>Feature sequence001 908 1672 gene locus_tag LOCUS_00010 908 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1676 2161 gene locus_tag LOCUS_00020 1676 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2229 2627 gene locus_tag LOCUS_00030 2229 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2763 3677 gene locus_tag LOCUS_00040 2763 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5300 3759 gene locus_tag LOCUS_00050 5300 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5479 5778 gene locus_tag LOCUS_00060 5479 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5751 5774 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5820 6443 gene locus_tag LOCUS_00070 5820 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7721 6525 gene locus_tag LOCUS_00080 7721 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8038 8370 gene locus_tag LOCUS_00090 8038 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8380 9201 gene locus_tag LOCUS_00100 8380 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9198 9854 gene locus_tag LOCUS_00110 9198 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10076 10108 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10256 11311 gene locus_tag LOCUS_00120 10256 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11364 13697 gene locus_tag LOCUS_00130 11364 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13715 13864 gene locus_tag LOCUS_00140 13715 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15120 14338 gene locus_tag LOCUS_00150 15120 14338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15281 16579 gene locus_tag LOCUS_00160 15281 16579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18360 16594 gene locus_tag LOCUS_00170 18360 16594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18658 19266 gene locus_tag LOCUS_00180 18658 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19412 21394 gene locus_tag LOCUS_00190 19412 21394 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_00190 21461 22450 gene locus_tag LOCUS_00200 21461 22450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22573 22827 gene locus_tag LOCUS_00210 22573 22827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22973 23995 gene locus_tag LOCUS_00220 22973 23995 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965012.1 protein_id gnl|my_center|LOCUS_00220 24217 24402 gene locus_tag LOCUS_00230 24217 24402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24627 25427 gene locus_tag LOCUS_00240 24627 25427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25431 26228 gene locus_tag LOCUS_00250 25431 26228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26238 27050 gene locus_tag LOCUS_00260 26238 27050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 27067 27396 gene locus_tag LOCUS_00270 27067 27396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27453 29120 gene locus_tag LOCUS_00280 27453 29120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29203 30519 gene locus_tag LOCUS_00290 29203 30519 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_00290 30530 31816 gene locus_tag LOCUS_00300 30530 31816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31937 32248 gene locus_tag LOCUS_00310 31937 32248 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349637.1 protein_id gnl|my_center|LOCUS_00310 32281 34827 gene locus_tag LOCUS_00320 32281 34827 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_00320 35297 34860 gene locus_tag LOCUS_00330 35297 34860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35385 35945 gene locus_tag LOCUS_00340 35385 35945 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_00340 38013 35923 gene locus_tag LOCUS_00350 38013 35923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38185 38559 gene locus_tag LOCUS_00360 38185 38559 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_00360 38561 39463 gene locus_tag LOCUS_00370 gene pmtA 38561 39463 CDS product phenol-soluble modulin export ABC transporter ATP-binding protein PmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830432.1 protein_id gnl|my_center|LOCUS_00370 39482 40147 gene locus_tag LOCUS_00380 39482 40147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40151 41626 gene locus_tag LOCUS_00390 40151 41626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 43131 41623 gene locus_tag LOCUS_00400 43131 41623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 43333 45345 gene locus_tag LOCUS_00410 gene lysS 43333 45345 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558598.1 protein_id gnl|my_center|LOCUS_00410 45345 46340 gene locus_tag LOCUS_00420 45345 46340 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_00420 46438 47967 gene locus_tag LOCUS_00430 46438 47967 CDS product propionate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392773.1 protein_id gnl|my_center|LOCUS_00430 47990 48703 gene locus_tag LOCUS_00440 47990 48703 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389733.1 protein_id gnl|my_center|LOCUS_00440 48808 49776 gene locus_tag LOCUS_00450 48808 49776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 49974 51230 gene locus_tag LOCUS_00460 49974 51230 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_00460 51339 52109 gene locus_tag LOCUS_00470 51339 52109 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_00470 52102 53358 gene locus_tag LOCUS_00480 52102 53358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 53493 55568 gene locus_tag LOCUS_00490 53493 55568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 55593 56891 gene locus_tag LOCUS_00500 55593 56891 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173870.1 protein_id gnl|my_center|LOCUS_00500 56930 57619 gene locus_tag LOCUS_00510 56930 57619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 57989 59467 gene locus_tag LOCUS_00520 57989 59467 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_00520 59481 60359 gene locus_tag LOCUS_00530 gene speE 59481 60359 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366713.1 protein_id gnl|my_center|LOCUS_00530 60429 61688 gene locus_tag LOCUS_00540 60429 61688 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_00540 61711 62847 gene locus_tag LOCUS_00550 gene nspC 61711 62847 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_00550 62835 63941 gene locus_tag LOCUS_00560 gene aguA 62835 63941 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969442.1 protein_id gnl|my_center|LOCUS_00560 64129 64998 gene locus_tag LOCUS_00570 gene aguB 64129 64998 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246756.1 protein_id gnl|my_center|LOCUS_00570 66479 65088 gene locus_tag LOCUS_00580 66479 65088 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 protein_id gnl|my_center|LOCUS_00580 68834 66531 gene locus_tag LOCUS_00590 68834 66531 