142324 144606 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_01420 144617 146023 gene locus_tag LOCUS_01430 gene ffh 144617 146023 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_01430 146168 146722 gene locus_tag LOCUS_01440 146168 146722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 146725 146964 gene locus_tag LOCUS_01450 146725 146964 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_01450 146969 147499 gene locus_tag LOCUS_01460 gene rimM 146969 147499 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_01460 147489 148178 gene locus_tag LOCUS_01470 gene trmD 147489 148178 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223852.1 protein_id gnl|my_center|LOCUS_01470 148196 148720 gene locus_tag LOCUS_01480 148196 148720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 148622 148645 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 148717 148947 gene locus_tag LOCUS_01490 148717 148947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 148957 149640 gene locus_tag LOCUS_01500 148957 149640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 149644 150255 gene locus_tag LOCUS_01510 149644 150255 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908431.1 protein_id gnl|my_center|LOCUS_01510 150252 150566 gene locus_tag LOCUS_01520 150252 150566 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_01520 150668 151462 gene locus_tag LOCUS_01530 150668 151462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 151514 152428 gene locus_tag LOCUS_01540 151514 152428 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_01540 152870 152418 gene locus_tag LOCUS_01550 152870 152418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 153134 153937 gene locus_tag LOCUS_01560 gene rpsB 153134 153937 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_01560 153968 154798 gene locus_tag LOCUS_01570 gene tsf 153968 154798 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 protein_id gnl|my_center|LOCUS_01570 154839 155573 gene locus_tag LOCUS_01580 gene pyrH 154839 155573 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223864.1 protein_id gnl|my_center|LOCUS_01580 155589 156146 gene locus_tag LOCUS_01590 gene frr 155589 156146 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_01590 156290 156973 gene locus_tag LOCUS_01600 156290 156973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 156970 158094 gene locus_tag LOCUS_01610 gene rlmN 156970 158094 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_01610 159452 158091 gene locus_tag LOCUS_01620 159452 158091 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_01620 160096 159449 gene locus_tag LOCUS_01630 160096 159449 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477285.1 protein_id gnl|my_center|LOCUS_01630 161493 160093 gene locus_tag LOCUS_01640 161493 160093 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_01640 161951 161490 gene locus_tag LOCUS_01650 161951 161490 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_01650 162103 163548 gene locus_tag LOCUS_01660 162103 163548 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_01660 163601 164818 gene locus_tag LOCUS_01670 163601 164818 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030369.1 protein_id gnl|my_center|LOCUS_01670 164872 165023 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 165144 166007 gene locus_tag LOCUS_01680 165144 166007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 166007 166903 gene locus_tag LOCUS_01690 166007 166903 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_01690 166903 167703 gene locus_tag LOCUS_01700 166903 167703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_01700 167703 168704 gene locus_tag LOCUS_01710 gene speB 167703 168704 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_01710 170041 168701 gene locus_tag LOCUS_01720 gene gabT 170041 168701 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 protein_id gnl|my_center|LOCUS_01720 170146 171387 gene locus_tag LOCUS_01730 170146 171387 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_01730 171435 172595 gene locus_tag LOCUS_01740 gene ispG 171435 172595 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_01740 172599 173429 gene locus_tag LOCUS_01750 172599 173429 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466751.1 protein_id gnl|my_center|LOCUS_01750 173769 173879 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 173892 175256 gene locus_tag LOCUS_01760 173892 175256 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081714.1 protein_id gnl|my_center|LOCUS_01760 175309 175779 gene locus_tag LOCUS_01770 gene rimP 175309 175779 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_01770 175779 176804 gene locus_tag LOCUS_01780 gene nusA 175779 176804 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_01780 176468 176537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 176812 177078 gene locus_tag LOCUS_01790 176812 177078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 177200 179848 gene locus_tag LOCUS_01800 gene infB 177200 179848 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877447.1 protein_id gnl|my_center|LOCUS_01800 179849 180280 gene locus_tag LOCUS_01810 gene rbfA 179849 180280 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973318.1 protein_id gnl|my_center|LOCUS_01810 180290 181189 gene locus_tag LOCUS_01820 gene truB 180290 181189 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014799.1 protein_id gnl|my_center|LOCUS_01820 181182 182087 gene locus_tag LOCUS_01830 181182 182087 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_01830 182166 182432 gene locus_tag LOCUS_01840 gene rpsO 182166 182432 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804659.1 protein_id gnl|my_center|LOCUS_01840 182565 184763 gene locus_tag LOCUS_01850 182565 184763 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_01850 184908 185651 gene locus_tag LOCUS_01860 gene dapB 184908 185651 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 protein_id gnl|my_center|LOCUS_01860 185955 185644 gene locus_tag LOCUS_01870 185955 185644 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973260.1 protein_id gnl|my_center|LOCUS_01870 186626 185955 gene locus_tag LOCUS_01880 186626 185955 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804665.1 protein_id gnl|my_center|LOCUS_01880 186721 187434 gene locus_tag LOCUS_01890 gene thyX 186721 187434 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030430.1 protein_id gnl|my_center|LOCUS_01890 187459 188337 gene locus_tag LOCUS_01900 gene dapA 187459 188337 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_01900 188334 190016 gene locus_tag LOCUS_01910 188334 190016 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_01910 190252 190079 gene locus_tag LOCUS_01920 190252 190079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 190182 192665 gene locus_tag LOCUS_01930 190182 192665 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_01930 192811 193557 gene locus_tag LOCUS_01940 192811 193557 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973273.1 protein_id gnl|my_center|LOCUS_01940 193582 194976 gene locus_tag LOCUS_01950 gene rimO 193582 194976 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228069.1 protein_id gnl|my_center|LOCUS_01950 194973 195500 gene locus_tag LOCUS_01960 gene pgsA 194973 195500 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_01960 195497 195961 gene locus_tag LOCUS_01970 195497 195961 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_01970 195965 196306 gene locus_tag LOCUS_01980 195965 196306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 196303 196485 gene locus_tag LOCUS_01990 196303 196485 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_01990 197070 197152 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 197162 197683 gene locus_tag LOCUS_02000 197162 197683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02000 197684 198235 gene locus_tag LOCUS_02010 197684 198235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 198900 198232 gene locus_tag LOCUS_02020 198900 198232 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222352.1 protein_id gnl|my_center|LOCUS_02020 198942 199178 gene locus_tag LOCUS_02030 198942 199178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 199218 199541 gene locus_tag LOCUS_02040 199218 199541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 199737 200183 gene locus_tag LOCUS_02050 199737 200183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 201037 200306 gene locus_tag LOCUS_02060 201037 200306 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922437.1 protein_id gnl|my_center|LOCUS_02060 201126 201590 gene locus_tag LOCUS_02070 201126 201590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 201615 201779 gene locus_tag LOCUS_02080 201615 201779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 201813 202310 gene locus_tag LOCUS_02090 201813 202310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 202336 203097 gene locus_tag LOCUS_02100 202336 203097 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994509.1 protein_id gnl|my_center|LOCUS_02100 204970 203243 gene locus_tag LOCUS_02110 gene oppA 204970 203243 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900310.1 protein_id gnl|my_center|LOCUS_02110 204990 205147 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 205183 206160 gene locus_tag LOCUS_02120 205183 206160 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730242.1 protein_id gnl|my_center|LOCUS_02120 206157 207080 gene locus_tag LOCUS_02130 206157 207080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406607.1 protein_id gnl|my_center|LOCUS_02130 207077 209113 gene locus_tag LOCUS_02140 207077 209113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_02140 209123 210364 gene locus_tag LOCUS_02150 209123 210364 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_02150 210923 210369 gene locus_tag LOCUS_02160 210923 210369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 211055 213019 gene locus_tag LOCUS_02170 gene iolD 211055 213019 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612343.1 protein_id gnl|my_center|LOCUS_02170 213310 213023 gene locus_tag LOCUS_02180 213310 213023 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084697.1 protein_id gnl|my_center|LOCUS_02180 213607 214494 gene locus_tag LOCUS_02190 213607 214494 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113238.1 protein_id gnl|my_center|LOCUS_02190 214497 215717 gene locus_tag LOCUS_02200 214497 215717 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884513.1 protein_id gnl|my_center|LOCUS_02200 215746 217179 gene locus_tag LOCUS_02210 gene miaB 215746 217179 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_02210 217176 218090 gene locus_tag LOCUS_02220 gene miaA 217176 218090 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_02220 218095 218892 gene locus_tag LOCUS_02230 gene dapF 218095 218892 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 protein_id gnl|my_center|LOCUS_02230 218889 220262 gene locus_tag LOCUS_02240 gene hflX 218889 220262 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_02240 220255 222258 gene locus_tag LOCUS_02250 220255 222258 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_02250 222653 222255 gene locus_tag LOCUS_02260 222653 222255 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085007.1 protein_id gnl|my_center|LOCUS_02260 223483 222650 gene locus_tag LOCUS_02270 223483 222650 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_02270 224151 223480 gene locus_tag LOCUS_02280 224151 223480 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775739.1 protein_id gnl|my_center|LOCUS_02280 225125 224214 gene locus_tag LOCUS_02290 225125 224214 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_02290 225817 225164 gene locus_tag LOCUS_02300 gene lexA 225817 225164 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894124.1 protein_id gnl|my_center|LOCUS_02300 225959 226282 gene locus_tag LOCUS_02310 225959 226282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 226699 226262 gene locus_tag LOCUS_02320 226699 226262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 226920 227450 gene locus_tag LOCUS_02330 gene nrdR 226920 227450 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804686.1 protein_id gnl|my_center|LOCUS_02330 227504 230311 gene locus_tag LOCUS_02340 227504 230311 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_02340 230438 232147 gene locus_tag LOCUS_02350 230438 232147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_02350 232144 233979 gene locus_tag LOCUS_02360 232144 233979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 protein_id gnl|my_center|LOCUS_02360 234067 235692 gene locus_tag LOCUS_02370 gene ptsP 234067 235692 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231021.1 protein_id gnl|my_center|LOCUS_02370 236210 235695 gene locus_tag LOCUS_02380 236210 235695 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_02380 236708 236235 gene locus_tag LOCUS_02390 236708 236235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 236821 237267 gene locus_tag LOCUS_02400 236821 237267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 237270 237896 gene locus_tag LOCUS_02410 237270 237896 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080357.1 protein_id gnl|my_center|LOCUS_02410 237974 238915 gene locus_tag LOCUS_02420 237974 238915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 239751 238912 gene locus_tag LOCUS_02430 239751 238912 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104392.1 protein_id gnl|my_center|LOCUS_02430 239955 241250 gene locus_tag LOCUS_02440 239955 241250 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_02440 241253 242362 gene locus_tag LOCUS_02450 241253 242362 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_02450 243252 243818 gene locus_tag LOCUS_02460 243252 243818 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_02460 243998 244125 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 244291 244387 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 245971 245753 gene locus_tag LOCUS_02470 245971 245753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_02470 246119 248179 gene locus_tag LOCUS_02480 246119 248179 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_02480 248304 248483 gene locus_tag LOCUS_02490 248304 248483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 250911 248488 gene locus_tag LOCUS_02500 250911 248488 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_02500 251020 251694 gene locus_tag LOCUS_02510 251020 251694 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_02510 252630 251701 gene locus_tag LOCUS_02520 252630 251701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 253540 252725 gene locus_tag LOCUS_02530 gene sepH 253540 252725 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_02530 254698 253592 gene locus_tag LOCUS_02540 254698 253592 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_02540 254804 255604 gene locus_tag LOCUS_02550 254804 255604 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894144.1 protein_id gnl|my_center|LOCUS_02550 256119 255601 gene locus_tag LOCUS_02560 256119 255601 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_02560 256245 256547 gene locus_tag LOCUS_02570 256245 256547 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_02570 256975 256544 gene locus_tag LOCUS_02580 256975 256544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 257045 257482 gene locus_tag LOCUS_02590 gene dut 257045 257482 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_02590 257482 257841 gene locus_tag LOCUS_02600 257482 257841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 257834 258463 gene locus_tag LOCUS_02610 257834 258463 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783114.1 protein_id gnl|my_center|LOCUS_02610 259105 258410 gene locus_tag LOCUS_02620 259105 258410 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_02620 259764 259102 gene locus_tag LOCUS_02630 259764 259102 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_02630 259836 261770 gene locus_tag LOCUS_02640 259836 261770 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093687.1 protein_id gnl|my_center|LOCUS_02640 261767 262912 gene locus_tag LOCUS_02650 261767 262912 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_02650 262958 265618 gene locus_tag LOCUS_02660 gene acnA 262958 265618 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_02660 265719 266792 gene locus_tag LOCUS_02670 265719 266792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 266792 267106 gene locus_tag LOCUS_02680 266792 267106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 267175 267360 gene locus_tag LOCUS_02690 267175 267360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776783.1 protein_id gnl|my_center|LOCUS_02690 268619 267363 gene locus_tag LOCUS_02700 268619 267363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 269483 268755 gene locus_tag LOCUS_02710 269483 268755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 269502 269696 gene locus_tag LOCUS_02720 269502 269696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 270924 269707 gene locus_tag LOCUS_02730 270924 269707 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_02730 271651 270956 gene locus_tag LOCUS_02740 271651 270956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 272139 271663 gene locus_tag LOCUS_02750 272139 271663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 272728 272294 gene locus_tag LOCUS_02760 gene msrB 272728 272294 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413865.1 protein_id gnl|my_center|LOCUS_02760 273333 272728 gene locus_tag LOCUS_02770 273333 272728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 273471 273397 gene locus_tag LOCUS_t00060 273471 273397 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 273560 