>Feature sequence001 139 729 gene locus_tag LOCUS_00010 139 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1820 807 gene locus_tag LOCUS_00020 1820 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2113 1817 gene locus_tag LOCUS_00030 2113 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679303.1 protein_id gnl|my_center|LOCUS_00030 2564 2208 gene locus_tag LOCUS_00040 2564 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2782 2567 gene locus_tag LOCUS_00050 2782 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4229 3090 gene locus_tag LOCUS_00060 4229 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5374 4316 gene locus_tag LOCUS_00070 5374 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5936 5514 gene locus_tag LOCUS_00080 5936 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6134 5973 gene locus_tag LOCUS_00090 6134 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7325 6138 gene locus_tag LOCUS_00100 7325 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 8255 7344 gene locus_tag LOCUS_00110 8255 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9018 8467 gene locus_tag LOCUS_00120 9018 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9460 9119 gene locus_tag LOCUS_00130 9460 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 9578 9597 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10546 9932 gene locus_tag LOCUS_00140 10546 9932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10786 13170 gene locus_tag LOCUS_00150 10786 13170 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527693.1 protein_id gnl|my_center|LOCUS_00150 14300 13254 gene locus_tag LOCUS_00160 14300 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14446 14778 gene locus_tag LOCUS_00170 14446 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14785 15681 gene locus_tag LOCUS_00180 14785 15681 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680667.1 protein_id gnl|my_center|LOCUS_00180 16577 15678 gene locus_tag LOCUS_00190 16577 15678 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861195.1 protein_id gnl|my_center|LOCUS_00190 16668 17591 gene locus_tag LOCUS_00200 16668 17591 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858282.1 protein_id gnl|my_center|LOCUS_00200 18552 17596 gene locus_tag LOCUS_00210 gene rsgA 18552 17596 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679106.1 protein_id gnl|my_center|LOCUS_00210 18692 18766 gene locus_tag LOCUS_t00010 18692 18766 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 20514 18865 gene locus_tag LOCUS_00220 20514 18865 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940946.1 protein_id gnl|my_center|LOCUS_00220 22563 20530 gene locus_tag LOCUS_00230 gene fusA 22563 20530 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681223.1 protein_id gnl|my_center|LOCUS_00230 22750 23775 gene locus_tag LOCUS_00240 22750 23775 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_00240 23816 25804 gene locus_tag LOCUS_00250 23816 25804 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_00250 25798 26640 gene locus_tag LOCUS_00260 gene rlmJ 25798 26640 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707316.1 protein_id gnl|my_center|LOCUS_00260 27465 26644 gene locus_tag LOCUS_00270 27465 26644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679875.1 protein_id gnl|my_center|LOCUS_00270 28126 27458 gene locus_tag LOCUS_00280 28126 27458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 27836 27846 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29737 28190 gene locus_tag LOCUS_00290 29737 28190 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_00290 32094 29749 gene locus_tag LOCUS_00300 gene rpsA 32094 29749 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679883.1 protein_id gnl|my_center|LOCUS_00300 32850 32107 gene locus_tag LOCUS_00310 32850 32107 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682155.1 protein_id gnl|my_center|LOCUS_00310 33499 32840 gene locus_tag LOCUS_00320 gene scpB 33499 32840 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672067.1 protein_id gnl|my_center|LOCUS_00320 34230 33475 gene locus_tag LOCUS_00330 34230 33475 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670199.1 protein_id gnl|my_center|LOCUS_00330 34759 34253 gene locus_tag LOCUS_00340 gene folK 34759 34253 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832213.1 protein_id gnl|my_center|LOCUS_00340 36042 34765 gene locus_tag LOCUS_00350 gene recA 36042 34765 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682153.1 protein_id gnl|my_center|LOCUS_00350 36599 36384 gene locus_tag LOCUS_00360 36599 36384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 36724 36835 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37469 37681 gene locus_tag LOCUS_00370 37469 37681 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670897.1 protein_id gnl|my_center|LOCUS_00370 37872 37887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38005 38640 gene locus_tag LOCUS_00380 38005 38640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00380 38676 38692 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38768 39700 gene locus_tag LOCUS_00390 38768 39700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39991 40293 gene locus_tag LOCUS_00400 39991 40293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 41144 40431 gene locus_tag LOCUS_00410 41144 40431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 41358 42725 gene locus_tag LOCUS_00420 41358 42725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 42640 42891 gene locus_tag LOCUS_00430 42640 42891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 42893 44611 gene locus_tag LOCUS_00440 42893 44611 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680487.1 protein_id gnl|my_center|LOCUS_00440 46420 44615 gene locus_tag LOCUS_00450 gene lepA 46420 44615 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_00450 48118 46454 gene locus_tag LOCUS_00460 48118 46454 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678901.1 protein_id gnl|my_center|LOCUS_00460 50195 48102 gene locus_tag LOCUS_00470 50195 48102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 51319 50216 gene locus_tag LOCUS_00480 gene tilS 51319 50216 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678896.1 protein_id gnl|my_center|LOCUS_00480 51519 51525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52255 51701 gene locus_tag LOCUS_00490 52255 51701 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889819.1 protein_id gnl|my_center|LOCUS_00490 52367 52293 gene locus_tag LOCUS_t00020 52367 52293 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 52666 52388 gene locus_tag LOCUS_00500 gene spoVG 52666 52388 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_00500 53650 52763 gene locus_tag LOCUS_00510 gene ispE 53650 52763 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678892.1 protein_id gnl|my_center|LOCUS_00510 53818 54111 gene locus_tag LOCUS_00520 53818 54111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 55416 54199 gene locus_tag LOCUS_00530 55416 54199 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671534.1 protein_id gnl|my_center|LOCUS_00530 56216 55416 gene locus_tag LOCUS_00540 56216 55416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668611.1 protein_id gnl|my_center|LOCUS_00540 57913 56216 gene locus_tag LOCUS_00550 gene recN 57913 56216 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678799.1 protein_id gnl|my_center|LOCUS_00550 58760 57906 gene locus_tag LOCUS_00560 58760 57906 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679270.1 protein_id gnl|my_center|LOCUS_00560 59146 58757 gene locus_tag LOCUS_00570 59146 58757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00570 59846 59148 gene locus_tag LOCUS_00580 59846 59148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00580 59177 59187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60450 59959 gene locus_tag LOCUS_00590 60450 59959 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669135.1 protein_id gnl|my_center|LOCUS_00590 61281 60520 gene locus_tag LOCUS_00600 61281 60520 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682284.1 protein_id gnl|my_center|LOCUS_00600 63923 61332 gene locus_tag LOCUS_00610 gene mutS 63923 61332 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920616.1 protein_id gnl|my_center|LOCUS_00610 64524 63991 gene locus_tag LOCUS_00620 64524 63991 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667237.1 protein_id gnl|my_center|LOCUS_00620 67039 64562 gene locus_tag LOCUS_00630 gene bamA 67039 64562 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667239.1 protein_id gnl|my_center|LOCUS_00630 71464 67061 gene locus_tag LOCUS_00640 71464 67061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680585.1 protein_id gnl|my_center|LOCUS_00640 71541 72185 gene locus_tag LOCUS_00650 gene tmk 71541 72185 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957272.1 protein_id gnl|my_center|LOCUS_00650 72305 72847 gene locus_tag LOCUS_00660 72305 72847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680583.1 protein_id gnl|my_center|LOCUS_00660 72900 74348 gene locus_tag LOCUS_00670 72900 74348 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679249.1 protein_id gnl|my_center|LOCUS_00670 74370 75242 gene locus_tag LOCUS_00680 gene metF 74370 75242 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence002 2232 1204 gene locus_tag LOCUS_00690 2232 1204 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_00690 4439 2229 gene locus_tag LOCUS_00700 4439 2229 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680253.1 protein_id gnl|my_center|LOCUS_00700 5890 4436 gene locus_tag LOCUS_00710 gene rimO 5890 4436 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680609.1 protein_id gnl|my_center|LOCUS_00710 6998 5883 gene locus_tag LOCUS_00720 6998 5883 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680601.1 protein_id gnl|my_center|LOCUS_00720 7667 7002 gene locus_tag LOCUS_00730 7667 7002 CDS product outer-membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673641.1 protein_id gnl|my_center|LOCUS_00730 8910 7783 gene locus_tag LOCUS_00740 8910 7783 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613385.1 protein_id gnl|my_center|LOCUS_00740 10341 8920 gene locus_tag LOCUS_00750 10341 8920 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679156.1 protein_id gnl|my_center|LOCUS_00750 10862 10407 gene locus_tag LOCUS_00760 10862 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 11833 10859 gene locus_tag LOCUS_00770 11833 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 12885 11830 gene locus_tag LOCUS_00780 12885 11830 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722692.1 protein_id gnl|my_center|LOCUS_00780 14873 13002 gene locus_tag LOCUS_00790 14873 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681756.1 protein_id gnl|my_center|LOCUS_00790 15131 15586 gene locus_tag LOCUS_00800 15131 15586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 17902 15683 gene locus_tag LOCUS_00810 17902 15683 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680923.1 protein_id gnl|my_center|LOCUS_00810 17988 19520 gene locus_tag LOCUS_00820 17988 19520 CDS product DUF5312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680918.1 protein_id gnl|my_center|LOCUS_00820 19537 19929 gene locus_tag LOCUS_00830 19537 19929 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680077.1 protein_id gnl|my_center|LOCUS_00830 20208 19933 gene locus_tag LOCUS_00840 20208 19933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 20372 21661 gene locus_tag LOCUS_00850 gene hflX 20372 21661 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081386.1 protein_id gnl|my_center|LOCUS_00850 21658 22155 gene locus_tag LOCUS_00860 21658 22155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 22658 22200 gene locus_tag LOCUS_00870 gene rnhA 22658 22200 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_00870 23186 22680 gene locus_tag LOCUS_00880 23186 22680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 23808 23251 gene locus_tag LOCUS_00890 23808 23251 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678761.1 protein_id gnl|my_center|LOCUS_00890 25143 23827 gene locus_tag LOCUS_00900 25143 23827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 26777 25161 gene locus_tag LOCUS_00910 26777 25161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 27775 26774 gene locus_tag LOCUS_00920 27775 26774 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678753.1 protein_id gnl|my_center|LOCUS_00920 28960 27911 gene locus_tag LOCUS_00930 28960 27911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 29848 28970 gene locus_tag LOCUS_00940 29848 28970 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678741.1 protein_id gnl|my_center|LOCUS_00940 30834 29845 gene locus_tag LOCUS_00950 30834 29845 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666315.1 protein_id gnl|my_center|LOCUS_00950 31058 30879 gene locus_tag LOCUS_00960 31058 30879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 31926 31015 gene locus_tag LOCUS_00970 gene xylF 31926 31015 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00970 31040 31055 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33491 31923 gene locus_tag LOCUS_00980 33491 31923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 34974 33484 gene locus_tag LOCUS_00990 34974 33484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 35948 34971 gene locus_tag LOCUS_01000 35948 34971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 36094 36315 gene locus_tag LOCUS_01010 36094 36315 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016100.1 protein_id gnl|my_center|LOCUS_01010 36312 37466 gene locus_tag LOCUS_01020 36312 37466 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071664104.1 protein_id gnl|my_center|LOCUS_01020 37561 39198 gene locus_tag LOCUS_01030 37561 39198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 39534 40751 gene locus_tag LOCUS_01040 39534 40751 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462283.1 protein_id gnl|my_center|LOCUS_01040 40921 41169 gene locus_tag LOCUS_01050 40921 41169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 41213 41848 gene locus_tag LOCUS_01060 41213 41848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 42004 42522 gene locus_tag LOCUS_01070 42004 42522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 44676 42925 gene locus_tag LOCUS_01080 44676 42925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 45911 44913 gene locus_tag LOCUS_01090 45911 44913 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679909.1 protein_id gnl|my_center|LOCUS_01090 48117 46024 gene locus_tag LOCUS_01100 48117 46024 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_01100 49035 48277 gene locus_tag LOCUS_01110 49035 48277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 49154 49032 gene locus_tag LOCUS_01120 49154 49032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 49729 49331 gene locus_tag LOCUS_01130 49729 49331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 49925 51133 gene locus_tag LOCUS_01140 gene glnA 49925 51133 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_01140 51145 51729 gene locus_tag LOCUS_01150 51145 51729 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_01150 51843 51881 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53551 51950 gene locus_tag LOCUS_01160 53551 51950 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_01160 53972 53682 gene locus_tag LOCUS_01170 53972 53682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 57077 53973 gene locus_tag LOCUS_01180 57077 53973 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_01180 58019 57081 gene locus_tag LOCUS_01190 58019 57081 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658190.1 protein_id gnl|my_center|LOCUS_01190 59299 58022 gene locus_tag LOCUS_01200 59299 58022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence003 1325 333 gene locus_tag LOCUS_01210 1325 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 1423 1713 gene locus_tag LOCUS_01220 1423 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668328.1 protein_id gnl|my_center|LOCUS_01220 1774 2865 gene locus_tag LOCUS_01230 gene prfB 1774 2865 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096641376.1 protein_id gnl|my_center|LOCUS_01230 3000 4526 gene locus_tag LOCUS_01240 3000 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 4547 5422 gene locus_tag LOCUS_01250 gene ftsY 4547 5422 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668333.1 protein_id gnl|my_center|LOCUS_01250 5422 6288 gene locus_tag LOCUS_01260 5422 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 6311 7591 gene locus_tag LOCUS_01270 6311 7591 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679815.1 protein_id gnl|my_center|LOCUS_01270 7584 8276 gene locus_tag LOCUS_01280 7584 8276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668339.1 protein_id gnl|my_center|LOCUS_01280 8273 9616 gene locus_tag LOCUS_01290 8273 9616 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679814.1 protein_id gnl|my_center|LOCUS_01290 9655 10191 gene locus_tag LOCUS_01300 9655 10191 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674811.1 protein_id gnl|my_center|LOCUS_01300 10191 11303 gene locus_tag LOCUS_01310 10191 11303 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966467.1 protein_id gnl|my_center|LOCUS_01310 11313 13880 gene locus_tag LOCUS_01320 11313 13880 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679812.1 protein_id gnl|my_center|LOCUS_01320 13898 15175 gene locus_tag LOCUS_01330 13898 15175 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 protein_id gnl|my_center|LOCUS_01330 15186 15836 gene locus_tag LOCUS_01340 15186 15836 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_01340 16783 15932 gene locus_tag LOCUS_01350 16783 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 17744 16809 gene locus_tag LOCUS_01360 17744 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 18397 17990 gene locus_tag LOCUS_01370 18397 17990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 19549 18479 gene locus_tag LOCUS_01380 19549 18479 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_01380 19742 21022 gene locus_tag LOCUS_01390 19742 21022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 21578 23032 gene locus_tag LOCUS_01400 21578 23032 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003289.1 protein_id gnl|my_center|LOCUS_01400 23029 23838 gene locus_tag LOCUS_01410 23029 23838 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679573.1 protein_id gnl|my_center|LOCUS_01410 23840 24580 gene locus_tag LOCUS_01420 23840 24580 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675248.1 protein_id gnl|my_center|LOCUS_01420 24587 25648 gene locus_tag LOCUS_01430 24587 25648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 26363 25635 gene locus_tag LOCUS_01440 26363 25635 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679885.1 protein_id gnl|my_center|LOCUS_01440 26924 26376 gene locus_tag LOCUS_01450 26924 26376 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668265.1 protein_id gnl|my_center|LOCUS_01450 27135 28448 gene locus_tag LOCUS_01460 gene hisD 27135 28448 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861261.1 protein_id gnl|my_center|LOCUS_01460 28467 29045 gene locus_tag LOCUS_01470 gene def 28467 29045 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016949.1 protein_id gnl|my_center|LOCUS_01470 29046 30059 gene locus_tag LOCUS_01480 gene fmt 29046 30059 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679327.1 protein_id gnl|my_center|LOCUS_01480 30063 31094 gene locus_tag LOCUS_01490 30063 31094 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678383.1 protein_id gnl|my_center|LOCUS_01490 32671 31325 gene locus_tag LOCUS_01500 32671 31325 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_01500 32944 34047 gene locus_tag LOCUS_01510 32944 34047 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_01510 34895 34053 gene locus_tag LOCUS_01520 34895 34053 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157194.1 protein_id gnl|my_center|LOCUS_01520 34969 37035 gene locus_tag LOCUS_01530 34969 37035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 37093 38016 gene locus_tag LOCUS_01540 gene pyrB 37093 38016 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_01540 38016 38453 gene locus_tag LOCUS_01550 38016 38453 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_01550 39595 38618 gene locus_tag LOCUS_01560 gene bioB 39595 38618 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016821.1 protein_id gnl|my_center|LOCUS_01560 40277 39588 gene locus_tag LOCUS_01570 40277 39588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 40984 40268 gene locus_tag LOCUS_01580 40984 40268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679334.1 protein_id gnl|my_center|LOCUS_01580 41563 40988 gene locus_tag LOCUS_01590 41563 40988 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679338.1 protein_id gnl|my_center|LOCUS_01590 42340 41723 gene locus_tag LOCUS_01600 42340 41723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 43394 42453 gene locus_tag LOCUS_01610 43394 42453 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_01610 44324 43431 gene locus_tag LOCUS_01620 44324 43431 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_01620 44422 44715 gene locus_tag LOCUS_01630 44422 44715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 44712 45269 gene locus_tag LOCUS_01640 44712 45269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 46285 45266 gene locus_tag LOCUS_01650 46285 45266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 47314 46295 gene locus_tag LOCUS_01660 47314 46295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 47435 48361 gene locus_tag LOCUS_01670 47435 48361 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234873.1 protein_id gnl|my_center|LOCUS_01670 50061 48556 gene locus_tag LOCUS_01680 gene gltA 50061 48556 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681438.1 protein_id gnl|my_center|LOCUS_01680 49108 49122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50888 50079 gene locus_tag LOCUS_01690 50888 50079 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_01690 52014 51046 gene locus_tag LOCUS_01700 52014 51046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 53575 52097 gene locus_tag LOCUS_01710 53575 52097 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_01710 54413 53733 gene locus_tag LOCUS_01720 54413 53733 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 protein_id gnl|my_center|LOCUS_01720 55229 54426 gene locus_tag LOCUS_01730 55229 54426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 55429 56862 gene locus_tag LOCUS_01740 gene trpE 55429 56862 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003269846.1 protein_id gnl|my_center|LOCUS_01740 56724 56731 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56843 58438 gene locus_tag LOCUS_01750 56843 58438 CDS product bifunctional anthranilate synthase component II/anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943371.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence004 314 1633 gene locus_tag LOCUS_01760 gene carA 314 1633 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950981.1 protein_id gnl|my_center|LOCUS_01760 1695 5930 gene locus_tag LOCUS_01770 gene carB 1695 5930 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_01770 7907 6012 gene locus_tag LOCUS_01780 7907 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 10212 8008 gene locus_tag LOCUS_01790 10212 8008 CDS product TIGR03545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957002.1 protein_id gnl|my_center|LOCUS_01790 10730 10209 gene locus_tag LOCUS_01800 10730 10209 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679252.1 protein_id gnl|my_center|LOCUS_01800 10858 10786 gene locus_tag LOCUS_t00030 10858 10786 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11038 11901 gene locus_tag LOCUS_01810 11038 11901 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_01810 11894 13357 gene locus_tag LOCUS_01820 11894 13357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 13398 14870 gene locus_tag LOCUS_01830 13398 14870 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678947.1 protein_id gnl|my_center|LOCUS_01830 14904 15272 gene locus_tag LOCUS_01840 14904 15272 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948112.1 protein_id gnl|my_center|LOCUS_01840 15275 15970 gene locus_tag LOCUS_01850 15275 15970 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_01850 16492 17325 gene locus_tag LOCUS_01860 gene proB 16492 17325 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_01860 17322 18101 gene locus_tag LOCUS_01870 gene proC 17322 18101 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783010.1 protein_id gnl|my_center|LOCUS_01870 18952 18104 gene locus_tag LOCUS_01880 18952 18104 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680882.1 protein_id gnl|my_center|LOCUS_01880 20310 18928 gene locus_tag LOCUS_01890 20310 18928 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_01890 20429 21865 gene locus_tag LOCUS_01900 20429 21865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 21871 22341 gene locus_tag LOCUS_01910 21871 22341 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_01910 22419 23336 gene locus_tag LOCUS_01920 22419 23336 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235901447.1 protein_id gnl|my_center|LOCUS_01920 23445 24725 gene locus_tag LOCUS_01930 23445 24725 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_01930 24892 25770 gene locus_tag LOCUS_01940 gene pdxS 24892 25770 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_01940 25767 26324 gene locus_tag LOCUS_01950 gene pdxT 25767 26324 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461704.1 protein_id gnl|my_center|LOCUS_01950 27734 26334 gene locus_tag LOCUS_01960 gene cls 27734 26334 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_01960 27994 31935 gene locus_tag LOCUS_01970 27994 31935 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_01970 31951 32934 gene locus_tag LOCUS_01980 31951 32934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 32934 34208 gene locus_tag LOCUS_01990 32934 34208 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681281.1 protein_id gnl|my_center|LOCUS_01990 34205 35470 gene locus_tag LOCUS_02000 34205 35470 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_02000 36115 35465 gene locus_tag LOCUS_02010 36115 35465 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_02010 36931 36185 gene locus_tag LOCUS_02020 36931 36185 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_02020 37748 36978 gene locus_tag LOCUS_02030 37748 36978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_02030 38164 37736 gene locus_tag LOCUS_02040 38164 37736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 38238 38579 gene locus_tag LOCUS_02050 38238 38579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 39560 38715 gene locus_tag LOCUS_02060 39560 38715 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732701.1 protein_id gnl|my_center|LOCUS_02060 40246 39557 gene locus_tag LOCUS_02070 gene pyrE 40246 39557 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_02070 40783 40331 gene locus_tag LOCUS_02080 40783 40331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02080 42762 40711 gene locus_tag LOCUS_02090 42762 40711 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583018.