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_00590 69303 68845 gene locus_tag LOCUS_00600 69303 68845 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902988.1 protein_id gnl|my_center|LOCUS_00600 70091 69300 gene locus_tag LOCUS_00610 70091 69300 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434058.1 protein_id gnl|my_center|LOCUS_00610 70219 71346 gene locus_tag LOCUS_00620 70219 71346 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032012.1 protein_id gnl|my_center|LOCUS_00620 71309 72301 gene locus_tag LOCUS_00630 71309 72301 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024407.1 protein_id gnl|my_center|LOCUS_00630 72298 73101 gene locus_tag LOCUS_00640 72298 73101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761990.1 protein_id gnl|my_center|LOCUS_00640 73101 73442 gene locus_tag LOCUS_00650 73101 73442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 73474 74031 gene locus_tag LOCUS_00660 73474 74031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 74022 74999 gene locus_tag LOCUS_00670 74022 74999 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_00670 75088 75915 gene locus_tag LOCUS_00680 75088 75915 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_00680 75985 76671 gene locus_tag LOCUS_00690 75985 76671 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303625.1 protein_id gnl|my_center|LOCUS_00690 76688 77476 gene locus_tag LOCUS_00700 76688 77476 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356242.1 protein_id gnl|my_center|LOCUS_00700 77542 79956 gene locus_tag LOCUS_00710 77542 79956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 80028 80834 gene locus_tag LOCUS_00720 80028 80834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 81089 81316 gene locus_tag LOCUS_00730 gene acpP 81089 81316 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406112.1 protein_id gnl|my_center|LOCUS_00730 81379 82314 gene locus_tag LOCUS_00740 gene fabK 81379 82314 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_00740 82314 83231 gene locus_tag LOCUS_00750 gene fabD 82314 83231 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_00750 83250 84005 gene locus_tag LOCUS_00760 gene fabG 83250 84005 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_00760 84017 85252 gene locus_tag LOCUS_00770 gene fabF 84017 85252 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_00770 85267 85695 gene locus_tag LOCUS_00780 gene fabZ 85267 85695 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356286.1 protein_id gnl|my_center|LOCUS_00780 85742 87556 gene locus_tag LOCUS_00790 85742 87556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 87578 88630 gene locus_tag LOCUS_00800 87578 88630 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430617.1 protein_id gnl|my_center|LOCUS_00800 88630 89598 gene locus_tag LOCUS_00810 88630 89598 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_00810 89690 90127 gene locus_tag LOCUS_00820 89690 90127 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002993768.1 protein_id gnl|my_center|LOCUS_00820 90226 90828 gene locus_tag LOCUS_00830 gene thrH 90226 90828 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_00830 92135 90915 gene locus_tag LOCUS_00840 92135 90915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 92312 94090 gene locus_tag LOCUS_00850 gene recJ 92312 94090 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_00850 94113 96332 gene locus_tag LOCUS_00860 gene priA 94113 96332 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965028.1 protein_id gnl|my_center|LOCUS_00860 96351 96848 gene locus_tag LOCUS_00870 gene def 96351 96848 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_00870 96848 97774 gene locus_tag LOCUS_00880 gene fmt 96848 97774 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_00880 97776 99131 gene locus_tag LOCUS_00890 gene rsmB 97776 99131 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_00890 99153 100205 gene locus_tag LOCUS_00900 gene rlmN 99153 100205 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_00900 100255 100998 gene locus_tag LOCUS_00910 gene prpC 100255 100998 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_00910 101017 103404 gene locus_tag LOCUS_00920 101017 103404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 103408 104310 gene locus_tag LOCUS_00930 gene rsgA 103408 104310 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_00930 104351 105010 gene locus_tag LOCUS_00940 gene rpe 104351 105010 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_00940 105110 106312 gene locus_tag LOCUS_00950 105110 106312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 106391 107143 gene locus_tag LOCUS_00960 106391 107143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 107365 108717 gene locus_tag LOCUS_00970 107365 108717 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_00970 108868 109587 gene locus_tag LOCUS_00980 108868 109587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 109587 110348 gene locus_tag LOCUS_00990 109587 110348 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251182.1 protein_id gnl|my_center|LOCUS_00990 111523 110345 gene locus_tag LOCUS_01000 111523 110345 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860903.1 protein_id gnl|my_center|LOCUS_01000 111706 112227 gene locus_tag LOCUS_01010 111706 112227 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_01010 112220 112945 gene locus_tag LOCUS_01020 112220 112945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 114441 113053 gene locus_tag LOCUS_01030 114441 113053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 114624 115106 gene locus_tag LOCUS_01040 114624 115106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 115356 117563 gene locus_tag LOCUS_01050 115356 117563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 117591 118175 gene locus_tag LOCUS_01060 117591 118175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 118380 118745 gene locus_tag LOCUS_01070 118380 118745 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805188.1 protein_id gnl|my_center|LOCUS_01070 118761 119627 gene locus_tag LOCUS_01080 118761 119627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560935.1 protein_id gnl|my_center|LOCUS_01080 119637 120302 gene locus_tag LOCUS_01090 119637 120302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 120314 121018 gene locus_tag LOCUS_01100 120314 121018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 121178 122533 gene locus_tag LOCUS_01110 121178 122533 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_01110 122546 123559 gene locus_tag LOCUS_01120 122546 123559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 123635 124792 gene locus_tag LOCUS_01130 123635 124792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 124845 126197 gene locus_tag LOCUS_01140 124845 126197 