273489 gene locus_tag LOCUS_t00070 273560 273489 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 273656 273584 gene locus_tag LOCUS_t00080 273656 273584 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 273761 274771 gene locus_tag LOCUS_02780 273761 274771 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_02780 274772 275596 gene locus_tag LOCUS_02790 274772 275596 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_02790 275669 276028 gene locus_tag LOCUS_02800 275669 276028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 276090 278072 gene locus_tag LOCUS_02810 gene thrS 276090 278072 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804992.1 protein_id gnl|my_center|LOCUS_02810 278072 278572 gene locus_tag LOCUS_02820 278072 278572 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227148.1 protein_id gnl|my_center|LOCUS_02820 278578 279180 gene locus_tag LOCUS_02830 278578 279180 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_02830 279177 280034 gene locus_tag LOCUS_02840 279177 280034 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227145.1 protein_id gnl|my_center|LOCUS_02840 280161 280301 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 280505 281215 gene locus_tag LOCUS_02850 280505 281215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 281323 281682 gene locus_tag LOCUS_02860 281323 281682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 281790 282137 gene locus_tag LOCUS_02870 281790 282137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 282254 283147 gene locus_tag LOCUS_02880 gene pdxS 282254 283147 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939476.1 protein_id gnl|my_center|LOCUS_02880 283155 283754 gene locus_tag LOCUS_02890 gene pdxT 283155 283754 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 protein_id gnl|my_center|LOCUS_02890 283791 284537 gene locus_tag LOCUS_02900 283791 284537 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_02900 284537 285070 gene locus_tag LOCUS_02910 gene ruvC 284537 285070 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082392.1 protein_id gnl|my_center|LOCUS_02910 285067 285627 gene locus_tag LOCUS_02920 gene ruvA 285067 285627 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_02920 285624 286637 gene locus_tag LOCUS_02930 gene ruvB 285624 286637 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_02930 286773 288311 gene locus_tag LOCUS_02940 286773 288311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 288308 289384 gene locus_tag LOCUS_02950 gene secF 288308 289384 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_02950 289430 291673 gene locus_tag LOCUS_02960 gene relA 289430 291673 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_02960 292908 291670 gene locus_tag LOCUS_02970 292908 291670 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_02970 293676 292930 gene locus_tag LOCUS_02980 293676 292930 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014511.1 protein_id gnl|my_center|LOCUS_02980 293797 294468 gene locus_tag LOCUS_02990 293797 294468 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413366.1 protein_id gnl|my_center|LOCUS_02990 294471 295754 gene locus_tag LOCUS_03000 gene hisS 294471 295754 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894356.1 protein_id gnl|my_center|LOCUS_03000 295760 297493 gene locus_tag LOCUS_03010 gene aspS 295760 297493 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_03010 297490 300159 gene locus_tag LOCUS_03020 gene alaS 297490 300159 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_03020 300162 300605 gene locus_tag LOCUS_03030 gene ruvX 300162 300605 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_03030 300592 301635 gene locus_tag LOCUS_03040 gene mltG 300592 301635 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 protein_id gnl|my_center|LOCUS_03040 301635 302537 gene locus_tag LOCUS_03050 301635 302537 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775668.1 protein_id gnl|my_center|LOCUS_03050 303012 304190 gene locus_tag LOCUS_03060 gene aroC 303012 304190 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_03060 304187 304699 gene locus_tag LOCUS_03070 304187 304699 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111371.1 protein_id gnl|my_center|LOCUS_03070 304696 305775 gene locus_tag LOCUS_03080 gene aroB 304696 305775 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224604.1 protein_id gnl|my_center|LOCUS_03080 305772 306209 gene locus_tag LOCUS_03090 gene aroQ 305772 306209 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052141.1 protein_id gnl|my_center|LOCUS_03090 306784 306882 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 306922 307266 gene locus_tag LOCUS_03100 306922 307266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 307280 307366 gene locus_tag LOCUS_t00090 307280 307366 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 307384 307977 gene locus_tag LOCUS_03110 307384 307977 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894637.1 protein_id gnl|my_center|LOCUS_03110 308386 307952 gene locus_tag LOCUS_03120 308386 307952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence02 121 134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2418 322 gene locus_tag LOCUS_03130 gene fusA 2418 322 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974302.1 protein_id gnl|my_center|LOCUS_03130 2910 2440 gene locus_tag LOCUS_03140 gene rpsG 2910 2440 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974303.1 protein_id gnl|my_center|LOCUS_03140 3284 2910 gene locus_tag LOCUS_03150 gene rpsL 3284 2910 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102113.1 protein_id gnl|my_center|LOCUS_03150 3573 4259 gene locus_tag LOCUS_03160 3573 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 8190 4303 gene locus_tag LOCUS_03170 8190 4303 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_03170 11714 8247 gene locus_tag LOCUS_03180 gene rpoB 11714 8247 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_03180 8895 8967 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9631 9639 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11688 11936 gene locus_tag LOCUS_03190 11688 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 12308 11925 gene locus_tag LOCUS_03200 gene rplL 12308 11925 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974310.1 protein_id gnl|my_center|LOCUS_03200 13037 12369 gene locus_tag LOCUS_03210 gene rplJ 13037 12369 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_03210 13955 13245 gene locus_tag LOCUS_03220 gene rplA 13955 13245 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776393.1 protein_id gnl|my_center|LOCUS_03220 14489 14058 gene locus_tag LOCUS_03230 gene rplK 14489 14058 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 protein_id gnl|my_center|LOCUS_03230 15349 14510 gene locus_tag LOCUS_03240 15349 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 15604 15365 gene locus_tag LOCUS_03250 15604 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 15752 15679 gene locus_tag LOCUS_t00100 15752 15679 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 15847 17067 gene locus_tag LOCUS_03260 15847 17067 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_03260 18074 17064 gene locus_tag LOCUS_03270 18074 17064 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_03270 18840 18085 gene locus_tag LOCUS_03280 18840 18085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 19250 18837 gene locus_tag LOCUS_03290 19250 18837 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_03290 19672 19247 gene locus_tag LOCUS_03300 19672 19247 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_03300 19858 19694 gene locus_tag LOCUS_03310 gene rpmG 19858 19694 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005152047.1 protein_id gnl|my_center|LOCUS_03310 19964 20035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20168 21229 gene locus_tag LOCUS_03320 gene rarD 20168 21229 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_03320 20265 20183 gene locus_tag LOCUS_t00110 20265 20183 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 22208 21210 gene locus_tag LOCUS_03330 22208 21210 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_03330 23760 22213 gene locus_tag LOCUS_03340 gene nuoN 23760 22213 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_03340 25286 23760 gene locus_tag LOCUS_03350 25286 23760 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086541.1 protein_id gnl|my_center|LOCUS_03350 27219 25288 gene locus_tag LOCUS_03360 gene nuoL 27219 25288 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_03360 27540 27241 gene locus_tag LOCUS_03370 gene nuoK 27540 27241 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893422.1 protein_id gnl|my_center|LOCUS_03370 28324 27527 gene locus_tag LOCUS_03380 28324 27527 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416449.1 protein_id gnl|my_center|LOCUS_03380 28869 28324 gene locus_tag LOCUS_03390 gene nuoI 28869 28324 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086544.1 protein_id gnl|my_center|LOCUS_03390 30136 28862 gene locus_tag LOCUS_03400 gene nuoH 30136 28862 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_03400 32508 30133 gene locus_tag LOCUS_03410 32508 30133 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_03410 33770 32505 gene locus_tag LOCUS_03420 gene nuoF 33770 32505 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_03420 34402 33770 gene locus_tag LOCUS_03430 34402 33770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 35742 34402 gene locus_tag LOCUS_03440 35742 34402 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_03440 36446 35739 gene locus_tag LOCUS_03450 36446 35739 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_03450 36997 36443 gene locus_tag LOCUS_03460 36997 36443 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416420.1 protein_id gnl|my_center|LOCUS_03460 37357 36998 gene locus_tag LOCUS_03470 37357 36998 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_03470 38163 37465 gene locus_tag LOCUS_03480 38163 37465 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_03480 38228 39496 gene locus_tag LOCUS_03490 38228 39496 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_03490 41081 39480 gene locus_tag LOCUS_03500 gene menD 41081 39480 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402927.1 protein_id gnl|my_center|LOCUS_03500 42055 41078 gene locus_tag LOCUS_03510 42055 41078 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908796.1 protein_id gnl|my_center|LOCUS_03510 42918 42052 gene locus_tag LOCUS_03520 gene menB 42918 42052 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963885.1 protein_id gnl|my_center|LOCUS_03520 42990 44066 gene locus_tag LOCUS_03530 42990 44066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 44063 44932 gene locus_tag LOCUS_03540 44063 44932 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_03540 45211 44903 gene locus_tag LOCUS_03550 45211 44903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 46044 45211 gene locus_tag LOCUS_03560 46044 45211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 47465 46041 gene locus_tag LOCUS_03570 47465 46041 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776419.1 protein_id gnl|my_center|LOCUS_03570 48259 47546 gene locus_tag LOCUS_03580 48259 47546 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_03580 48798 48259 gene locus_tag LOCUS_03590 48798 48259 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776421.1 protein_id gnl|my_center|LOCUS_03590 49439 48798 gene locus_tag LOCUS_03600 49439 48798 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_03600 51002 49443 gene locus_tag LOCUS_03610 51002 49443 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_03610 51682 50999 gene locus_tag LOCUS_03620 51682 50999 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_03620 51997 51752 gene locus_tag LOCUS_03630 51997 51752 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030145241.1 protein_id gnl|my_center|LOCUS_03630 52960 52172 gene locus_tag LOCUS_03640 gene proC 52960 52172 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769432.1 protein_id gnl|my_center|LOCUS_03640 53899 52970 gene locus_tag LOCUS_03650 53899 52970 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_03650 54002 54712 gene locus_tag LOCUS_03660 54002 54712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_03660 54723 56081 gene locus_tag LOCUS_03670 gene radA 54723 56081 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_03670 58576 56078 gene locus_tag LOCUS_03680 58576 56078 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_03680 58681 61407 gene locus_tag LOCUS_03690 gene ppc 58681 61407 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_03690 61910 61404 gene locus_tag LOCUS_03700 61910 61404 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 protein_id gnl|my_center|LOCUS_03700 63412 61916 gene locus_tag LOCUS_03710 63412 61916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 64204 63449 gene locus_tag LOCUS_03720 64204 63449 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230456.1 protein_id gnl|my_center|LOCUS_03720 65019 64213 gene locus_tag LOCUS_03730 gene panC 65019 64213 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 protein_id gnl|my_center|LOCUS_03730 65468 65019 gene locus_tag LOCUS_03740 65468 65019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 65956 65465 gene locus_tag LOCUS_03750 gene folK 65956 65465 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_03750 66315 65953 gene locus_tag LOCUS_03760 gene folB 66315 65953 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230465.1 protein_id gnl|my_center|LOCUS_03760 67132 66308 gene locus_tag LOCUS_03770 gene folP 67132 66308 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804896.1 protein_id gnl|my_center|LOCUS_03770 67761 67135 gene locus_tag LOCUS_03780 gene folE 67761 67135 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_03780 69702 67771 gene locus_tag LOCUS_03790 gene ftsH 69702 67771 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_03790 70341 69790 gene locus_tag LOCUS_03800 gene hpt 70341 69790 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_03800 71309 70338 gene locus_tag LOCUS_03810 gene tilS 71309 70338 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_03810 71543 71325 gene locus_tag LOCUS_03820 71543 71325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 71488 73764 gene locus_tag LOCUS_03830 71488 73764 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449634.1 protein_id gnl|my_center|LOCUS_03830 75739 73796 gene locus_tag LOCUS_03840 75739 73796 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_03840 76351 75815 gene locus_tag LOCUS_03850 76351 75815 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_03850 76467 76862 gene locus_tag LOCUS_03860 76467 76862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 76961 78862 gene locus_tag LOCUS_03870 gene typA 76961 78862 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_03870 78262 78371 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 79365 78874 gene locus_tag LOCUS_03880 79365 78874 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_03880 79473 79401 gene locus_tag LOCUS_t00120 79473 79401 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 80987 79488 gene locus_tag LOCUS_03890 80987 79488 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776491.1 protein_id gnl|my_center|LOCUS_03890 82163 80988 gene locus_tag LOCUS_03900 82163 80988 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_03900 82456 82160 gene locus_tag LOCUS_03910 82456 82160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03910 82457 82533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 85522 82850 gene locus_tag LOCUS_03920 gene topA 85522 82850 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_03920 85984 85640 gene locus_tag LOCUS_03930 85984 85640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 86328 85981 gene locus_tag LOCUS_03940 86328 85981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 86534 86322 gene locus_tag LOCUS_03950 86534 86322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 87326 86643 gene locus_tag LOCUS_03960 87326 86643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 87943 87323 gene locus_tag LOCUS_03970 87943 87323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 89043 87937 gene locus_tag LOCUS_03980 89043 87937 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_03980 90050 89040 gene locus_tag LOCUS_03990 gene ssd 90050 89040 CDS product septum site-determining protein Ssd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419685.1 protein_id gnl|my_center|LOCUS_03990 90213 92147 gene locus_tag LOCUS_04000 gene acs 90213 92147 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_04000 92209 92604 gene locus_tag LOCUS_04010 92209 92604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 92609 93532 gene locus_tag LOCUS_04020 92609 93532 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_04020 94048 93509 gene locus_tag LOCUS_04030 94048 93509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 94675 94049 gene locus_tag LOCUS_04040 94675 94049 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_04040 95346 94672 gene locus_tag LOCUS_04050 gene nth 95346 94672 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230550.1 protein_id gnl|my_center|LOCUS_04050 95424 96098 gene locus_tag LOCUS_04060 95424 96098 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_04060 96556 96095 gene locus_tag LOCUS_04070 96556 96095 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230563.1 protein_id gnl|my_center|LOCUS_04070 96708 96553 gene locus_tag LOCUS_04080 96708 96553 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_04080 97033 96752 gene locus_tag LOCUS_04090 97033 96752 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230567.1 protein_id gnl|my_center|LOCUS_04090 