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02090 40757 40762 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43091 44350 gene locus_tag LOCUS_02100 43091 44350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 44507 45466 gene locus_tag LOCUS_02110 44507 45466 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311850.1 protein_id gnl|my_center|LOCUS_02110 45482 46321 gene locus_tag LOCUS_02120 gene araQ 45482 46321 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_02120 46346 47941 gene locus_tag LOCUS_02130 46346 47941 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240529.1 protein_id gnl|my_center|LOCUS_02130 48058 49071 gene locus_tag LOCUS_02140 48058 49071 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583096.1 protein_id gnl|my_center|LOCUS_02140 49124 49194 gene locus_tag LOCUS_t00040 49124 49194 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 49234 49545 gene locus_tag LOCUS_02150 49234 49545 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669078.1 protein_id gnl|my_center|LOCUS_02150 49549 50136 gene locus_tag LOCUS_02160 gene recR 49549 50136 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956990.1 protein_id gnl|my_center|LOCUS_02160 50194 51162 gene locus_tag LOCUS_02170 50194 51162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 51159 53063 gene locus_tag LOCUS_02180 51159 53063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 54328 53060 gene locus_tag LOCUS_02190 54328 53060 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582595.1 protein_id gnl|my_center|LOCUS_02190 54987 54325 gene locus_tag LOCUS_02200 gene rsmG 54987 54325 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957250.1 protein_id gnl|my_center|LOCUS_02200 55880 54990 gene locus_tag LOCUS_02210 55880 54990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 56367 56398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence005 382 1914 gene locus_tag LOCUS_02220 382 1914 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_02220 1920 2132 gene locus_tag LOCUS_02230 1920 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 3177 2320 gene locus_tag LOCUS_02240 3177 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 4816 3566 gene locus_tag LOCUS_02250 gene gguB 4816 3566 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287993.1 protein_id gnl|my_center|LOCUS_02250 6526 4994 gene locus_tag LOCUS_02260 gene gguA 6526 4994 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_02260 7672 6608 gene locus_tag LOCUS_02270 gene chvE 7672 6608 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_02270 8469 8020 gene locus_tag LOCUS_02280 8469 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02280 9337 8354 gene locus_tag LOCUS_02290 9337 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02290 8363 8400 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9622 10914 gene locus_tag LOCUS_02300 9622 10914 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_02300 10898 11845 gene locus_tag LOCUS_02310 10898 11845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02310 11760 11781 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11812 12162 gene locus_tag LOCUS_02320 11812 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02320 12264 12665 gene locus_tag LOCUS_02330 12264 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 14024 12669 gene locus_tag LOCUS_02340 14024 12669 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_02340 16167 14041 gene locus_tag LOCUS_02350 16167 14041 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886474.1 protein_id gnl|my_center|LOCUS_02350 16842 16297 gene locus_tag LOCUS_02360 16842 16297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 17614 16844 gene locus_tag LOCUS_02370 17614 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 18599 17718 gene locus_tag LOCUS_02380 18599 17718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 19820 18624 gene locus_tag LOCUS_02390 19820 18624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 20292 19822 gene locus_tag LOCUS_02400 20292 19822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 20367 23213 gene locus_tag LOCUS_02410 20367 23213 CDS product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682238.1 protein_id gnl|my_center|LOCUS_02410 23549 25057 gene locus_tag LOCUS_02420 23549 25057 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_02420 25864 25148 gene locus_tag LOCUS_02430 25864 25148 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287284.1 protein_id gnl|my_center|LOCUS_02430 27599 26001 gene locus_tag LOCUS_02440 27599 26001 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_02440 27828 28757 gene locus_tag LOCUS_02450 27828 28757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 28880 30394 gene locus_tag LOCUS_02460 28880 30394 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_02460 30391 31485 gene locus_tag LOCUS_02470 30391 31485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_02470 31486 32538 gene locus_tag LOCUS_02480 gene yjfF 31486 32538 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_02480 32699 33481 gene locus_tag LOCUS_02490 32699 33481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 34413 33553 gene locus_tag LOCUS_02500 34413 33553 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670454.1 protein_id gnl|my_center|LOCUS_02500 35064 34552 gene locus_tag LOCUS_02510 35064 34552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971528.1 protein_id gnl|my_center|LOCUS_02510 35091 36029 gene locus_tag LOCUS_02520 35091 36029 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_02520 36023 37213 gene locus_tag LOCUS_02530 gene coaBC 36023 37213 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_02530 37225 38034 gene locus_tag LOCUS_02540 37225 38034 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680208.1 protein_id gnl|my_center|LOCUS_02540 38085 38573 gene locus_tag LOCUS_02550 38085 38573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 38622 39752 gene locus_tag LOCUS_02560 38622 39752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957140.1 protein_id gnl|my_center|LOCUS_02560 41293 39749 gene locus_tag LOCUS_02570 41293 39749 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957136.1 protein_id gnl|my_center|LOCUS_02570 42718 41312 gene locus_tag LOCUS_02580 42718 41312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679821.1 protein_id gnl|my_center|LOCUS_02580 43784 42882 gene locus_tag LOCUS_02590 43784 42882 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680076.1 protein_id gnl|my_center|LOCUS_02590 >Feature sequence006 1824 1925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3226 4506 gene locus_tag LOCUS_02600 3226 4506 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582886.1 protein_id gnl|my_center|LOCUS_02600 4587 5471 gene locus_tag LOCUS_02610 4587 5471 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_02610 5468 6283 gene locus_tag LOCUS_02620 5468 6283 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_02620 6308 6321 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6656 6399 gene locus_tag LOCUS_02630 6656 6399 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_02630 7467 6664 gene locus_tag LOCUS_02640 7467 6664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_02640 8422 7460 gene locus_tag LOCUS_02650 8422 7460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587303.1 protein_id gnl|my_center|LOCUS_02650 9434 8478 gene locus_tag LOCUS_02660 9434 8478 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_02660 9816 10865 gene locus_tag LOCUS_02670 9816 10865 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_02670 11073 11951 gene locus_tag LOCUS_02680 11073 11951 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_02680 12034 12885 gene locus_tag LOCUS_02690 gene pstC 12034 12885 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_02690 13043 13885 gene locus_tag LOCUS_02700 gene pstA 13043 13885 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_02700 13878 14633 gene locus_tag LOCUS_02710 gene pstB 13878 14633 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_02710 14679 15338 gene locus_tag LOCUS_02720 gene phoU 14679 15338 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_02720 15669 16784 gene locus_tag LOCUS_02730 15669 16784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 17369 16893 gene locus_tag LOCUS_02740 17369 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 17632 17730 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17745 17982 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtaacaattcttgacggcgttacttctatca 18929 18234 gene locus_tag LOCUS_02750 18929 18234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 19341 19616 gene locus_tag LOCUS_02760 19341 19616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 19613 19876 gene locus_tag LOCUS_02770 19613 19876 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113436.1 protein_id gnl|my_center|LOCUS_02770 19950 22013 gene locus_tag LOCUS_02780 19950 22013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 22100 22795 gene locus_tag LOCUS_02790 22100 22795 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_02790 22799 24217 gene locus_tag LOCUS_02800 22799 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 24279 24950 gene locus_tag LOCUS_02810 gene radC 24279 24950 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682286.1 protein_id gnl|my_center|LOCUS_02810 24954 26231 gene locus_tag LOCUS_02820 24954 26231 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679693.1 protein_id gnl|my_center|LOCUS_02820 26550 28547 gene locus_tag LOCUS_02830 gene uvrB 26550 28547 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678935.1 protein_id gnl|my_center|LOCUS_02830 28570 30897 gene locus_tag LOCUS_02840 28570 30897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 30977 32962 gene locus_tag LOCUS_02850 30977 32962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 33022 35124 gene locus_tag LOCUS_02860 33022 35124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 35216 35446 gene locus_tag LOCUS_02870 gene rpmB 35216 35446 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670427.1 protein_id gnl|my_center|LOCUS_02870 35607 36578 gene locus_tag LOCUS_02880 35607 36578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 37781 36798 gene locus_tag LOCUS_02890 37781 36798 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_02890 37880 38800 gene locus_tag LOCUS_02900 37880 38800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 39867 39049 gene locus_tag LOCUS_02910 39867 39049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 40400 41860 gene locus_tag LOCUS_02920 gene asnS 40400 41860 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682293.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence007 <1 2296 gene locus_tag LOCUS_02930 <1 2296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957315.1:DNA polymerase III subunit alpha 2319 2900 gene locus_tag LOCUS_02940 2319 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 2901 5084 gene locus_tag LOCUS_02950 gene recG 2901 5084 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680562.1 protein_id gnl|my_center|LOCUS_02950 5916 5065 gene locus_tag LOCUS_02960 5916 5065 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670326.1 protein_id gnl|my_center|LOCUS_02960 6431 6159 gene locus_tag LOCUS_02970 6431 6159 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670325.1 protein_id gnl|my_center|LOCUS_02970 8428 6566 gene locus_tag LOCUS_02980 8428 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 8910 8425 gene locus_tag LOCUS_02990 gene nusB 8910 8425 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679351.1 protein_id gnl|my_center|LOCUS_02990 9999 8920 gene locus_tag LOCUS_03000 9999 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 11879 10062 gene locus_tag LOCUS_03010 11879 10062 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_03010 12613 11978 gene locus_tag LOCUS_03020 gene upp 12613 11978 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699935.1 protein_id gnl|my_center|LOCUS_03020 13912 12617 gene locus_tag LOCUS_03030 13912 12617 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_03030 15420 13927 gene locus_tag LOCUS_03040 15420 13927 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_03040 15581 15417 gene locus_tag LOCUS_03050 15581 15417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 16430 15609 gene locus_tag LOCUS_03060 16430 15609 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669703.1 protein_id gnl|my_center|LOCUS_03060 17026 16448 gene locus_tag LOCUS_03070 17026 16448 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670118.1 protein_id gnl|my_center|LOCUS_03070 17640 17023 gene locus_tag LOCUS_03080 17640 17023 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670120.1 protein_id gnl|my_center|LOCUS_03080 18244 17642 gene locus_tag LOCUS_03090 18244 17642 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670122.1 protein_id gnl|my_center|LOCUS_03090 19272 18241 gene locus_tag LOCUS_03100 19272 18241 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002685644.1 protein_id gnl|my_center|LOCUS_03100 20582 19269 gene locus_tag LOCUS_03110 gene rsxC 20582 19269 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682097.1 protein_id gnl|my_center|LOCUS_03110 21200 20718 gene locus_tag LOCUS_03120 gene ybaK 21200 20718 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_03120 22144 21206 gene locus_tag LOCUS_03130 22144 21206 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679323.1 protein_id gnl|my_center|LOCUS_03130 22854 22255 gene locus_tag LOCUS_03140 gene coaE 22854 22255 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679322.1 protein_id gnl|my_center|LOCUS_03140 25646 22854 gene locus_tag LOCUS_03150 gene polA 25646 22854 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679321.1 protein_id gnl|my_center|LOCUS_03150 26066 26833 gene locus_tag LOCUS_03160 26066 26833 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682132.1 protein_id gnl|my_center|LOCUS_03160 27383 26841 gene locus_tag LOCUS_03170 27383 26841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 29467 27410 gene locus_tag LOCUS_03180 29467 27410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 30202 29471 gene locus_tag LOCUS_03190 30202 29471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_03190 31136 30183 gene locus_tag LOCUS_03200 31136 30183 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_03200 31279 31303 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31712 32065 gene locus_tag LOCUS_03210 31712 32065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 33721 32072 gene locus_tag LOCUS_03220 33721 32072 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943604.1 protein_id gnl|my_center|LOCUS_03220 33819 33866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34623 34015 gene locus_tag LOCUS_03230 34623 34015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03230 34061 34099 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34688 34772 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36225 35449 gene locus_tag LOCUS_03240 36225 35449 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 protein_id gnl|my_center|LOCUS_03240 37682 36243 gene locus_tag LOCUS_03250 gene argH 37682 36243 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_03250 38058 37684 gene locus_tag LOCUS_03260 38058 37684 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_03260 38978 38247 gene locus_tag LOCUS_03270 38978 38247 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_03270 41046 39076 gene locus_tag LOCUS_03280 gene htpG 41046 39076 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957241.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence008 1075 3054 gene locus_tag LOCUS_03290 gene pflB 1075 3054 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03290 2895 2914 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3051 3380 gene locus_tag LOCUS_03300 3051 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03300 4265 3510 gene locus_tag LOCUS_03310 4265 3510 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_03310 4476 4793 gene locus_tag LOCUS_03320 4476 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 4908 5654 gene locus_tag LOCUS_03330 gene pflA 4908 5654 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_03330 5774 6910 gene locus_tag LOCUS_03340 5774 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 7028 7834 gene locus_tag LOCUS_03350 7028 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 7902 9140 gene locus_tag LOCUS_03360 gene pepT 7902 9140 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723986.1 protein_id gnl|my_center|LOCUS_03360 9204 10487 gene locus_tag LOCUS_03370 gene murA 9204 10487 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669886.1 protein_id gnl|my_center|LOCUS_03370 10560 12317 gene locus_tag LOCUS_03380 gene thrS 10560 12317 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682400.1 protein_id gnl|my_center|LOCUS_03380 12874 12314 gene locus_tag LOCUS_03390 12874 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 13588 13007 gene locus_tag LOCUS_03400 13588 13007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 13755 14972 gene locus_tag LOCUS_03410 13755 14972 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681770.1 protein_id gnl|my_center|LOCUS_03410 16233 15088 gene locus_tag LOCUS_03420 16233 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 16365 17387 gene locus_tag LOCUS_03430 16365 17387 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_03430 18024 17347 gene locus_tag LOCUS_03440 18024 17347 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_03440 18955 18026 gene locus_tag LOCUS_03450 18955 18026 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674458.1 protein_id gnl|my_center|LOCUS_03450 19148 20212 gene locus_tag LOCUS_03460 19148 20212 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681843.1 protein_id gnl|my_center|LOCUS_03460 20260 22665 gene locus_tag LOCUS_03470 20260 22665 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971495.1 protein_id gnl|my_center|LOCUS_03470 22662 24050 gene locus_tag LOCUS_03480 gene mnmE 22662 24050 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680027.1 protein_id gnl|my_center|LOCUS_03480 24085 24891 gene locus_tag LOCUS_03490 24085 24891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957218.1 protein_id gnl|my_center|LOCUS_03490 24985 25401 gene locus_tag LOCUS_03500 24985 25401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670484.1 protein_id gnl|my_center|LOCUS_03500 26347 25454 gene locus_tag LOCUS_03510 26347 25454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 27288 26407 gene locus_tag LOCUS_03520 27288 26407 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680625.1 protein_id gnl|my_center|LOCUS_03520 27406 28686 gene locus_tag LOCUS_03530 27406 28686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 28808 28840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29499 28939 gene locus_tag LOCUS_03540 29499 28939 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_03540 29597 30193 gene locus_tag LOCUS_03550 29597 30193 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_03550 32352 30112 gene locus_tag LOCUS_03560 32352 30112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 32640 32861 gene locus_tag LOCUS_03570 32640 32861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 32999 34117 gene locus_tag LOCUS_03580 32999 34117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 34523 36877 gene locus_tag LOCUS_03590 34523 36877 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682327.1 protein_id gnl|my_center|LOCUS_03590 36881 37939 gene locus_tag LOCUS_03600 36881 37939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 38001 38073 gene locus_tag LOCUS_t00050 38001 38073 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence009 983 1741 gene locus_tag LOCUS_03610 983 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 3810 1813 gene locus_tag LOCUS_03620 gene tkt 3810 1813 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678841.1 protein_id gnl|my_center|LOCUS_03620 2983 3025 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4389 3913 gene locus_tag LOCUS_03630 4389 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5937 4417 gene locus_tag LOCUS_03640 5937 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6101 6625 gene locus_tag LOCUS_03650 6101 6625 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_03650 8254 6728 gene locus_tag LOCUS_03660 gene ilvB 8254 6728 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298157.1 protein_id gnl|my_center|LOCUS_03660 8274 8294 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8622 9254 gene locus_tag LOCUS_03670 8622 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 9266 10855 gene locus_tag LOCUS_03680 9266 10855 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682403.1 protein_id gnl|my_center|LOCUS_03680 12308 10953 gene locus_tag LOCUS_03690 12308 10953 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202473.1 protein_id gnl|my_center|LOCUS_03690 13032 12358 gene locus_tag LOCUS_03700 13032 12358 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_03700 13794 13081 gene locus_tag LOCUS_03710 13794 13081 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_03710 14020 15186 gene locus_tag LOCUS_03720 14020 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 15283 15984 gene locus_tag LOCUS_03730 15283 15984 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_03730 15996 17042 gene locus_tag LOCUS_03740 15996 17042 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013616093.1 protein_id gnl|my_center|LOCUS_03740 17847 17125 gene locus_tag LOCUS_03750 17847 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 18060 17851 gene locus_tag LOCUS_03760 18060 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03760 20278 18074 gene locus_tag LOCUS_03770 gene lon 20278 18074 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681876.1 protein_id gnl|my_center|LOCUS_03770 18084 18112 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22058 20328 gene locus_tag LOCUS_03780 gene ade 22058 20328 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_03780 22243 22161 gene locus_tag LOCUS_t00060 22243 22161 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22370 23830 gene locus_tag LOCUS_03790 22370 23830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 25102 24038 gene locus_tag LOCUS_03800 25102 24038 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383751.1 protein_id gnl|my_center|LOCUS_03800 25809 25099 gene locus_tag LOCUS_03810 25809 25099 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380521.1 protein_id gnl|my_center|LOCUS_03810 26619 25813 gene locus_tag LOCUS_03820 26619 25813 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_03820 27253 26657 gene locus_tag LOCUS_03830 27253 26657 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_03830 27311 27790 gene locus_tag LOCUS_03840 27311 27790 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_03840 27790 28236 gene locus_tag LOCUS_03850 27790 28236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 28312 29271 gene locus_tag LOCUS_03860 28312 29271 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296670.1 protein_id gnl|my_center|LOCUS_03860 29271 30248 gene locus_tag LOCUS_03870 29271 30248 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201896.1 protein_id gnl|my_center|LOCUS_03870 30257 30733 gene locus_tag LOCUS_03880 30257 30733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03880 30418 30424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31288 31713 gene locus_tag LOCUS_03890 31288 31713 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760904.1 protein_id gnl|my_center|LOCUS_03890 31861 33300 gene locus_tag LOCUS_03900 31861 33300 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_03900 33350 33610 gene locus_tag LOCUS_03910 33350 33610 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_03910 33627 33980 gene locus_tag LOCUS_03920 33627 33980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 33994 35043 gene locus_tag LOCUS_03930 33994 35043 CDS product capsular polysaccharide synthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799666.1 protein_id gnl|my_center|LOCUS_03930 35040 36176 gene locus_tag LOCUS_03940 35040 36176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 36280 37212 gene locus_tag LOCUS_03950 36280 37212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 37121 37858 gene locus_tag LOCUS_03960 37121 37858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 37149 37172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37818 37842 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38093 38124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence010 511 583 gene locus_tag LOCUS_t00070 511 583 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2121 679 gene locus_tag LOCUS_03970 2121 679 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680943.1 protein_id gnl|my_center|LOCUS_03970 3582 2131 gene locus_tag LOCUS_03980 gene trkA 3582 2131 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676352.1 protein_id gnl|my_center|LOCUS_03980 3724 4557 gene locus_tag LOCUS_03990 gene uppP 3724 4557 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_03990 6035 4683 gene locus_tag LOCUS_04000 gene purD 6035 4683 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047939.1 protein_id gnl|my_center|LOCUS_04000 6688 6110 gene locus_tag LOCUS_04010 6688 6110 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681594.1 protein_id gnl|my_center|LOCUS_04010 7422 6691 gene locus_tag LOCUS_04020 gene pyrH 7422 6691 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668261.1 protein_id gnl|my_center|LOCUS_04020 9151 7442 gene locus_tag LOCUS_04030 9151 7442 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680944.1 protein_id gnl|my_center|LOCUS_04030 9869 9153 gene locus_tag LOCUS_04040 9869 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 10407 9853 gene locus_tag LOCUS_04050 10407 9853 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666766.1 protein_id gnl|my_center|LOCUS_04050 10989 10444 gene locus_tag LOCUS_04060 10989 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 10493 10500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11996 10905 gene locus_tag LOCUS_04070 11996 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04070 11003 11047 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12165 13049 gene locus_tag LOCUS_04080 gene murB 12165 13049 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680945.1 protein_id gnl|my_center|LOCUS_04080 13064 14257 gene locus_tag LOCUS_04090 13064 14257 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673293.1 protein_id gnl|my_center|LOCUS_04090 14247 14792 gene locus_tag LOCUS_04100 14247 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680920.1 protein_id gnl|my_center|LOCUS_04100 14796 15248 gene locus_tag LOCUS_04110 14796 15248 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680919.1 protein_id gnl|my_center|LOCUS_04110 16409 15255 gene locus_tag LOCUS_04120 16409 15255 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681112.1 protein_id gnl|my_center|LOCUS_04120 17329 16427 gene locus_tag LOCUS_04130 17329 16427 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681114.1 protein_id gnl|my_center|LOCUS_04130 17522 18115 gene locus_tag LOCUS_04140 gene rpsD 17522 18115 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401493.1 protein_id gnl|my_center|LOCUS_04140 19201 18185 gene locus_tag LOCUS_04150 gene holA 19201 18185 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681969.1 protein_id gnl|my_center|LOCUS_04150 19817 19203 gene locus_tag LOCUS_04160 gene lexA 19817 19203 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_04160 20123 19821 gene locus_tag LOCUS_04170 20123 19821 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668605.1 protein_id gnl|my_center|LOCUS_04170 21109 20120 gene locus_tag LOCUS_04180 gene hprK 21109 20120 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_04180 21158 21922 gene locus_tag LOCUS_04190 21158 21922 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667426.1 protein_id gnl|my_center|LOCUS_04190 22259 22570 gene locus_tag LOCUS_04200 22259 22570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 22669 24759 gene locus_tag LOCUS_04210 22669 24759 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665246.1 protein_id gnl|my_center|LOCUS_04210 24898 26481 gene locus_tag LOCUS_04220 24898 26481 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681501.1 protein_id gnl|my_center|LOCUS_04220 29023 26393 gene locus_tag LOCUS_04230 29023 26393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 29033 29088 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31892 29373 gene locus_tag LOCUS_04240 31892 29373 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_04240 32306 31944 gene locus_tag LOCUS_04250 32306 31944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 32640 32329 gene locus_tag LOCUS_04260 32640 32329 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461875.1 protein_id gnl|my_center|LOCUS_04260 34010 32832 gene locus_tag LOCUS_04270 34010 32832 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_04270 34690 34025 gene locus_tag LOCUS_04280 34690 34025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04280 >Feature sequence011 310 981 gene locus_tag LOCUS_04290 310 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 1381 1442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1482 1829 gene locus_tag LOCUS_04300 1482 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04300 1911 2396 gene locus_tag LOCUS_04310 gene ruvC 1911 2396 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679556.1 protein_id gnl|my_center|LOCUS_04310 3099 2362 gene locus_tag LOCUS_04320 3099 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3285 3728 gene locus_tag LOCUS_04330 gene mraZ 3285 3728 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678680.1 protein_id gnl|my_center|LOCUS_04330 3763 4746 gene locus_tag LOCUS_04340 gene rsmH 3763 4746 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678681.1 protein_id gnl|my_center|LOCUS_04340 4746 5045 gene locus_tag LOCUS_04350 4746 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5032 6465 gene locus_tag LOCUS_04360 gene murF 5032 6465 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678687.1 protein_id gnl|my_center|LOCUS_04360 6468 7676 gene locus_tag LOCUS_04370 gene ftsW 6468 7676 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677685.1 protein_id gnl|my_center|LOCUS_04370 7669 8511 gene locus_tag LOCUS_04380 7669 8511 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668441.1 protein_id gnl|my_center|LOCUS_04380 8524 9768 gene locus_tag LOCUS_04390 gene ftsA 8524 9768 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656287.1 protein_id gnl|my_center|LOCUS_04390 9844 11331 gene locus_tag LOCUS_04400 9844 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 11335 12228 gene locus_tag LOCUS_04410 11335 12228 CDS product site-specific tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044909847.1 protein_id gnl|my_center|LOCUS_04410 12246 12980 gene locus_tag LOCUS_04420 12246 12980 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678696.1 protein_id gnl|my_center|LOCUS_04420 13019 13975 gene locus_tag LOCUS_04430 gene dprA 13019 13975 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677699.1 protein_id gnl|my_center|LOCUS_04430 13914 16181 gene locus_tag LOCUS_04440 gene topA 13914 16181 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678704.1 protein_id gnl|my_center|LOCUS_04440 16174 17097 gene locus_tag LOCUS_04450 16174 17097 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678705.1 protein_id gnl|my_center|LOCUS_04450 17131 17673 gene locus_tag LOCUS_04460 gene hslV 17131 17673 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668456.1 protein_id gnl|my_center|LOCUS_04460 17675 19198 gene locus_tag LOCUS_04470 gene hslU 17675 19198 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677705.1 protein_id gnl|my_center|LOCUS_04470 22057 19289 gene locus_tag LOCUS_04480 gene secA 22057 19289 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679596.1 protein_id gnl|my_center|LOCUS_04480 21021 21053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22234 23928 gene locus_tag LOCUS_04490 22234 23928 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680894.1 protein_id gnl|my_center|LOCUS_04490 24420 24019 gene locus_tag LOCUS_04500 24420 24019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04500 26074 24401 gene locus_tag LOCUS_04510 26074 24401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04510 24564 24599 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26888 26064 gene locus_tag LOCUS_04520 26888 26064 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680465.1 protein_id gnl|my_center|LOCUS_04520 28111 26885 gene locus_tag LOCUS_04530 28111 26885 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583323.1 protein_id gnl|my_center|LOCUS_04530 28172 29857 gene locus_tag LOCUS_04540 28172 29857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678730.1 protein_id gnl|my_center|LOCUS_04540 29862 31640 gene locus_tag LOCUS_04550 29862 31640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668497.1 protein_id gnl|my_center|LOCUS_04550 31600 31755 gene locus_tag LOCUS_04560 31600 31755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 31765 32994 gene locus_tag LOCUS_04570 gene thiI 31765 32994 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680552.1 protein_id gnl|my_center|LOCUS_04570 32970 34064 gene locus_tag LOCUS_04580 32970 34064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence012 <1 703 gene locus_tag LOCUS_04590 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920597.1:polyprenyl synthetase family protein 696 1220 gene locus_tag LOCUS_04600 696 1220 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671188.1 protein_id gnl|my_center|LOCUS_04600 1324 1818 gene locus_tag LOCUS_04610 1324 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 1826 2389 gene locus_tag LOCUS_04620 1826 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2379 3098 gene locus_tag LOCUS_04630 2379 3098 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669890.1 protein_id gnl|my_center|LOCUS_04630 