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966714.1 protein_id gnl|my_center|LOCUS_01140 126260 127267 gene locus_tag LOCUS_01150 126260 127267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 127575 128171 gene locus_tag LOCUS_01160 127575 128171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 128296 129075 gene locus_tag LOCUS_01170 128296 129075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 129515 129703 gene locus_tag LOCUS_01180 129515 129703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 129978 129700 gene locus_tag LOCUS_01190 129978 129700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 130406 130014 gene locus_tag LOCUS_01200 130406 130014 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_01200 130741 130430 gene locus_tag LOCUS_01210 130741 130430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 131044 131316 gene locus_tag LOCUS_01220 131044 131316 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476650.1 protein_id gnl|my_center|LOCUS_01220 131406 131918 gene locus_tag LOCUS_01230 131406 131918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 132251 133027 gene locus_tag LOCUS_01240 132251 133027 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228232.1 protein_id gnl|my_center|LOCUS_01240 133072 134256 gene locus_tag LOCUS_01250 133072 134256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 134882 134349 gene locus_tag LOCUS_01260 134882 134349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 >Feature sequence002 1019 747 gene locus_tag LOCUS_01270 gene groES 1019 747 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_01270 1392 2501 gene locus_tag LOCUS_01280 1392 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 2563 4209 gene locus_tag LOCUS_01290 2563 4209 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_01290 4218 5861 gene locus_tag LOCUS_01300 4218 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 5942 6787 gene locus_tag LOCUS_01310 5942 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 7151 6894 gene locus_tag LOCUS_01320 7151 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 7788 7171 gene locus_tag LOCUS_01330 7788 7171 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249905.1 protein_id gnl|my_center|LOCUS_01330 9956 7836 gene locus_tag LOCUS_01340 9956 7836 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_01340 11501 9957 gene locus_tag LOCUS_01350 11501 9957 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_01350 12829 11561 gene locus_tag LOCUS_01360 12829 11561 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_01360 12923 13462 gene locus_tag LOCUS_01370 12923 13462 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_01370 13547 14464 gene locus_tag LOCUS_01380 gene pyrB 13547 14464 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_01380 14509 14937 gene locus_tag LOCUS_01390 14509 14937 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_01390 16358 14973 gene locus_tag LOCUS_01400 16358 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 17347 16415 gene locus_tag LOCUS_01410 17347 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 18470 17367 gene locus_tag LOCUS_01420 18470 17367 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_01420 19489 18572 gene locus_tag LOCUS_01430 19489 18572 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_01430 20290 19559 gene locus_tag LOCUS_01440 20290 19559 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_01440 21081 20578 gene locus_tag LOCUS_01450 21081 20578 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434936.1 protein_id gnl|my_center|LOCUS_01450 22527 21154 gene locus_tag LOCUS_01460 gene radA 22527 21154 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_01460 23026 22616 gene locus_tag LOCUS_01470 23026 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 25568 23124 gene locus_tag LOCUS_01480 25568 23124 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048366.1 protein_id gnl|my_center|LOCUS_01480 26945 25659 gene locus_tag LOCUS_01490 26945 25659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 28275 27001 gene locus_tag LOCUS_01500 gene purD 28275 27001 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_01500 28910 28317 gene locus_tag LOCUS_01510 gene purN 28910 28317 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_01510 29929 28904 gene locus_tag LOCUS_01520 gene purM 29929 28904 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_01520 30448 29948 gene locus_tag LOCUS_01530 gene purE 30448 29948 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_01530 32567 30483 gene locus_tag LOCUS_01540 32567 30483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 32890 32564 gene locus_tag LOCUS_01550 32890 32564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 33057 32902 gene locus_tag LOCUS_01560 33057 32902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 33756 33070 gene locus_tag LOCUS_01570 gene pyrE 33756 33070 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_01570 34794 33868 gene locus_tag LOCUS_01580 gene pyrF 34794 33868 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_01580 37304 34917 gene locus_tag LOCUS_01590 37304 34917 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_01590 38546 37593 gene locus_tag LOCUS_01600 38546 37593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 39651 38629 gene locus_tag LOCUS_01610 39651 38629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 40056 39664 gene locus_tag LOCUS_01620 40056 39664 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_01620 40881 40171 gene locus_tag LOCUS_01630 40881 40171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 41058 40985 gene locus_tag LOCUS_t00010 41058 40985 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 41188 41114 gene locus_tag LOCUS_t00020 41188 41114 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 41285 41211 gene locus_tag LOCUS_t00030 41285 41211 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 43561 41360 gene locus_tag LOCUS_01640 43561 41360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 44142 43648 gene locus_tag LOCUS_01650 44142 43648 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229585.1 protein_id gnl|my_center|LOCUS_01650 45801 44170 gene locus_tag LOCUS_01660 45801 44170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 45979 46194 gene locus_tag LOCUS_01670 45979 46194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 46721 46248 gene locus_tag LOCUS_01680 gene greA 46721 46248 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818760.1 protein_id gnl|my_center|LOCUS_01680 46965 46723 gene locus_tag LOCUS_01690 46965 46723 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831726.1 protein_id gnl|my_center|LOCUS_01690 47494 47081 gene locus_tag LOCUS_01700 47494 47081 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_01700 48939 47542 gene