97145 99259 gene locus_tag LOCUS_04100 97145 99259 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_04100 99716 99264 gene locus_tag LOCUS_04110 99716 99264 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_04110 99726 100640 gene locus_tag LOCUS_04120 99726 100640 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467832.1 protein_id gnl|my_center|LOCUS_04120 100732 100824 gene locus_tag LOCUS_t00130 100732 100824 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 100891 100981 gene locus_tag LOCUS_t00140 100891 100981 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 101107 101122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 101180 101785 gene locus_tag LOCUS_04130 gene pcp 101180 101785 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816813.1 protein_id gnl|my_center|LOCUS_04130 103499 102126 gene locus_tag LOCUS_04140 103499 102126 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467865.1 protein_id gnl|my_center|LOCUS_04140 106258 103562 gene locus_tag LOCUS_04150 gene ppdK 106258 103562 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_04150 107613 106531 gene locus_tag LOCUS_04160 107613 106531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 108918 107701 gene locus_tag LOCUS_04170 gene nhaA 108918 107701 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029088.1 protein_id gnl|my_center|LOCUS_04170 109188 108928 gene locus_tag LOCUS_04180 109188 108928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 111170 109218 gene locus_tag LOCUS_04190 111170 109218 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 protein_id gnl|my_center|LOCUS_04190 111283 114150 gene locus_tag LOCUS_04200 gene gcvP 111283 114150 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_04200 114150 115241 gene locus_tag LOCUS_04210 gene gcvT 114150 115241 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_04210 115247 115615 gene locus_tag LOCUS_04220 gene gcvH 115247 115615 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223709.1 protein_id gnl|my_center|LOCUS_04220 115685 116245 gene locus_tag LOCUS_04230 115685 116245 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869265.1 protein_id gnl|my_center|LOCUS_04230 116317 117156 gene locus_tag LOCUS_04240 gene htpX 116317 117156 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836621.1 protein_id gnl|my_center|LOCUS_04240 117153 118112 gene locus_tag LOCUS_04250 117153 118112 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228820.1 protein_id gnl|my_center|LOCUS_04250 118194 118601 gene locus_tag LOCUS_04260 118194 118601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 119431 118652 gene locus_tag LOCUS_04270 119431 118652 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259006.1 protein_id gnl|my_center|LOCUS_04270 119685 119473 gene locus_tag LOCUS_04280 119685 119473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 119596 119799 gene locus_tag LOCUS_04290 119596 119799 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_04290 121152 119851 gene locus_tag LOCUS_04300 121152 119851 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 protein_id gnl|my_center|LOCUS_04300 121318 122553 gene locus_tag LOCUS_04310 121318 122553 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731196.1 protein_id gnl|my_center|LOCUS_04310 121975 122058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 123638 122550 gene locus_tag LOCUS_04320 gene tal 123638 122550 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111302.1 protein_id gnl|my_center|LOCUS_04320 124279 123641 gene locus_tag LOCUS_04330 gene upp 124279 123641 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_04330 124333 124794 gene locus_tag LOCUS_04340 gene tadA 124333 124794 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693256.1 protein_id gnl|my_center|LOCUS_04340 124886 124797 gene locus_tag LOCUS_t00150 124886 124797 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 125064 125151 gene locus_tag LOCUS_t00160 125064 125151 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 125194 126897 gene locus_tag LOCUS_04350 125194 126897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 126901 127497 gene locus_tag LOCUS_04360 gene recR 126901 127497 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_04360 127554 128825 gene locus_tag LOCUS_04370 127554 128825 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_04370 128826 129878 gene locus_tag LOCUS_04380 128826 129878 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_04380 130429 129875 gene locus_tag LOCUS_04390 130429 129875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 130521 131831 gene locus_tag LOCUS_04400 gene serS 130521 131831 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_04400 131828 132673 gene locus_tag LOCUS_04410 131828 132673 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_04410 132693 132908 gene locus_tag LOCUS_04420 132693 132908 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 protein_id gnl|my_center|LOCUS_04420 132913 135081 gene locus_tag LOCUS_04430 132913 135081 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_04430 135995 135078 gene locus_tag LOCUS_04440 gene pheA 135995 135078 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_04440 136846 136058 gene locus_tag LOCUS_04450 136846 136058 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084130.1 protein_id gnl|my_center|LOCUS_04450 137190 137230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 137244 138116 gene locus_tag LOCUS_04460 137244 138116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 138131 138493 gene locus_tag LOCUS_04470 138131 138493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 138560 139225 gene locus_tag LOCUS_04480 138560 139225 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_04480 139222 139674 gene locus_tag LOCUS_04490 139222 139674 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003079002.1 protein_id gnl|my_center|LOCUS_04490 139671 140798 gene locus_tag LOCUS_04500 139671 140798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 140801 142120 gene locus_tag LOCUS_04510 140801 142120 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 protein_id gnl|my_center|LOCUS_04510 140884 141012 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 142117 143580 gene locus_tag LOCUS_04520 142117 143580 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_04520 143617 145281 gene locus_tag LOCUS_04530 gene pknB 143617 145281 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_04530 145453 146658 gene locus_tag LOCUS_04540 145453 146658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 147307 146687 gene locus_tag LOCUS_04550 147307 146687 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_04550 148019 147312 gene locus_tag LOCUS_04560 148019 147312 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891353.1 protein_id gnl|my_center|LOCUS_04560 148020 148304 gene locus_tag LOCUS_04570 148020 148304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 148995 148360 gene locus_tag LOCUS_04580 148995 148360 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400822.1 protein_id gnl|my_center|LOCUS_04580 149552 149040 gene locus_tag LOCUS_04590 149552 149040 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878080.1 protein_id gnl|my_center|LOCUS_04590 149653 149580 gene locus_tag LOCUS_t00170 149653 149580 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 149796 149659 gene locus_tag LOCUS_04600 149796 149659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 149902 149827 gene locus_tag LOCUS_t00180 149902 149827 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 150352 149975 gene locus_tag LOCUS_04610 150352 149975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 150822 150355 gene locus_tag LOCUS_04620 150822 150355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04620 152851 150794 gene locus_tag LOCUS_04630 152851 150794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04630 150844 150905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 152612 152663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 154809 152869 gene locus_tag LOCUS_04640 gene gyrB 154809 152869 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_04640 155476 155048 gene locus_tag LOCUS_04650 155476 155048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 156602 155469 gene locus_tag LOCUS_04660 gene recF 156602 155469 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_04660 157717 156602 gene locus_tag LOCUS_04670 gene dnaN 157717 156602 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_04670 159515 158085 gene locus_tag LOCUS_04680 159515 158085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 159914 160255 gene locus_tag LOCUS_04690 gene rnpA 159914 160255 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777158.1 protein_id gnl|my_center|LOCUS_04690 160248 160559 gene locus_tag LOCUS_04700 160248 160559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 160560 161498 gene locus_tag LOCUS_04710 160560 161498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 161724 161849 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 162019 163584 gene locus_tag LOCUS_04720 162019 163584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 162576 162656 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 163581 164510 gene locus_tag LOCUS_04730 163581 164510 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400175.1 protein_id gnl|my_center|LOCUS_04730 165770 164511 gene locus_tag LOCUS_04740 165770 164511 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_04740 165727 165746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 166971 165919 gene locus_tag LOCUS_04750 166971 165919 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231059.1 protein_id gnl|my_center|LOCUS_04750 167157 166978 gene locus_tag LOCUS_04760 167157 166978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04760 167179 167222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 167954 167352 gene locus_tag LOCUS_04770 167954 167352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 168006 168132 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 169629 168322 gene locus_tag LOCUS_04780 169629 168322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 171236 169629 gene locus_tag LOCUS_04790 171236 169629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 172291 171233 gene locus_tag LOCUS_04800 172291 171233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 172427 172611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 173499 173005 gene locus_tag LOCUS_04810 173499 173005 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284381.1 protein_id gnl|my_center|LOCUS_04810 173533 174969 gene locus_tag LOCUS_04820 173533 174969 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_04820 176192 174966 gene locus_tag LOCUS_04830 176192 174966 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_04830 176250 176711 gene locus_tag LOCUS_04840 176250 176711 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731617.1 protein_id gnl|my_center|LOCUS_04840 176716 178704 gene locus_tag LOCUS_04850 176716 178704 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777144.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence03 1541 675 gene locus_tag LOCUS_04860 1541 675 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_04860 4822 1538 gene locus_tag LOCUS_04870 gene carB 4822 1538 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_04870 5949 4822 gene locus_tag LOCUS_04880 gene carA 5949 4822 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_04880 7235 5949 gene locus_tag LOCUS_04890 7235 5949 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_04890 8179 7232 gene locus_tag LOCUS_04900 8179 7232 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_04900 8748 8176 gene locus_tag LOCUS_04910 gene pyrR 8748 8176 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_04910 10246 8816 gene locus_tag LOCUS_04920 gene pyk 10246 8816 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805095.1 protein_id gnl|my_center|LOCUS_04920 11738 10275 gene locus_tag LOCUS_04930 11738 10275 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_04930 16272 11731 gene locus_tag LOCUS_04940 gene gltB 16272 11731 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_04940 16921 16349 gene locus_tag LOCUS_04950 16921 16349 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_04950 17765 16911 gene locus_tag LOCUS_04960 gene lgt 17765 16911 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 protein_id gnl|my_center|LOCUS_04960 18526 17768 gene locus_tag LOCUS_04970 18526 17768 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223189.1 protein_id gnl|my_center|LOCUS_04970 19361 18561 gene locus_tag LOCUS_04980 gene trpA 19361 18561 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_04980 20566 19361 gene locus_tag LOCUS_04990 gene trpB 20566 19361 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_04990 21385 20576 gene locus_tag LOCUS_05000 gene trpC 21385 20576 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_05000 21606 21382 gene locus_tag LOCUS_05010 21606 21382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 22199 21684 gene locus_tag LOCUS_05020 22199 21684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 23692 22196 gene locus_tag LOCUS_05030 23692 22196 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 protein_id gnl|my_center|LOCUS_05030 24030 23692 gene locus_tag LOCUS_05040 24030 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 24081 24749 gene locus_tag LOCUS_05050 24081 24749 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230583.1 protein_id gnl|my_center|LOCUS_05050 25504 24746 gene locus_tag LOCUS_05060 gene hisF 25504 24746 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728898.1 protein_id gnl|my_center|LOCUS_05060 25572 25952 gene locus_tag LOCUS_05070 25572 25952 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660557.1 protein_id gnl|my_center|LOCUS_05070 26657 25941 gene locus_tag LOCUS_05080 gene priA 26657 25941 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_05080 27283 26654 gene locus_tag LOCUS_05090 gene hisH 27283 26654 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_05090 27867 27280 gene locus_tag LOCUS_05100 gene hisB 27867 27280 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_05100 28958 27867 gene locus_tag LOCUS_05110 28958 27867 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_05110 30259 28955 gene locus_tag LOCUS_05120 gene hisD 30259 28955 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068574.1 protein_id gnl|my_center|LOCUS_05120 30418 30978 gene locus_tag LOCUS_05130 30418 30978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 34510 30971 gene locus_tag LOCUS_05140 gene dnaE 34510 30971 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_05140 35530 34592 gene locus_tag LOCUS_05150 35530 34592 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_05150 36026 35523 gene locus_tag LOCUS_05160 36026 35523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 36437 36027 gene locus_tag LOCUS_05170 36437 36027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 36523 39696 gene locus_tag LOCUS_05180 gene ileS 36523 39696 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_05180 39974 39693 gene locus_tag LOCUS_05190 39974 39693 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_05190 40408 39974 gene locus_tag LOCUS_05200 40408 39974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 41149 40451 gene locus_tag LOCUS_05210 41149 40451 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_05210 41835 41146 gene locus_tag LOCUS_05220 gene pgeF 41835 41146 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411140.1 protein_id gnl|my_center|LOCUS_05220 43055 41862 gene locus_tag LOCUS_05230 gene ftsZ 43055 41862 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_05230 43285 43734 gene locus_tag LOCUS_05240 43285 43734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 43831 44886 gene locus_tag LOCUS_05250 gene msiK 43831 44886 CDS product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_05250 45988 44942 gene locus_tag LOCUS_05260 45988 44942 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582579.1 protein_id gnl|my_center|LOCUS_05260 46721 46053 gene locus_tag LOCUS_05270 46721 46053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 48115 46724 gene locus_tag LOCUS_05280 gene murC 48115 46724 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_05280 49197 48112 gene locus_tag LOCUS_05290 gene murG 49197 48112 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908021.1 protein_id gnl|my_center|LOCUS_05290 50285 49200 gene locus_tag LOCUS_05300 50285 49200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 50460 51965 gene locus_tag LOCUS_05310 50460 51965 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730606.1 protein_id gnl|my_center|LOCUS_05310 53383 51962 gene locus_tag LOCUS_05320 gene murD 53383 51962 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_05320 54447 53380 gene locus_tag LOCUS_05330 gene mraY 54447 53380 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_05330 55841 54450 gene locus_tag LOCUS_05340 55841 54450 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_05340 57298 55838 gene locus_tag LOCUS_05350 57298 55838 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092426.1 protein_id gnl|my_center|LOCUS_05350 59058 57298 gene locus_tag LOCUS_05360 gene ftsI 59058 57298 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_05360 59453 59055 gene locus_tag LOCUS_05370 59453 59055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 60430 59450 gene locus_tag LOCUS_05380 gene rsmH 60430 59450 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228045.1 protein_id gnl|my_center|LOCUS_05380 61136 60705 gene locus_tag LOCUS_05390 gene mraZ 61136 60705 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_05390 61690 61325 gene locus_tag LOCUS_05400 61690 