3082 3828 gene locus_tag LOCUS_04640 gene lptB 3082 3828 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681841.1 protein_id gnl|my_center|LOCUS_04640 4027 3941 gene locus_tag LOCUS_t00080 4027 3941 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4167 4091 gene locus_tag LOCUS_t00090 4167 4091 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4303 4216 gene locus_tag LOCUS_t00100 4303 4216 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4413 4325 gene locus_tag LOCUS_t00110 4413 4325 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5098 4496 gene locus_tag LOCUS_04650 5098 4496 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567066.1 protein_id gnl|my_center|LOCUS_04650 5169 6170 gene locus_tag LOCUS_04660 5169 6170 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680574.1 protein_id gnl|my_center|LOCUS_04660 7336 6167 gene locus_tag LOCUS_04670 7336 6167 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_04670 7482 9707 gene locus_tag LOCUS_04680 7482 9707 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_04680 10505 9729 gene locus_tag LOCUS_04690 gene rlmB 10505 9729 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679077.1 protein_id gnl|my_center|LOCUS_04690 11320 10817 gene locus_tag LOCUS_04700 11320 10817 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_04700 12637 11396 gene locus_tag LOCUS_04710 12637 11396 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_04710 13218 12634 gene locus_tag LOCUS_04720 13218 12634 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841930.1 protein_id gnl|my_center|LOCUS_04720 15056 13230 gene locus_tag LOCUS_04730 gene iorA 15056 13230 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392452.1 protein_id gnl|my_center|LOCUS_04730 15658 15218 gene locus_tag LOCUS_04740 15658 15218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 15868 17529 gene locus_tag LOCUS_04750 15868 17529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 17677 19596 gene locus_tag LOCUS_04760 17677 19596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 19673 21403 gene locus_tag LOCUS_04770 19673 21403 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679009.1 protein_id gnl|my_center|LOCUS_04770 21477 21713 gene locus_tag LOCUS_04780 21477 21713 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_04780 21717 22262 gene locus_tag LOCUS_04790 21717 22262 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669747.1 protein_id gnl|my_center|LOCUS_04790 22834 22259 gene locus_tag LOCUS_04800 gene aroK 22834 22259 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946667.1 protein_id gnl|my_center|LOCUS_04800 23560 22838 gene locus_tag LOCUS_04810 23560 22838 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_04810 24754 23567 gene locus_tag LOCUS_04820 24754 23567 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680885.1 protein_id gnl|my_center|LOCUS_04820 26221 24761 gene locus_tag LOCUS_04830 26221 24761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 26405 28180 gene locus_tag LOCUS_04840 26405 28180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682311.1 protein_id gnl|my_center|LOCUS_04840 28327 29757 gene locus_tag LOCUS_04850 28327 29757 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_04850 29884 31422 gene locus_tag LOCUS_04860 29884 31422 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_04860 31426 33555 gene locus_tag LOCUS_04870 31426 33555 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence013 689 321 gene locus_tag LOCUS_04880 689 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1238 693 gene locus_tag LOCUS_04890 gene lspA 1238 693 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680623.1 protein_id gnl|my_center|LOCUS_04890 1325 1882 gene locus_tag LOCUS_04900 gene yfcE 1325 1882 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_04900 2897 1854 gene locus_tag LOCUS_04910 2897 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 4003 2894 gene locus_tag LOCUS_04920 4003 2894 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_04920 4871 4059 gene locus_tag LOCUS_04930 4871 4059 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673320.1 protein_id gnl|my_center|LOCUS_04930 5173 4871 gene locus_tag LOCUS_04940 5173 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04940 5976 5215 gene locus_tag LOCUS_04950 5976 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04950 6340 6053 gene locus_tag LOCUS_04960 6340 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 7013 6312 gene locus_tag LOCUS_04970 gene rsmI 7013 6312 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681097.1 protein_id gnl|my_center|LOCUS_04970 7255 10071 gene locus_tag LOCUS_04980 7255 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 10086 11042 gene locus_tag LOCUS_04990 10086 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 12756 11050 gene locus_tag LOCUS_05000 12756 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680819.1 protein_id gnl|my_center|LOCUS_05000 12951 13730 gene locus_tag LOCUS_05010 12951 13730 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016563.1 protein_id gnl|my_center|LOCUS_05010 15091 13781 gene locus_tag LOCUS_05020 15091 13781 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667136.1 protein_id gnl|my_center|LOCUS_05020 16405 15233 gene locus_tag LOCUS_05030 16405 15233 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_05030 16900 16406 gene locus_tag LOCUS_05040 16900 16406 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_05040 17544 16927 gene locus_tag LOCUS_05050 gene hisB 17544 16927 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_05050 18429 17557 gene locus_tag LOCUS_05060 gene hisG 18429 17557 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_05060 19208 18489 gene locus_tag LOCUS_05070 gene rpiA 19208 18489 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679325.1 protein_id gnl|my_center|LOCUS_05070 20701 19208 gene locus_tag LOCUS_05080 20701 19208 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679324.1 protein_id gnl|my_center|LOCUS_05080 22802 20703 gene locus_tag LOCUS_05090 22802 20703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681085.1 protein_id gnl|my_center|LOCUS_05090 24586 22799 gene locus_tag LOCUS_05100 24586 22799 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680776.1 protein_id gnl|my_center|LOCUS_05100 24853 25395 gene locus_tag LOCUS_05110 gene rbr3B 24853 25395 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966861.1 protein_id gnl|my_center|LOCUS_05110 25472 25876 gene locus_tag LOCUS_05120 25472 25876 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 protein_id gnl|my_center|LOCUS_05120 26538 25879 gene locus_tag LOCUS_05130 26538 25879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 27142 26540 gene locus_tag LOCUS_05140 27142 26540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 28309 27146 gene locus_tag LOCUS_05150 28309 27146 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682240.1 protein_id gnl|my_center|LOCUS_05150 28895 28434 gene locus_tag LOCUS_05160 28895 28434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 29391 28906 gene locus_tag LOCUS_05170 29391 28906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 29990 30700 gene locus_tag LOCUS_05180 29990 30700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 <32156 30805 gene locus_tag LOCUS_05190 <32156 30805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065725.1:ABC transporter ATP-binding protein >Feature sequence014 226 1440 gene locus_tag LOCUS_05200 gene xseA 226 1440 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682333.1 protein_id gnl|my_center|LOCUS_05200 1452 1751 gene locus_tag LOCUS_05210 1452 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1748 3583 gene locus_tag LOCUS_05220 gene mutL 1748 3583 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656028.1 protein_id gnl|my_center|LOCUS_05220 6938 3603 gene locus_tag LOCUS_05230 6938 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 7944 6913 gene locus_tag LOCUS_05240 7944 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 8133 9506 gene locus_tag LOCUS_05250 8133 9506 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670692.1 protein_id gnl|my_center|LOCUS_05250 9503 10273 gene locus_tag LOCUS_05260 9503 10273 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670690.1 protein_id gnl|my_center|LOCUS_05260 10239 11168 gene locus_tag LOCUS_05270 10239 11168 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259715.1 protein_id gnl|my_center|LOCUS_05270 11359 13059 gene locus_tag LOCUS_05280 11359 13059 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682419.1 protein_id gnl|my_center|LOCUS_05280 13088 13426 gene locus_tag LOCUS_05290 13088 13426 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670686.1 protein_id gnl|my_center|LOCUS_05290 13438 13989 gene locus_tag LOCUS_05300 13438 13989 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670683.1 protein_id gnl|my_center|LOCUS_05300 14041 14405 gene locus_tag LOCUS_tm00010 14041 14405 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 14771 14442 gene locus_tag LOCUS_05310 14771 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 15144 14758 gene locus_tag LOCUS_05320 15144 14758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 15557 15141 gene locus_tag LOCUS_05330 15557 15141 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115312693.1 protein_id gnl|my_center|LOCUS_05330 16006 15566 gene locus_tag LOCUS_05340 16006 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 16627 16061 gene locus_tag LOCUS_05350 16627 16061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 17856 16642 gene locus_tag LOCUS_05360 17856 16642 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682130.1 protein_id gnl|my_center|LOCUS_05360 18692 17907 gene locus_tag LOCUS_05370 gene truA 18692 17907 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667863.1 protein_id gnl|my_center|LOCUS_05370 19593 18685 gene locus_tag LOCUS_05380 19593 18685 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667865.1 protein_id gnl|my_center|LOCUS_05380 20005 19622 gene locus_tag LOCUS_05390 gene acpS 20005 19622 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048318.1 protein_id gnl|my_center|LOCUS_05390 21051 20014 gene locus_tag LOCUS_05400 21051 20014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 21844 21017 gene locus_tag LOCUS_05410 gene cdaA 21844 21017 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669723.1 protein_id gnl|my_center|LOCUS_05410 22661 21831 gene locus_tag LOCUS_05420 22661 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 24577 22658 gene locus_tag LOCUS_05430 gene dxs 24577 22658 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957098.1 protein_id gnl|my_center|LOCUS_05430 26037 24862 gene locus_tag LOCUS_05440 gene hemW 26037 24862 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679120.1 protein_id gnl|my_center|LOCUS_05440 26364 26041 gene locus_tag LOCUS_05450 26364 26041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05450 26376 26394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26493 26717 gene locus_tag LOCUS_05460 26493 26717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence015 195 815 gene locus_tag LOCUS_05470 195 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 833 1612 gene locus_tag LOCUS_05480 833 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 2037 2813 gene locus_tag LOCUS_05490 2037 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 3121 4860 gene locus_tag LOCUS_05500 gene ettA 3121 4860 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_05500 5994 5278 gene locus_tag LOCUS_05510 5994 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6142 7923 gene locus_tag LOCUS_05520 6142 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 8001 8840 gene locus_tag LOCUS_05530 8001 8840 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_05530 10604 8844 gene locus_tag LOCUS_05540 10604 8844 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682136.1 protein_id gnl|my_center|LOCUS_05540 10780 12450 gene locus_tag LOCUS_05550 gene lysS 10780 12450 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680521.1 protein_id gnl|my_center|LOCUS_05550 12527 13159 gene locus_tag LOCUS_05560 12527 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 13252 13695 gene locus_tag LOCUS_05570 13252 13695 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_05570 14764 13733 gene locus_tag LOCUS_05580 gene pta 14764 13733 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_05580 14871 14796 gene locus_tag LOCUS_t00120 14871 14796 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15231 15521 gene locus_tag LOCUS_05590 15231 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 15651 16673 gene locus_tag LOCUS_05600 15651 16673 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_05600 18248 16896 gene locus_tag LOCUS_05610 18248 16896 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_05610 19356 18250 gene locus_tag LOCUS_05620 19356 18250 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681927.1 protein_id gnl|my_center|LOCUS_05620 19722 20975 gene locus_tag LOCUS_05630 19722 20975 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667047.1 protein_id gnl|my_center|LOCUS_05630 21060 22298 gene locus_tag LOCUS_05640 21060 22298 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680777.1 protein_id gnl|my_center|LOCUS_05640 22313 22966 gene locus_tag LOCUS_05650 22313 22966 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941145.1 protein_id gnl|my_center|LOCUS_05650 23008 24357 gene locus_tag LOCUS_05660 23008 24357 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482935.1 protein_id gnl|my_center|LOCUS_05660 25653 24427 gene locus_tag LOCUS_05670 25653 24427 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048438.1 protein_id gnl|my_center|LOCUS_05670 26307 25699 gene locus_tag LOCUS_05680 26307 25699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence016 595 1734 gene locus_tag LOCUS_05690 595 1734 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197970.1 protein_id gnl|my_center|LOCUS_05690 1736 2623 gene locus_tag LOCUS_05700 1736 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 2865 4232 gene locus_tag LOCUS_05710 2865 4232 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256966.1 protein_id gnl|my_center|LOCUS_05710 4339 5253 gene locus_tag LOCUS_05720 4339 5253 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256965.1 protein_id gnl|my_center|LOCUS_05720 5303 6331 gene locus_tag LOCUS_05730 5303 6331 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256964.1 protein_id gnl|my_center|LOCUS_05730 6334 7725 gene locus_tag LOCUS_05740 6334 7725 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_05740 7734 8759 gene locus_tag LOCUS_05750 gene ccpA 7734 8759 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_05750 10188 8824 gene locus_tag LOCUS_05760 10188 8824 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_05760 11075 10299 gene locus_tag LOCUS_05770 11075 10299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 12793 11072 gene locus_tag LOCUS_05780 12793 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 14967 12907 gene locus_tag LOCUS_05790 14967 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 16274 15084 gene locus_tag LOCUS_05800 gene argJ 16274 15084 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_05800 15095 15122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16418 16696 gene locus_tag LOCUS_05810 16418 16696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 16680 16958 gene locus_tag LOCUS_05820 16680 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 18593 17016 gene locus_tag LOCUS_05830 gene gltX 18593 17016 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681104.1 protein_id gnl|my_center|LOCUS_05830 18978 19706 gene locus_tag LOCUS_05840 18978 19706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669611.1 protein_id gnl|my_center|LOCUS_05840 19720 20097 gene locus_tag LOCUS_05850 19720 20097 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288776.1 protein_id gnl|my_center|LOCUS_05850 20401 20102 gene locus_tag LOCUS_05860 20401 20102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 20696 20415 gene locus_tag LOCUS_05870 20696 20415 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_05870 21314 20763 gene locus_tag LOCUS_05880 21314 20763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 22668 21304 gene locus_tag LOCUS_05890 22668 21304 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_05890 22879 24975 gene locus_tag LOCUS_05900 22879 24975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence017 762 322 gene locus_tag LOCUS_05910 762 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 2563 785 gene locus_tag LOCUS_05920 2563 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 3660 2905 gene locus_tag LOCUS_05930 3660 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 3734 4186 gene locus_tag LOCUS_05940 3734 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 5145 4198 gene locus_tag LOCUS_05950 5145 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 6185 5169 gene locus_tag LOCUS_05960 6185 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 6705 7055 gene locus_tag LOCUS_05970 6705 7055 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667543.1 protein_id gnl|my_center|LOCUS_05970 7181 7618 gene locus_tag LOCUS_05980 7181 7618 CDS product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 protein_id gnl|my_center|LOCUS_05980 7629 8066 gene locus_tag LOCUS_05990 7629 8066 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788828.1 protein_id gnl|my_center|LOCUS_05990 8229 8915 gene locus_tag LOCUS_06000 8229 8915 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836295.1 protein_id gnl|my_center|LOCUS_06000 14388 8953 gene locus_tag LOCUS_06010 14388 8953 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889758.1 protein_id gnl|my_center|LOCUS_06010 15101 14430 gene locus_tag LOCUS_06020 15101 14430 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675739.1 protein_id gnl|my_center|LOCUS_06020 16123 15125 gene locus_tag LOCUS_06030 16123 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 16530 16120 gene locus_tag LOCUS_06040 16530 16120 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_06040 17146 16532 gene locus_tag LOCUS_06050 17146 16532 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_06050 18826 17177 gene locus_tag LOCUS_06060 18826 17177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 21718 18833 gene locus_tag LOCUS_06070 21718 18833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 23090 21705 gene locus_tag LOCUS_06080 23090 21705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679186.1 protein_id gnl|my_center|LOCUS_06080 <25070 23130 gene locus_tag LOCUS_06090 <25070 23130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679398.1:2-hydroxyacyl-CoA dehydratase >Feature sequence018 856 957 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1068 1448 gene locus_tag LOCUS_06100 1068 1448 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_06100 1667 2908 gene locus_tag LOCUS_06110 1667 2908 CDS product IS110-like element ISDha12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808714.1 protein_id gnl|my_center|LOCUS_06110 3087 4154 gene locus_tag LOCUS_06120 3087 4154 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680516.1 protein_id gnl|my_center|LOCUS_06120 4181 6193 gene locus_tag LOCUS_06130 4181 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6459 7295 gene locus_tag LOCUS_06140 gene thyX 6459 7295 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681263.1 protein_id gnl|my_center|LOCUS_06140 7881 7342 gene locus_tag LOCUS_06150 7881 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 7966 8703 gene locus_tag LOCUS_06160 7966 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 9213 8839 gene locus_tag LOCUS_06170 9213 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 9839 9231 gene locus_tag LOCUS_06180 gene pgsA 9839 9231 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667297.1 protein_id gnl|my_center|LOCUS_06180 9961 11310 gene locus_tag LOCUS_06190 gene radA 9961 11310 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680482.1 protein_id gnl|my_center|LOCUS_06190 13152 11581 gene locus_tag LOCUS_06200 13152 11581 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680967.1 protein_id gnl|my_center|LOCUS_06200 13675 13241 gene locus_tag LOCUS_06210 13675 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 14430 13699 gene locus_tag LOCUS_06220 14430 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666686.1 protein_id gnl|my_center|LOCUS_06220 15044 14421 gene locus_tag LOCUS_06230 15044 14421 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666681.1 protein_id gnl|my_center|LOCUS_06230 16198 15041 gene locus_tag LOCUS_06240 16198 15041 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956680.1 protein_id gnl|my_center|LOCUS_06240 17780 16200 gene locus_tag LOCUS_06250 17780 16200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 18861 17851 gene locus_tag LOCUS_06260 gene dusB 18861 17851 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680788.1 protein_id gnl|my_center|LOCUS_06260 19643 18858 gene locus_tag LOCUS_06270 19643 18858 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680785.1 protein_id gnl|my_center|LOCUS_06270 19919 20932 gene locus_tag LOCUS_06280 19919 20932 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666722.1 protein_id gnl|my_center|LOCUS_06280 20934 21350 gene locus_tag LOCUS_06290 20934 21350 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680969.1 protein_id gnl|my_center|LOCUS_06290 21352 21894 gene locus_tag LOCUS_06300 21352 21894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 21923 22846 gene locus_tag LOCUS_06310 gene ricT 21923 22846 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680971.1 protein_id gnl|my_center|LOCUS_06310 22923 23738 gene locus_tag LOCUS_06320 22923 23738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 23800 24801 gene locus_tag LOCUS_06330 23800 24801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence019 1044 337 gene locus_tag LOCUS_06340 1044 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 1380 1045 gene locus_tag LOCUS_06350 1380 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 2057 1758 gene locus_tag LOCUS_06360 2057 1758 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_06360 2326 2054 gene locus_tag LOCUS_06370 2326 2054 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_06370 3573 2383 gene locus_tag LOCUS_06380 gene ispD 3573 2383 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_06380 2817 2837 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4135 3566 gene locus_tag LOCUS_06390 4135 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 4113 4128 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4532 5866 gene locus_tag LOCUS_06400 4532 5866 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_06400 5866 6519 gene locus_tag LOCUS_06410 5866 6519 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_06410 6543 7028 gene locus_tag LOCUS_06420 6543 7028 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173597.1 protein_id gnl|my_center|LOCUS_06420 7134 8654 gene locus_tag LOCUS_06430 7134 8654 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_06430 8839 8866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8925 9284 gene locus_tag LOCUS_06440 8925 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 9284 10132 gene locus_tag LOCUS_06450 9284 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 10896 10129 gene locus_tag LOCUS_06460 10896 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 11576 11082 gene locus_tag LOCUS_06470 11576 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 13618 11573 gene locus_tag LOCUS_06480 13618 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 13674 15383 gene locus_tag LOCUS_06490 gene ptsP 13674 15383 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_06490 15399 16952 gene locus_tag LOCUS_06500 gene der 15399 16952 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680939.1 protein_id gnl|my_center|LOCUS_06500 16952 17287 gene locus_tag LOCUS_06510 16952 17287 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680938.1 protein_id gnl|my_center|LOCUS_06510 17287 18648 gene locus_tag LOCUS_06520 17287 18648 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680936.1 protein_id gnl|my_center|LOCUS_06520 20582 18645 gene locus_tag LOCUS_06530 20582 18645 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957030.1 protein_id gnl|my_center|LOCUS_06530 20775 21380 gene locus_tag LOCUS_06540 20775 21380 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669797.1 protein_id gnl|my_center|LOCUS_06540 21389 22387 gene locus_tag LOCUS_06550 21389 22387 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667792.1 protein_id gnl|my_center|LOCUS_06550 22509 23330 gene locus_tag LOCUS_06560 22509 23330 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669892.1 protein_id gnl|my_center|LOCUS_06560 23360 24565 gene locus_tag LOCUS_06570 23360 24565 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677016.1 protein_id gnl|my_center|LOCUS_06570 24073 24116 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence020 1557 910 gene locus_tag LOCUS_06580 1557 910 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682388.1 protein_id gnl|my_center|LOCUS_06580 2496 1672 gene locus_tag LOCUS_06590 2496 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 2557 2985 gene locus_tag LOCUS_06600 2557 2985 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074962.1 protein_id gnl|my_center|LOCUS_06600 3516 3082 gene locus_tag LOCUS_06610 3516 3082 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668975.1 protein_id gnl|my_center|LOCUS_06610 3716 3795 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5424 4015 gene locus_tag LOCUS_06620 5424 4015 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671242.1 protein_id gnl|my_center|LOCUS_06620 7866 5428 gene locus_tag LOCUS_06630 7866 5428 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671244.1 protein_id gnl|my_center|LOCUS_06630 8036 9280 gene locus_tag LOCUS_06640 8036 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 9961 9284 gene locus_tag LOCUS_06650 9961 9284 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_06650 10692 10195 gene locus_tag LOCUS_06660 10692 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 11312 10689 gene locus_tag LOCUS_06670 11312 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 12700 11315 gene locus_tag LOCUS_06680 12700 11315 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_06680 14487 12697 gene locus_tag LOCUS_06690 14487 12697 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_06690 15122 14484 gene locus_tag LOCUS_06700 15122 14484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 15651 15283 gene locus_tag LOCUS_06710 15651 15283 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_06710 16014 15688 gene locus_tag LOCUS_06720 16014 15688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 16741 16076 gene locus_tag LOCUS_06730 16741 16076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 18069 16741 gene locus_tag LOCUS_06740 18069 16741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 16841 16850 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19093 18062 gene locus_tag LOCUS_06750 19093 18062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 19411 19103 gene locus_tag LOCUS_06760 19411 19103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 19902 19444 gene locus_tag LOCUS_06770 19902 19444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 20365 20024 gene locus_tag LOCUS_06780 20365 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 21228 20488 gene locus_tag LOCUS_06790 21228 20488 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682279.1 protein_id gnl|my_center|LOCUS_06790 21356 21577 gene locus_tag LOCUS_06800 21356 21577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670390.1 protein_id gnl|my_center|LOCUS_06800 22530 21574 gene locus_tag LOCUS_06810 gene miaA 22530 21574 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679096.1 protein_id gnl|my_center|LOCUS_06810 23782 22535 gene locus_tag LOCUS_06820 23782 22535 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence021 1419 3911 gene locus_tag LOCUS_06830 gene thrA 1419 3911 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262570.1 protein_id gnl|my_center|LOCUS_06830 4006 5964 gene locus_tag LOCUS_06840 4006 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 5998 6489 gene locus_tag LOCUS_06850 gene ilvN 5998 6489 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_06850 6939 6493 gene locus_tag LOCUS_06860 6939 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 7075 8736 gene locus_tag LOCUS_06870 7075 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 9306 8740 gene locus_tag LOCUS_06880 9306 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678723.1 protein_id gnl|my_center|LOCUS_06880 9971 9303 gene locus_tag LOCUS_06890 9971 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 12265 10043 gene locus_tag LOCUS_06900 12265 10043 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957228.1 protein_id gnl|my_center|LOCUS_06900 13420 12284 gene locus_tag LOCUS_06910 13420 12284 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680821.1 protein_id gnl|my_center|LOCUS_06910 13553 14062 gene locus_tag LOCUS_06920 gene lepB 13553 14062 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956947.1 protein_id gnl|my_center|LOCUS_06920 14059 15933 gene locus_tag LOCUS_06930 14059 15933 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678847.1 protein_id gnl|my_center|LOCUS_06930 15914 17731 gene locus_tag LOCUS_06940 15914 17731 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678848.1 protein_id gnl|my_center|LOCUS_06940 17991 19472 gene locus_tag LOCUS_06950 17991 19472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 20262 19480 gene locus_tag LOCUS_06960 20262 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 21884 20430 gene locus_tag LOCUS_06970 21884 20430 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_06970 22743 22318 gene locus_tag LOCUS_06980 22743 22318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 23028 22744 gene locus_tag LOCUS_06990 23028 22744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 >Feature sequence022 504 923 gene locus_tag LOCUS_07000 gene nrdR 504 923 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678882.1 protein_id gnl|my_center|LOCUS_07000 1037 2563 gene locus_tag LOCUS_07010 1037 2563 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681937.1 protein_id gnl|my_center|LOCUS_07010 2563 3762 gene locus_tag LOCUS_07020 2563 3762 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681964.1 protein_id gnl|my_center|LOCUS_07020 3755 6073 gene locus_tag LOCUS_07030 3755 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 