locus_tag LOCUS_01710 gene atpD 48939 47542 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_01710 49910 48939 gene locus_tag LOCUS_01720 gene atpG 49910 48939 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829942.1 protein_id gnl|my_center|LOCUS_01720 51670 49940 gene locus_tag LOCUS_01730 gene atpA 51670 49940 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_01730 52166 51672 gene locus_tag LOCUS_01740 52166 51672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 52604 52236 gene locus_tag LOCUS_01750 52604 52236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 53440 52625 gene locus_tag LOCUS_01760 53440 52625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 53662 53589 gene locus_tag LOCUS_t00040 53662 53589 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 54926 53790 gene locus_tag LOCUS_01770 54926 53790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 56825 55629 gene locus_tag LOCUS_01780 56825 55629 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_01780 57512 56889 gene locus_tag LOCUS_01790 57512 56889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 57598 58122 gene locus_tag LOCUS_01800 57598 58122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 60919 58235 gene locus_tag LOCUS_01810 60919 58235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 62738 61011 gene locus_tag LOCUS_01820 62738 61011 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_01820 62887 63804 gene locus_tag LOCUS_01830 62887 63804 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_01830 64472 63879 gene locus_tag LOCUS_01840 gene yihA 64472 63879 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_01840 65761 64472 gene locus_tag LOCUS_01850 gene clpX 65761 64472 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_01850 66399 65782 gene locus_tag LOCUS_01860 gene clpP 66399 65782 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_01860 67808 66534 gene locus_tag LOCUS_01870 gene tig 67808 66534 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_01870 68378 67893 gene locus_tag LOCUS_01880 68378 67893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 69243 68449 gene locus_tag LOCUS_01890 69243 68449 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_01890 71169 69286 gene locus_tag LOCUS_01900 71169 69286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 72367 71324 gene locus_tag LOCUS_01910 72367 71324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 74109 72391 gene locus_tag LOCUS_01920 74109 72391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 74847 74143 gene locus_tag LOCUS_01930 74847 74143 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 protein_id gnl|my_center|LOCUS_01930 75771 74992 gene locus_tag LOCUS_01940 75771 74992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 75984 75908 gene locus_tag LOCUS_t00050 75984 75908 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 78128 76047 gene locus_tag LOCUS_01950 78128 76047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 79979 78171 gene locus_tag LOCUS_01960 79979 78171 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861202.1 protein_id gnl|my_center|LOCUS_01960 80507 80070 gene locus_tag LOCUS_01970 gene ohrR 80507 80070 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_01970 80799 80500 gene locus_tag LOCUS_01980 80799 80500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 81271 80801 gene locus_tag LOCUS_01990 81271 80801 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_01990 82328 81330 gene locus_tag LOCUS_02000 gene galE 82328 81330 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_02000 83519 82392 gene locus_tag LOCUS_02010 83519 82392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 84714 83602 gene locus_tag LOCUS_02020 84714 83602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 84957 84727 gene locus_tag LOCUS_02030 84957 84727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 85170 85099 gene locus_tag LOCUS_t00060 85170 85099 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 85260 85185 gene locus_tag LOCUS_t00070 85260 85185 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 88053 85351 gene locus_tag LOCUS_02040 88053 85351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 88888 88088 gene locus_tag LOCUS_02050 88888 88088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 89085 89951 gene locus_tag LOCUS_02060 89085 89951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 89963 91459 gene locus_tag LOCUS_02070 89963 91459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 94121 91605 gene locus_tag LOCUS_02080 94121 91605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 95061 94333 gene locus_tag LOCUS_02090 gene deoD 95061 94333 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_02090 96095 95094 gene locus_tag LOCUS_02100 96095 95094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 96665 96099 gene locus_tag LOCUS_02110 96665 96099 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 protein_id gnl|my_center|LOCUS_02110 97332 96736 gene locus_tag LOCUS_02120 97332 96736 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_02120 97811 97452 gene locus_tag LOCUS_02130 97811 97452 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816218.1 protein_id gnl|my_center|LOCUS_02130 98425 97949 gene locus_tag LOCUS_02140 98425 97949 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_02140 99160 98468 gene locus_tag LOCUS_02150 99160 98468 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_02150 99447 99250 gene locus_tag LOCUS_02160 99447 99250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 100042 99701 gene locus_tag LOCUS_02170 100042 99701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 100876 100130 gene locus_tag LOCUS_02180 gene truA 100876 100130 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553118.1 protein_id gnl|my_center|LOCUS_02180 101112 101029 gene locus_tag LOCUS_t00080 101112 101029 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101200 101129 gene locus_tag LOCUS_t00090 101200 101129 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence003 1253 51 gene locus_tag LOCUS_02190 1253 51 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876001.1 protein_id gnl|my_center|LOCUS_02190 2397 1246 gene locus_tag LOCUS_02200 2397 1246 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_02200 3144 2407 gene locus_tag LOCUS_02210 3144 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 4121 3144 gene locus_tag LOCUS_02220 4121 3144 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_02220 5476 4160 gene locus_tag LOCUS_02230 5476 4160 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_02230 6590 5490 gene locus_tag LOCUS_02240 6590 5490 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476099.1 protein_id gnl|my_center|LOCUS_02240 7941 6583 gene locus_tag