61325 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_05400 62985 61750 gene locus_tag LOCUS_05410 gene dinB 62985 61750 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_05410 66674 62985 gene locus_tag LOCUS_05420 gene dnaE 66674 62985 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_05420 66880 66674 gene locus_tag LOCUS_05430 66880 66674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 68275 67106 gene locus_tag LOCUS_05440 68275 67106 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_05440 68558 69745 gene locus_tag LOCUS_05450 68558 69745 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_05450 70609 69746 gene locus_tag LOCUS_05460 70609 69746 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246070.1 protein_id gnl|my_center|LOCUS_05460 70659 71171 gene locus_tag LOCUS_05470 70659 71171 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_05470 71168 71881 gene locus_tag LOCUS_05480 71168 71881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 71890 72684 gene locus_tag LOCUS_05490 71890 72684 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225926.1 protein_id gnl|my_center|LOCUS_05490 72705 73844 gene locus_tag LOCUS_05500 72705 73844 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225927.1 protein_id gnl|my_center|LOCUS_05500 73841 75334 gene locus_tag LOCUS_05510 gene crtI 73841 75334 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_05510 75943 75290 gene locus_tag LOCUS_05520 75943 75290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 76698 75940 gene locus_tag LOCUS_05530 gene metF 76698 75940 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_05530 76836 77894 gene locus_tag LOCUS_05540 76836 77894 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_05540 77898 79430 gene locus_tag LOCUS_05550 gene crtI 77898 79430 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_05550 79432 80340 gene locus_tag LOCUS_05560 79432 80340 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224196.1 protein_id gnl|my_center|LOCUS_05560 81094 80351 gene locus_tag LOCUS_05570 81094 80351 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206049.1 protein_id gnl|my_center|LOCUS_05570 81882 81097 gene locus_tag LOCUS_05580 81882 81097 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808030.1 protein_id gnl|my_center|LOCUS_05580 82704 81892 gene locus_tag LOCUS_05590 82704 81892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_05590 83965 82736 gene locus_tag LOCUS_05600 83965 82736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 84175 86154 gene locus_tag LOCUS_05610 84175 86154 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_05610 86164 86535 gene locus_tag LOCUS_05620 86164 86535 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170906.1 protein_id gnl|my_center|LOCUS_05620 87896 86532 gene locus_tag LOCUS_05630 87896 86532 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927872.1 protein_id gnl|my_center|LOCUS_05630 88528 87893 gene locus_tag LOCUS_05640 88528 87893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 88659 89846 gene locus_tag LOCUS_05650 88659 89846 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_05650 89850 90701 gene locus_tag LOCUS_05660 89850 90701 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529371.1 protein_id gnl|my_center|LOCUS_05660 90710 91519 gene locus_tag LOCUS_05670 90710 91519 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_05670 91522 92925 gene locus_tag LOCUS_05680 91522 92925 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_05680 93032 94498 gene locus_tag LOCUS_05690 93032 94498 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_05690 94897 94502 gene locus_tag LOCUS_05700 94897 94502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 95229 94894 gene locus_tag LOCUS_05710 95229 94894 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225087.1 protein_id gnl|my_center|LOCUS_05710 95853 95239 gene locus_tag LOCUS_05720 95853 95239 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_05720 96401 95829 gene locus_tag LOCUS_05730 gene pnuC 96401 95829 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400615.1 protein_id gnl|my_center|LOCUS_05730 96517 97398 gene locus_tag LOCUS_05740 96517 97398 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814015.1 protein_id gnl|my_center|LOCUS_05740 97852 97331 gene locus_tag LOCUS_05750 97852 97331 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058688.1 protein_id gnl|my_center|LOCUS_05750 99114 97858 gene locus_tag LOCUS_05760 99114 97858 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_05760 100028 99210 gene locus_tag LOCUS_05770 gene tatC 100028 99210 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_05770 100226 100044 gene locus_tag LOCUS_05780 100226 100044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 101039 100293 gene locus_tag LOCUS_05790 101039 100293 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_05790 101118 101867 gene locus_tag LOCUS_05800 101118 101867 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_05800 102037 101864 gene locus_tag LOCUS_05810 102037 101864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 102103 102190 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 103793 102849 gene locus_tag LOCUS_05820 103793 102849 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_05820 104227 103790 gene locus_tag LOCUS_05830 104227 103790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 105355 104237 gene locus_tag LOCUS_05840 105355 104237 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_05840 105416 105889 gene locus_tag LOCUS_05850 105416 105889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 106879 105893 gene locus_tag LOCUS_05860 gene glpX 106879 105893 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_05860 107631 106876 gene locus_tag LOCUS_05870 107631 106876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05870 108362 107652 gene locus_tag LOCUS_05880 108362 107652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05880 107671 107724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 108584 109675 gene locus_tag LOCUS_05890 108584 109675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740065.1 protein_id gnl|my_center|LOCUS_05890 109676 110761 gene locus_tag LOCUS_05900 109676 110761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085225.1 protein_id gnl|my_center|LOCUS_05900 110763 111638 gene locus_tag LOCUS_05910 110763 111638 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810946.1 protein_id gnl|my_center|LOCUS_05910 111635 112489 gene locus_tag LOCUS_05920 111635 112489 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337643.1 protein_id gnl|my_center|LOCUS_05920 112493 112768 gene locus_tag LOCUS_05930 112493 112768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 112891 114666 gene locus_tag LOCUS_05940 112891 114666 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148771775.1 protein_id gnl|my_center|LOCUS_05940 114762 116303 gene locus_tag LOCUS_05950 gene glpD 114762 116303 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994115.1 protein_id gnl|my_center|LOCUS_05950 117027 116296 gene locus_tag LOCUS_05960 117027 116296 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612384.1 protein_id gnl|my_center|LOCUS_05960 117950 117027 gene locus_tag LOCUS_05970 gene rbsK 117950 117027 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949108.1 protein_id gnl|my_center|LOCUS_05970 118202 117963 gene locus_tag LOCUS_05980 118202 117963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_05980 118253 118876 gene locus_tag LOCUS_05990 118253 118876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 119924 118881 gene locus_tag LOCUS_06000 gene trpD 119924 118881 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_06000 120340 119924 gene locus_tag LOCUS_06010 120340 119924 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 protein_id gnl|my_center|LOCUS_06010 120590 121093 gene locus_tag LOCUS_06020 120590 121093 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_06020 121112 121945 gene locus_tag LOCUS_06030 121112 121945 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_06030 121942 122985 gene locus_tag LOCUS_06040 121942 122985 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_06040 122982 124673 gene locus_tag LOCUS_06050 122982 124673 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_06050 124718 126040 gene locus_tag LOCUS_06060 124718 126040 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_06060 126352 126098 gene locus_tag LOCUS_06070 126352 126098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 126234 127103 gene locus_tag LOCUS_06080 126234 127103 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_06080 127108 128004 gene locus_tag LOCUS_06090 127108 128004 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_06090 128004 128750 gene locus_tag LOCUS_06100 128004 128750 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051227.1 protein_id gnl|my_center|LOCUS_06100 128830 129756 gene locus_tag LOCUS_06110 128830 129756 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729403.1 protein_id gnl|my_center|LOCUS_06110 129759 131513 gene locus_tag LOCUS_06120 129759 131513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 131497 132132 gene locus_tag LOCUS_06130 131497 132132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 132514 132113 gene locus_tag LOCUS_06140 132514 132113 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224074.1 protein_id gnl|my_center|LOCUS_06140 134202 132514 gene locus_tag LOCUS_06150 gene ctaD 134202 132514 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_06150 135002 134199 gene locus_tag LOCUS_06160 gene coxB 135002 134199 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 protein_id gnl|my_center|LOCUS_06160 136055 135084 gene locus_tag LOCUS_06170 136055 135084 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224071.1 protein_id gnl|my_center|LOCUS_06170 136437 136093 gene locus_tag LOCUS_06180 136437 136093 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_06180 137582 136461 gene locus_tag LOCUS_06190 137582 136461 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990054.1 protein_id gnl|my_center|LOCUS_06190 137608 138153 gene locus_tag LOCUS_06200 137608 138153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06200 138155 139153 gene locus_tag LOCUS_06210 138155 139153 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_06210 139475 140122 gene locus_tag LOCUS_06220 139475 140122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 140124 141179 gene locus_tag LOCUS_06230 140124 141179 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790914.1 protein_id gnl|my_center|LOCUS_06230 141172 142782 gene locus_tag LOCUS_06240 141172 142782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_06240 142760 143578 gene locus_tag LOCUS_06250 142760 143578 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013711.1 protein_id gnl|my_center|LOCUS_06250 143542 144303 gene locus_tag LOCUS_06260 143542 144303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 144336 145814 gene locus_tag LOCUS_06270 144336 145814 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_06270 145916 147292 gene locus_tag LOCUS_06280 gene lpdA 145916 147292 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_06280 147341 148774 gene locus_tag LOCUS_06290 gene sucB 147341 148774 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110455.1 protein_id gnl|my_center|LOCUS_06290 147629 147691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 148007 148022 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 148782 149675 gene locus_tag LOCUS_06300 148782 149675 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_06300 149676 150917 gene locus_tag LOCUS_06310 149676 150917 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742232.1 protein_id gnl|my_center|LOCUS_06310 150914 151648 gene locus_tag LOCUS_06320 150914 151648 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence04 981 3368 gene locus_tag LOCUS_06330 981 3368 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727490.1 protein_id gnl|my_center|LOCUS_06330 3421 4044 gene locus_tag LOCUS_06340 3421 4044 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_06340 4065 4283 gene locus_tag LOCUS_06350 4065 4283 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 protein_id gnl|my_center|LOCUS_06350 4284 5642 gene locus_tag LOCUS_06360 4284 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 5657 6493 gene locus_tag LOCUS_06370 5657 6493 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_06370 7331 6453 gene locus_tag LOCUS_06380 7331 6453 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_06380 7403 8647 gene locus_tag LOCUS_06390 7403 8647 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_06390 8640 9116 gene locus_tag LOCUS_06400 8640 9116 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_06400 10329 9109 gene locus_tag LOCUS_06410 10329 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 10988 10326 gene locus_tag LOCUS_06420 10988 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 11553 10996 gene locus_tag LOCUS_06430 11553 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 11684 12205 gene locus_tag LOCUS_06440 11684 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 14889 12202 gene locus_tag LOCUS_06450 gene secA 14889 12202 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_06450 15538 14969 gene locus_tag LOCUS_06460 gene raiA 15538 14969 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416957.1 protein_id gnl|my_center|LOCUS_06460 16126 15584 gene locus_tag LOCUS_06470 16126 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 17851 16265 gene locus_tag LOCUS_06480 17851 16265 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_06480 19295 17916 gene locus_tag LOCUS_06490 19295 17916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 20098 19418 gene locus_tag LOCUS_06500 gene mtrA 20098 19418 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_06500 20161 21123 gene locus_tag LOCUS_06510 20161 21123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 22622 21120 gene locus_tag LOCUS_06520 gene ahcY 22622 21120 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_06520 23827 22694 gene locus_tag LOCUS_06530 23827 22694 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_06530 25387 24011 gene locus_tag LOCUS_06540 25387 24011 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_06540 25677 25411 gene locus_tag LOCUS_06550 25677 25411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 25756 26133 gene locus_tag LOCUS_06560 25756 26133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 26400 26161 gene locus_tag LOCUS_06570 26400 26161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 26166 26179 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27588 26530 gene locus_tag LOCUS_06580 27588 26530 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080830.1 protein_id gnl|my_center|LOCUS_06580 28802 27618 gene locus_tag LOCUS_06590 28802 27618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 28964 30379 gene locus_tag LOCUS_06600 28964 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 32597 30372 gene locus_tag LOCUS_06610 32597 30372 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930053.1 protein_id gnl|my_center|LOCUS_06610 33220 32594 gene locus_tag LOCUS_06620 33220 32594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 34317 33217 gene locus_tag LOCUS_06630 gene wecB 34317 33217 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_06630 34397 35848 gene locus_tag LOCUS_06640 34397 35848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 35867 37126 gene locus_tag LOCUS_06650 35867 37126 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_06650 37123 37959 gene locus_tag LOCUS_06660 37123 37959 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_06660 37946 38707 gene locus_tag LOCUS_06670 37946 38707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_06670 38710 39792 gene locus_tag LOCUS_06680 38710 39792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 40762 39761 gene locus_tag LOCUS_06690 40762 39761 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173531.1 protein_id gnl|my_center|LOCUS_06690 40940 41908 gene locus_tag LOCUS_06700 40940 41908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 42622 41879 gene locus_tag LOCUS_06710 42622 41879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 42769 44094 gene locus_tag LOCUS_06720 42769 44094 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015433.1 protein_id gnl|my_center|LOCUS_06720 44091 45008 gene locus_tag LOCUS_06730 gene cysD 44091 45008 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967449.1 protein_id gnl|my_center|LOCUS_06730 45008 46855 gene locus_tag LOCUS_06740 gene cysN 45008 46855 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503688.1 protein_id gnl|my_center|LOCUS_06740 47355 46852 gene locus_tag LOCUS_06750 gene purE 47355 46852 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222903.1 protein_id gnl|my_center|LOCUS_06750 48525 47374 gene locus_tag LOCUS_06760 48525 47374 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_06760 49249 48515 gene locus_tag LOCUS_06770 49249 48515 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899999.1 protein_id gnl|my_center|LOCUS_06770 49323 50906 gene locus_tag LOCUS_06780 49323 50906 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_06780 51104 51718 gene locus_tag LOCUS_06790 51104 51718 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222850.1 protein_id gnl|my_center|LOCUS_06790 51759 53510 gene locus_tag LOCUS_06800 51759 53510 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_06800 53814 53500 gene locus_tag LOCUS_06810 53814 53500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 54400 53804 gene locus_tag LOCUS_06820 54400 53804 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_06820 55812 