6045 6536 gene locus_tag LOCUS_07040 6045 6536 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669971.1 protein_id gnl|my_center|LOCUS_07040 6523 7326 gene locus_tag LOCUS_07050 6523 7326 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681967.1 protein_id gnl|my_center|LOCUS_07050 8397 7357 gene locus_tag LOCUS_07060 gene queA 8397 7357 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957235.1 protein_id gnl|my_center|LOCUS_07060 9571 8429 gene locus_tag LOCUS_07070 gene ruvB 9571 8429 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679608.1 protein_id gnl|my_center|LOCUS_07070 10188 9568 gene locus_tag LOCUS_07080 gene ruvA 10188 9568 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679554.1 protein_id gnl|my_center|LOCUS_07080 11156 10224 gene locus_tag LOCUS_07090 11156 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 11973 11248 gene locus_tag LOCUS_07100 11973 11248 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668795.1 protein_id gnl|my_center|LOCUS_07100 12738 11995 gene locus_tag LOCUS_07110 12738 11995 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668794.1 protein_id gnl|my_center|LOCUS_07110 12964 13968 gene locus_tag LOCUS_07120 12964 13968 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_07120 14104 14757 gene locus_tag LOCUS_07130 14104 14757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 14813 15343 gene locus_tag LOCUS_07140 gene infC 14813 15343 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668127.1 protein_id gnl|my_center|LOCUS_07140 15348 15548 gene locus_tag LOCUS_07150 gene rpmI 15348 15548 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679992.1 protein_id gnl|my_center|LOCUS_07150 15564 15923 gene locus_tag LOCUS_07160 gene rplT 15564 15923 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668132.1 protein_id gnl|my_center|LOCUS_07160 15927 16400 gene locus_tag LOCUS_07170 15927 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 16421 16723 gene locus_tag LOCUS_07180 16421 16723 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668137.1 protein_id gnl|my_center|LOCUS_07180 16720 17163 gene locus_tag LOCUS_07190 16720 17163 CDS product DUF188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679987.1 protein_id gnl|my_center|LOCUS_07190 18421 17165 gene locus_tag LOCUS_07200 18421 17165 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_07200 19386 18517 gene locus_tag LOCUS_07210 19386 18517 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679999.1 protein_id gnl|my_center|LOCUS_07210 20464 19373 gene locus_tag LOCUS_07220 20464 19373 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678712.1 protein_id gnl|my_center|LOCUS_07220 20585 21373 gene locus_tag LOCUS_07230 20585 21373 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence023 341 1609 gene locus_tag LOCUS_07240 341 1609 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 protein_id gnl|my_center|LOCUS_07240 2558 1644 gene locus_tag LOCUS_07250 gene metA 2558 1644 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121536.1 protein_id gnl|my_center|LOCUS_07250 2607 3563 gene locus_tag LOCUS_07260 2607 3563 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680147.1 protein_id gnl|my_center|LOCUS_07260 3567 5033 gene locus_tag LOCUS_07270 3567 5033 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680143.1 protein_id gnl|my_center|LOCUS_07270 5094 7004 gene locus_tag LOCUS_07280 gene relA 5094 7004 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_07280 7048 7626 gene locus_tag LOCUS_07290 7048 7626 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_07290 9106 7649 gene locus_tag LOCUS_07300 9106 7649 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_07300 9207 10037 gene locus_tag LOCUS_07310 9207 10037 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_07310 10045 11367 gene locus_tag LOCUS_07320 10045 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 12548 11418 gene locus_tag LOCUS_07330 gene ychF 12548 11418 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666350.1 protein_id gnl|my_center|LOCUS_07330 13589 12663 gene locus_tag LOCUS_07340 gene era 13589 12663 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679589.1 protein_id gnl|my_center|LOCUS_07340 15366 13672 gene locus_tag LOCUS_07350 gene sulP 15366 13672 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_07350 15799 15467 gene locus_tag LOCUS_07360 15799 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 16050 16958 gene locus_tag LOCUS_07370 16050 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 16993 17667 gene locus_tag LOCUS_07380 16993 17667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 17669 18520 gene locus_tag LOCUS_07390 17669 18520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 18579 19574 gene locus_tag LOCUS_07400 18579 19574 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461887.1 protein_id gnl|my_center|LOCUS_07400 19577 20071 gene locus_tag LOCUS_07410 19577 20071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 20072 20635 gene locus_tag LOCUS_07420 20072 20635 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_07420 21084 21830 gene locus_tag LOCUS_07430 21084 21830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence024 1789 179 gene locus_tag LOCUS_07440 gene murJ 1789 179 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681318.1 protein_id gnl|my_center|LOCUS_07440 1872 3602 gene locus_tag LOCUS_07450 1872 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 3581 5080 gene locus_tag LOCUS_07460 3581 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5177 5986 gene locus_tag LOCUS_07470 5177 5986 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582520.1 protein_id gnl|my_center|LOCUS_07470 5979 7658 gene locus_tag LOCUS_07480 5979 7658 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_07480 8316 7711 gene locus_tag LOCUS_07490 gene thrH 8316 7711 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_07490 8655 10256 gene locus_tag LOCUS_07500 gene cimA 8655 10256 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966451.1 protein_id gnl|my_center|LOCUS_07500 10355 11440 gene locus_tag LOCUS_07510 gene leuB 10355 11440 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_07510 11581 13707 gene locus_tag LOCUS_07520 11581 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 13790 14947 gene locus_tag LOCUS_07530 gene lysA 13790 14947 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_07530 14961 15140 gene locus_tag LOCUS_07540 14961 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 15179 15592 gene locus_tag LOCUS_07550 15179 15592 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948264.1 protein_id gnl|my_center|LOCUS_07550 15809 16018 gene locus_tag LOCUS_07560 15809 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 16081 16302 gene locus_tag LOCUS_07570 16081 16302 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_07570 16304 18571 gene locus_tag LOCUS_07580 gene feoB 16304 18571 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_07580 18577 18711 gene locus_tag LOCUS_07590 18577 18711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 18812 18970 gene locus_tag LOCUS_07600 18812 18970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 19224 20645 gene locus_tag LOCUS_07610 19224 20645 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_07610 20757 21083 gene locus_tag LOCUS_07620 20757 21083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680234.1 protein_id gnl|my_center|LOCUS_07620 21182 21523 gene locus_tag LOCUS_07630 21182 21523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 21480 21773 gene locus_tag LOCUS_07640 21480 21773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence025 467 27 gene locus_tag LOCUS_07650 467 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 529 576 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1017 1814 gene locus_tag LOCUS_07660 1017 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3046 1817 gene locus_tag LOCUS_07670 3046 1817 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680921.1 protein_id gnl|my_center|LOCUS_07670 4103 3123 gene locus_tag LOCUS_07680 gene galE 4103 3123 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931718.1 protein_id gnl|my_center|LOCUS_07680 4889 4356 gene locus_tag LOCUS_07690 4889 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07690 5187 4837 gene locus_tag LOCUS_07700 5187 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07700 6275 5139 gene locus_tag LOCUS_07710 6275 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07710 5206 5228 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7671 6346 gene locus_tag LOCUS_07720 7671 6346 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678992.1 protein_id gnl|my_center|LOCUS_07720 7757 9598 gene locus_tag LOCUS_07730 gene pepF 7757 9598 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971600.1 protein_id gnl|my_center|LOCUS_07730 8237 8304 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10893 9712 gene locus_tag LOCUS_07740 10893 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07740 12884 10803 gene locus_tag LOCUS_07750 12884 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07750 10961 11006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13958 12888 gene locus_tag LOCUS_07760 13958 12888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 14876 14022 gene locus_tag LOCUS_07770 gene ispH 14876 14022 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682405.1 protein_id gnl|my_center|LOCUS_07770 16272 15016 gene locus_tag LOCUS_07780 gene secF 16272 15016 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681892.1 protein_id gnl|my_center|LOCUS_07780 18008 16272 gene locus_tag LOCUS_07790 gene secD 18008 16272 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681894.1 protein_id gnl|my_center|LOCUS_07790 18426 18001 gene locus_tag LOCUS_07800 18426 18001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 19684 18593 gene locus_tag LOCUS_07810 19684 18593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 20088 19849 gene locus_tag LOCUS_07820 20088 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 20673 20182 gene locus_tag LOCUS_07830 20673 20182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 20681 20732 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21057 21671 gene locus_tag LOCUS_07840 21057 21671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07840 21604 21657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence026 1313 2689 gene locus_tag LOCUS_07850 1313 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2829 4925 gene locus_tag LOCUS_07860 gene fusA 2829 4925 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_07860 5126 5809 gene locus_tag LOCUS_07870 5126 5809 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670541.1 protein_id gnl|my_center|LOCUS_07870 6992 6087 gene locus_tag LOCUS_07880 6992 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 7695 6919 gene locus_tag LOCUS_07890 7695 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 7913 7686 gene locus_tag LOCUS_07900 7913 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 8805 7897 gene locus_tag LOCUS_07910 8805 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 9072 9839 gene locus_tag LOCUS_07920 9072 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 9999 10424 gene locus_tag LOCUS_07930 9999 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 10421 12607 gene locus_tag LOCUS_07940 10421 12607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 12604 14025 gene locus_tag LOCUS_07950 12604 14025 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 protein_id gnl|my_center|LOCUS_07950 14022 15044 gene locus_tag LOCUS_07960 14022 15044 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964406.1 protein_id gnl|my_center|LOCUS_07960 15041 15496 gene locus_tag LOCUS_07970 gene gspG 15041 15496 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_07970 15500 15643 gene locus_tag LOCUS_07980 15500 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 15630 16022 gene locus_tag LOCUS_07990 15630 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 16009 16827 gene locus_tag LOCUS_08000 16009 16827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 16824 18218 gene locus_tag LOCUS_08010 16824 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 18215 18688 gene locus_tag LOCUS_08020 18215 18688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 18678 19307 gene locus_tag LOCUS_08030 18678 19307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 19300 20319 gene locus_tag LOCUS_08040 19300 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence027 1639 683 gene locus_tag LOCUS_08050 1639 683 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681776.1 protein_id gnl|my_center|LOCUS_08050 2254 1808 gene locus_tag LOCUS_08060 2254 1808 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666808.1 protein_id gnl|my_center|LOCUS_08060 3230 2343 gene locus_tag LOCUS_08070 3230 2343 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_08070 3377 6148 gene locus_tag LOCUS_08080 3377 6148 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_08080 6256 6525 gene locus_tag LOCUS_08090 6256 6525 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_08090 7091 6675 gene locus_tag LOCUS_08100 7091 6675 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963907.1 protein_id gnl|my_center|LOCUS_08100 7668 7099 gene locus_tag LOCUS_08110 7668 7099 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_08110 9453 7912 gene locus_tag LOCUS_08120 gene gatB 9453 7912 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681743.1 protein_id gnl|my_center|LOCUS_08120 10961 9456 gene locus_tag LOCUS_08130 gene gatA 10961 9456 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956776.1 protein_id gnl|my_center|LOCUS_08130 11277 10963 gene locus_tag LOCUS_08140 gene gatC 11277 10963 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665812.1 protein_id gnl|my_center|LOCUS_08140 11427 12191 gene locus_tag LOCUS_08150 11427 12191 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679454.1 protein_id gnl|my_center|LOCUS_08150 12211 12990 gene locus_tag LOCUS_08160 gene map 12211 12990 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670900.1 protein_id gnl|my_center|LOCUS_08160 13028 14230 gene locus_tag LOCUS_08170 13028 14230 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_08170 15087 14251 gene locus_tag LOCUS_08180 gene murI 15087 14251 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679098.1 protein_id gnl|my_center|LOCUS_08180 16553 15108 gene locus_tag LOCUS_08190 16553 15108 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682292.1 protein_id gnl|my_center|LOCUS_08190 17617 16556 gene locus_tag LOCUS_08200 gene aroC 17617 16556 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878173.1 protein_id gnl|my_center|LOCUS_08200 19210 17660 gene locus_tag LOCUS_08210 19210 17660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 19776 19171 gene locus_tag LOCUS_08220 19776 19171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence028 408 1613 gene locus_tag LOCUS_08230 408 1613 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_08230 1610 2422 gene locus_tag LOCUS_08240 1610 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08240 2435 3091 gene locus_tag LOCUS_08250 2435 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08250 3198 4283 gene locus_tag LOCUS_08260 gene trpS 3198 4283 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804845.1 protein_id gnl|my_center|LOCUS_08260 4355 5284 gene locus_tag LOCUS_08270 4355 5284 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_08270 6402 5281 gene locus_tag LOCUS_08280 gene pcnB 6402 5281 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669419.1 protein_id gnl|my_center|LOCUS_08280 7338 6475 gene locus_tag LOCUS_08290 7338 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_08290 8271 7342 gene locus_tag LOCUS_08300 8271 7342 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678971.1 protein_id gnl|my_center|LOCUS_08300 8486 8791 gene locus_tag LOCUS_08310 8486 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 8784 10193 gene locus_tag LOCUS_08320 8784 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 10257 11531 gene locus_tag LOCUS_08330 10257 11531 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678974.1 protein_id gnl|my_center|LOCUS_08330 11541 12617 gene locus_tag LOCUS_08340 11541 12617 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678975.1 protein_id gnl|my_center|LOCUS_08340 12619 13122 gene locus_tag LOCUS_08350 12619 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 13150 13764 gene locus_tag LOCUS_08360 13150 13764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 13766 14326 gene locus_tag LOCUS_08370 13766 14326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 14320 14922 gene locus_tag LOCUS_08380 14320 14922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 14932 16896 gene locus_tag LOCUS_08390 14932 16896 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956965.1 protein_id gnl|my_center|LOCUS_08390 18045 16918 gene locus_tag LOCUS_08400 18045 16918 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658082.1 protein_id gnl|my_center|LOCUS_08400 20391 18064 gene locus_tag LOCUS_08410 gene metG 20391 18064 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682373.1 protein_id gnl|my_center|LOCUS_08410 20737 20462 gene locus_tag LOCUS_08420 20737 20462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence029 149 187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 452 1429 gene locus_tag LOCUS_08430 452 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1457 2320 gene locus_tag LOCUS_08440 1457 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3654 2434 gene locus_tag LOCUS_08450 gene mnmA 3654 2434 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_08450 4509 3712 gene locus_tag LOCUS_08460 4509 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 5087 4500 gene locus_tag LOCUS_08470 5087 4500 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678865.1 protein_id gnl|my_center|LOCUS_08470 5973 5071 gene locus_tag LOCUS_08480 5973 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 7975 5996 gene locus_tag LOCUS_08490 7975 5996 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_08490 10088 7986 gene locus_tag LOCUS_08500 10088 7986 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_08500 10785 10150 gene locus_tag LOCUS_08510 10785 10150 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296332.1 protein_id gnl|my_center|LOCUS_08510 11292 10807 gene locus_tag LOCUS_08520 11292 10807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680977.1 protein_id gnl|my_center|LOCUS_08520 11808 11350 gene locus_tag LOCUS_08530 11808 11350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 11963 13774 gene locus_tag LOCUS_08540 11963 13774 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957184.1 protein_id gnl|my_center|LOCUS_08540 13800 14855 gene locus_tag LOCUS_08550 13800 14855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680074.1 protein_id gnl|my_center|LOCUS_08550 15055 14858 gene locus_tag LOCUS_08560 15055 14858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08560 15761 15045 gene locus_tag LOCUS_08570 15761 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 15081 15113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16889 15879 gene locus_tag LOCUS_08580 16889 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 17265 18263 gene locus_tag LOCUS_08590 17265 18263 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813556.1 protein_id gnl|my_center|LOCUS_08590 19238 18405 gene locus_tag LOCUS_08600 19238 18405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 20007 19240 gene locus_tag LOCUS_08610 20007 19240 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957298.1 protein_id gnl|my_center|LOCUS_08610 20718 20062 gene locus_tag LOCUS_08620 20718 20062 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963654.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence030 1931 897 gene locus_tag LOCUS_08630 gene aroF 1931 897 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_08630 2431 2204 gene locus_tag LOCUS_08640 2431 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 3719 2433 gene locus_tag LOCUS_08650 3719 2433 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_08650 5698 3755 gene locus_tag LOCUS_08660 5698 3755 CDS product ribonuclease catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678953.1 protein_id gnl|my_center|LOCUS_08660 5586 5840 gene locus_tag LOCUS_08670 5586 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 7056 5851 gene locus_tag LOCUS_08680 gene ugpC 7056 5851 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_08680 7677 7147 gene locus_tag LOCUS_08690 7677 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 7877 9970 gene locus_tag LOCUS_08700 7877 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 10039 10827 gene locus_tag LOCUS_08710 10039 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 10956 12104 gene locus_tag LOCUS_08720 10956 12104 CDS product 3-dehydroquinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680953.1 protein_id gnl|my_center|LOCUS_08720 12101 13276 gene locus_tag LOCUS_08730 12101 13276 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680952.1 protein_id gnl|my_center|LOCUS_08730 13383 13823 gene locus_tag LOCUS_08740 13383 13823 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672091.1 protein_id gnl|my_center|LOCUS_08740 14419 13820 gene locus_tag LOCUS_08750 14419 13820 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956988.1 protein_id gnl|my_center|LOCUS_08750 16500 14425 gene locus_tag LOCUS_08760 16500 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 17114 16506 gene locus_tag LOCUS_08770 17114 16506 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679200.1 protein_id gnl|my_center|LOCUS_08770 18322 17198 gene locus_tag LOCUS_08780 18322 17198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667248.1 protein_id gnl|my_center|LOCUS_08780 19540 18323 gene locus_tag LOCUS_08790 19540 18323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 20439 19540 gene locus_tag LOCUS_08800 20439 19540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence031 1651 1575 gene locus_tag LOCUS_t00130 1651 1575 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2269 1697 gene locus_tag LOCUS_08810 gene efp 2269 1697 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897833.1 protein_id gnl|my_center|LOCUS_08810 3553 2363 gene locus_tag LOCUS_08820 gene earP 3553 2363 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016605.1 protein_id gnl|my_center|LOCUS_08820 3652 5217 gene locus_tag LOCUS_08830 3652 5217 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679741.1 protein_id gnl|my_center|LOCUS_08830 5331 5247 gene locus_tag LOCUS_t00140 5331 5247 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5530 5348 gene locus_tag LOCUS_08840 5530 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 5533 7095 gene locus_tag LOCUS_08850 5533 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 8787 7099 gene locus_tag LOCUS_08860 8787 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 9958 8822 gene locus_tag LOCUS_08870 gene tgt 9958 8822 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681512.1 protein_id gnl|my_center|LOCUS_08870 11054 9984 gene locus_tag LOCUS_08880 11054 9984 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682352.1 protein_id gnl|my_center|LOCUS_08880 12394 11051 gene locus_tag LOCUS_08890 12394 11051 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670521.1 protein_id gnl|my_center|LOCUS_08890 12843 12400 gene locus_tag LOCUS_08900 gene dut 12843 12400 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682351.1 protein_id gnl|my_center|LOCUS_08900 14114 12828 gene locus_tag LOCUS_08910 14114 12828 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438321.1 protein_id gnl|my_center|LOCUS_08910 16315 14225 gene locus_tag LOCUS_08920 gene pnp 16315 14225 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682350.1 protein_id gnl|my_center|LOCUS_08920 16792 16523 gene locus_tag LOCUS_08930 gene rpsO 16792 16523 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671840.1 protein_id gnl|my_center|LOCUS_08930 18777 16960 gene locus_tag LOCUS_08940 18777 16960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 19195 18791 gene locus_tag LOCUS_08950 gene rbfA 19195 18791 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670660.1 protein_id gnl|my_center|LOCUS_08950 <20446 19207 gene locus_tag LOCUS_08960 <20446 19207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682412.1:translation initiation factor IF-2 >Feature sequence032 341 913 gene locus_tag LOCUS_08970 341 913 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_08970 910 1473 gene locus_tag LOCUS_08980 910 1473 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_08980 1474 2805 gene locus_tag LOCUS_08990 1474 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2880 3965 gene locus_tag LOCUS_09000 gene prfA 2880 3965 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680455.1 protein_id gnl|my_center|LOCUS_09000 3977 4909 gene locus_tag LOCUS_09010 gene prmC 3977 4909 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680454.1 protein_id gnl|my_center|LOCUS_09010 4902 6176 gene locus_tag LOCUS_09020 4902 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 7318 6173 gene locus_tag LOCUS_09030 7318 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 7462 8394 gene locus_tag LOCUS_09040 7462 8394 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392447.1 protein_id gnl|my_center|LOCUS_09040 8394 9227 gene locus_tag LOCUS_09050 8394 9227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_09050 9234 10079 gene locus_tag LOCUS_09060 9234 10079 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903855.1 protein_id gnl|my_center|LOCUS_09060 10081 10728 gene locus_tag LOCUS_09070 10081 10728 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_09070 10725 13304 gene locus_tag LOCUS_09080 10725 13304 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679109.1 protein_id gnl|my_center|LOCUS_09080 13771 13301 gene locus_tag LOCUS_09090 13771 13301 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_09090 15697 13832 gene locus_tag LOCUS_09100 15697 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 16269 15670 gene locus_tag LOCUS_09110 16269 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 15699 15724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16391 17980 gene locus_tag LOCUS_09120 16391 17980 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680556.1 protein_id gnl|my_center|LOCUS_09120 18962 18069 gene locus_tag LOCUS_09130 18962 18069 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679808.1 protein_id gnl|my_center|LOCUS_09130 19103 19016 gene locus_tag LOCUS_t00150 19103 19016 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19538 19179 gene locus_tag LOCUS_09140 19538 19179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 19854 19690 gene locus_tag LOCUS_09150 19854 19690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence033 1163 576 gene locus_tag LOCUS_09160 1163 576 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430090.1 protein_id gnl|my_center|LOCUS_09160 2289 1192 gene locus_tag LOCUS_09170 2289 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679444.1 protein_id gnl|my_center|LOCUS_09170 2655 3857 gene locus_tag LOCUS_09180 2655 3857 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681086.1 protein_id gnl|my_center|LOCUS_09180 4264 3854 gene locus_tag LOCUS_09190 4264 3854 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679984.1 protein_id gnl|my_center|LOCUS_09190 4378 5322 gene locus_tag LOCUS_09200 gene argC 4378 5322 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_09200 5583 5389 gene locus_tag LOCUS_09210 5583 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 6087 5632 gene locus_tag LOCUS_09220 6087 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6559 6104 gene locus_tag LOCUS_09230 6559 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 7170 6646 gene locus_tag LOCUS_09240 7170 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 7395 7781 gene locus_tag LOCUS_09250 gene queD 7395 7781 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_09250 7801 9600 gene locus_tag LOCUS_09260 gene pyk 7801 9600 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232648.1 protein_id gnl|my_center|LOCUS_09260 10376 9609 gene locus_tag LOCUS_09270 gene hisF 10376 9609 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_09270 11025 10378 gene locus_tag LOCUS_09280 gene hisH 11025 10378 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949113.1 protein_id gnl|my_center|LOCUS_09280 11094 11348 gene locus_tag LOCUS_09290 11094 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 11393 12712 gene locus_tag LOCUS_09300 11393 12712 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673523.1 protein_id gnl|my_center|LOCUS_09300 16322 12678 gene locus_tag LOCUS_09310 16322 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 18368 16350 gene locus_tag LOCUS_09320 18368 16350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 18616 19260 gene locus_tag LOCUS_09330 18616 19260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence034 161 178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1406 582 gene locus_tag LOCUS_09340 1406 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1485 2375 gene locus_tag LOCUS_09350 gene ilvY 1485 2375 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_09350 2496 4073 gene locus_tag LOCUS_09360 gene modF 2496 4073 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096881.1 protein_id gnl|my_center|LOCUS_09360 4173 4532 gene locus_tag LOCUS_09370 4173 4532 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074395.1 protein_id gnl|my_center|LOCUS_09370 4525 4848 gene locus_tag LOCUS_09380 4525 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 5994 4978 gene locus_tag LOCUS_09390 5994 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6607 6023 gene locus_tag LOCUS_09400 6607 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 7275 6883 gene locus_tag LOCUS_09410 7275 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 8284 7304 gene locus_tag LOCUS_09420 8284 7304 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796125.1 protein_id gnl|my_center|LOCUS_09420 8738 8430 gene locus_tag LOCUS_09430 8738 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 9833 11011 gene locus_tag LOCUS_09440 gene metK 9833 11011 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680429.1 protein_id gnl|my_center|LOCUS_09440 11013 11657 gene locus_tag LOCUS_09450 gene nth 11013 11657 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965134.1 protein_id gnl|my_center|LOCUS_09450 12840 11647 gene locus_tag LOCUS_09460 12840 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 13216 15057 gene locus_tag LOCUS_09470 gene