LOCUS_02250 7941 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 8888 7941 gene locus_tag LOCUS_02260 8888 7941 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_02260 9415 8888 gene locus_tag LOCUS_02270 9415 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 11181 9427 gene locus_tag LOCUS_02280 11181 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 12470 11160 gene locus_tag LOCUS_02290 12470 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 13622 12495 gene locus_tag LOCUS_02300 gene rffA 13622 12495 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 protein_id gnl|my_center|LOCUS_02300 14043 13615 gene locus_tag LOCUS_02310 14043 13615 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114300.1 protein_id gnl|my_center|LOCUS_02310 14912 14094 gene locus_tag LOCUS_02320 14912 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 16861 14912 gene locus_tag LOCUS_02330 16861 14912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 17550 16858 gene locus_tag LOCUS_02340 gene pseF 17550 16858 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_02340 18774 17566 gene locus_tag LOCUS_02350 gene pseC 18774 17566 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_02350 19823 18804 gene locus_tag LOCUS_02360 19823 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 20873 19824 gene locus_tag LOCUS_02370 gene pseI 20873 19824 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_02370 21871 20876 gene locus_tag LOCUS_02380 gene pseB 21871 20876 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015759.1 protein_id gnl|my_center|LOCUS_02380 23092 21944 gene locus_tag LOCUS_02390 23092 21944 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454855.1 protein_id gnl|my_center|LOCUS_02390 24433 23099 gene locus_tag LOCUS_02400 24433 23099 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_02400 26279 24534 gene locus_tag LOCUS_02410 26279 24534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_02410 27379 26294 gene locus_tag LOCUS_02420 27379 26294 CDS product glycosyltransferase family 52 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922741.1 protein_id gnl|my_center|LOCUS_02420 28363 27413 gene locus_tag LOCUS_02430 28363 27413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767223.1 protein_id gnl|my_center|LOCUS_02430 29569 28379 gene locus_tag LOCUS_02440 29569 28379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 30862 29582 gene locus_tag LOCUS_02450 30862 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 31637 30846 gene locus_tag LOCUS_02460 31637 30846 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257991.1 protein_id gnl|my_center|LOCUS_02460 32645 31650 gene locus_tag LOCUS_02470 gene wzy 32645 31650 CDS product O104 family O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205117.1 protein_id gnl|my_center|LOCUS_02470 33550 32774 gene locus_tag LOCUS_02480 33550 32774 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083199050.1 protein_id gnl|my_center|LOCUS_02480 34622 33573 gene locus_tag LOCUS_02490 34622 33573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 35882 34632 gene locus_tag LOCUS_02500 35882 34632 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_02500 36765 36025 gene locus_tag LOCUS_02510 36765 36025 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426498.1 protein_id gnl|my_center|LOCUS_02510 37599 36793 gene locus_tag LOCUS_02520 37599 36793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 38507 37593 gene locus_tag LOCUS_02530 38507 37593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 39521 38577 gene locus_tag LOCUS_02540 39521 38577 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410273.1 protein_id gnl|my_center|LOCUS_02540 40347 39889 gene locus_tag LOCUS_02550 40347 39889 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_02550 41212 40358 gene locus_tag LOCUS_02560 gene rfbD 41212 40358 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_02560 41424 42629 gene locus_tag LOCUS_02570 41424 42629 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_02570 42113 42209 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44161 42797 gene locus_tag LOCUS_02580 44161 42797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 45029 44139 gene locus_tag LOCUS_02590 45029 44139 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_02590 47795 45033 gene locus_tag LOCUS_02600 47795 45033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 49527 47821 gene locus_tag LOCUS_02610 49527 47821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 49731 49564 gene locus_tag LOCUS_02620 49731 49564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 51406 49733 gene locus_tag LOCUS_02630 gene leuA 51406 49733 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_02630 51742 51479 gene locus_tag LOCUS_02640 51742 51479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 53121 51817 gene locus_tag LOCUS_02650 53121 51817 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966359.1 protein_id gnl|my_center|LOCUS_02650 54073 53111 gene locus_tag LOCUS_02660 gene cdaA 54073 53111 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_02660 55361 54138 gene locus_tag LOCUS_02670 55361 54138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 55737 55342 gene locus_tag LOCUS_02680 55737 55342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 55799 55965 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56931 56239 gene locus_tag LOCUS_02690 56931 56239 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099097343.1 protein_id gnl|my_center|LOCUS_02690 59186 56934 gene locus_tag LOCUS_02700 59186 56934 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_02700 60017 59193 gene locus_tag LOCUS_02710 60017 59193 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948004.1 protein_id gnl|my_center|LOCUS_02710 60505 60092 gene locus_tag LOCUS_02720 60505 60092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 60662 60742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 62136 61414 gene locus_tag LOCUS_02730 gene flgF 62136 61414 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_02730 63252 62257 gene locus_tag LOCUS_02740 63252 62257 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_02740 63672 64313 gene locus_tag LOCUS_02750 63672 64313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 64314 64739 gene locus_tag LOCUS_02760 64314 64739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 67756 64913 gene locus_tag LOCUS_02770 gene uvrA 67756 64913 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963825.1 protein_id gnl|my_center|LOCUS_02770 69934 67943 gene locus_tag LOCUS_02780 gene uvrB 69934 67943 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_02780 68744 68813 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 70207 71190 gene locus_tag LOCUS_02790 70207 