54400 gene locus_tag LOCUS_06830 55812 54400 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_06830 55870 56682 gene locus_tag LOCUS_06840 55870 56682 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222820.1 protein_id gnl|my_center|LOCUS_06840 56679 58331 gene locus_tag LOCUS_06850 56679 58331 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_06850 57531 57671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58358 59317 gene locus_tag LOCUS_06860 gene deoC 58358 59317 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_06860 59320 60765 gene locus_tag LOCUS_06870 59320 60765 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_06870 60758 61594 gene locus_tag LOCUS_06880 60758 61594 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_06880 62679 61591 gene locus_tag LOCUS_06890 62679 61591 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_06890 62829 64265 gene locus_tag LOCUS_06900 62829 64265 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_06900 64671 64318 gene locus_tag LOCUS_06910 64671 64318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 65961 64672 gene locus_tag LOCUS_06920 65961 64672 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_06920 66362 65958 gene locus_tag LOCUS_06930 66362 65958 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056128.1 protein_id gnl|my_center|LOCUS_06930 67603 66362 gene locus_tag LOCUS_06940 67603 66362 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_06940 68676 67600 gene locus_tag LOCUS_06950 68676 67600 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222770.1 protein_id gnl|my_center|LOCUS_06950 70191 68677 gene locus_tag LOCUS_06960 70191 68677 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_06960 71341 70289 gene locus_tag LOCUS_06970 71341 70289 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029926.1 protein_id gnl|my_center|LOCUS_06970 73073 71481 gene locus_tag LOCUS_06980 73073 71481 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031217.1 protein_id gnl|my_center|LOCUS_06980 73857 73105 gene locus_tag LOCUS_06990 73857 73105 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_06990 75752 73857 gene locus_tag LOCUS_07000 75752 73857 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_07000 77680 76673 gene locus_tag LOCUS_07010 gene trpS 77680 76673 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_07010 78968 77724 gene locus_tag LOCUS_07020 78968 77724 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582296.1 protein_id gnl|my_center|LOCUS_07020 80232 79018 gene locus_tag LOCUS_07030 80232 79018 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971927.1 protein_id gnl|my_center|LOCUS_07030 81216 80260 gene locus_tag LOCUS_07040 gene mdh 81216 80260 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_07040 81553 81293 gene locus_tag LOCUS_07050 81553 81293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 82386 81550 gene locus_tag LOCUS_07060 82386 81550 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_07060 83931 82399 gene locus_tag LOCUS_07070 gene purH 83931 82399 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013935.1 protein_id gnl|my_center|LOCUS_07070 84509 83937 gene locus_tag LOCUS_07080 gene purN 84509 83937 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222719.1 protein_id gnl|my_center|LOCUS_07080 85678 84506 gene locus_tag LOCUS_07090 85678 84506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 86569 85682 gene locus_tag LOCUS_07100 gene sucD 86569 85682 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 protein_id gnl|my_center|LOCUS_07100 87754 86579 gene locus_tag LOCUS_07110 gene sucC 87754 86579 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222715.1 protein_id gnl|my_center|LOCUS_07110 88192 87794 gene locus_tag LOCUS_07120 88192 87794 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206188813.1 protein_id gnl|my_center|LOCUS_07120 88481 89140 gene locus_tag LOCUS_07130 88481 89140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 91341 89137 gene locus_tag LOCUS_07140 gene pcrA 91341 89137 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_07140 93783 91363 gene locus_tag LOCUS_07150 93783 91363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 93924 94634 gene locus_tag LOCUS_07160 93924 94634 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_07160 95006 94635 gene locus_tag LOCUS_07170 95006 94635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327076.1 protein_id gnl|my_center|LOCUS_07170 96581 95019 gene locus_tag LOCUS_07180 gene guaA 96581 95019 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893015.1 protein_id gnl|my_center|LOCUS_07180 97702 96593 gene locus_tag LOCUS_07190 97702 96593 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_07190 99225 97711 gene locus_tag LOCUS_07200 gene guaB 99225 97711 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974203.1 protein_id gnl|my_center|LOCUS_07200 99933 99268 gene locus_tag LOCUS_07210 99933 99268 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073605.1 protein_id gnl|my_center|LOCUS_07210 100952 100005 gene locus_tag LOCUS_07220 100952 100005 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978674.1 protein_id gnl|my_center|LOCUS_07220 101097 101399 gene locus_tag LOCUS_07230 101097 101399 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_07230 103157 101529 gene locus_tag LOCUS_07240 gene groL 103157 101529 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_07240 103535 103236 gene locus_tag LOCUS_07250 gene groES 103535 103236 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056050.1 protein_id gnl|my_center|LOCUS_07250 104640 103639 gene locus_tag LOCUS_07260 gene tsaD 104640 103639 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_07260 105094 104633 gene locus_tag LOCUS_07270 gene rimI 105094 104633 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_07270 105780 105091 gene locus_tag LOCUS_07280 gene tsaB 105780 105091 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_07280 106246 105782 gene locus_tag LOCUS_07290 gene tsaE 106246 105782 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_07290 107337 106243 gene locus_tag LOCUS_07300 gene alr 107337 106243 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_07300 107708 107334 gene locus_tag LOCUS_07310 107708 107334 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_07310 109565 107715 gene locus_tag LOCUS_07320 gene glmS 109565 107715 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_07320 110918 109575 gene locus_tag LOCUS_07330 gene glmM 110918 109575 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_07330 111373 110921 gene locus_tag LOCUS_07340 gene rpsI 111373 110921 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974238.1 protein_id gnl|my_center|LOCUS_07340 111846 111403 gene locus_tag LOCUS_07350 gene rplM 111846 111403 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_07350 113556 111949 gene locus_tag LOCUS_07360 113556 111949 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_07360 114404 113556 gene locus_tag LOCUS_07370 gene truA 114404 113556 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_07370 114862 114437 gene locus_tag LOCUS_07380 gene rplQ 114862 114437 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974243.1 protein_id gnl|my_center|LOCUS_07380 115913 114888 gene locus_tag LOCUS_07390 115913 114888 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776351.1 protein_id gnl|my_center|LOCUS_07390 116645 116019 gene locus_tag LOCUS_07400 gene rpsD 116645 116019 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_07400 117094 116663 gene locus_tag LOCUS_07410 gene rpsK 117094 116663 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 protein_id gnl|my_center|LOCUS_07410 117491 117114 gene locus_tag LOCUS_07420 gene rpsM 117491 117114 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055954.1 protein_id gnl|my_center|LOCUS_07420 118017 117796 gene locus_tag LOCUS_07430 gene infA 118017 117796 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_07430 118733 118170 gene locus_tag LOCUS_07440 118733 118170 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_07440 120031 118736 gene locus_tag LOCUS_07450 gene secY 120031 118736 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_07450 120506 120060 gene locus_tag LOCUS_07460 gene rplO 120506 120060 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013717.1 protein_id gnl|my_center|LOCUS_07460 120691 120509 gene locus_tag LOCUS_07470 gene rpmD 120691 120509 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_07470 121293 120691 gene locus_tag LOCUS_07480 gene rpsE 121293 120691 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403680.1 protein_id gnl|my_center|LOCUS_07480 121693 121310 gene locus_tag LOCUS_07490 gene rplR 121693 121310 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776361.1 protein_id gnl|my_center|LOCUS_07490 122235 121690 gene locus_tag LOCUS_07500 gene rplF 122235 121690 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_07500 122650 122252 gene locus_tag LOCUS_07510 gene rpsH 122650 122252 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055710.1 protein_id gnl|my_center|LOCUS_07510 123021 122716 gene locus_tag LOCUS_07520 gene rpsN 123021 122716 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063153.1 protein_id gnl|my_center|LOCUS_07520 123581 123021 gene locus_tag LOCUS_07530 gene rplE 123581 123021 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_07530 123940 123581 gene locus_tag LOCUS_07540 gene rplX 123940 123581 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892853.1 protein_id gnl|my_center|LOCUS_07540 124311 123943 gene locus_tag LOCUS_07550 gene rplN 124311 123943 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055680.1 protein_id gnl|my_center|LOCUS_07550 124622 124353 gene locus_tag LOCUS_07560 gene rpsQ 124622 124353 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_07560 124846 124619 gene locus_tag LOCUS_07570 gene rpmC 124846 124619 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_07570 125265 124846 gene locus_tag LOCUS_07580 gene rplP 125265 124846 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_07580 126653 125268 gene locus_tag LOCUS_07590 126653 125268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 126110 126141 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 126967 126686 gene locus_tag LOCUS_07600 gene rpsS 126967 126686 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814508.1 protein_id gnl|my_center|LOCUS_07600 127815 126979 gene locus_tag LOCUS_07610 gene rplB 127815 126979 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974264.1 protein_id gnl|my_center|LOCUS_07610 128134 127838 gene locus_tag LOCUS_07620 128134 127838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 128811 128134 gene locus_tag LOCUS_07630 128811 128134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 129458 128814 gene locus_tag LOCUS_07640 gene rplC 129458 128814 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_07640 129789 129481 gene locus_tag LOCUS_07650 gene rpsJ 129789 129481 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_07650 130017 129880 gene locus_tag LOCUS_07660 130017 129880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 130085 130206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence05 <1 2133 gene locus_tag LOCUS_07670 <1 2133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111860.1:ATP-dependent DNA helicase 2130 5165 gene locus_tag LOCUS_07680 2130 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 5970 5155 gene locus_tag LOCUS_07690 5970 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 6035 6943 gene locus_tag LOCUS_07700 6035 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 7108 6932 gene locus_tag LOCUS_07710 7108 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 7236 7895 gene locus_tag LOCUS_07720 7236 7895 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913210.1 protein_id gnl|my_center|LOCUS_07720 7922 9664 gene locus_tag LOCUS_07730 7922 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 10998 9628 gene locus_tag LOCUS_07740 10998 9628 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_07740 12055 11015 gene locus_tag LOCUS_07750 12055 11015 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486346.1 protein_id gnl|my_center|LOCUS_07750 12313 12158 gene locus_tag LOCUS_07760 12313 12158 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_07760 12770 13318 gene locus_tag LOCUS_07770 12770 13318 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_07770 14514 13315 gene locus_tag LOCUS_07780 14514 13315 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_07780 14639 14830 gene locus_tag LOCUS_07790 14639 14830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 14878 15882 gene locus_tag LOCUS_07800 14878 15882 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_07800 15907 18780 gene locus_tag LOCUS_07810 15907 18780 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_07810 18830 18863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19351 18941 gene locus_tag LOCUS_07820 19351 18941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 19544 20065 gene locus_tag LOCUS_07830 19544 20065 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_07830 20104 20179 gene locus_tag LOCUS_t00190 20104 20179 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 20217 20291 gene locus_tag LOCUS_t00200 20217 20291 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 20402 21076 gene locus_tag LOCUS_07840 20402 21076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 21737 21099 gene locus_tag LOCUS_07850 21737 21099 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227852.1 protein_id gnl|my_center|LOCUS_07850 22177 21755 gene locus_tag LOCUS_07860 22177 21755 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081016.1 protein_id gnl|my_center|LOCUS_07860 22959 22180 gene locus_tag LOCUS_07870 22959 22180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804277.1 protein_id gnl|my_center|LOCUS_07870 23669 22959 gene locus_tag LOCUS_07880 23669 22959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 24313 23699 gene locus_tag LOCUS_07890 24313 23699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 24387 25724 gene locus_tag LOCUS_07900 24387 25724 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_07900 26535 25714 gene locus_tag LOCUS_07910 gene hisN 26535 25714 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728137.1 protein_id gnl|my_center|LOCUS_07910 26562 27041 gene locus_tag LOCUS_07920 26562 27041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 28018 27038 gene locus_tag LOCUS_07930 gene rsgA 28018 27038 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088496.1 protein_id gnl|my_center|LOCUS_07930 29127 28015 gene locus_tag LOCUS_07940 gene aroA 29127 28015 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013873.1 protein_id gnl|my_center|LOCUS_07940 29326 30024 gene locus_tag LOCUS_07950 29326 30024 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_07950 30252 31184 gene locus_tag LOCUS_07960 gene cysK 30252 31184 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804846.1 protein_id gnl|my_center|LOCUS_07960 31187 31738 gene locus_tag LOCUS_07970 gene cysE 31187 31738 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_07970 31900 33288 gene locus_tag LOCUS_07980 31900 33288 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_07980 33595 33338 gene locus_tag LOCUS_07990 33595 33338 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_07990 33791 34153 gene locus_tag LOCUS_08000 33791 34153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 34543 34154 gene locus_tag LOCUS_08010 gene sodN 34543 34154 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_08010 35928 34906 gene locus_tag LOCUS_08020 35928 34906 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_08020 35992 37485 gene locus_tag LOCUS_08030 35992 37485 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_08030 37482 38864 gene locus_tag LOCUS_08040 37482 38864 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_08040 42499 38870 gene locus_tag LOCUS_08050 42499 38870 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_08050 42694 43311 gene locus_tag LOCUS_08060 42694 43311 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_08060 43321 43785 gene locus_tag LOCUS_08070 43321 43785 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257301.1 protein_id gnl|my_center|LOCUS_08070 43772 44752 gene locus_tag LOCUS_08080 43772 44752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 44771 45604 gene locus_tag LOCUS_08090 44771 45604 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083532.1 protein_id gnl|my_center|LOCUS_08090 45691 46788 gene locus_tag LOCUS_08100 45691 46788 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_08100 47217 46789 gene locus_tag LOCUS_08110 47217 46789 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_08110 48516 47278 gene locus_tag LOCUS_08120 48516 47278 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938462.1 protein_id gnl|my_center|LOCUS_08120 48751 49653 gene locus_tag LOCUS_08130 48751 49653 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805200.1 protein_id gnl|my_center|LOCUS_08130 50372 49806 gene locus_tag LOCUS_08140 gene trmB 50372 49806 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694335.1 protein_id gnl|my_center|LOCUS_08140 50916 50458 gene locus_tag LOCUS_08150 50916 50458 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096137271.1 protein_id gnl|my_center|LOCUS_08150 50977 51852 gene locus_tag LOCUS_08160 50977 51852 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142342.1 protein_id gnl|my_center|LOCUS_08160 52947 51841 gene locus_tag LOCUS_08170 52947 51841 CDS product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532992.1 protein_id gnl|my_center|LOCUS_08170 52982 53470 gene locus_tag LOCUS_08180 52982 53470 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727465.1 