glmS 13216 15057 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048324.1 protein_id gnl|my_center|LOCUS_09470 15950 15126 gene locus_tag LOCUS_09480 15950 15126 CDS product cytidylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956669.1 protein_id gnl|my_center|LOCUS_09480 16077 16619 gene locus_tag LOCUS_09490 16077 16619 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680868.1 protein_id gnl|my_center|LOCUS_09490 17308 16616 gene locus_tag LOCUS_09500 17308 16616 CDS product DUF4398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674029.1 protein_id gnl|my_center|LOCUS_09500 18306 17308 gene locus_tag LOCUS_09510 18306 17308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 18587 18826 gene locus_tag LOCUS_09520 18587 18826 CDS product PC4/YdbC family ssDNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667298.1 protein_id gnl|my_center|LOCUS_09520 18847 19581 gene locus_tag LOCUS_09530 18847 19581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence035 418 206 gene locus_tag LOCUS_09540 418 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 464 498 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 740 810 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 914 3019 gene locus_tag LOCUS_09550 914 3019 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861108.1 protein_id gnl|my_center|LOCUS_09550 3003 3230 gene locus_tag LOCUS_09560 3003 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3252 3461 gene locus_tag LOCUS_09570 3252 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3445 3990 gene locus_tag LOCUS_09580 3445 3990 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087381.1 protein_id gnl|my_center|LOCUS_09580 4045 4512 gene locus_tag LOCUS_09590 4045 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 4586 5890 gene locus_tag LOCUS_09600 4586 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 7560 6166 gene locus_tag LOCUS_09610 7560 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 8114 7908 gene locus_tag LOCUS_09620 8114 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 8450 8977 gene locus_tag LOCUS_09630 8450 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 9659 10873 gene locus_tag LOCUS_09640 9659 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 12565 11111 gene locus_tag LOCUS_09650 12565 11111 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_09650 13089 12712 gene locus_tag LOCUS_09660 gene crcB 13089 12712 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927153.1 protein_id gnl|my_center|LOCUS_09660 13204 14190 gene locus_tag LOCUS_09670 13204 14190 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957962.1 protein_id gnl|my_center|LOCUS_09670 14267 14605 gene locus_tag LOCUS_09680 14267 14605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 14781 16049 gene locus_tag LOCUS_09690 14781 16049 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_09690 16331 16056 gene locus_tag LOCUS_09700 16331 16056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 16882 16682 gene locus_tag LOCUS_09710 16882 16682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 16708 16714 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17174 16845 gene locus_tag LOCUS_09720 17174 16845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 17391 17399 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17540 18799 gene locus_tag LOCUS_09730 17540 18799 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022243.1 protein_id gnl|my_center|LOCUS_09730 19057 19080 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence036 1795 1424 gene locus_tag LOCUS_09740 1795 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4746 1792 gene locus_tag LOCUS_09750 4746 1792 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679154.1 protein_id gnl|my_center|LOCUS_09750 5968 4802 gene locus_tag LOCUS_09760 5968 4802 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986366.1 protein_id gnl|my_center|LOCUS_09760 6017 7135 gene locus_tag LOCUS_09770 6017 7135 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956987.1 protein_id gnl|my_center|LOCUS_09770 8361 7183 gene locus_tag LOCUS_09780 gene clpX 8361 7183 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679368.1 protein_id gnl|my_center|LOCUS_09780 7771 7849 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9064 8453 gene locus_tag LOCUS_09790 gene clpP 9064 8453 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679367.1 protein_id gnl|my_center|LOCUS_09790 10521 9151 gene locus_tag LOCUS_09800 gene tig 10521 9151 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679366.1 protein_id gnl|my_center|LOCUS_09800 10634 10649 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10787 10715 gene locus_tag LOCUS_t00160 10787 10715 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10923 10843 gene locus_tag LOCUS_t00170 10923 10843 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11035 10963 gene locus_tag LOCUS_t00180 11035 10963 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11116 11043 gene locus_tag LOCUS_t00190 11116 11043 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11186 11211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12073 11303 gene locus_tag LOCUS_09810 12073 11303 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399515.1 protein_id gnl|my_center|LOCUS_09810 12897 12070 gene locus_tag LOCUS_09820 12897 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 13736 12894 gene locus_tag LOCUS_09830 13736 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 14316 13759 gene locus_tag LOCUS_09840 14316 13759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115564.1 protein_id gnl|my_center|LOCUS_09840 14466 15356 gene locus_tag LOCUS_09850 14466 15356 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957234.1 protein_id gnl|my_center|LOCUS_09850 15360 16511 gene locus_tag LOCUS_09860 gene murG 15360 16511 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957113.1 protein_id gnl|my_center|LOCUS_09860 16508 17041 gene locus_tag LOCUS_09870 16508 17041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 17044 17523 gene locus_tag LOCUS_09880 17044 17523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09880 17483 18286 gene locus_tag LOCUS_09890 17483 18286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09890 >Feature sequence037 <1 345 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatcccttaaatcaggtctatgtttttaat 894 601 gene locus_tag LOCUS_09900 894 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1177 902 gene locus_tag LOCUS_09910 1177 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2274 1174 gene locus_tag LOCUS_09920 2274 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2513 2298 gene locus_tag LOCUS_09930 2513 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3001 2510 gene locus_tag LOCUS_09940 3001 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 3219 3001 gene locus_tag LOCUS_09950 3219 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 4696 3326 gene locus_tag LOCUS_09960 4696 3326 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_09960 5128 4733 gene locus_tag LOCUS_09970 5128 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 6362 5139 gene locus_tag LOCUS_09980 6362 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 8061 6889 gene locus_tag LOCUS_09990 8061 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 8446 8051 gene locus_tag LOCUS_10000 8446 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 9344 8448 gene locus_tag LOCUS_10010 gene cmr4 9344 8448 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064477.1 protein_id gnl|my_center|LOCUS_10010 10342 9368 gene locus_tag LOCUS_10020 10342 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 13119 10339 gene locus_tag LOCUS_10030 gene cas10 13119 10339 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274454.1 protein_id gnl|my_center|LOCUS_10030 14141 13116 gene locus_tag LOCUS_10040 14141 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 15069 14155 gene locus_tag LOCUS_10050 gene cas6 15069 14155 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545702.1 protein_id gnl|my_center|LOCUS_10050 17459 15279 gene locus_tag LOCUS_10060 17459 15279 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109145.1 protein_id gnl|my_center|LOCUS_10060 17898 18075 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence038 78 410 gene locus_tag LOCUS_10070 78 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 561 932 gene locus_tag LOCUS_10080 561 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1454 2230 gene locus_tag LOCUS_10090 1454 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2700 3998 gene locus_tag LOCUS_10100 2700 3998 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_10100 4559 5062 gene locus_tag LOCUS_10110 4559 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5070 6737 gene locus_tag LOCUS_10120 5070 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 6890 8902 gene locus_tag LOCUS_10130 6890 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 9086 9694 gene locus_tag LOCUS_10140 9086 9694 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679729.1 protein_id gnl|my_center|LOCUS_10140 9931 10104 gene locus_tag LOCUS_10150 9931 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667639.1 protein_id gnl|my_center|LOCUS_10150 10156 10434 gene locus_tag LOCUS_10160 gene rpsT 10156 10434 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669392.1 protein_id gnl|my_center|LOCUS_10160 10488 10814 gene locus_tag LOCUS_10170 10488 10814 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669390.1 protein_id gnl|my_center|LOCUS_10170 10852 11268 gene locus_tag LOCUS_10180 10852 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 11522 12985 gene locus_tag LOCUS_10190 11522 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10190 12841 12927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12958 13314 gene locus_tag LOCUS_10200 12958 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10200 14710 13418 gene locus_tag LOCUS_10210 14710 13418 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_10210 15927 14875 gene locus_tag LOCUS_10220 15927 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10220 16279 16019 gene locus_tag LOCUS_10230 16279 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 16440 16913 gene locus_tag LOCUS_10240 16440 16913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10240 16894 16902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16910 17227 gene locus_tag LOCUS_10250 16910 17227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10250 17244 18038 gene locus_tag LOCUS_10260 gene flgG 17244 18038 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670463.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence039 1998 1234 gene locus_tag LOCUS_10270 1998 1234 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680775.1 protein_id gnl|my_center|LOCUS_10270 3229 2000 gene locus_tag LOCUS_10280 3229 2000 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670666.1 protein_id gnl|my_center|LOCUS_10280 4091 3288 gene locus_tag LOCUS_10290 4091 3288 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039647756.1 protein_id gnl|my_center|LOCUS_10290 5005 4088 gene locus_tag LOCUS_10300 5005 4088 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940886.1 protein_id gnl|my_center|LOCUS_10300 5986 5012 gene locus_tag LOCUS_10310 5986 5012 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940885.1 protein_id gnl|my_center|LOCUS_10310 7876 6359 gene locus_tag LOCUS_10320 gene putP 7876 6359 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_10320 8338 9669 gene locus_tag LOCUS_10330 8338 9669 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_10330 9810 10658 gene locus_tag LOCUS_10340 9810 10658 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052964.1 protein_id gnl|my_center|LOCUS_10340 10655 11500 gene locus_tag LOCUS_10350 10655 11500 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015137.1 protein_id gnl|my_center|LOCUS_10350 11597 12634 gene locus_tag LOCUS_10360 11597 12634 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294322.1 protein_id gnl|my_center|LOCUS_10360 12658 14142 gene locus_tag LOCUS_10370 gene malQ 12658 14142 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_10370 14337 16496 gene locus_tag LOCUS_10380 14337 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 16560 17885 gene locus_tag LOCUS_10390 16560 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence040 1075 68 gene locus_tag LOCUS_10400 1075 68 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_10400 1279 1500 gene locus_tag LOCUS_10410 1279 1500 CDS product DUF6110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665998.1 protein_id gnl|my_center|LOCUS_10410 1550 3622 gene locus_tag LOCUS_10420 1550 3622 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681568.1 protein_id gnl|my_center|LOCUS_10420 3626 3928 gene locus_tag LOCUS_10430 3626 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681569.1 protein_id gnl|my_center|LOCUS_10430 3992 4594 gene locus_tag LOCUS_10440 3992 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4728 4830 gene locus_tag LOCUS_r00010 4728 4830 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5260 4931 gene locus_tag LOCUS_10450 5260 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 5398 6600 gene locus_tag LOCUS_10460 5398 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6794 8395 gene locus_tag LOCUS_10470 6794 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 8411 9727 gene locus_tag LOCUS_10480 8411 9727 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669145.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10480 9701 9709 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9751 10059 gene locus_tag LOCUS_10490 9751 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10490 12088 10136 gene locus_tag LOCUS_10500 12088 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 13210 12098 gene locus_tag LOCUS_10510 gene rseP 13210 12098 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_10510 14322 13207 gene locus_tag LOCUS_10520 gene dxr 14322 13207 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680260.1 protein_id gnl|my_center|LOCUS_10520 15203 14322 gene locus_tag LOCUS_10530 15203 14322 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667742.1 protein_id gnl|my_center|LOCUS_10530 15913 15200 gene locus_tag LOCUS_10540 gene uppS 15913 15200 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675801.1 protein_id gnl|my_center|LOCUS_10540 16458 15919 gene locus_tag LOCUS_10550 gene frr 16458 15919 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675802.1 protein_id gnl|my_center|LOCUS_10550 17388 16552 gene locus_tag LOCUS_10560 gene tsf 17388 16552 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674264.1 protein_id gnl|my_center|LOCUS_10560 <17932 17408 gene locus_tag LOCUS_10570 <17932 17408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680262.1:30S ribosomal protein S2 >Feature sequence041 454 518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1611 628 gene locus_tag LOCUS_10580 1611 628 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075386.1 protein_id gnl|my_center|LOCUS_10580 3561 1846 gene locus_tag LOCUS_10590 3561 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 3989 5284 gene locus_tag LOCUS_10600 3989 5284 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_10600 5455 6336 gene locus_tag LOCUS_10610 5455 6336 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_10610 6361 7518 gene locus_tag LOCUS_10620 6361 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 7530 9659 gene locus_tag LOCUS_10630 7530 9659 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080058.1 protein_id gnl|my_center|LOCUS_10630 9676 10857 gene locus_tag LOCUS_10640 9676 10857 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_10640 10854 12029 gene locus_tag LOCUS_10650 10854 12029 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_10650 12048 13037 gene locus_tag LOCUS_10660 12048 13037 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_10660 13047 13820 gene locus_tag LOCUS_10670 13047 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 14262 15002 gene locus_tag LOCUS_10680 14262 15002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 14999 15943 gene locus_tag LOCUS_10690 14999 15943 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669381.1 protein_id gnl|my_center|LOCUS_10690 16398 15988 gene locus_tag LOCUS_10700 gene arfB 16398 15988 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463517.1 protein_id gnl|my_center|LOCUS_10700 17570 16479 gene locus_tag LOCUS_10710 gene asd 17570 16479 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence042 2702 120 gene locus_tag LOCUS_10720 2702 120 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971578.1 protein_id gnl|my_center|LOCUS_10720 3850 2693 gene locus_tag LOCUS_10730 3850 2693 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679158.1 protein_id gnl|my_center|LOCUS_10730 4763 3924 gene locus_tag LOCUS_10740 4763 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 5174 6682 gene locus_tag LOCUS_10750 gene galT 5174 6682 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_10750 6724 7761 gene locus_tag LOCUS_10760 gene asnA 6724 7761 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_10760 7748 8746 gene locus_tag LOCUS_10770 7748 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 9286 8759 gene locus_tag LOCUS_10780 9286 8759 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_10780 11106 9619 gene locus_tag LOCUS_10790 11106 9619 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674333.1 protein_id gnl|my_center|LOCUS_10790 11258 12532 gene locus_tag LOCUS_10800 11258 12532 CDS product FliG C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678791.1 protein_id gnl|my_center|LOCUS_10800 12529 15513 gene locus_tag LOCUS_10810 12529 15513 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679557.1 protein_id gnl|my_center|LOCUS_10810 15552 15773 gene locus_tag LOCUS_10820 15552 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 15894 17075 gene locus_tag LOCUS_10830 15894 17075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence043 52 1299 gene locus_tag LOCUS_10840 gene fabF 52 1299 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673329.1 protein_id gnl|my_center|LOCUS_10840 1304 1735 gene locus_tag LOCUS_10850 gene fabZ 1304 1735 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_10850 2259 1732 gene locus_tag LOCUS_10860 2259 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 2331 2339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2485 2910 gene locus_tag LOCUS_10870 gene ndk 2485 2910 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809738.1 protein_id gnl|my_center|LOCUS_10870 3091 4146 gene locus_tag LOCUS_10880 3091 4146 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679888.1 protein_id gnl|my_center|LOCUS_10880 4172 5566 gene locus_tag LOCUS_10890 gene ffh 4172 5566 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668253.1 protein_id gnl|my_center|LOCUS_10890 6213 5563 gene locus_tag LOCUS_10900 6213 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681839.1 protein_id gnl|my_center|LOCUS_10900 6451 9795 gene locus_tag LOCUS_10910 6451 9795 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682402.1 protein_id gnl|my_center|LOCUS_10910 9798 10448 gene locus_tag LOCUS_10920 9798 10448 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680767.1 protein_id gnl|my_center|LOCUS_10920 10942 10445 gene locus_tag LOCUS_10930 10942 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 10977 11348 gene locus_tag LOCUS_10940 10977 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 11431 12132 gene locus_tag LOCUS_10950 11431 12132 CDS product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679167.1 protein_id gnl|my_center|LOCUS_10950 12256 13488 gene locus_tag LOCUS_10960 12256 13488 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940837.1 protein_id gnl|my_center|LOCUS_10960 13564 14688 gene locus_tag LOCUS_10970 gene hisC 13564 14688 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208421.1 protein_id gnl|my_center|LOCUS_10970 14714 15388 gene locus_tag LOCUS_10980 14714 15388 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680480.1 protein_id gnl|my_center|LOCUS_10980 15445 17292 gene locus_tag LOCUS_10990 15445 17292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence044 77 2986 gene locus_tag LOCUS_11000 gene uvrA 77 2986 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956862.1 protein_id gnl|my_center|LOCUS_11000 203 252 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2990 6226 gene locus_tag LOCUS_11010 2990 6226 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682325.1 protein_id gnl|my_center|LOCUS_11010 6256 6621 gene locus_tag LOCUS_11020 6256 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 6776 8536 gene locus_tag LOCUS_11030 gene lepB 6776 8536 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680071.1 protein_id gnl|my_center|LOCUS_11030 8585 9445 gene locus_tag LOCUS_11040 8585 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 9503 10378 gene locus_tag LOCUS_11050 gene rfbA 9503 10378 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679070.1 protein_id gnl|my_center|LOCUS_11050 10378 10977 gene locus_tag LOCUS_11060 gene rfbC 10378 10977 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_11060 10979 12094 gene locus_tag LOCUS_11070 gene rfbB 10979 12094 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679073.1 protein_id gnl|my_center|LOCUS_11070 12664 12149 gene locus_tag LOCUS_11080 12664 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 13101 14612 gene locus_tag LOCUS_11090 13101 14612 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 protein_id gnl|my_center|LOCUS_11090 14633 15472 gene locus_tag LOCUS_11100 14633 15472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 16416 15490 gene locus_tag LOCUS_11110 16416 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11110 16519 16537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence045 1025 2182 gene locus_tag LOCUS_11120 1025 2182 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682269.1 protein_id gnl|my_center|LOCUS_11120 3000 2194 gene locus_tag LOCUS_11130 3000 2194 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564427.1 protein_id gnl|my_center|LOCUS_11130 3150 3179 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3345 3401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3430 4497 gene locus_tag LOCUS_11140 3430 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11140 5013 4543 gene locus_tag LOCUS_11150 gene ribE 5013 4543 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_11150 6260 5046 gene locus_tag LOCUS_11160 6260 5046 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905673.1 protein_id gnl|my_center|LOCUS_11160 6861 6250 gene locus_tag LOCUS_11170 gene ribE 6861 6250 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493908.1 protein_id gnl|my_center|LOCUS_11170 8036 6885 gene locus_tag LOCUS_11180 gene ribD 8036 6885 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975998.1 protein_id gnl|my_center|LOCUS_11180 8149 10731 gene locus_tag LOCUS_11190 8149 10731 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679459.1 protein_id gnl|my_center|LOCUS_11190 10761 11174 gene locus_tag LOCUS_11200 10761 11174 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668053.1 protein_id gnl|my_center|LOCUS_11200 11289 12941 gene locus_tag LOCUS_11210 11289 12941 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674349.1 protein_id gnl|my_center|LOCUS_11210 13153 12938 gene locus_tag LOCUS_11220 13153 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 14726 13377 gene locus_tag LOCUS_11230 gene fliI 14726 13377 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678707.1 protein_id gnl|my_center|LOCUS_11230 15745 14813 gene locus_tag LOCUS_11240 gene fliH 15745 14813 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668471.1 protein_id gnl|my_center|LOCUS_11240 <16675 15766 gene locus_tag LOCUS_11250 <16675 15766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002668469.1:flagellar motor switch protein FliG >Feature sequence046 <1 694 gene locus_tag LOCUS_11260 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680036.1:thymidine phosphorylase 694 2859 gene locus_tag LOCUS_11270 gene recJ 694 2859 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680035.1 protein_id gnl|my_center|LOCUS_11270 2889 3869 gene locus_tag LOCUS_11280 2889 3869 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680034.1 protein_id gnl|my_center|LOCUS_11280 5821 3866 gene locus_tag LOCUS_11290 gene ligA 5821 3866 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679195.1 protein_id gnl|my_center|LOCUS_11290 6557 5826 gene locus_tag LOCUS_11300 gene trmB 6557 5826 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956879.1 protein_id gnl|my_center|LOCUS_11300 7113 6550 gene locus_tag LOCUS_11310 7113 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 8376 7210 gene locus_tag LOCUS_11320 8376 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670701.1 protein_id gnl|my_center|LOCUS_11320 8534 10498 gene locus_tag LOCUS_11330 8534 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 10488 11705 gene locus_tag LOCUS_11340 gene dinB 10488 11705 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956849.1 protein_id gnl|my_center|LOCUS_11340 13719 11656 gene locus_tag LOCUS_11350 13719 11656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680210.1 protein_id gnl|my_center|LOCUS_11350 13188 13210 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14417 13719 gene locus_tag LOCUS_11360 14417 13719 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680214.1 protein_id gnl|my_center|LOCUS_11360 15253 14429 gene locus_tag LOCUS_11370 gene surE 15253 14429 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082178.1 protein_id gnl|my_center|LOCUS_11370 15058 15088 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <16181 15250 gene locus_tag LOCUS_11380 <16181 15250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667821.1:galactokinase >Feature sequence047 131 1957 gene locus_tag LOCUS_11390 gene tacF 131 1957 CDS product type IV teichoic acid flippase TacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835918.1 protein_id gnl|my_center|LOCUS_11390 448 487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1950 2321 gene locus_tag LOCUS_11400 1950 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2353 3204 gene locus_tag LOCUS_11410 2353 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11410 3201 4109 gene locus_tag LOCUS_11420 3201 4109 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101287.1 protein_id gnl|my_center|LOCUS_11420 4956 5357 gene locus_tag LOCUS_11430 4956 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 5354 6091 gene locus_tag LOCUS_11440 5354 6091 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362119.1 protein_id gnl|my_center|LOCUS_11440 6099 6902 gene locus_tag LOCUS_11450 6099 6902 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905211.1 protein_id gnl|my_center|LOCUS_11450 6899 8077 gene locus_tag LOCUS_11460 6899 8077 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065081.1 protein_id gnl|my_center|LOCUS_11460 8335 8538 gene locus_tag LOCUS_11470 8335 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 8730 9170 gene locus_tag LOCUS_11480 8730 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 9185 9367 gene locus_tag LOCUS_11490 9185 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 9554 11218 gene locus_tag LOCUS_11500 9554 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 11366 12457 gene locus_tag LOCUS_11510 11366 12457 CDS product ATP/GTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616490.1 protein_id gnl|my_center|LOCUS_11510 12457 13113 gene locus_tag LOCUS_11520 12457 13113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 13657 14475 gene locus_tag LOCUS_11530 13657 14475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 14686 14946 gene locus_tag LOCUS_11540 14686 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 14943 15107 gene locus_tag LOCUS_11550 14943 15107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence048 843 1232 gene locus_tag LOCUS_11560 843 1232 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667147.1 protein_id gnl|my_center|LOCUS_11560 1309 1394 gene locus_tag LOCUS_t00200 1309 1394 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2119 1400 gene locus_tag LOCUS_11570 2119 1400 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575791.1 protein_id gnl|my_center|LOCUS_11570 2701 2417 gene locus_tag LOCUS_11580 2701 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2819 3331 gene locus_tag LOCUS_11590 2819 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 3405 3974 gene locus_tag LOCUS_11600 3405 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3435 3466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3983 4363 gene locus_tag LOCUS_11610 3983 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263467.1 protein_id gnl|my_center|LOCUS_11610 4360 4743 gene locus_tag LOCUS_11620 4360 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 4883 5998 gene locus_tag LOCUS_11630 gene alr 4883 5998 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682404.1 protein_id gnl|my_center|LOCUS_11630 5929 5936 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7469 6036 gene locus_tag LOCUS_11640 7469 6036 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682395.1 protein_id gnl|my_center|LOCUS_11640 8311 7466 gene locus_tag LOCUS_11650 8311 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 10539 8308 gene locus_tag LOCUS_11660 10539 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 11255 10536 gene locus_tag LOCUS_11670 11255 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 11379 11245 gene locus_tag LOCUS_11680 11379 11245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11680 12125 11382 gene locus_tag LOCUS_11690 12125 11382 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11690 11404 11423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12290 13045 gene locus_tag LOCUS_11700 12290 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 13050 14309 gene locus_tag LOCUS_11710 13050 14309 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080489.1 protein_id gnl|my_center|LOCUS_11710 14337 15296 gene locus_tag LOCUS_11720 gene rfbD 14337 15296 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence049 628 1566 gene locus_tag LOCUS_11730 628 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667094.1 protein_id gnl|my_center|LOCUS_11730 1606 2196 gene locus_tag LOCUS_11740 1606 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11740 2118 2123 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2204 4327 gene locus_tag LOCUS_11750 gene greA 2204 4327 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673498.