71190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 71238 71555 gene locus_tag LOCUS_02800 71238 71555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 72100 71906 gene locus_tag LOCUS_02810 72100 71906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 72500 72213 gene locus_tag LOCUS_02820 72500 72213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 72872 72531 gene locus_tag LOCUS_02830 72872 72531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 74019 72892 gene locus_tag LOCUS_02840 74019 72892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 75259 74021 gene locus_tag LOCUS_02850 75259 74021 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_02850 76221 75268 gene locus_tag LOCUS_02860 76221 75268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 77140 76190 gene locus_tag LOCUS_02870 77140 76190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 77445 77143 gene locus_tag LOCUS_02880 77445 77143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 78471 77464 gene locus_tag LOCUS_02890 78471 77464 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_02890 79211 78456 gene locus_tag LOCUS_02900 gene pnuC 79211 78456 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026840.1 protein_id gnl|my_center|LOCUS_02900 80499 79240 gene locus_tag LOCUS_02910 80499 79240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 83287 80594 gene locus_tag LOCUS_02920 83287 80594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 84092 83379 gene locus_tag LOCUS_02930 84092 83379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence004 695 1966 gene locus_tag LOCUS_02940 695 1966 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700902.1 protein_id gnl|my_center|LOCUS_02940 2048 3646 gene locus_tag LOCUS_02950 2048 3646 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_02950 3648 4691 gene locus_tag LOCUS_02960 gene xylF 3648 4691 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_02960 5613 4744 gene locus_tag LOCUS_02970 5613 4744 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_02970 5763 6434 gene locus_tag LOCUS_02980 5763 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 6443 6517 gene locus_tag LOCUS_t00100 6443 6517 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6612 7286 gene locus_tag LOCUS_02990 6612 7286 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_02990 7283 8461 gene locus_tag LOCUS_03000 7283 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 11179 8474 gene locus_tag LOCUS_03010 11179 8474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 12360 11344 gene locus_tag LOCUS_03020 gene trpD 12360 11344 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_03020 13198 12422 gene locus_tag LOCUS_03030 gene trpA 13198 12422 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_03030 14375 13191 gene locus_tag LOCUS_03040 gene trpB 14375 13191 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_03040 14985 14380 gene locus_tag LOCUS_03050 14985 14380 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_03050 15811 14996 gene locus_tag LOCUS_03060 gene trpC 15811 14996 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_03060 15825 15906 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18064 16271 gene locus_tag LOCUS_03070 18064 16271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_03070 19800 18061 gene locus_tag LOCUS_03080 19800 18061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963980.1 protein_id gnl|my_center|LOCUS_03080 20081 20506 gene locus_tag LOCUS_03090 20081 20506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 22586 20556 gene locus_tag LOCUS_03100 22586 20556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 23150 22614 gene locus_tag LOCUS_03110 23150 22614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 23517 23155 gene locus_tag LOCUS_03120 23517 23155 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860652.1 protein_id gnl|my_center|LOCUS_03120 25082 23547 gene locus_tag LOCUS_03130 25082 23547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 25324 25572 gene locus_tag LOCUS_03140 25324 25572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 25585 25806 gene locus_tag LOCUS_03150 25585 25806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 26913 25864 gene locus_tag LOCUS_03160 26913 25864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 27548 27096 gene locus_tag LOCUS_03170 27548 27096 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287575.1 protein_id gnl|my_center|LOCUS_03170 28028 27567 gene locus_tag LOCUS_03180 28028 27567 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902885.1 protein_id gnl|my_center|LOCUS_03180 28569 28123 gene locus_tag LOCUS_03190 28569 28123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 28791 29243 gene locus_tag LOCUS_03200 28791 29243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 29258 30115 gene locus_tag LOCUS_03210 29258 30115 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 protein_id gnl|my_center|LOCUS_03210 30435 30124 gene locus_tag LOCUS_03220 30435 30124 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_03220 30640 30416 gene locus_tag LOCUS_03230 30640 30416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 31449 30661 gene locus_tag LOCUS_03240 31449 30661 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964806.1 protein_id gnl|my_center|LOCUS_03240 32461 31439 gene locus_tag LOCUS_03250 32461 31439 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964805.1 protein_id gnl|my_center|LOCUS_03250 33053 32580 gene locus_tag LOCUS_03260 33053 32580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 34493 33183 gene locus_tag LOCUS_03270 34493 33183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 35143 34670 gene locus_tag LOCUS_03280 35143 34670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 35782 35228 gene locus_tag LOCUS_03290 35782 35228 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_03290 35980 36978 gene locus_tag LOCUS_03300 35980 36978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 38664 37051 gene locus_tag LOCUS_03310 38664 37051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 39411 38842 gene locus_tag LOCUS_03320 39411 38842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 41149 39644 gene locus_tag LOCUS_03330 41149 39644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 42341 41262 gene locus_tag LOCUS_03340 42341 41262 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459186.1 protein_id gnl|my_center|LOCUS_03340 43521 42382 gene locus_tag LOCUS_03350 43521 42382 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_03350 44820 43531 gene locus_tag LOCUS_03360 44820 43531 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_03360 45595 44945 gene locus_tag LOCUS_03370 45595 44945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 45824 48145 gene locus_tag