protein_id gnl|my_center|LOCUS_08180 55434 53467 gene locus_tag LOCUS_08190 55434 53467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 56287 55439 gene locus_tag LOCUS_08200 gene malD 56287 55439 CDS product maltosaccharide ABC transporter permease MalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022608.1 protein_id gnl|my_center|LOCUS_08200 57840 56284 gene locus_tag LOCUS_08210 57840 56284 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804842.1 protein_id gnl|my_center|LOCUS_08210 59173 57920 gene locus_tag LOCUS_08220 gene malE 59173 57920 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583082.1 protein_id gnl|my_center|LOCUS_08220 59733 59368 gene locus_tag LOCUS_08230 59733 59368 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_08230 59773 60585 gene locus_tag LOCUS_08240 59773 60585 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_08240 60582 61304 gene locus_tag LOCUS_08250 60582 61304 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_08250 61280 61714 gene locus_tag LOCUS_08260 61280 61714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 61751 62185 gene locus_tag LOCUS_08270 61751 62185 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085450.1 protein_id gnl|my_center|LOCUS_08270 62290 63561 gene locus_tag LOCUS_08280 62290 63561 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804267.1 protein_id gnl|my_center|LOCUS_08280 63656 64534 gene locus_tag LOCUS_08290 63656 64534 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_08290 64547 65368 gene locus_tag LOCUS_08300 64547 65368 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804269.1 protein_id gnl|my_center|LOCUS_08300 65421 66131 gene locus_tag LOCUS_08310 65421 66131 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528076.1 protein_id gnl|my_center|LOCUS_08310 66135 67526 gene locus_tag LOCUS_08320 66135 67526 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703822.1 protein_id gnl|my_center|LOCUS_08320 67523 68479 gene locus_tag LOCUS_08330 67523 68479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 68483 69061 gene locus_tag LOCUS_08340 68483 69061 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230536.1 protein_id gnl|my_center|LOCUS_08340 69175 69273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69535 70578 gene locus_tag LOCUS_08350 69535 70578 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_08350 70626 72392 gene locus_tag LOCUS_08360 70626 72392 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_08360 72373 73410 gene locus_tag LOCUS_08370 72373 73410 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_08370 73407 74195 gene locus_tag LOCUS_08380 73407 74195 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_08380 74199 74855 gene locus_tag LOCUS_08390 74199 74855 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070188143.1 protein_id gnl|my_center|LOCUS_08390 76015 74846 gene locus_tag LOCUS_08400 gene tgt 76015 74846 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112950.1 protein_id gnl|my_center|LOCUS_08400 76123 77478 gene locus_tag LOCUS_08410 76123 77478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 78156 77470 gene locus_tag LOCUS_08420 78156 77470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 78340 79113 gene locus_tag LOCUS_08430 78340 79113 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_08430 80291 79110 gene locus_tag LOCUS_08440 80291 79110 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079507.1 protein_id gnl|my_center|LOCUS_08440 80398 81129 gene locus_tag LOCUS_08450 gene recO 80398 81129 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_08450 81142 81900 gene locus_tag LOCUS_08460 81142 81900 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775743.1 protein_id gnl|my_center|LOCUS_08460 81897 82286 gene locus_tag LOCUS_08470 81897 82286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 82276 82776 gene locus_tag LOCUS_08480 82276 82776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 82816 84207 gene locus_tag LOCUS_08490 82816 84207 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_08490 84217 85395 gene locus_tag LOCUS_08500 gene dusB 84217 85395 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_08500 85395 85988 gene locus_tag LOCUS_08510 85395 85988 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 protein_id gnl|my_center|LOCUS_08510 85985 87199 gene locus_tag LOCUS_08520 85985 87199 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775728.1 protein_id gnl|my_center|LOCUS_08520 87215 89062 gene locus_tag LOCUS_08530 gene dnaG 87215 89062 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_08530 89059 89538 gene locus_tag LOCUS_08540 89059 89538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 90776 89535 gene locus_tag LOCUS_08550 90776 89535 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_08550 91030 90791 gene locus_tag LOCUS_08560 91030 90791 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559006.1 protein_id gnl|my_center|LOCUS_08560 92069 91068 gene locus_tag LOCUS_08570 92069 91068 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 protein_id gnl|my_center|LOCUS_08570 93004 92066 gene locus_tag LOCUS_08580 93004 92066 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_08580 95801 93066 gene locus_tag LOCUS_08590 gene aceE 95801 93066 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729733.1 protein_id gnl|my_center|LOCUS_08590 95950 96369 gene locus_tag LOCUS_08600 95950 96369 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060606.1 protein_id gnl|my_center|LOCUS_08600 96378 96836 gene locus_tag LOCUS_08610 96378 96836 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_08610 96884 96958 gene locus_tag LOCUS_t00210 96884 96958 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 97578 96973 gene locus_tag LOCUS_08620 97578 96973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 98717 97731 gene locus_tag LOCUS_08630 98717 97731 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_08630 99917 98721 gene locus_tag LOCUS_08640 99917 98721 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222093.1 protein_id gnl|my_center|LOCUS_08640 100893 99946 gene locus_tag LOCUS_08650 100893 99946 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265442.1 protein_id gnl|my_center|LOCUS_08650 101912 100914 gene locus_tag LOCUS_08660 101912 100914 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461131.1 protein_id gnl|my_center|LOCUS_08660 102850 101909 gene locus_tag LOCUS_08670 102850 101909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence06 <1 891 gene locus_tag LOCUS_08680 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223495647.1:tetratricopeptide repeat protein 940 1221 gene locus_tag LOCUS_08690 940 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1221 1406 gene locus_tag LOCUS_08700 1221 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1413 2201 gene locus_tag LOCUS_08710 1413 2201 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227822.1 protein_id gnl|my_center|LOCUS_08710 2194 3072 gene locus_tag LOCUS_08720 2194 3072 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_08720 3075 4775 gene locus_tag LOCUS_08730 gene recN 3075 4775 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_08730 4888 6507 gene locus_tag LOCUS_08740 4888 6507 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_08740 4900 4992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6565 7674 gene locus_tag LOCUS_08750 gene ald 6565 7674 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_08750 7684 8604 gene locus_tag LOCUS_08760 gene xerD 7684 8604 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286377.1 protein_id gnl|my_center|LOCUS_08760 8697 9536 gene locus_tag LOCUS_08770 8697 9536 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_08770 9533 10372 gene locus_tag LOCUS_08780 9533 10372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 10365 10979 gene locus_tag LOCUS_08790 gene scpB 10365 10979 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_08790 10976 11716 gene locus_tag LOCUS_08800 10976 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 11735 12097 gene locus_tag LOCUS_08810 gene aroH 11735 12097 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_08810 12094 13152 gene locus_tag LOCUS_08820 12094 13152 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_08820 13145 15205 gene locus_tag LOCUS_08830 gene der 13145 15205 CDS product bifunctional cytidylate kinase/GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389933.1 protein_id gnl|my_center|LOCUS_08830 15527 15198 gene locus_tag LOCUS_08840 15527 15198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08840 15606 15613 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15753 16316 gene locus_tag LOCUS_08850 15753 16316 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111646.1 protein_id gnl|my_center|LOCUS_08850 16504 16584 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16603 17160 gene locus_tag LOCUS_08860 16603 17160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 17160 17492 gene locus_tag LOCUS_08870 17160 17492 CDS product DUF1290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895106.1 protein_id gnl|my_center|LOCUS_08870 17496 18164 gene locus_tag LOCUS_08880 17496 18164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 18302 18643 gene locus_tag LOCUS_08890 18302 18643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 18643 19380 gene locus_tag LOCUS_08900 18643 19380 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_08900 19407 19874 gene locus_tag LOCUS_08910 19407 19874 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_08910 19991 20557 gene locus_tag LOCUS_08920 19991 20557 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_08920 20609 21673 gene locus_tag LOCUS_08930 20609 21673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 21673 22389 gene locus_tag LOCUS_08940 21673 22389 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_08940 23860 22370 gene locus_tag LOCUS_08950 gene lnt 23860 22370 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014392.1 protein_id gnl|my_center|LOCUS_08950 24975 23857 gene locus_tag LOCUS_08960 24975 23857 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_08960 25164 25946 gene locus_tag LOCUS_08970 25164 25946 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_08970 28643 25920 gene locus_tag LOCUS_08980 28643 25920 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_08980 29536 28640 gene locus_tag LOCUS_08990 29536 28640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 30465 29533 gene locus_tag LOCUS_09000 30465 29533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 30970 30470 gene locus_tag LOCUS_09010 30970 30470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 31821 30967 gene locus_tag LOCUS_09020 31821 30967 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_09020 32498 31818 gene locus_tag LOCUS_09030 32498 31818 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_09030 35919 32488 gene locus_tag LOCUS_09040 gene metH 35919 32488 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_09040 36071 36892 gene locus_tag LOCUS_09050 gene parJ 36071 36892 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_09050 38423 36885 gene locus_tag LOCUS_09060 gene pgi 38423 36885 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994356.1 protein_id gnl|my_center|LOCUS_09060 39637 38423 gene locus_tag LOCUS_09070 gene mshC 39637 38423 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_09070 40414 39656 gene locus_tag LOCUS_09080 40414 39656 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226501.1 protein_id gnl|my_center|LOCUS_09080 40926 40411 gene locus_tag LOCUS_09090 40926 40411 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 protein_id gnl|my_center|LOCUS_09090 41575 40928 gene locus_tag LOCUS_09100 41575 40928 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_09100 42421 41585 gene locus_tag LOCUS_09110 42421 41585 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971321.1 protein_id gnl|my_center|LOCUS_09110 43737 42421 gene locus_tag LOCUS_09120 43737 42421 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_09120 43805 43891 gene locus_tag LOCUS_t00220 43805 43891 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44458 43892 gene locus_tag LOCUS_09130 44458 43892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 44988 44455 gene locus_tag LOCUS_09140 44988 44455 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_09140 45729 44998 gene locus_tag LOCUS_09150 45729 44998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 46585 45797 gene locus_tag LOCUS_09160 46585 45797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_09160 47271 48002 gene locus_tag LOCUS_09170 47271 48002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 48763 47999 gene locus_tag LOCUS_09180 gene fabI 48763 47999 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_09180 49476 48763 gene locus_tag LOCUS_09190 gene fabG 49476 48763 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_09190 49559 49843 gene locus_tag LOCUS_09200 49559 49843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 49990 50547 gene locus_tag LOCUS_09210 49990 50547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 50851 50537 gene locus_tag LOCUS_09220 50851 50537 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_09220 51282 50848 gene locus_tag LOCUS_09230 51282 50848 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_09230 51764 51282 gene locus_tag LOCUS_09240 51764 51282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09240 52564 51800 gene locus_tag LOCUS_09250 52564 51800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 51803 51872 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53322 52561 gene locus_tag LOCUS_09260 gene sufC 53322 52561 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805067.1 protein_id gnl|my_center|LOCUS_09260 53654 53319 gene locus_tag LOCUS_09270 53654 53319 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_09270 54781 53651 gene locus_tag LOCUS_09280 gene sufD 54781 53651 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994879.1 protein_id gnl|my_center|LOCUS_09280 56187 54778 gene locus_tag LOCUS_09290 gene sufB 56187 54778 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_09290 56876 56184 gene locus_tag LOCUS_09300 56876 56184 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_09300 56940 57803 gene locus_tag LOCUS_09310 56940 57803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 58652 57783 gene locus_tag LOCUS_09320 58652 57783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877581.1 protein_id gnl|my_center|LOCUS_09320 59551 58655 gene locus_tag LOCUS_09330 59551 58655 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_09330 59628 61625 gene locus_tag LOCUS_09340 gene tkt 59628 61625 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031086.1 protein_id gnl|my_center|LOCUS_09340 61953 61615 gene locus_tag LOCUS_09350 61953 61615 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284344.1 protein_id gnl|my_center|LOCUS_09350 62193 61969 gene locus_tag LOCUS_09360 gene secG 62193 61969 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_09360 63009 62230 gene locus_tag LOCUS_09370 gene tpiA 63009 62230 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_09370 64197 63010 gene locus_tag LOCUS_09380 64197 63010 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930207.1 protein_id gnl|my_center|LOCUS_09380 65240 64200 gene locus_tag LOCUS_09390 gene gap 65240 64200 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907806.1 protein_id gnl|my_center|LOCUS_09390 66290 65307 gene locus_tag LOCUS_09400 gene whiA 66290 65307 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877572.1 protein_id gnl|my_center|LOCUS_09400 67157 66312 gene locus_tag LOCUS_09410 gene rapZ 67157 66312 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_09410 69018 67180 gene locus_tag LOCUS_09420 gene uvrC 69018 67180 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082304.1 protein_id gnl|my_center|LOCUS_09420 71417 69030 gene locus_tag LOCUS_09430 gene uvrA 71417 69030 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467399.1 protein_id gnl|my_center|LOCUS_09430 71730 71802 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 72880 71882 gene locus_tag LOCUS_09440 72880 71882 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027421.1 protein_id gnl|my_center|LOCUS_09440 75004 72881 gene locus_tag LOCUS_09450 gene uvrB 75004 72881 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389776.1 protein_id gnl|my_center|LOCUS_09450 75582 75001 gene locus_tag LOCUS_09460 75582 75001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 76920 75598 gene locus_tag LOCUS_09470 gene rpsA 76920 75598 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227916.1 protein_id gnl|my_center|LOCUS_09470 77079 77852 gene locus_tag LOCUS_09480 77079 77852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 <78743 77832 gene locus_tag LOCUS_09490 <78743 77832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467407.1:DNA polymerase I >Feature sequence07 1304 1532 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1942 2247 gene locus_tag LOCUS_09500 1942 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3222 2296 gene locus_tag LOCUS_09510 3222 2296 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228081.1 protein_id gnl|my_center|LOCUS_09510 5112 3259 gene locus_tag LOCUS_09520 5112 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 5364 6281 gene locus_tag LOCUS_09530 5364 6281 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483876.1 protein_id gnl|my_center|LOCUS_09530 6337 7011 gene locus_tag LOCUS_09540 6337 7011 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532132.1 protein_id gnl|my_center|LOCUS_09540 8354 7008 gene locus_tag LOCUS_09550 8354 7008 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_09550 8501 10366 