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11750 4351 5286 gene locus_tag LOCUS_11760 4351 5286 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081221.1 protein_id gnl|my_center|LOCUS_11760 5283 5993 gene locus_tag LOCUS_11770 gene deoC 5283 5993 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130468.1 protein_id gnl|my_center|LOCUS_11770 6347 5997 gene locus_tag LOCUS_11780 6347 5997 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566249.1 protein_id gnl|my_center|LOCUS_11780 6537 9485 gene locus_tag LOCUS_11790 6537 9485 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680747.1 protein_id gnl|my_center|LOCUS_11790 9529 10308 gene locus_tag LOCUS_11800 9529 10308 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673490.1 protein_id gnl|my_center|LOCUS_11800 10334 11791 gene locus_tag LOCUS_11810 10334 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 13285 11837 gene locus_tag LOCUS_11820 gene mtaB 13285 11837 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679581.1 protein_id gnl|my_center|LOCUS_11820 13925 13296 gene locus_tag LOCUS_11830 13925 13296 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679583.1 protein_id gnl|my_center|LOCUS_11830 14318 13956 gene locus_tag LOCUS_11840 14318 13956 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669698.1 protein_id gnl|my_center|LOCUS_11840 <15681 14413 gene locus_tag LOCUS_11850 <15681 14413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957152.1:DEAD/DEAH box helicase >Feature sequence050 2928 1474 gene locus_tag LOCUS_11860 gene nusA 2928 1474 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682413.1 protein_id gnl|my_center|LOCUS_11860 3408 2941 gene locus_tag LOCUS_11870 gene rimP 3408 2941 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670663.1 protein_id gnl|my_center|LOCUS_11870 3618 4208 gene locus_tag LOCUS_11880 3618 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 4250 4897 gene locus_tag LOCUS_11890 4250 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 4917 5945 gene locus_tag LOCUS_11900 gene sppA 4917 5945 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 protein_id gnl|my_center|LOCUS_11900 6547 5936 gene locus_tag LOCUS_11910 6547 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6942 6550 gene locus_tag LOCUS_11920 gene rpsI 6942 6550 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682117.1 protein_id gnl|my_center|LOCUS_11920 7385 6957 gene locus_tag LOCUS_11930 gene rplM 7385 6957 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682116.1 protein_id gnl|my_center|LOCUS_11930 7795 7574 gene locus_tag LOCUS_11940 7795 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 8395 7874 gene locus_tag LOCUS_11950 8395 7874 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_11950 7885 7934 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8837 8505 gene locus_tag LOCUS_11960 8837 8505 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928535.1 protein_id gnl|my_center|LOCUS_11960 9589 8834 gene locus_tag LOCUS_11970 9589 8834 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_11970 9830 11020 gene locus_tag LOCUS_11980 9830 11020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_11980 11017 12036 gene locus_tag LOCUS_11990 11017 12036 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_11990 12033 12905 gene locus_tag LOCUS_12000 12033 12905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627435.1 protein_id gnl|my_center|LOCUS_12000 12961 14004 gene locus_tag LOCUS_12010 12961 14004 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_12010 14140 15531 gene locus_tag LOCUS_12020 gene aroA 14140 15531 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679391.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence051 130 1029 gene locus_tag LOCUS_12030 130 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1026 2315 gene locus_tag LOCUS_12040 1026 2315 CDS product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681017.1 protein_id gnl|my_center|LOCUS_12040 2357 4243 gene locus_tag LOCUS_12050 gene guaA 2357 4243 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_12050 4315 6081 gene locus_tag LOCUS_12060 4315 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6527 6087 gene locus_tag LOCUS_12070 6527 6087 CDS product Holliday junction resolvase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680619.1 protein_id gnl|my_center|LOCUS_12070 6526 7773 gene locus_tag LOCUS_12080 6526 7773 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681866.1 protein_id gnl|my_center|LOCUS_12080 7843 8505 gene locus_tag LOCUS_12090 7843 8505 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384107.1 protein_id gnl|my_center|LOCUS_12090 8483 9187 gene locus_tag LOCUS_12100 8483 9187 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_12100 9204 9956 gene locus_tag LOCUS_12110 9204 9956 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005008.1 protein_id gnl|my_center|LOCUS_12110 10024 10860 gene locus_tag LOCUS_12120 10024 10860 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765262.1 protein_id gnl|my_center|LOCUS_12120 11840 10857 gene locus_tag LOCUS_12130 11840 10857 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680508.1 protein_id gnl|my_center|LOCUS_12130 12226 11837 gene locus_tag LOCUS_12140 12226 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 13961 12228 gene locus_tag LOCUS_12150 gene ilvB 13961 12228 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_12150 <14640 14073 gene locus_tag LOCUS_12160 <14640 14073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393742.1:dihydroxy-acid dehydratase >Feature sequence052 849 52 gene locus_tag LOCUS_12170 849 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1446 865 gene locus_tag LOCUS_12180 1446 865 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_12180 1588 3012 gene locus_tag LOCUS_12190 1588 3012 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666804.1 protein_id gnl|my_center|LOCUS_12190 3153 4298 gene locus_tag LOCUS_12200 3153 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 6210 4495 gene locus_tag LOCUS_12210 6210 4495 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_12210 6768 6277 gene locus_tag LOCUS_12220 6768 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 7218 7330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7331 8308 gene locus_tag LOCUS_12230 7331 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12230 9116 8421 gene locus_tag LOCUS_12240 9116 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 9323 10321 gene locus_tag LOCUS_12250 9323 10321 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518875.1 protein_id gnl|my_center|LOCUS_12250 10373 11572 gene locus_tag LOCUS_12260 10373 11572 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 protein_id gnl|my_center|LOCUS_12260 11828 13150 gene locus_tag LOCUS_12270 11828 13150 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804062.1 protein_id gnl|my_center|LOCUS_12270 13147 13989 gene locus_tag LOCUS_12280 13147 13989 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence053 317 1156 gene locus_tag LOCUS_12290 317 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1727 1146 gene locus_tag LOCUS_12300 1727 1146 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679118.1 protein_id gnl|my_center|LOCUS_12300 2148 1714 gene locus_tag LOCUS_12310 2148 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2375 5455 gene locus_tag LOCUS_12320 2375 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3863 3931 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5545 7050 gene locus_tag LOCUS_12330 5545 7050 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679115.1 protein_id gnl|my_center|LOCUS_12330 7047 8534 gene locus_tag LOCUS_12340 7047 8534 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679114.1 protein_id gnl|my_center|LOCUS_12340 8540 9874 gene locus_tag LOCUS_12350 8540 9874 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679113.1 protein_id gnl|my_center|LOCUS_12350 10489 9884 gene locus_tag LOCUS_12360 10489 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679299.1 protein_id gnl|my_center|LOCUS_12360 11424 10486 gene locus_tag LOCUS_12370 11424 10486 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680709.1 protein_id gnl|my_center|LOCUS_12370 <14147 11456 gene locus_tag LOCUS_12380 <14147 11456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680710.1:isoleucine--tRNA ligase >Feature sequence054 1705 200 gene locus_tag LOCUS_12390 1705 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 3217 1907 gene locus_tag LOCUS_12400 3217 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2952 2977 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3402 4055 gene locus_tag LOCUS_12410 3402 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 5539 4052 gene locus_tag LOCUS_12420 5539 4052 CDS product pallilysin-related adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682100.1 protein_id gnl|my_center|LOCUS_12420 6516 5884 gene locus_tag LOCUS_12430 6516 5884 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670667.1 protein_id gnl|my_center|LOCUS_12430 7826 6594 gene locus_tag LOCUS_12440 gene tyrS 7826 6594 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_12440 8016 7945 gene locus_tag LOCUS_t00210 8016 7945 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8124 8052 gene locus_tag LOCUS_t00220 8124 8052 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8271 8504 gene locus_tag LOCUS_12450 8271 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 8501 8761 gene locus_tag LOCUS_12460 8501 8761 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681985.1 protein_id gnl|my_center|LOCUS_12460 9242 8769 gene locus_tag LOCUS_12470 9242 8769 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_12470 10513 9269 gene locus_tag LOCUS_12480 10513 9269 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_12480 11576 10524 gene locus_tag LOCUS_12490 gene sufD 11576 10524 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_12490 13003 11588 gene locus_tag LOCUS_12500 gene sufB 13003 11588 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_12500 13858 13019 gene locus_tag LOCUS_12510 gene sufC 13858 13019 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence055 211 267 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 357 1631 gene locus_tag LOCUS_12520 357 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1631 2614 gene locus_tag LOCUS_12530 1631 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2599 3150 gene locus_tag LOCUS_12540 2599 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3153 5474 gene locus_tag LOCUS_12550 3153 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 5458 6435 gene locus_tag LOCUS_12560 5458 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 6432 7139 gene locus_tag LOCUS_12570 6432 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 7245 7463 gene locus_tag LOCUS_12580 7245 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 7817 8221 gene locus_tag LOCUS_12590 7817 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 8202 8867 gene locus_tag LOCUS_12600 8202 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 9149 9907 gene locus_tag LOCUS_12610 9149 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 10061 11632 gene locus_tag LOCUS_12620 10061 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 11651 12634 gene locus_tag LOCUS_12630 11651 12634 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_12630 12779 13471 gene locus_tag LOCUS_12640 12779 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence056 252 755 gene locus_tag LOCUS_12650 252 755 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_12650 822 1265 gene locus_tag LOCUS_12660 822 1265 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016851.1 protein_id gnl|my_center|LOCUS_12660 1389 4055 gene locus_tag LOCUS_12670 gene leuS 1389 4055 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680258.1 protein_id gnl|my_center|LOCUS_12670 4056 4988 gene locus_tag LOCUS_12680 4056 4988 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677008.1 protein_id gnl|my_center|LOCUS_12680 6189 5194 gene locus_tag LOCUS_12690 6189 5194 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680981.1 protein_id gnl|my_center|LOCUS_12690 6689 6186 gene locus_tag LOCUS_12700 6689 6186 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_12700 7525 6686 gene locus_tag LOCUS_12710 7525 6686 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_12710 7993 9006 gene locus_tag LOCUS_12720 7993 9006 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724006.1 protein_id gnl|my_center|LOCUS_12720 9343 11172 gene locus_tag LOCUS_12730 gene argS 9343 11172 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682282.1 protein_id gnl|my_center|LOCUS_12730 11455 11874 gene locus_tag LOCUS_12740 gene flgB 11455 11874 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668460.1 protein_id gnl|my_center|LOCUS_12740 11907 12368 gene locus_tag LOCUS_12750 gene flgC 11907 12368 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657104.1 protein_id gnl|my_center|LOCUS_12750 12398 12748 gene locus_tag LOCUS_12760 12398 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 12873 13106 gene locus_tag LOCUS_12770 12873 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 13059 13081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence057 390 315 gene locus_tag LOCUS_t00230 390 315 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2049 520 gene locus_tag LOCUS_12780 2049 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2934 2212 gene locus_tag LOCUS_12790 2934 2212 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_12790 3589 2921 gene locus_tag LOCUS_12800 3589 2921 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_12800 4378 3605 gene locus_tag LOCUS_12810 4378 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 5947 4565 gene locus_tag LOCUS_12820 gene miaB 5947 4565 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679246.1 protein_id gnl|my_center|LOCUS_12820 6153 6512 gene locus_tag LOCUS_12830 6153 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7343 6558 gene locus_tag LOCUS_12840 gene folE2 7343 6558 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_12840 8151 7336 gene locus_tag LOCUS_12850 gene folD 8151 7336 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_12850 8164 8226 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8424 8972 gene locus_tag LOCUS_12860 8424 8972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 8825 8856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8990 9136 gene locus_tag LOCUS_12870 8990 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 9157 10353 gene locus_tag LOCUS_12880 9157 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 10363 12408 gene locus_tag LOCUS_12890 10363 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 12386 12784 gene locus_tag LOCUS_12900 12386 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 12781 13515 gene locus_tag LOCUS_12910 12781 13515 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence058 2011 44 gene locus_tag LOCUS_12920 2011 44 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667114.1 protein_id gnl|my_center|LOCUS_12920 2817 2020 gene locus_tag LOCUS_12930 gene whiG 2817 2020 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_12930 3615 2878 gene locus_tag LOCUS_12940 3615 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4553 3678 gene locus_tag LOCUS_12950 4553 3678 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680723.1 protein_id gnl|my_center|LOCUS_12950 5932 4589 gene locus_tag LOCUS_12960 gene flhF 5932 4589 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957291.1 protein_id gnl|my_center|LOCUS_12960 8051 5925 gene locus_tag LOCUS_12970 gene flhA 8051 5925 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684593.1 protein_id gnl|my_center|LOCUS_12970 9249 8149 gene locus_tag LOCUS_12980 gene flhB 9249 8149 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680909.1 protein_id gnl|my_center|LOCUS_12980 10067 9246 gene locus_tag LOCUS_12990 gene fliR 10067 9246 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673318.1 protein_id gnl|my_center|LOCUS_12990 10338 10069 gene locus_tag LOCUS_13000 gene fliQ 10338 10069 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666830.1 protein_id gnl|my_center|LOCUS_13000 11223 10378 gene locus_tag LOCUS_13010 gene fliP 11223 10378 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680826.1 protein_id gnl|my_center|LOCUS_13010 11909 11220 gene locus_tag LOCUS_13020 11909 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence059 <1 1474 gene locus_tag LOCUS_13030 <1 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679625.1:spiro-SPASM protein 1449 2402 gene locus_tag LOCUS_13040 1449 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679623.1 protein_id gnl|my_center|LOCUS_13040 2417 4951 gene locus_tag LOCUS_13050 2417 4951 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679616.1 protein_id gnl|my_center|LOCUS_13050 4987 6555 gene locus_tag LOCUS_13060 4987 6555 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680053.1 protein_id gnl|my_center|LOCUS_13060 6552 7583 gene locus_tag LOCUS_13070 6552 7583 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679426.1 protein_id gnl|my_center|LOCUS_13070 7586 8050 gene locus_tag LOCUS_13080 7586 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 8179 9264 gene locus_tag LOCUS_13090 8179 9264 CDS product flagellar filament outer layer protein FlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670927.1 protein_id gnl|my_center|LOCUS_13090 9361 10614 gene locus_tag LOCUS_13100 9361 10614 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679418.1 protein_id gnl|my_center|LOCUS_13100 10723 10770 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12146 10944 gene locus_tag LOCUS_13110 12146 10944 CDS product YidE/YbjL duplication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280515.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence060 1795 821 gene locus_tag LOCUS_13120 1795 821 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519085.1 protein_id gnl|my_center|LOCUS_13120 3890 1812 gene locus_tag LOCUS_13130 3890 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4874 3897 gene locus_tag LOCUS_13140 4874 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 5985 4891 gene locus_tag LOCUS_13150 5985 4891 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081376.1 protein_id gnl|my_center|LOCUS_13150 7818 5995 gene locus_tag LOCUS_13160 7818 5995 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_13160 9538 7820 gene locus_tag LOCUS_13170 gene dnaX 9538 7820 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957269.1 protein_id gnl|my_center|LOCUS_13170 10378 9746 gene locus_tag LOCUS_13180 10378 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 10778 10380 gene locus_tag LOCUS_13190 10778 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 11176 10775 gene locus_tag LOCUS_13200 11176 10775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 11798 11169 gene locus_tag LOCUS_13210 11798 11169 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence061 <1 1161 gene locus_tag LOCUS_13220 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680832.1:flagellar hook-length control protein FliK 1177 1626 gene locus_tag LOCUS_13230 gene flgD 1177 1626 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666981.1 protein_id gnl|my_center|LOCUS_13230 1673 3064 gene locus_tag LOCUS_13240 gene flgE 1673 3064 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_13240 3289 3510 gene locus_tag LOCUS_13250 3289 3510 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666823.1 protein_id gnl|my_center|LOCUS_13250 3536 4468 gene locus_tag LOCUS_13260 gene miaA 3536 4468 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680912.1 protein_id gnl|my_center|LOCUS_13260 5828 4449 gene locus_tag LOCUS_13270 5828 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 6526 5825 gene locus_tag LOCUS_13280 6526 5825 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013630.1 protein_id gnl|my_center|LOCUS_13280 6852 7508 gene locus_tag LOCUS_13290 6852 7508 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_13290 7618 7809 gene locus_tag LOCUS_13300 7618 7809 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680829.1 protein_id gnl|my_center|LOCUS_13300 7834 8616 gene locus_tag LOCUS_13310 7834 8616 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666986.1 protein_id gnl|my_center|LOCUS_13310 8635 9357 gene locus_tag LOCUS_13320 gene motB 8635 9357 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666988.1 protein_id gnl|my_center|LOCUS_13320 9448 10002 gene locus_tag LOCUS_13330 9448 10002 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666989.1 protein_id gnl|my_center|LOCUS_13330 10026 10835 gene locus_tag LOCUS_13340 10026 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13340 10766 10827 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10837 11094 gene locus_tag LOCUS_13350 10837 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13350 >Feature sequence062 <1 576 gene locus_tag LOCUS_13360 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680359.1:DNA-directed RNA polymerase subunit beta' 477 506 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 516 3284 gene locus_tag LOCUS_13370 516 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13370 3433 3807 gene locus_tag LOCUS_13380 gene rpsL 3433 3807 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670535.1 protein_id gnl|my_center|LOCUS_13380 3823 4293 gene locus_tag LOCUS_13390 gene rpsG 3823 4293 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670537.1 protein_id gnl|my_center|LOCUS_13390 4953 6140 gene locus_tag LOCUS_13400 gene tuf 4953 6140 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669993.1 protein_id gnl|my_center|LOCUS_13400 6189 6497 gene locus_tag LOCUS_13410 gene rpsJ 6189 6497 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669994.1 protein_id gnl|my_center|LOCUS_13410 6579 7199 gene locus_tag LOCUS_13420 gene rplC 6579 7199 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669995.1 protein_id gnl|my_center|LOCUS_13420 7214 7852 gene locus_tag LOCUS_13430 gene rplD 7214 7852 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669996.1 protein_id gnl|my_center|LOCUS_13430 7852 8136 gene locus_tag LOCUS_13440 7852 8136 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672216.1 protein_id gnl|my_center|LOCUS_13440 8166 8990 gene locus_tag LOCUS_13450 gene rplB 8166 8990 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669998.1 protein_id gnl|my_center|LOCUS_13450 9005 9289 gene locus_tag LOCUS_13460 gene rpsS 9005 9289 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669999.1 protein_id gnl|my_center|LOCUS_13460 9304 9660 gene locus_tag LOCUS_13470 gene rplV 9304 9660 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670000.1 protein_id gnl|my_center|LOCUS_13470 9662 10414 gene locus_tag LOCUS_13480 gene rpsC 9662 10414 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670002.1 protein_id gnl|my_center|LOCUS_13480 10407 10823 gene locus_tag LOCUS_13490 gene rplP 10407 10823 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670003.1 protein_id gnl|my_center|LOCUS_13490 10834 11076 gene locus_tag LOCUS_13500 10834 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 11087 11359 gene locus_tag LOCUS_13510 gene rpsQ 11087 11359 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670009.1 protein_id gnl|my_center|LOCUS_13510 11375 11743 gene locus_tag LOCUS_13520 gene rplN 11375 11743 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670011.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence063 288 362 gene locus_tag LOCUS_t00240 288 362 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 546 1496 gene locus_tag LOCUS_13530 gene argF 546 1496 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080343.1 protein_id gnl|my_center|LOCUS_13530 1519 1962 gene locus_tag LOCUS_13540 1519 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2058 3041 gene locus_tag LOCUS_13550 2058 3041 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679142.1 protein_id gnl|my_center|LOCUS_13550 3393 4307 gene locus_tag LOCUS_13560 3393 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 4367 5017 gene locus_tag LOCUS_13570 gene rdgB 4367 5017 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957197.1 protein_id gnl|my_center|LOCUS_13570 5014 5751 gene locus_tag LOCUS_13580 5014 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13580 5685 5726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5795 6088 gene locus_tag LOCUS_13590 5795 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 6148 7587 gene locus_tag LOCUS_13600 6148 7587 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922333.1 protein_id gnl|my_center|LOCUS_13600 7591 9078 gene locus_tag LOCUS_13610 7591 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 9047 9220 gene locus_tag LOCUS_13620 9047 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 9051 9060 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10337 9222 gene locus_tag LOCUS_13630 10337 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668541.1 protein_id gnl|my_center|LOCUS_13630 11439 10342 gene locus_tag LOCUS_13640 gene ispG 11439 10342 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678768.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence064 1526 39 gene locus_tag LOCUS_13650 gene purF 1526 39 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_13650 2135 1635 gene locus_tag LOCUS_13660 gene purE 2135 1635 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357851.1 protein_id gnl|my_center|LOCUS_13660 4858 2183 gene locus_tag LOCUS_13670 4858 2183 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681534.1 protein_id gnl|my_center|LOCUS_13670 6371 4869 gene locus_tag LOCUS_13680 6371 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920589.1 protein_id gnl|my_center|LOCUS_13680 6360 8324 gene locus_tag LOCUS_13690 gene uvrC 6360 8324 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657940.1 protein_id gnl|my_center|LOCUS_13690 9625 8321 gene locus_tag LOCUS_13700 9625 8321 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779465.1 protein_id gnl|my_center|LOCUS_13700 10647 9751 gene locus_tag LOCUS_13710 10647 9751 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869154.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence065 <1 813 gene locus_tag LOCUS_13720 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002670719.1:chaperonin GroEL 950 2686 gene locus_tag LOCUS_13730 950 2686 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_13730 2925 3125 gene locus_tag LOCUS_13740 2925 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3715 3230 gene locus_tag LOCUS_13750 3715 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4165 3788 gene locus_tag LOCUS_13760 4165 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5053 4190 gene locus_tag LOCUS_13770 5053 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 5952 5053 gene locus_tag LOCUS_13780 5952 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6163 5861 gene locus_tag LOCUS_13790 6163 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13790 7212 6469 gene locus_tag LOCUS_13800 7212 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 7528 7797 gene locus_tag LOCUS_13810 7528 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 7856 8287 gene locus_tag LOCUS_13820 7856 8287 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911311.1 protein_id gnl|my_center|LOCUS_13820 9453 8401 gene locus_tag LOCUS_13830 9453 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 9646 9413 gene locus_tag LOCUS_13840 9646 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 10301 9900 gene locus_tag LOCUS_13850 10301 9900 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_13850 10531 10298 gene locus_tag LOCUS_13860 10531 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 10935 10860 gene locus_tag LOCUS_t00250 10935 10860 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence066 355 798 gene locus_tag LOCUS_13870 355 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 814 2685 gene locus_tag LOCUS_13880 gene flgK 814 2685 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957216.1 protein_id gnl|my_center|LOCUS_13880 2710 3957 gene locus_tag LOCUS_13890 2710 3957 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680271.1 protein_id gnl|my_center|LOCUS_13890 3986 4429 gene locus_tag LOCUS_13900 3986 4429 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_13900 4429 4647 gene locus_tag LOCUS_13910 gene csrA 4429 4647 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667708.1 protein_id gnl|my_center|LOCUS_13910 5350 4667 gene locus_tag LOCUS_13920 5350 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 5798 5352 gene locus_tag LOCUS_13930 gene tsaE 5798 5352 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679136.1 protein_id gnl|my_center|LOCUS_13930 6085 5816 gene locus_tag LOCUS_13940 6085 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 7182 6106 gene locus_tag LOCUS_13950 7182 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 7787 7188 gene locus_tag LOCUS_13960 7787 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 9428 7797 gene locus_tag LOCUS_13970 gene fliD 9428 7797 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679139.