LOCUS_03380 45824 48145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 50277 48187 gene locus_tag LOCUS_03390 50277 48187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 51420 50428 gene locus_tag LOCUS_03400 51420 50428 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_03400 52795 51599 gene locus_tag LOCUS_03410 52795 51599 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679691.1 protein_id gnl|my_center|LOCUS_03410 53831 52932 gene locus_tag LOCUS_03420 53831 52932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 56563 53963 gene locus_tag LOCUS_03430 gene gyrA 56563 53963 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_03430 58551 56602 gene locus_tag LOCUS_03440 gene gyrB 58551 56602 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_03440 59651 58566 gene locus_tag LOCUS_03450 gene recF 59651 58566 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_03450 59893 59684 gene locus_tag LOCUS_03460 gene yaaA 59893 59684 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_03460 61014 59902 gene locus_tag LOCUS_03470 gene dnaN 61014 59902 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_03470 62587 61223 gene locus_tag LOCUS_03480 gene dnaA 62587 61223 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_03480 63117 63251 gene locus_tag LOCUS_03490 gene rpmH 63117 63251 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_03490 63314 63655 gene locus_tag LOCUS_03500 gene rnpA 63314 63655 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542420.1 protein_id gnl|my_center|LOCUS_03500 63717 63929 gene locus_tag LOCUS_03510 gene yidD 63717 63929 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048456.1 protein_id gnl|my_center|LOCUS_03510 63950 65272 gene locus_tag LOCUS_03520 63950 65272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 65278 66075 gene locus_tag LOCUS_03530 65278 66075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 66270 67667 gene locus_tag LOCUS_03540 gene mnmE 66270 67667 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_03540 67694 68191 gene locus_tag LOCUS_03550 67694 68191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 68980 68336 gene locus_tag LOCUS_03560 68980 68336 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903260.1 protein_id gnl|my_center|LOCUS_03560 69116 69583 gene locus_tag LOCUS_03570 69116 69583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence005 3 863 gene locus_tag LOCUS_03580 3 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 928 1662 gene locus_tag LOCUS_03590 928 1662 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_03590 1681 2658 gene locus_tag LOCUS_03600 gene bioB 1681 2658 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_03600 2702 3850 gene locus_tag LOCUS_03610 2702 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4123 5070 gene locus_tag LOCUS_03620 4123 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 5179 6267 gene locus_tag LOCUS_03630 5179 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 6350 7072 gene locus_tag LOCUS_03640 6350 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 7266 7075 gene locus_tag LOCUS_03650 7266 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 7417 7707 gene locus_tag LOCUS_03660 7417 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 7719 7889 gene locus_tag LOCUS_03670 7719 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 7919 9199 gene locus_tag LOCUS_03680 gene galK 7919 9199 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_03680 9386 9766 gene locus_tag LOCUS_03690 9386 9766 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424232.1 protein_id gnl|my_center|LOCUS_03690 9823 10686 gene locus_tag LOCUS_03700 9823 10686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_03700 10703 11482 gene locus_tag LOCUS_03710 10703 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 11482 12255 gene locus_tag LOCUS_03720 11482 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 12255 13145 gene locus_tag LOCUS_03730 12255 13145 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_03730 13769 13188 gene locus_tag LOCUS_03740 13769 13188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 15024 13813 gene locus_tag LOCUS_03750 gene glnA 15024 13813 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_03750 15388 15750 gene locus_tag LOCUS_03760 15388 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03760 15704 17500 gene locus_tag LOCUS_03770 15704 17500 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03770 15714 15731 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17580 19328 gene locus_tag LOCUS_03780 17580 19328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 19638 19710 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19722 23987 gene locus_tag LOCUS_03790 gene gltB 19722 23987 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_03790 23997 25481 gene locus_tag LOCUS_03800 23997 25481 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807932.1 protein_id gnl|my_center|LOCUS_03800 25506 26339 gene locus_tag LOCUS_03810 gene dapF 25506 26339 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_03810 26360 27577 gene locus_tag LOCUS_03820 26360 27577 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_03820 27733 29313 gene locus_tag LOCUS_03830 gene asnB 27733 29313 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_03830 29344 30768 gene locus_tag LOCUS_03840 gene purF 29344 30768 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_03840 30792 32402 gene locus_tag LOCUS_03850 30792 32402 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_03850 32421 33521 gene locus_tag LOCUS_03860 gene carA 32421 33521 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016378.1 protein_id gnl|my_center|LOCUS_03860 33525 36701 gene locus_tag LOCUS_03870 gene carB 33525 36701 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126116.1 protein_id gnl|my_center|LOCUS_03870 36842 38836 gene locus_tag LOCUS_03880 36842 38836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 39086 39727 gene locus_tag LOCUS_03890 gene thiE 39086 39727 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_03890 39791 40588 gene locus_tag LOCUS_03900 gene thiD 39791 40588 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_03900 40625 41143 gene locus_tag LOCUS_03910 gene thiW 40625 41143 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_03910 41168 41914 gene locus_tag LOCUS_03920 gene thiM 41168 41914 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_03920 41996 42151 gene locus_tag LOCUS_03930 41996 42151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 42175 42465 gene locus_tag LOCUS_03940 42175 42465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_03940 42581 43804 gene locus_tag LOCUS_03950 42581 43804 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_03950 45385 43898 gene locus_tag