gene locus_tag LOCUS_09560 8501 10366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_09560 11478 10342 gene locus_tag LOCUS_09570 11478 10342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113311.1 protein_id gnl|my_center|LOCUS_09570 11625 12584 gene locus_tag LOCUS_09580 gene rfbD 11625 12584 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_09580 13408 12581 gene locus_tag LOCUS_09590 13408 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09590 13460 13539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14201 14626 gene locus_tag LOCUS_09600 14201 14626 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101517.1 protein_id gnl|my_center|LOCUS_09600 15510 14623 gene locus_tag LOCUS_09610 15510 14623 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466843.1 protein_id gnl|my_center|LOCUS_09610 16424 15507 gene locus_tag LOCUS_09620 16424 15507 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_09620 16944 16453 gene locus_tag LOCUS_09630 16944 16453 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084138.1 protein_id gnl|my_center|LOCUS_09630 17249 17013 gene locus_tag LOCUS_09640 17249 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 18021 17269 gene locus_tag LOCUS_09650 18021 17269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_09650 18677 18018 gene locus_tag LOCUS_09660 gene cbiQ 18677 18018 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_09660 19086 18796 gene locus_tag LOCUS_09670 19086 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09670 19775 19089 gene locus_tag LOCUS_09680 19775 19089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09680 19889 19973 gene locus_tag LOCUS_t00230 19889 19973 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20602 20000 gene locus_tag LOCUS_09690 20602 20000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09690 21324 20602 gene locus_tag LOCUS_09700 gene rph 21324 20602 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_09700 22139 21354 gene locus_tag LOCUS_09710 gene murI 22139 21354 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 protein_id gnl|my_center|LOCUS_09710 22728 22825 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22904 23221 gene locus_tag LOCUS_09720 22904 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09720 23824 23282 gene locus_tag LOCUS_09730 23824 23282 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_09730 24105 23824 gene locus_tag LOCUS_09740 gene clpS 24105 23824 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776026.1 protein_id gnl|my_center|LOCUS_09740 26224 24143 gene locus_tag LOCUS_09750 26224 24143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 26455 26225 gene locus_tag LOCUS_09760 26455 26225 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_09760 26615 26992 gene locus_tag LOCUS_09770 26615 26992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 27034 28038 gene locus_tag LOCUS_09780 27034 28038 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967360.1 protein_id gnl|my_center|LOCUS_09780 29746 28019 gene locus_tag LOCUS_09790 29746 28019 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_09790 29948 30601 gene locus_tag LOCUS_09800 29948 30601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 31057 31118 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31163 31882 gene locus_tag LOCUS_09810 31163 31882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 32290 31920 gene locus_tag LOCUS_tm00010 32290 31920 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 32883 32407 gene locus_tag LOCUS_09820 gene smpB 32883 32407 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_09820 33728 32886 gene locus_tag LOCUS_09830 33728 32886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 35015 33786 gene locus_tag LOCUS_09840 35015 33786 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_09840 35923 35015 gene locus_tag LOCUS_09850 gene ftsX 35923 35015 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_09850 36613 35927 gene locus_tag LOCUS_09860 gene ftsE 36613 35927 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_09860 37122 37261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38201 37764 gene locus_tag LOCUS_09870 38201 37764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 38620 38204 gene locus_tag LOCUS_09880 38620 38204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 38979 38617 gene locus_tag LOCUS_09890 38979 38617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 39148 38984 gene locus_tag LOCUS_09900 39148 38984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 39621 39163 gene locus_tag LOCUS_09910 39621 39163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 40694 40020 gene locus_tag LOCUS_09920 40694 40020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 41767 40694 gene locus_tag LOCUS_09930 41767 40694 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_09930 41317 41355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41915 42475 gene locus_tag LOCUS_09940 41915 42475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 43163 42516 gene locus_tag LOCUS_09950 43163 42516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 43228 44352 gene locus_tag LOCUS_09960 43228 44352 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_09960 44618 44349 gene locus_tag LOCUS_09970 44618 44349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 45767 44619 gene locus_tag LOCUS_09980 45767 44619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 45852 46484 gene locus_tag LOCUS_09990 45852 46484 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908112.1 protein_id gnl|my_center|LOCUS_09990 46664 46485 gene locus_tag LOCUS_10000 46664 46485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 47199 46759 gene locus_tag LOCUS_10010 47199 46759 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222966.1 protein_id gnl|my_center|LOCUS_10010 47796 47200 gene locus_tag LOCUS_10020 47796 47200 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730304.1 protein_id gnl|my_center|LOCUS_10020 47839 48747 gene locus_tag LOCUS_10030 gene dapD 47839 48747 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084448.1 protein_id gnl|my_center|LOCUS_10030 49839 48739 gene locus_tag LOCUS_10040 49839 48739 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_10040 50163 49843 gene locus_tag LOCUS_10050 50163 49843 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_10050 50255 51637 gene locus_tag LOCUS_10060 gene cysS 50255 51637 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_10060 51973 51629 gene locus_tag LOCUS_10070 51973 51629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 52050 54104 gene locus_tag LOCUS_10080 52050 54104 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224556.1 protein_id gnl|my_center|LOCUS_10080 55219 54101 gene locus_tag LOCUS_10090 gene ychF 55219 54101 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_10090 55243 55713 gene locus_tag LOCUS_10100 55243 55713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 56292 55774 gene locus_tag LOCUS_10110 56292 55774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 57398 56442 gene locus_tag LOCUS_10120 57398 56442 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_10120 58634 57432 gene locus_tag LOCUS_10130 gene xseA 58634 57432 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776296.1 protein_id gnl|my_center|LOCUS_10130 58667 58888 gene locus_tag LOCUS_10140 58667 58888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 58885 60552 gene locus_tag LOCUS_10150 58885 60552 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224438.1 protein_id gnl|my_center|LOCUS_10150 61079 60549 gene locus_tag LOCUS_10160 61079 60549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 62599 61199 gene locus_tag LOCUS_10170 62599 61199 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_10170 63453 62689 gene locus_tag LOCUS_10180 63453 62689 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_10180 63615 63454 gene locus_tag LOCUS_10190 63615 63454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 64521 63625 gene locus_tag LOCUS_10200 gene mca 64521 63625 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_10200 64524 65024 gene locus_tag LOCUS_10210 64524 65024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 65044 65523 gene locus_tag LOCUS_10220 gene greA 65044 65523 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_10220 65578 66804 gene locus_tag LOCUS_10230 65578 66804 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081138.1 protein_id gnl|my_center|LOCUS_10230 66829 67467 gene locus_tag LOCUS_10240 gene msrA 66829 67467 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056729.1 protein_id gnl|my_center|LOCUS_10240 67546 67473 gene locus_tag LOCUS_t00240 67546 67473 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 68108 67563 gene locus_tag LOCUS_10250 gene def 68108 67563 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_10250 68625 68110 gene locus_tag LOCUS_10260 68625 68110 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_10260 69479 68643 gene locus_tag LOCUS_10270 69479 68643 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730268.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence08 1066 569 gene locus_tag LOCUS_10280 1066 569 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_10280 1548 1063 gene locus_tag LOCUS_10290 1548 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2828 1551 gene locus_tag LOCUS_10300 gene eno 2828 1551 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804956.1 protein_id gnl|my_center|LOCUS_10300 2928 3012 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3113 3295 gene locus_tag LOCUS_10310 3113 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 3285 3584 gene locus_tag LOCUS_10320 3285 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3653 4510 gene locus_tag LOCUS_10330 3653 4510 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_10330 5168 4500 gene locus_tag LOCUS_10340 5168 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 5772 5179 gene locus_tag LOCUS_10350 5772 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 9251 5769 gene locus_tag LOCUS_10360 gene mfd 9251 5769 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_10360 10020 9256 gene locus_tag LOCUS_10370 10020 9256 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_10370 10607 10017 gene locus_tag LOCUS_10380 gene pth 10607 10017 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_10380 10924 10610 gene locus_tag LOCUS_10390 10924 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 12019 11063 gene locus_tag LOCUS_10400 12019 11063 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_10400 13517 11970 gene locus_tag LOCUS_10410 gene glmU 13517 11970 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_10410 12173 12249 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13626 13555 gene locus_tag LOCUS_t00250 13626 13555 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13782 14375 gene locus_tag LOCUS_10420 13782 14375 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467756.1 protein_id gnl|my_center|LOCUS_10420 14372 14878 gene locus_tag LOCUS_10430 gene tamR 14372 14878 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_10430 15792 14875 gene locus_tag LOCUS_10440 15792 14875 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229975.1 protein_id gnl|my_center|LOCUS_10440 16638 15802 gene locus_tag LOCUS_10450 gene rsmA 16638 15802 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 protein_id gnl|my_center|LOCUS_10450 17512 16652 gene locus_tag LOCUS_10460 17512 16652 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_10460 18767 17505 gene locus_tag LOCUS_10470 gene metG 18767 17505 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10470 18843 18935 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19975 19121 gene locus_tag LOCUS_10480 gene rsmI 19975 19121 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_10480 20620 20006 gene locus_tag LOCUS_10490 20620 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 21296 20670 gene locus_tag LOCUS_10500 21296 20670 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_10500 22165 21293 gene locus_tag LOCUS_10510 22165 21293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 23070 22168 gene locus_tag LOCUS_10520 gene galU 23070 22168 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_10520 23119 23652 gene locus_tag LOCUS_10530 23119 23652 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_10530 23953 23636 gene locus_tag LOCUS_10540 gene crcB 23953 23636 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_10540 24306 23950 gene locus_tag LOCUS_10550 24306 23950 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224560.1 protein_id gnl|my_center|LOCUS_10550 24339 24575 gene locus_tag LOCUS_10560 24339 24575 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230041.1 protein_id gnl|my_center|LOCUS_10560 24641 25078 gene locus_tag LOCUS_10570 24641 25078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 25106 25486 gene locus_tag LOCUS_10580 gene mscL 25106 25486 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889048.1 protein_id gnl|my_center|LOCUS_10580 25800 25483 gene locus_tag LOCUS_10590 25800 25483 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836461.1 protein_id gnl|my_center|LOCUS_10590 25933 27051 gene locus_tag LOCUS_10600 25933 27051 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254121.1 protein_id gnl|my_center|LOCUS_10600 27083 28075 gene locus_tag LOCUS_10610 27083 28075 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_10610 28123 28195 gene locus_tag LOCUS_t00260 28123 28195 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28317 30239 gene locus_tag LOCUS_10620 28317 30239 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265568.1 protein_id gnl|my_center|LOCUS_10620 30385 31668 gene locus_tag LOCUS_10630 30385 31668 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 protein_id gnl|my_center|LOCUS_10630 33197 31815 gene locus_tag LOCUS_10640 33197 31815 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227476.1 protein_id gnl|my_center|LOCUS_10640 33912 33202 gene locus_tag LOCUS_10650 33912 33202 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878347.1 protein_id gnl|my_center|LOCUS_10650 35372 33981 gene locus_tag LOCUS_10660 35372 33981 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223979.1 protein_id gnl|my_center|LOCUS_10660 35653 35369 gene locus_tag LOCUS_10670 35653 35369 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_10670 36789 35650 gene locus_tag LOCUS_10680 36789 35650 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_10680 37389 36829 gene locus_tag LOCUS_10690 37389 36829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 37622 37764 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37824 38828 gene locus_tag LOCUS_10700 37824 38828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 39781 38825 gene locus_tag LOCUS_10710 gene pfkB 39781 38825 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226343.1 protein_id gnl|my_center|LOCUS_10710 40508 39822 gene locus_tag LOCUS_10720 gene pdxH 40508 39822 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230168.1 protein_id gnl|my_center|LOCUS_10720 40592 41692 gene locus_tag LOCUS_10730 gene serC 40592 41692 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404623.1 protein_id gnl|my_center|LOCUS_10730 41818 42006 gene locus_tag LOCUS_10740 41818 42006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 42832 41969 gene locus_tag LOCUS_10750 42832 41969 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776598.1 protein_id gnl|my_center|LOCUS_10750 42761 42819 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43330 42950 gene locus_tag LOCUS_10760 43330 42950 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230216.1 protein_id gnl|my_center|LOCUS_10760 43989 43372 gene locus_tag LOCUS_10770 43989 43372 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230218.1 protein_id gnl|my_center|LOCUS_10770 44022 46289 gene locus_tag LOCUS_10780 44022 46289 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_10780 46306 47388 gene locus_tag LOCUS_10790 46306 47388 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225315.