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13970 9454 9502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10295 9918 gene locus_tag LOCUS_13980 10295 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence067 210 1631 gene locus_tag LOCUS_13990 210 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1863 3470 gene locus_tag LOCUS_14000 1863 3470 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_14000 3458 4612 gene locus_tag LOCUS_14010 3458 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 5631 4621 gene locus_tag LOCUS_14020 5631 4621 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680474.1 protein_id gnl|my_center|LOCUS_14020 6051 5635 gene locus_tag LOCUS_14030 6051 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 6115 6654 gene locus_tag LOCUS_14040 6115 6654 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791198.1 protein_id gnl|my_center|LOCUS_14040 6644 6925 gene locus_tag LOCUS_14050 6644 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 6975 7046 gene locus_tag LOCUS_t00260 6975 7046 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7203 8888 gene locus_tag LOCUS_14060 7203 8888 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680883.1 protein_id gnl|my_center|LOCUS_14060 9222 8914 gene locus_tag LOCUS_14070 9222 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 9434 9237 gene locus_tag LOCUS_14080 9434 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence068 108 33 gene locus_tag LOCUS_t00270 108 33 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 175 343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1695 343 gene locus_tag LOCUS_r00020 1695 343 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2676 2885 gene locus_tag LOCUS_14090 2676 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2994 3122 gene locus_tag LOCUS_14100 2994 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3196 3546 gene locus_tag LOCUS_14110 3196 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 3561 5030 gene locus_tag LOCUS_14120 3561 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5032 5799 gene locus_tag LOCUS_14130 5032 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 5819 6001 gene locus_tag LOCUS_14140 5819 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 5985 6200 gene locus_tag LOCUS_14150 5985 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 6228 6797 gene locus_tag LOCUS_14160 6228 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 6991 7773 gene locus_tag LOCUS_14170 6991 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 8276 9091 gene locus_tag LOCUS_14180 8276 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 9060 10622 gene locus_tag LOCUS_14190 9060 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence069 239 2473 gene locus_tag LOCUS_14200 239 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 2463 2639 gene locus_tag LOCUS_14210 2463 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 2630 4624 gene locus_tag LOCUS_14220 2630 4624 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_14220 4627 5163 gene locus_tag LOCUS_14230 4627 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5173 6222 gene locus_tag LOCUS_14240 gene rpoD 5173 6222 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 protein_id gnl|my_center|LOCUS_14240 6274 6735 gene locus_tag LOCUS_14250 6274 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062537442.1 protein_id gnl|my_center|LOCUS_14250 6732 7502 gene locus_tag LOCUS_14260 6732 7502 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_14260 7724 10699 gene locus_tag LOCUS_14270 7724 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence070 297 1826 gene locus_tag LOCUS_14280 297 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14280 1882 1980 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2028 3860 gene locus_tag LOCUS_14290 2028 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 3869 4486 gene locus_tag LOCUS_14300 3869 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 4518 7517 gene locus_tag LOCUS_14310 4518 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 8737 7808 gene locus_tag LOCUS_14320 8737 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 8882 8925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9327 9641 gene locus_tag LOCUS_14330 9327 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence071 182 298 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 438 950 gene locus_tag LOCUS_14340 438 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1045 1269 gene locus_tag LOCUS_14350 1045 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1266 1775 gene locus_tag LOCUS_14360 1266 1775 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803082.1 protein_id gnl|my_center|LOCUS_14360 1768 1998 gene locus_tag LOCUS_14370 1768 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2018 5254 gene locus_tag LOCUS_14380 2018 5254 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_14380 6573 5260 gene locus_tag LOCUS_14390 6573 5260 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388984.1 protein_id gnl|my_center|LOCUS_14390 6842 8056 gene locus_tag LOCUS_14400 6842 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 8443 8063 gene locus_tag LOCUS_14410 8443 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 8650 8883 gene locus_tag LOCUS_14420 8650 8883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14420 8883 9185 gene locus_tag LOCUS_14430 8883 9185 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence072 401 1561 gene locus_tag LOCUS_14440 401 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1617 3563 gene locus_tag LOCUS_14450 1617 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 3936 5642 gene locus_tag LOCUS_14460 3936 5642 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682087.1 protein_id gnl|my_center|LOCUS_14460 5639 6769 gene locus_tag LOCUS_14470 5639 6769 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680316.1 protein_id gnl|my_center|LOCUS_14470 6794 8395 gene locus_tag LOCUS_14480 gene murD 6794 8395 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956725.1 protein_id gnl|my_center|LOCUS_14480 8715 9095 gene locus_tag LOCUS_14490 8715 9095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 9115 9774 gene locus_tag LOCUS_14500 9115 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence073 146 1666 gene locus_tag LOCUS_14510 146 1666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920612.1 protein_id gnl|my_center|LOCUS_14510 1663 2808 gene locus_tag LOCUS_14520 1663 2808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679664.1 protein_id gnl|my_center|LOCUS_14520 2805 3737 gene locus_tag LOCUS_14530 2805 3737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044979586.1 protein_id gnl|my_center|LOCUS_14530 3758 4639 gene locus_tag LOCUS_14540 3758 4639 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932949.1 protein_id gnl|my_center|LOCUS_14540 4916 4719 gene locus_tag LOCUS_14550 4916 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 5081 5926 gene locus_tag LOCUS_14560 5081 5926 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897033.1 protein_id gnl|my_center|LOCUS_14560 5977 6702 gene locus_tag LOCUS_14570 5977 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 7362 6901 gene locus_tag LOCUS_14580 7362 6901 CDS product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966759.1 protein_id gnl|my_center|LOCUS_14580 7567 8376 gene locus_tag LOCUS_14590 7567 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 8394 9335 gene locus_tag LOCUS_14600 8394 9335 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence074 491 90 gene locus_tag LOCUS_14610 491 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2143 488 gene locus_tag LOCUS_14620 2143 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14620 567 613 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2252 3127 gene locus_tag LOCUS_14630 2252 3127 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000530036.1 protein_id gnl|my_center|LOCUS_14630 3750 3923 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5728 3962 gene locus_tag LOCUS_14640 gene asnB 5728 3962 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202957.1 protein_id gnl|my_center|LOCUS_14640 6093 6518 gene locus_tag LOCUS_14650 6093 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14650 6477 6495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6523 6789 gene locus_tag LOCUS_14660 6523 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14660 6887 8101 gene locus_tag LOCUS_14670 6887 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 8446 8532 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence075 739 806 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1110 826 gene locus_tag LOCUS_14680 1110 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1233 2342 gene locus_tag LOCUS_14690 gene purM 1233 2342 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099415.1 protein_id gnl|my_center|LOCUS_14690 2335 2961 gene locus_tag LOCUS_14700 gene purN 2335 2961 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 protein_id gnl|my_center|LOCUS_14700 3674 2958 gene locus_tag LOCUS_14710 3674 2958 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_14710 5148 3676 gene locus_tag LOCUS_14720 5148 3676 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674553.1 protein_id gnl|my_center|LOCUS_14720 5291 5330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5352 7400 gene locus_tag LOCUS_14730 5352 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 7640 7885 gene locus_tag LOCUS_14740 7640 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 7915 9810 gene locus_tag LOCUS_14750 gene oadA 7915 9810 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_14750 9592 9668 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence076 2949 2167 gene locus_tag LOCUS_14760 2949 2167 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678735.1 protein_id gnl|my_center|LOCUS_14760 3452 2958 gene locus_tag LOCUS_14770 gene ybeY 3452 2958 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668517.1 protein_id gnl|my_center|LOCUS_14770 5281 3452 gene locus_tag LOCUS_14780 5281 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6260 5268 gene locus_tag LOCUS_14790 6260 5268 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678733.1 protein_id gnl|my_center|LOCUS_14790 6890 6270 gene locus_tag LOCUS_14800 6890 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669375.1 protein_id gnl|my_center|LOCUS_14800 9669 6931 gene locus_tag LOCUS_14810 9669 6931 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678931.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence077 <1 864 gene locus_tag LOCUS_14820 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002675346.1:sigma-54 dependent transcriptional regulator 857 1273 gene locus_tag LOCUS_14830 857 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 2109 1276 gene locus_tag LOCUS_14840 2109 1276 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 protein_id gnl|my_center|LOCUS_14840 2257 3663 gene locus_tag LOCUS_14850 gene xylB 2257 3663 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036931.1 protein_id gnl|my_center|LOCUS_14850 3687 3701 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3811 5124 gene locus_tag LOCUS_14860 gene xylA 3811 5124 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_14860 5401 6900 gene locus_tag LOCUS_14870 gene murC 5401 6900 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956876.1 protein_id gnl|my_center|LOCUS_14870 6910 7779 gene locus_tag LOCUS_14880 6910 7779 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682397.1 protein_id gnl|my_center|LOCUS_14880 7822 8382 gene locus_tag LOCUS_14890 7822 8382 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682399.1 protein_id gnl|my_center|LOCUS_14890 9001 8453 gene locus_tag LOCUS_14900 9001 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14900 9491 8976 gene locus_tag LOCUS_14910 9491 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14910 9041 9081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence078 811 74 gene locus_tag LOCUS_14920 811 74 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678965.1 protein_id gnl|my_center|LOCUS_14920 1888 848 gene locus_tag LOCUS_14930 1888 848 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_14930 2514 1987 gene locus_tag LOCUS_14940 2514 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2910 2572 gene locus_tag LOCUS_14950 2910 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667116.1 protein_id gnl|my_center|LOCUS_14950 4308 3013 gene locus_tag LOCUS_14960 4308 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 5098 4310 gene locus_tag LOCUS_14970 5098 4310 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679546.1 protein_id gnl|my_center|LOCUS_14970 6434 5148 gene locus_tag LOCUS_14980 6434 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 7855 6434 gene locus_tag LOCUS_14990 7855 6434 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679548.1 protein_id gnl|my_center|LOCUS_14990 <9491 7964 gene locus_tag LOCUS_15000 <9491 7964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963596.1:2-isopropylmalate synthase >Feature sequence079 <1 1327 gene locus_tag LOCUS_15010 <1 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903830.1:homocysteine S-methyltransferase family protein 1324 2262 gene locus_tag LOCUS_15020 1324 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 3078 2287 gene locus_tag LOCUS_15030 3078 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 3987 3079 gene locus_tag LOCUS_15040 3987 3079 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681782.1 protein_id gnl|my_center|LOCUS_15040 4940 4200 gene locus_tag LOCUS_15050 gene deoD 4940 4200 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681557.1 protein_id gnl|my_center|LOCUS_15050 5504 4968 gene locus_tag LOCUS_15060 5504 4968 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678446.1 protein_id gnl|my_center|LOCUS_15060 5794 6273 gene locus_tag LOCUS_15070 5794 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 6270 7211 gene locus_tag LOCUS_15080 6270 7211 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676765.1 protein_id gnl|my_center|LOCUS_15080 7214 9355 gene locus_tag LOCUS_15090 7214 9355 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681441.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence080 268 17 gene locus_tag LOCUS_15100 268 17 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_15100 760 1308 gene locus_tag LOCUS_15110 760 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1901 1341 gene locus_tag LOCUS_15120 1901 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2734 2000 gene locus_tag LOCUS_15130 gene vraR 2734 2000 CDS product two-component system response regulator VraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153535.1 protein_id gnl|my_center|LOCUS_15130 3728 2712 gene locus_tag LOCUS_15140 3728 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 3859 4254 gene locus_tag LOCUS_15150 3859 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 5596 4394 gene locus_tag LOCUS_15160 5596 4394 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_15160 5932 6660 gene locus_tag LOCUS_15170 5932 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 6695 7603 gene locus_tag LOCUS_15180 6695 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 8080 7910 gene locus_tag LOCUS_15190 8080 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 8310 8774 gene locus_tag LOCUS_15200 gene tnpA 8310 8774 CDS product IS200/IS605-like element ISMac7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020315.1 protein_id gnl|my_center|LOCUS_15200 8764 9339 gene locus_tag LOCUS_15210 8764 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence081 <1 1308 gene locus_tag LOCUS_15220 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546740.1:pyruvate, phosphate dikinase 1416 2210 gene locus_tag LOCUS_15230 1416 2210 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682046.1 protein_id gnl|my_center|LOCUS_15230 2700 2146 gene locus_tag LOCUS_15240 2700 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2812 3168 gene locus_tag LOCUS_15250 2812 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 4021 3293 gene locus_tag LOCUS_15260 4021 3293 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_15260 5968 4055 gene locus_tag LOCUS_15270 5968 4055 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049207.1 protein_id gnl|my_center|LOCUS_15270 7197 6067 gene locus_tag LOCUS_15280 7197 6067 CDS product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 protein_id gnl|my_center|LOCUS_15280 <8953 7299 gene locus_tag LOCUS_15290 <8953 7299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680731.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence082 1298 12 gene locus_tag LOCUS_15300 1298 12 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_15300 2317 1373 gene locus_tag LOCUS_15310 2317 1373 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_15310 2533 2324 gene locus_tag LOCUS_15320 2533 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3631 2603 gene locus_tag LOCUS_15330 gene rlmN 3631 2603 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679871.1 protein_id gnl|my_center|LOCUS_15330 4788 3643 gene locus_tag LOCUS_15340 4788 3643 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679870.1 protein_id gnl|my_center|LOCUS_15340 5141 4803 gene locus_tag LOCUS_15350 5141 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668283.1 protein_id gnl|my_center|LOCUS_15350 5787 5218 gene locus_tag LOCUS_15360 gene rsmD 5787 5218 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669684.1 protein_id gnl|my_center|LOCUS_15360 7079 5790 gene locus_tag LOCUS_15370 7079 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence083 2 595 gene locus_tag LOCUS_15380 2 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 652 1692 gene locus_tag LOCUS_15390 652 1692 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587069.1 protein_id gnl|my_center|LOCUS_15390 1689 2405 gene locus_tag LOCUS_15400 1689 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2475 3137 gene locus_tag LOCUS_15410 gene pth 2475 3137 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672368.1 protein_id gnl|my_center|LOCUS_15410 3152 3988 gene locus_tag LOCUS_15420 gene mazG 3152 3988 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680184.1 protein_id gnl|my_center|LOCUS_15420 4040 4651 gene locus_tag LOCUS_15430 4040 4651 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667667.1 protein_id gnl|my_center|LOCUS_15430 4662 5591 gene locus_tag LOCUS_15440 4662 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 5662 6522 gene locus_tag LOCUS_15450 5662 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 6519 7184 gene locus_tag LOCUS_15460 6519 7184 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680333.1 protein_id gnl|my_center|LOCUS_15460 8422 7325 gene locus_tag LOCUS_15470 8422 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15470 8390 8411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence084 30 347 gene locus_tag LOCUS_15480 30 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 378 638 gene locus_tag LOCUS_15490 gene rpmA 378 638 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669471.1 protein_id gnl|my_center|LOCUS_15490 740 1861 gene locus_tag LOCUS_15500 gene obgE 740 1861 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679468.1 protein_id gnl|my_center|LOCUS_15500 1864 2520 gene locus_tag LOCUS_15510 gene nadD 1864 2520 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656094.1 protein_id gnl|my_center|LOCUS_15510 2504 3112 gene locus_tag LOCUS_15520 2504 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15520 3131 4354 gene locus_tag LOCUS_15530 3131 4354 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669467.1 protein_id gnl|my_center|LOCUS_15530 4361 4708 gene locus_tag LOCUS_15540 gene rsfS 4361 4708 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679464.1 protein_id gnl|my_center|LOCUS_15540 5705 4713 gene locus_tag LOCUS_15550 5705 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 5914 5705 gene locus_tag LOCUS_15560 5914 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15560 6769 6197 gene locus_tag LOCUS_15570 6769 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15570 6893 7342 gene locus_tag LOCUS_15580 6893 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 7329 8330 gene locus_tag LOCUS_15590 7329 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 8281 8287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence085 <1 1878 gene locus_tag LOCUS_15600 <1 1878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678907.1:RNA polymerase sigma factor RpoD 1958 2821 gene locus_tag LOCUS_15610 1958 2821 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671470.1 protein_id gnl|my_center|LOCUS_15610 3289 4251 gene locus_tag LOCUS_15620 3289 4251 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678909.1 protein_id gnl|my_center|LOCUS_15620 4289 5341 gene locus_tag LOCUS_15630 4289 5341 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668696.1 protein_id gnl|my_center|LOCUS_15630 5362 6240 gene locus_tag LOCUS_15640 gene mreC 5362 6240 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668697.1 protein_id gnl|my_center|LOCUS_15640 6529 6158 gene locus_tag LOCUS_15650 6529 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence086 200 1519 gene locus_tag LOCUS_15660 gene rodA 200 1519 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677908.1 protein_id gnl|my_center|LOCUS_15660 1516 4239 gene locus_tag LOCUS_15670 1516 4239 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545608.1 protein_id gnl|my_center|LOCUS_15670 6182 4464 gene locus_tag LOCUS_15680 6182 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15680 4469 4480 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8190 6163 gene locus_tag LOCUS_15690 8190 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15690 >Feature sequence087 50 328 gene locus_tag LOCUS_15700 50 328 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_15700 581 856 gene locus_tag LOCUS_15710 581 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 929 1002 gene locus_tag LOCUS_t00280 929 1002 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1010 1084 gene locus_tag LOCUS_t00290 1010 1084 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1271 1345 gene locus_tag LOCUS_t00300 1271 1345 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1398 1574 gene locus_tag LOCUS_15720 1398 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1631 2668 gene locus_tag LOCUS_15730 1631 2668 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_15730 2675 3229 gene locus_tag LOCUS_15740 2675 3229 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797917.1 protein_id gnl|my_center|LOCUS_15740 3248 4363 gene locus_tag LOCUS_15750 3248 4363 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679607.1 protein_id gnl|my_center|LOCUS_15750 5804 4350 gene locus_tag LOCUS_15760 5804 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 6104 5889 gene locus_tag LOCUS_15770 gene rpmE 6104 5889 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_15770 6258 6962 gene locus_tag LOCUS_15780 6258 6962 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_15780 7081 8301 gene locus_tag LOCUS_15790 7081 8301 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680626.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence088 374 9 gene locus_tag LOCUS_15800 374 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1506 511 gene locus_tag LOCUS_15810 1506 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2408 1587 gene locus_tag LOCUS_15820 2408 1587 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263382.1 protein_id gnl|my_center|LOCUS_15820 6701 2634 gene locus_tag LOCUS_15830 6701 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 7686 6703 gene locus_tag LOCUS_15840 7686 6703 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109063.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence089 957 220 gene locus_tag LOCUS_15850 957 220 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674261.1 protein_id gnl|my_center|LOCUS_15850 1629 1027 gene locus_tag LOCUS_15860 1629 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2395 1727 gene locus_tag LOCUS_15870 2395 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 2550 3047 gene locus_tag LOCUS_15880 gene coaD 2550 3047 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678956.1 protein_id gnl|my_center|LOCUS_15880 3196 3384 gene locus_tag LOCUS_15890 gene rpmF 3196 3384 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670496.1 protein_id gnl|my_center|LOCUS_15890 3399 3635 gene locus_tag LOCUS_15900 gene acpP 3399 3635 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670497.1 protein_id gnl|my_center|LOCUS_15900 3789 4535 gene locus_tag LOCUS_15910 gene rnc 3789 4535 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_15910 5944 4541 gene locus_tag LOCUS_15920 5944 4541 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_15920 5985 6671 gene locus_tag LOCUS_15930 5985 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 7347 7381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence090 93 410 gene locus_tag LOCUS_15940 93 410 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_15940 414 719 gene locus_tag LOCUS_15950 414 719 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005643896.1 protein_id gnl|my_center|LOCUS_15950 938 967 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2539 1043 gene locus_tag LOCUS_15960 2539 1043 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_15960 4292 2670 gene locus_tag LOCUS_15970 4292 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 5293 4289 gene locus_tag LOCUS_15980 gene hflC 5293 4289 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_15980 6254 5277 gene locus_tag LOCUS_15990 gene hflK 6254 5277 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_15990 7509 6280 gene locus_tag LOCUS_16000 7509 6280 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence091 3474 289 gene locus_tag LOCUS_16010 3474 289 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_16010 3096 3122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4431 3478 gene locus_tag LOCUS_16020 4431 3478 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658190.1 protein_id gnl|my_center|LOCUS_16020 5848 4433 gene locus_tag LOCUS_16030 5848 4433 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665464.1 protein_id gnl|my_center|LOCUS_16030 7137 5845 gene locus_tag LOCUS_16040 7137 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence092 10 846 gene locus_tag LOCUS_16050 10 846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_16050 833 1543 gene locus_tag LOCUS_16060 833 1543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_16060 1546 2190 gene locus_tag LOCUS_16070 1546 2190 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_16070 2307 2380 gene locus_tag LOCUS_t00310 2307 2380 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2545 3090 gene locus_tag LOCUS_16080 2545 3090 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_16080 3107 3889 gene locus_tag LOCUS_16090 3107 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 4469 3891 gene locus_tag LOCUS_16100 4469 3891 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673829.1 protein_id gnl|my_center|LOCUS_16100 4552 5796 gene locus_tag LOCUS_16110 4552 5796 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667421.1 protein_id gnl|my_center|LOCUS_16110 5814 6656 gene locus_tag LOCUS_16120 5814 6656 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107810.1 protein_id gnl|my_center|LOCUS_16120 7009 6653 gene locus_tag LOCUS_16130 7009 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 7132 7353 gene locus_tag LOCUS_16140 gene infA 7132 7353 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668257.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence093 1121 471 gene locus_tag LOCUS_16150 1121 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1202 2317 gene locus_tag LOCUS_16160 1202 2317 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678853.1 protein_id gnl|my_center|LOCUS_16160 2388 3548 gene locus_tag LOCUS_16170 2388 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3542 4807 gene locus_tag LOCUS_16180 3542 4807 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956948.1 protein_id gnl|my_center|LOCUS_16180 4824 5711 gene locus_tag LOCUS_16190 gene rsmA 4824 5711 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682389.1 protein_id gnl|my_center|LOCUS_16190 5715 6431 gene locus_tag LOCUS_16200 5715 6431 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_16200 6409 6921 gene locus_tag LOCUS_16210 6409 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682391.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence094 1988 882 gene locus_tag LOCUS_16220 1988 882 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755866.1 protein_id gnl|my_center|LOCUS_16220 2447 1992 gene locus_tag LOCUS_16230 2447 1992 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689706.1 protein_id gnl|my_center|LOCUS_16230 2673 3113 gene locus_tag LOCUS_16240 2673 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 3153 4124 gene locus_tag LOCUS_16250 3153 4124 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786554.1 protein_id gnl|my_center|LOCUS_16250 4186 4932 gene locus_tag LOCUS_16260 gene fabG 4186 4932 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_16260 5179 5667 gene locus_tag LOCUS_16270 5179 5667 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_16270 5710 6159 gene locus_tag LOCUS_16280 5710 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 6545 7144 gene locus_tag LOCUS_16290 6545 7144 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence095 269 808 gene locus_tag LOCUS_16300 269 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666906.1 protein_id gnl|my_center|LOCUS_16300 818 2077 gene locus_tag LOCUS_16310 818 2077 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583659.1 protein_id gnl|my_center|LOCUS_16310 4523 2226 gene locus_tag LOCUS_16320 gene pheT 4523 2226 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957104.1 protein_id gnl|my_center|LOCUS_16320 5400 4636 gene locus_tag LOCUS_16330 gene trpA 5400 4636 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_16330 6693 5419 gene locus_tag LOCUS_16340 gene trpB 6693 5419 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947035.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence096 243 920 gene locus_tag LOCUS_16350 gene rplA 243 920 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667601.1 protein_id gnl|my_center|LOCUS_16350 920 1516 gene locus_tag LOCUS_16360 gene rplJ 920 1516 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680363.1 protein_id gnl|my_center|LOCUS_16360 1683 2057 gene locus_tag LOCUS_16370 gene rplL 1683 2057 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466152.1 protein_id gnl|my_center|LOCUS_16370 2298 5855 gene locus_tag LOCUS_16380 gene rpoB 2298 5855 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680361.1 protein_id gnl|my_center|LOCUS_16380 5848 6861 gene locus_tag LOCUS_16390 5848 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16390 >Feature sequence097 551 4159 gene locus_tag LOCUS_16400 551 4159 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109349.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence098 54 1454 gene locus_tag LOCUS_16410 54 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1478 3475 gene locus_tag LOCUS_16420 1478 3475 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_16420 4096 3599 gene locus_tag LOCUS_16430 4096 3599 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674498.1 protein_id gnl|my_center|LOCUS_16430 5666 4362 gene locus_tag LOCUS_16440 5666 4362 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_16440 <6774 5850 gene locus_tag LOCUS_16450 <6774 5850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680159.1:formylglycine-generating enzyme family protein >Feature sequence099 484 2253 gene locus_tag LOCUS_16460 484 2253 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_16460 2253 3548 gene locus_tag LOCUS_16470 2253 3548 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_16470 3573 3905 gene locus_tag LOCUS_16480 3573 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16480 3880 4191 gene locus_tag LOCUS_16490 3880 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16490 3888 3892 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4191 6122 gene locus_tag LOCUS_16500 4191 6122 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003276.1 protein_id gnl|my_center|LOCUS_16500 6193 6615 gene locus_tag LOCUS_16510 6193 6615 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669353.