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence09 2260 101 gene locus_tag LOCUS_10800 2260 101 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226971.1 protein_id gnl|my_center|LOCUS_10800 2394 3065 gene locus_tag LOCUS_10810 gene lipB 2394 3065 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775681.1 protein_id gnl|my_center|LOCUS_10810 3062 4030 gene locus_tag LOCUS_10820 gene lipA 3062 4030 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466774.1 protein_id gnl|my_center|LOCUS_10820 4050 4724 gene locus_tag LOCUS_10830 4050 4724 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_10830 5147 4725 gene locus_tag LOCUS_10840 5147 4725 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_10840 5298 6731 gene locus_tag LOCUS_10850 gene glnA 5298 6731 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 protein_id gnl|my_center|LOCUS_10850 7730 6783 gene locus_tag LOCUS_10860 7730 6783 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975162.1 protein_id gnl|my_center|LOCUS_10860 7781 8428 gene locus_tag LOCUS_10870 7781 8428 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_10870 8508 9497 gene locus_tag LOCUS_10880 8508 9497 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_10880 9534 10424 gene locus_tag LOCUS_10890 9534 10424 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_10890 10426 11043 gene locus_tag LOCUS_10900 10426 11043 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223009.1 protein_id gnl|my_center|LOCUS_10900 13237 11024 gene locus_tag LOCUS_10910 13237 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 13265 13912 gene locus_tag LOCUS_10920 13265 13912 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324691.1 protein_id gnl|my_center|LOCUS_10920 13954 14730 gene locus_tag LOCUS_10930 13954 14730 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_10930 14737 15441 gene locus_tag LOCUS_10940 gene phoU 14737 15441 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804558.1 protein_id gnl|my_center|LOCUS_10940 15612 16523 gene locus_tag LOCUS_10950 gene pstC 15612 16523 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 protein_id gnl|my_center|LOCUS_10950 16613 17569 gene locus_tag LOCUS_10960 gene pstA 16613 17569 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229120.1 protein_id gnl|my_center|LOCUS_10960 17575 18414 gene locus_tag LOCUS_10970 17575 18414 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229121.1 protein_id gnl|my_center|LOCUS_10970 18571 19602 gene locus_tag LOCUS_10980 gene pstS 18571 19602 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_10980 19691 20791 gene locus_tag LOCUS_10990 19691 20791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 23691 20788 gene locus_tag LOCUS_11000 23691 20788 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_11000 25035 23701 gene locus_tag LOCUS_11010 gene glnA 25035 23701 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_11010 25116 26768 gene locus_tag LOCUS_11020 25116 26768 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_11020 27725 26769 gene locus_tag LOCUS_11030 27725 26769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 28861 27725 gene locus_tag LOCUS_11040 28861 27725 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_11040 29919 28861 gene locus_tag LOCUS_11050 29919 28861 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080341.1 protein_id gnl|my_center|LOCUS_11050 30111 30839 gene locus_tag LOCUS_11060 30111 30839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 30944 32122 gene locus_tag LOCUS_11070 30944 32122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 33704 32124 gene locus_tag LOCUS_11080 33704 32124 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030040.1 protein_id gnl|my_center|LOCUS_11080 33837 34676 gene locus_tag LOCUS_11090 gene panB 33837 34676 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_11090 34897 35042 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaggctgcaccaaagcgtcg 35524 37317 gene locus_tag LOCUS_11100 35524 37317 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_11100 37314 38165 gene locus_tag LOCUS_11110 37314 38165 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_11110 38212 39072 gene locus_tag LOCUS_11120 gene map 38212 39072 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_11120 39069 39554 gene locus_tag LOCUS_11130 39069 39554 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897002.1 protein_id gnl|my_center|LOCUS_11130 39631 39703 gene locus_tag LOCUS_t00270 39631 39703 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39743 40555 gene locus_tag LOCUS_11140 39743 40555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 40950 40552 gene locus_tag LOCUS_11150 40950 40552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 40990 41259 gene locus_tag LOCUS_11160 40990 41259 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811543.1 protein_id gnl|my_center|LOCUS_11160 42035 41271 gene locus_tag LOCUS_11170 42035 41271 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053836.1 protein_id gnl|my_center|LOCUS_11170 42112 42384 gene locus_tag LOCUS_11180 42112 42384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 42384 43454 gene locus_tag LOCUS_11190 42384 43454 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582708.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence10 317 1003 gene locus_tag LOCUS_11200 gene pyrF 317 1003 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_11200 1003 1335 gene locus_tag LOCUS_11210 1003 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1347 1886 gene locus_tag LOCUS_11220 gene gmk 1347 1886 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466863.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11220 1908 2195 gene locus_tag LOCUS_11230 gene rpoZ 1908 2195 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_11230 2213 3379 gene locus_tag LOCUS_11240 gene coaBC 2213 3379 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_11240 4134 3382 gene locus_tag LOCUS_11250 4134 3382 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 protein_id gnl|my_center|LOCUS_11250 4552 5754 gene locus_tag LOCUS_11260 gene metK 4552 5754 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057696.1 protein_id gnl|my_center|LOCUS_11260 5763 7661 gene locus_tag LOCUS_11270 5763 7661 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_11270 7689 8237 gene locus_tag LOCUS_11280 gene def 7689 8237 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_11280 8241 9164 gene locus_tag LOCUS_11290 gene fmt 8241 9164 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296597.1 protein_id gnl|my_center|LOCUS_11290 9161 10471 gene locus_tag LOCUS_11300 9161 10471 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_11300 10473 11144 gene locus_tag LOCUS_11310 gene rpe 10473 11144 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_11310 11680 11842 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12175 12774 gene locus_tag LOCUS_11320 12175 12774 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014470.1 protein_id gnl|my_center|LOCUS_11320 12771 13976 gene locus_tag LOCUS_11330 12771 13976 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_11330 14001 14480 gene locus_tag LOCUS_11340 gene ribH 14001 14480 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 protein_id gnl|my_center|LOCUS_11340 14477 14737 gene locus_tag LOCUS_11350 14477 14737 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899180.1 protein_id gnl|my_center|LOCUS_11350 14769 15611 gene locus_tag LOCUS_11360 gene hisG 14769 15611 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055763.1 protein_id gnl|my_center|LOCUS_11360 15931 16365 gene locus_tag LOCUS_11370 15931 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 16382 16579 gene locus_tag LOCUS_11380 gene rpmI 16382 16579 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_11380 16608 16970 gene locus_tag LOCUS_11390 gene rplT 16608 16970 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068013.1 protein_id gnl|my_center|LOCUS_11390 16974 17765 gene locus_tag LOCUS_11400 16974 17765 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408112.1 protein_id gnl|my_center|LOCUS_11400 17774 18808 gene locus_tag LOCUS_11410 gene pheS 17774 18808 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 protein_id gnl|my_center|LOCUS_11410 18809 21268 gene locus_tag LOCUS_11420 gene pheT 18809 21268 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_11420 22039 21272 gene locus_tag LOCUS_11430 22039 21272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 23031 23501 gene locus_tag LOCUS_11440 23031 23501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 23512 24120 gene locus_tag LOCUS_11450 23512 24120 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262334.1 protein_id gnl|my_center|LOCUS_11450 24198 25220 gene locus_tag LOCUS_11460 gene argC 24198 25220 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858698.1 protein_id gnl|my_center|LOCUS_11460 25217 26368 gene locus_tag LOCUS_11470 gene argJ 25217 26368 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_11470 26365 27252 gene locus_tag LOCUS_11480 gene argB 26365 27252 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058672.1 protein_id gnl|my_center|LOCUS_11480 27249 28424 gene locus_tag LOCUS_11490 27249 28424 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227835.1 protein_id gnl|my_center|LOCUS_11490 28421 28888 gene locus_tag LOCUS_11500 28421 28888 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227833.1 protein_id gnl|my_center|LOCUS_11500 28910 30121 gene locus_tag LOCUS_11510 28910 30121 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079277.1 protein_id gnl|my_center|LOCUS_11510 30111 31538 gene locus_tag LOCUS_11520 gene argH 30111 31538 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_11520 33392 31503 gene locus_tag LOCUS_11530 33392 31503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 33642 34727 gene locus_tag LOCUS_11540 gene tyrS 33642 34727 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_11540 35037 35051 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence11 77 2 gene locus_tag LOCUS_t00280 77 2 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 794 114 gene locus_tag LOCUS_11550 794 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11550 851 964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2189 1299 gene locus_tag LOCUS_11560 gene iolB 2189 1299 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223775.1 protein_id gnl|my_center|LOCUS_11560 3082 2186 gene locus_tag LOCUS_11570 3082 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223776.1 protein_id gnl|my_center|LOCUS_11570 4038 3085 gene locus_tag LOCUS_11580 gene iolC 4038 3085 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223777.1 protein_id gnl|my_center|LOCUS_11580 4947 4045 gene locus_tag LOCUS_11590 4947 4045 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223781.1 protein_id gnl|my_center|LOCUS_11590 5037 6017 gene locus_tag LOCUS_11600 5037 6017 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742135.1 protein_id gnl|my_center|LOCUS_11600 6052 6181 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6529 6637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7272 8303 gene locus_tag LOCUS_11610 7272 8303 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223779.1 protein_id gnl|my_center|LOCUS_11610 8300 9088 gene locus_tag LOCUS_11620 8300 9088 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_11620 9138 10136 gene locus_tag LOCUS_11630 gene iolG 9138 10136 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_11630 10172 11665 gene locus_tag LOCUS_11640 10172 11665 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_11640 12199 11825 gene locus_tag LOCUS_11650 12199 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 12290 12856 gene locus_tag LOCUS_11660 12290 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 12996 14231 gene locus_tag LOCUS_11670 gene gdhA 12996 14231 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_11670 14534 14358 gene locus_tag LOCUS_11680 14534 14358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 15654 14683 gene locus_tag LOCUS_11690 gene corA 15654 14683 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_11690 15891 17345 gene locus_tag LOCUS_11700 15891 17345 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388984.1 protein_id gnl|my_center|LOCUS_11700 17476 18711 gene locus_tag LOCUS_11710 17476 18711 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222135.1 protein_id gnl|my_center|LOCUS_11710 18601 18689 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19500 18733 gene locus_tag LOCUS_11720 gene heR 19500 18733 CDS product heliorhodopsin HeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_11720 20100 19615 gene locus_tag LOCUS_11730 20100 19615 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927167.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence12 77 2803 gene locus_tag LOCUS_11740 77 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4054 2879 gene locus_tag LOCUS_11750 4054 2879 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_11750 5430 4129 gene locus_tag LOCUS_11760 5430 4129 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_11760 5160 5230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5902 5471 gene locus_tag LOCUS_11770 5902 5471 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_11770 6162 5902 gene locus_tag LOCUS_11780 6162 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 6217 6390 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10618 7013 gene locus_tag LOCUS_11790 10618 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 11400 10765 gene locus_tag LOCUS_11800 11400 10765 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776560.1 protein_id gnl|my_center|LOCUS_11800 11501 11947 gene locus_tag LOCUS_11810 11501 11947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11810 11859 11901 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12030 12170 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence13 579 211 gene locus_tag LOCUS_11820 579 211 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257212.1 protein_id gnl|my_center|LOCUS_11820 953 582 gene locus_tag LOCUS_11830 953 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1590 1045 gene locus_tag LOCUS_11840 1590 1045 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257214.1 protein_id gnl|my_center|LOCUS_11840 2183 1590 gene locus_tag LOCUS_11850 2183 1590 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257215.1 protein_id gnl|my_center|LOCUS_11850 2665 2258 gene locus_tag LOCUS_11860 2665 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3629 2670 gene locus_tag LOCUS_11870 3629 2670 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339369.1 protein_id gnl|my_center|LOCUS_11870 3916 3647 gene locus_tag LOCUS_11880 3916 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 4906 3917 gene locus_tag LOCUS_11890 4906 3917 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529315.1 protein_id gnl|my_center|LOCUS_11890 5917 4907 gene locus_tag LOCUS_11900 5917 4907 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_11900 6017 6292 gene locus_tag LOCUS_11910 6017 6292 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814166.1 protein_id gnl|my_center|LOCUS_11910 6302 6766 gene locus_tag LOCUS_11920 gene ispF 6302 6766 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064989.1 protein_id gnl|my_center|LOCUS_11920 6775 8154 gene locus_tag LOCUS_11930 gene cysS 6775 8154 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_11930 8623 8159 gene locus_tag LOCUS_11940 8623 8159 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892531.1 protein_id gnl|my_center|LOCUS_11940 8718 8996 gene locus_tag LOCUS_11950 8718 8996 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041396.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence14 1400 369 gene locus_tag LOCUS_11960 1400 369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704970.1 protein_id gnl|my_center|LOCUS_11960 2989 1397 gene locus_tag LOCUS_11970 2989 1397 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729220.1 protein_id gnl|my_center|LOCUS_11970 3591 2986 gene locus_tag LOCUS_11980 3591 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 3868 4054 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5737 4100 gene locus_tag LOCUS_11990 5737 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 5742 5937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7025 6357 gene locus_tag LOCUS_12000 gene purQ 7025 6357 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863118.1 protein_id gnl|my_center|LOCUS_12000 7279 7022 gene locus_tag LOCUS_12010 gene purS 7279 7022 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776336.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence15 127 153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 351 483 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 589 1728 gene locus_tag LOCUS_12020 589 1728 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824469.1 protein_id gnl|my_center|LOCUS_12020 1830 1754 gene locus_tag LOCUS_t00290 1830 1754 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1934 1860 gene locus_tag LOCUS_t00300 1934 1860 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2029 1956 gene locus_tag LOCUS_t00310 2029 1956 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2192 2198 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4059 2221 gene locus_tag LOCUS_12030 4059 2221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_12030 4765 4064 gene locus_tag LOCUS_12040 gene glnR 4765 4064 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_12040 5179 5329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5482 5901 gene locus_tag LOCUS_12050 5482 5901 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_12050 6605 6793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7165 7238 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence16 <1 856 gene locus_tag LOCUS_12060 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877251.1:alpha/beta hydrolase 876 1658 gene locus_tag LOCUS_12070 876 1658 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908592.1 protein_id gnl|my_center|LOCUS_12070 1658 2770 gene locus_tag LOCUS_12080 1658 2770 CDS product peptidoglycan bridge formation peptidyltransferase VanK-Sc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029108.1 protein_id gnl|my_center|LOCUS_12080 2852 2962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <4888 3815 gene locus_tag LOCUS_12090 <4888 3815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205737.1:aspartate aminotransferase family protein >Feature sequence17 2495 1485 gene locus_tag LOCUS_12100 2495 1485 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259474.1 protein_id gnl|my_center|LOCUS_12100 3388 2495 gene locus_tag LOCUS_12110 3388 2495 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083706.1 protein_id gnl|my_center|LOCUS_12110 3055 3125 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4011 3388 gene locus_tag LOCUS_12120 4011 3388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259472.1 protein_id gnl|my_center|LOCUS_12120 4018 4103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence18 541 218 gene locus_tag LOCUS_12130 541 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1977 538 gene locus_tag LOCUS_12140 1977 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 <3943 2066 gene locus_tag LOCUS_12150 <3943 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000265568.1:5'-nucleotidase C-terminal domain-containing protein