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence100 <1 1090 gene locus_tag LOCUS_16520 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682289.1:SUMF1/EgtB/PvdO family nonheme iron enzyme 1380 1472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2007 1675 gene locus_tag LOCUS_16530 2007 1675 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861913.1 protein_id gnl|my_center|LOCUS_16530 2542 2015 gene locus_tag LOCUS_16540 2542 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 2653 2699 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3403 2804 gene locus_tag LOCUS_16550 3403 2804 CDS product DUF6434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247875.1 protein_id gnl|my_center|LOCUS_16550 3577 3702 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3833 3838 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3893 5743 gene locus_tag LOCUS_16560 3893 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 <6553 5948 gene locus_tag LOCUS_16570 <6553 5948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111014.1:aminoglycoside 6-adenylyltransferase >Feature sequence101 <1 727 gene locus_tag LOCUS_16580 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679730.1:ATP-dependent DNA helicase 1441 731 gene locus_tag LOCUS_16590 1441 731 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361291.1 protein_id gnl|my_center|LOCUS_16590 1589 2209 gene locus_tag LOCUS_16600 1589 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2221 3198 gene locus_tag LOCUS_16610 2221 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4326 3226 gene locus_tag LOCUS_16620 4326 3226 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658381.1 protein_id gnl|my_center|LOCUS_16620 5684 4347 gene locus_tag LOCUS_16630 gene serS 5684 4347 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680220.1 protein_id gnl|my_center|LOCUS_16630 6412 5717 gene locus_tag LOCUS_16640 6412 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence102 2651 831 gene locus_tag LOCUS_16650 2651 831 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680511.1 protein_id gnl|my_center|LOCUS_16650 2848 2681 gene locus_tag LOCUS_16660 2848 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2798 4087 gene locus_tag LOCUS_16670 2798 4087 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_16670 4289 6385 gene locus_tag LOCUS_16680 4289 6385 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680844.1 protein_id gnl|my_center|LOCUS_16680 6134 6279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence103 638 976 gene locus_tag LOCUS_16690 638 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 762 782 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1083 3758 gene locus_tag LOCUS_16700 1083 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 4357 3734 gene locus_tag LOCUS_16710 4357 3734 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109176.1 protein_id gnl|my_center|LOCUS_16710 4435 5718 gene locus_tag LOCUS_16720 4435 5718 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_16720 5733 6173 gene locus_tag LOCUS_16730 5733 6173 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence104 167 174 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 508 533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 569 772 gene locus_tag LOCUS_16740 569 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 723 734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 769 984 gene locus_tag LOCUS_16750 769 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1108 941 gene locus_tag LOCUS_16760 1108 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1588 2382 gene locus_tag LOCUS_16770 1588 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2636 3706 gene locus_tag LOCUS_16780 2636 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3727 4209 gene locus_tag LOCUS_16790 3727 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 4233 4451 gene locus_tag LOCUS_16800 4233 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 4510 5541 gene locus_tag LOCUS_16810 4510 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 5632 5859 gene locus_tag LOCUS_16820 5632 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 5863 5884 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence105 1290 67 gene locus_tag LOCUS_16830 1290 67 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_16830 4027 1319 gene locus_tag LOCUS_16840 4027 1319 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679058.1 protein_id gnl|my_center|LOCUS_16840 4212 5162 gene locus_tag LOCUS_16850 4212 5162 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_16850 5300 5692 gene locus_tag LOCUS_16860 5300 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence106 79 582 gene locus_tag LOCUS_16870 79 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 579 950 gene locus_tag LOCUS_16880 579 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 970 997 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1347 2054 gene locus_tag LOCUS_16890 1347 2054 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_16890 2288 2731 gene locus_tag LOCUS_16900 2288 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2784 4754 gene locus_tag LOCUS_16910 2784 4754 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802731.1 protein_id gnl|my_center|LOCUS_16910 5094 4888 gene locus_tag LOCUS_16920 5094 4888 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_16920 5682 5107 gene locus_tag LOCUS_16930 5682 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence107 1978 644 gene locus_tag LOCUS_16940 gene secY 1978 644 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670031.1 protein_id gnl|my_center|LOCUS_16940 2467 1994 gene locus_tag LOCUS_16950 gene rplO 2467 1994 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682039.1 protein_id gnl|my_center|LOCUS_16950 2649 2467 gene locus_tag LOCUS_16960 gene rpmD 2649 2467 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 protein_id gnl|my_center|LOCUS_16960 3164 2652 gene locus_tag LOCUS_16970 gene rpsE 3164 2652 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670027.1 protein_id gnl|my_center|LOCUS_16970 3535 3173 gene locus_tag LOCUS_16980 gene rplR 3535 3173 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670026.1 protein_id gnl|my_center|LOCUS_16980 4089 3547 gene locus_tag LOCUS_16990 gene rplF 4089 3547 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656835.1 protein_id gnl|my_center|LOCUS_16990 4599 4102 gene locus_tag LOCUS_17000 gene rpsH 4599 4102 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670022.1 protein_id gnl|my_center|LOCUS_17000 4803 4618 gene locus_tag LOCUS_17010 4803 4618 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557082.1 protein_id gnl|my_center|LOCUS_17010 4960 4993 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5333 5462 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence108 857 180 gene locus_tag LOCUS_17020 857 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1162 854 gene locus_tag LOCUS_17030 1162 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2876 1527 gene locus_tag LOCUS_17040 2876 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 4924 2939 gene locus_tag LOCUS_17050 4924 2939 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence109 1016 1063 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1303 1488 gene locus_tag LOCUS_17060 1303 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1921 1493 gene locus_tag LOCUS_17070 1921 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2274 3431 gene locus_tag LOCUS_17080 2274 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3435 4400 gene locus_tag LOCUS_17090 3435 4400 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679909.1 protein_id gnl|my_center|LOCUS_17090 5068 4523 gene locus_tag LOCUS_17100 5068 4523 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence110 800 438 gene locus_tag LOCUS_17110 800 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1029 814 gene locus_tag LOCUS_17120 1029 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1644 1189 gene locus_tag LOCUS_17130 1644 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2189 1653 gene locus_tag LOCUS_17140 2189 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 2513 2298 gene locus_tag LOCUS_17150 2513 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 3706 2510 gene locus_tag LOCUS_17160 3706 2510 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_17160 4401 3778 gene locus_tag LOCUS_17170 4401 3778 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461761.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence111 1079 606 gene locus_tag LOCUS_17180 1079 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1901 1089 gene locus_tag LOCUS_17190 gene trmD 1901 1089 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670221.1 protein_id gnl|my_center|LOCUS_17190 2512 1907 gene locus_tag LOCUS_17200 gene rimM 2512 1907 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670218.1 protein_id gnl|my_center|LOCUS_17200 2745 2512 gene locus_tag LOCUS_17210 2745 2512 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_17210 3029 2763 gene locus_tag LOCUS_17220 gene rpsP 3029 2763 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670213.1 protein_id gnl|my_center|LOCUS_17220 3271 4455 gene locus_tag LOCUS_17230 3271 4455 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680060.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence112 220 251 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 524 1297 gene locus_tag LOCUS_17240 524 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1294 1725 gene locus_tag LOCUS_17250 1294 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1736 1984 gene locus_tag LOCUS_17260 1736 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2154 3296 gene locus_tag LOCUS_17270 2154 3296 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_17270 3418 4308 gene locus_tag LOCUS_17280 3418 4308 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642246.1 protein_id gnl|my_center|LOCUS_17280 4319 5335 gene locus_tag LOCUS_17290 4319 5335 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence113 <1 1161 gene locus_tag LOCUS_17300 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000573847.1:DNA cytosine methyltransferase 1158 2243 gene locus_tag LOCUS_17310 1158 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2249 3937 gene locus_tag LOCUS_17320 2249 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 3937 5151 gene locus_tag LOCUS_17330 3937 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence114 183 276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1834 542 gene locus_tag LOCUS_17340 1834 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2801 1839 gene locus_tag LOCUS_17350 2801 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4221 2803 gene locus_tag LOCUS_17360 4221 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4962 4312 gene locus_tag LOCUS_17370 4962 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence115 1448 534 gene locus_tag LOCUS_17380 1448 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 627 713 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1574 2374 gene locus_tag LOCUS_17390 1574 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2443 3918 gene locus_tag LOCUS_17400 2443 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 3819 3865 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3873 4196 gene locus_tag LOCUS_17410 3873 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17410 4798 4373 gene locus_tag LOCUS_17420 4798 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 4819 4923 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence116 2947 1808 gene locus_tag LOCUS_17430 gene aepY 2947 1808 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679014.1 protein_id gnl|my_center|LOCUS_17430 4481 3180 gene locus_tag LOCUS_17440 gene aepX 4481 3180 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679012.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence117 220 1548 gene locus_tag LOCUS_17450 gene dnaB 220 1548 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669313.1 protein_id gnl|my_center|LOCUS_17450 1622 2563 gene locus_tag LOCUS_17460 1622 2563 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669065.1 protein_id gnl|my_center|LOCUS_17460 2560 3636 gene locus_tag LOCUS_17470 gene mltG 2560 3636 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671179.1 protein_id gnl|my_center|LOCUS_17470 2777 2793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3643 3972 gene locus_tag LOCUS_17480 3643 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17480 3917 3939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence118 765 415 gene locus_tag LOCUS_17490 765 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 994 2508 gene locus_tag LOCUS_17500 994 2508 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016392.1 protein_id gnl|my_center|LOCUS_17500 2510 3442 gene locus_tag LOCUS_17510 2510 3442 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016393.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence119 767 24 gene locus_tag LOCUS_17520 767 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 787 799 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1842 1063 gene locus_tag LOCUS_17530 1842 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2375 1875 gene locus_tag LOCUS_17540 2375 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2763 2377 gene locus_tag LOCUS_17550 2763 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 3213 2794 gene locus_tag LOCUS_17560 3213 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3419 3117 gene locus_tag LOCUS_17570 3419 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 3781 3817 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4521 3967 gene locus_tag LOCUS_17580 4521 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 4546 4577 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence120 1419 1724 gene locus_tag LOCUS_17590 1419 1724 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_17590 1728 2033 gene locus_tag LOCUS_17600 1728 2033 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005643896.1 protein_id gnl|my_center|LOCUS_17600 2238 3512 gene locus_tag LOCUS_17610 2238 3512 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence121 2894 1494 gene locus_tag LOCUS_17620 2894 1494 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672386.1 protein_id gnl|my_center|LOCUS_17620 4174 3029 gene locus_tag LOCUS_17630 gene dnaJ 4174 3029 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002686888.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence122 1994 15 gene locus_tag LOCUS_17640 1994 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 130 175 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4236 2098 gene locus_tag LOCUS_17650 gene glgX 4236 2098 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680950.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence123 160 1473 gene locus_tag LOCUS_17660 160 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1466 2287 gene locus_tag LOCUS_17670 gene istB 1466 2287 CDS product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021079.1 protein_id gnl|my_center|LOCUS_17670 2450 3190 gene locus_tag LOCUS_17680 2450 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3499 3864 gene locus_tag LOCUS_17690 3499 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence124 540 598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1901 690 gene locus_tag LOCUS_17700 1901 690 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674469.1 protein_id gnl|my_center|LOCUS_17700 2219 3247 gene locus_tag LOCUS_17710 2219 3247 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_17710 3728 3300 gene locus_tag LOCUS_17720 3728 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 <4597 3833 gene locus_tag LOCUS_17730 <4597 3833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082399.1:glycosyl transferase >Feature sequence125 1563 154 gene locus_tag LOCUS_17740 1563 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1696 1769 gene locus_tag LOCUS_t00320 1696 1769 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1829 2302 gene locus_tag LOCUS_17750 1829 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2312 2327 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3439 2342 gene locus_tag LOCUS_17760 gene rpsA 3439 2342 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_17760 3520 3999 gene locus_tag LOCUS_17770 3520 3999 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058223026.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence126 1540 680 gene locus_tag LOCUS_17780 1540 680 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668952.1 protein_id gnl|my_center|LOCUS_17780 2788 1733 gene locus_tag LOCUS_17790 2788 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 3982 2798 gene locus_tag LOCUS_17800 gene ugd 3982 2798 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706040.1 protein_id gnl|my_center|LOCUS_17800 4241 4168 gene locus_tag LOCUS_t00330 4241 4168 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence127 114 449 gene locus_tag LOCUS_17810 114 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17810 366 378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 569 1480 gene locus_tag LOCUS_17820 569 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17820 1646 2554 gene locus_tag LOCUS_17830 gene pyrF 1646 2554 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361662.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence128 120 47 gene locus_tag LOCUS_t00340 120 47 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1202 168 gene locus_tag LOCUS_17840 1202 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2596 1190 gene locus_tag LOCUS_17850 2596 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 3269 2664 gene locus_tag LOCUS_17860 gene lpoB 3269 2664 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706416.1 protein_id gnl|my_center|LOCUS_17860 4034 3270 gene locus_tag LOCUS_17870 4034 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence129 625 221 gene locus_tag LOCUS_17880 625 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 858 3053 gene locus_tag LOCUS_17890 858 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17890 3083 3901 gene locus_tag LOCUS_17900 3083 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17900 >Feature sequence130 248 568 gene locus_tag LOCUS_17910 248 568 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948666.1 protein_id gnl|my_center|LOCUS_17910 644 928 gene locus_tag LOCUS_17920 644 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1298 1513 gene locus_tag LOCUS_17930 1298 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1500 1934 gene locus_tag LOCUS_17940 1500 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2033 2596 gene locus_tag LOCUS_17950 2033 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 2610 3341 gene locus_tag LOCUS_17960 2610 3341 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948434.1 protein_id gnl|my_center|LOCUS_17960 3392 3934 gene locus_tag LOCUS_17970 3392 3934 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence131 840 142 gene locus_tag LOCUS_17980 840 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1681 1229 gene locus_tag LOCUS_17990 1681 1229 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680453.1 protein_id gnl|my_center|LOCUS_17990 2275 1838 gene locus_tag LOCUS_18000 2275 1838 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816860.1 protein_id gnl|my_center|LOCUS_18000 3307 2516 gene locus_tag LOCUS_18010 3307 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3665 3862 gene locus_tag LOCUS_18020 3665 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence132 162 1589 gene locus_tag LOCUS_18030 162 1589 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417780.1 protein_id gnl|my_center|LOCUS_18030 1657 1998 gene locus_tag LOCUS_18040 1657 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2066 2491 gene locus_tag LOCUS_18050 2066 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3426 2581 gene locus_tag LOCUS_18060 3426 2581 CDS product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 protein_id gnl|my_center|LOCUS_18060 3637 3951 gene locus_tag LOCUS_18070 gene rplU 3637 3951 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669481.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence133 2366 21 gene locus_tag LOCUS_18080 2366 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2824 3594 gene locus_tag LOCUS_18090 2824 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence134 218 235 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 483 1445 gene locus_tag LOCUS_18100 483 1445 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680524.1 protein_id gnl|my_center|LOCUS_18100 2305 2988 gene locus_tag LOCUS_18110 2305 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence135 145 1224 gene locus_tag LOCUS_18120 145 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1227 3839 gene locus_tag LOCUS_18130 gene sbcE 1227 3839 CDS product DNA repair/recombination ATPase SbcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233256.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence136 369 797 gene locus_tag LOCUS_18140 369 797 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_18140 1066 2001 gene locus_tag LOCUS_18150 gene cysK 1066 2001 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_18150 2233 3582 gene locus_tag LOCUS_18160 2233 3582 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_18160 2541 2557 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence137 3413 378 gene locus_tag LOCUS_18170 3413 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence138 <1 1060 gene locus_tag LOCUS_18180 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669780.1:BMP family ABC transporter substrate-binding protein 2512 1319 gene locus_tag LOCUS_18190 2512 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 <3468 2627 gene locus_tag LOCUS_18200 <3468 2627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681149.1:ribonuclease Y >Feature sequence139 213 2303 gene locus_tag LOCUS_18210 213 2303 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680511.1 protein_id gnl|my_center|LOCUS_18210 2367 2768 gene locus_tag LOCUS_18220 2367 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence140 1084 755 gene locus_tag LOCUS_18230 1084 755 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_18230 1314 1072 gene locus_tag LOCUS_18240 1314 1072 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_18240 2065 1376 gene locus_tag LOCUS_18250 gene fabG 2065 1376 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287617.1 protein_id gnl|my_center|LOCUS_18250 2808 2062 gene locus_tag LOCUS_18260 2808 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2895 2930 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3277 2966 gene locus_tag LOCUS_18270 3277 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence141 2292 406 gene locus_tag LOCUS_18280 2292 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence142 <1 571 gene locus_tag LOCUS_18290 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681821.1:M15 family metallopeptidase 1179 568 gene locus_tag LOCUS_18300 gene yihX 1179 568 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209011.1 protein_id gnl|my_center|LOCUS_18300 2022 1351 gene locus_tag LOCUS_18310 2022 1351 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943184.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence143 421 1398 gene locus_tag LOCUS_18320 421 1398 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_18320 1410 2321 gene locus_tag LOCUS_18330 1410 2321 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence144 1434 778 gene locus_tag LOCUS_18340 1434 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1694 1446 gene locus_tag LOCUS_18350 1694 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2148 1681 gene locus_tag LOCUS_18360 2148 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2542 2078 gene locus_tag LOCUS_18370 2542 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3220 2543 gene locus_tag LOCUS_18380 3220 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence145 1266 490 gene locus_tag LOCUS_18390 1266 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2161 1481 gene locus_tag LOCUS_18400 2161 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2504 2148 gene locus_tag LOCUS_18410 2504 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3082 2813 gene locus_tag LOCUS_18420 3082 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence146 1217 129 gene locus_tag LOCUS_18430 1217 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 136 218 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2500 1220 gene locus_tag LOCUS_18440 2500 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2827 2576 gene locus_tag LOCUS_18450 2827 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3093 2836 gene locus_tag LOCUS_18460 3093 2836 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence147 133 807 gene locus_tag LOCUS_18470 133 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1206 925 gene locus_tag LOCUS_18480 1206 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1413 2726 gene locus_tag LOCUS_18490 1413 2726 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence148 1999 2940 gene locus_tag LOCUS_18500 1999 2940 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence149 1878 106 gene locus_tag LOCUS_18510 1878 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18510 <3168 1782 gene locus_tag LOCUS_18520 <3168 1782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948376.1:DEAD/DEAH box helicase note possible pseudo, frameshifted >Feature sequence150 1388 36 gene locus_tag LOCUS_18530 1388 36 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_18530 2229 1390 gene locus_tag LOCUS_18540 2229 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 3025 2492 gene locus_tag LOCUS_18550 3025 2492 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence151 735 919 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1108 1524 gene locus_tag LOCUS_18560 1108 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1555 1938 gene locus_tag LOCUS_18570 1555 1938 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016864.1 protein_id gnl|my_center|LOCUS_18570 2021 2245 gene locus_tag LOCUS_18580 2021 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2242 2643 gene locus_tag LOCUS_18590 2242 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence152 <2862 1640 gene locus_tag LOCUS_18600 <2862 1640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680067.1:sugar ABC transporter ATP-binding protein >Feature sequence153 2117 255 gene locus_tag LOCUS_18610 2117 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence154 136 318 gene locus_tag LOCUS_18620 136 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2267 405 gene locus_tag LOCUS_18630 2267 405 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272416.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence155 314 1675 gene locus_tag LOCUS_18640 314 1675 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002646.1 protein_id gnl|my_center|LOCUS_18640 2436 1822 gene locus_tag LOCUS_18650 2436 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence156 215 1579 gene locus_tag LOCUS_18660 215 1579 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_18660 1666 2328 gene locus_tag LOCUS_18670 1666 2328 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681814.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence157 445 320 gene locus_tag LOCUS_18680 445 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 582 2132 gene locus_tag LOCUS_18690 gene lnt 582 2132 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680216.1 protein_id gnl|my_center|LOCUS_18690 2478 2272 gene locus_tag LOCUS_18700 2478 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence158 917 357 gene locus_tag LOCUS_18710 917 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1803 1189 gene locus_tag LOCUS_18720 1803 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2124 1807 gene locus_tag LOCUS_18730 2124 1807 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_18730 2275 2096 gene locus_tag LOCUS_18740 2275 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence159 347 1216 gene locus_tag LOCUS_18750 347 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1277 1353 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1994 1434 gene locus_tag LOCUS_18760 1994 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2127 2321 gene locus_tag LOCUS_18770 2127 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence160 488 231 gene locus_tag LOCUS_18780 488 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1190 624 gene locus_tag LOCUS_18790 1190 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2451 1516 gene locus_tag LOCUS_18800 2451 1516 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458873.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence161 962 138 gene locus_tag LOCUS_18810 962 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1438 974 gene locus_tag LOCUS_18820 1438 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2042 1455 gene locus_tag LOCUS_18830 2042 1455 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948175.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence162 1665 490 gene locus_tag LOCUS_18840 gene cytX 1665 490 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 protein_id gnl|my_center|LOCUS_18840 2458 1667 gene locus_tag LOCUS_18850 gene thiD 2458 1667 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence163 427 615 gene locus_tag LOCUS_18860 427 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18860 814 1692 gene locus_tag LOCUS_18870 814 1692 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861338.1 protein_id gnl|my_center|LOCUS_18870 1737 2393 gene locus_tag LOCUS_18880 1737 2393 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016701.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence164 917 648 gene locus_tag LOCUS_18890 917 648 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957057.1 protein_id gnl|my_center|LOCUS_18890 1203 886 gene locus_tag LOCUS_18900 1203 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1589 1329 gene locus_tag LOCUS_18910 1589 1329 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681985.1 protein_id gnl|my_center|LOCUS_18910 1840 1586 gene locus_tag LOCUS_18920 1840 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence165 1023 196 gene locus_tag LOCUS_18930 1023 196 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681821.1 protein_id gnl|my_center|LOCUS_18930 <2521 1229 gene locus_tag LOCUS_18940 <2521 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229858.1:metal-binding protein ZinT