LOCUS_03960 45385 43898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 46347 45412 gene locus_tag LOCUS_03970 46347 45412 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949052.1 protein_id gnl|my_center|LOCUS_03970 48276 46474 gene locus_tag LOCUS_03980 48276 46474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 49072 48398 gene locus_tag LOCUS_03990 49072 48398 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460336.1 protein_id gnl|my_center|LOCUS_03990 49245 50042 gene locus_tag LOCUS_04000 49245 50042 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964059.1 protein_id gnl|my_center|LOCUS_04000 50195 51106 gene locus_tag LOCUS_04010 gene ptb 50195 51106 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_04010 51165 52229 gene locus_tag LOCUS_04020 gene buk 51165 52229 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_04020 52388 54952 gene locus_tag LOCUS_04030 gene secA 52388 54952 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947996.1 protein_id gnl|my_center|LOCUS_04030 54980 56107 gene locus_tag LOCUS_04040 gene prfB 54980 56107 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_04040 56898 56170 gene locus_tag LOCUS_04050 56898 56170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 57398 56910 gene locus_tag LOCUS_04060 57398 56910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 57766 57416 gene locus_tag LOCUS_04070 57766 57416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 57900 60266 gene locus_tag LOCUS_04080 57900 60266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 61429 60344 gene locus_tag LOCUS_04090 61429 60344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 61630 62136 gene locus_tag LOCUS_04100 61630 62136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 62136 62564 gene locus_tag LOCUS_04110 gene tsaE 62136 62564 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_04110 62561 63283 gene locus_tag LOCUS_04120 gene tsaB 62561 63283 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_04120 63283 63750 gene locus_tag LOCUS_04130 gene rimI 63283 63750 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938967.1 protein_id gnl|my_center|LOCUS_04130 63765 64676 gene locus_tag LOCUS_04140 63765 64676 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_04140 64725 65309 gene locus_tag LOCUS_04150 64725 65309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 65326 66348 gene locus_tag LOCUS_04160 gene tsaD 65326 66348 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_04160 66348 67067 gene locus_tag LOCUS_04170 gene ispD 66348 67067 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_04170 67334 67361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence006 279 1175 gene locus_tag LOCUS_04180 279 1175 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_04180 1195 1824 gene locus_tag LOCUS_04190 1195 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 2100 3278 gene locus_tag LOCUS_04200 2100 3278 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_04200 3429 4310 gene locus_tag LOCUS_04210 3429 4310 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_04210 4322 5395 gene locus_tag LOCUS_04220 4322 5395 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_04220 5397 6155 gene locus_tag LOCUS_04230 5397 6155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_04230 6160 6870 gene locus_tag LOCUS_04240 6160 6870 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_04240 6903 7775 gene locus_tag LOCUS_04250 gene ispE 6903 7775 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_04250 7768 8457 gene locus_tag LOCUS_04260 7768 8457 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_04260 8450 8875 gene locus_tag LOCUS_04270 8450 8875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 8963 9580 gene locus_tag LOCUS_04280 8963 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 10252 9776 gene locus_tag LOCUS_04290 10252 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 10407 11636 gene locus_tag LOCUS_04300 10407 11636 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947929.1 protein_id gnl|my_center|LOCUS_04300 11649 11834 gene locus_tag LOCUS_04310 11649 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 11941 13452 gene locus_tag LOCUS_04320 11941 13452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 13454 14047 gene locus_tag LOCUS_04330 13454 14047 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_04330 14023 14463 gene locus_tag LOCUS_04340 14023 14463 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 protein_id gnl|my_center|LOCUS_04340 14490 15479 gene locus_tag LOCUS_04350 14490 15479 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_04350 15497 16435 gene locus_tag LOCUS_04360 15497 16435 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_04360 16404 17168 gene locus_tag LOCUS_04370 16404 17168 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_04370 17185 18024 gene locus_tag LOCUS_04380 gene rsmI 17185 18024 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_04380 18115 18354 gene locus_tag LOCUS_04390 gene acpP 18115 18354 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418905.1 protein_id gnl|my_center|LOCUS_04390 18503 19849 gene locus_tag LOCUS_04400 18503 19849 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_04400 19882 21339 gene locus_tag LOCUS_04410 19882 21339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 21380 21619 gene locus_tag LOCUS_04420 21380 21619 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 protein_id gnl|my_center|LOCUS_04420 21640 22482 gene locus_tag LOCUS_04430 21640 22482 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965285.1 protein_id gnl|my_center|LOCUS_04430 22981 24108 gene locus_tag LOCUS_04440 22981 24108 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_04440 24134 25207 gene locus_tag LOCUS_04450 24134 25207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 25270 27738 gene locus_tag LOCUS_04460 gene leuS 25270 27738 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_04460 25491 25509 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27817 29193 gene locus_tag LOCUS_04470 gene murC 27817 29193 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_04470 29497 30612 gene locus_tag LOCUS_04480 29497 30612 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048434.1 protein_id gnl|my_center|LOCUS_04480 30617 31594 gene locus_tag LOCUS_04490 30617 31594 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_04490 31675 32859 gene locus_tag LOCUS_04500 31675 32859 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_04500 33855 32932 gene locus_tag LOCUS_04510 33855 32932 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_04510 34032 34244 gene locus_tag LOCUS_04520 34032 34244 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263301.1 protein_id gnl|my_center|LOCUS_04520 34258 35628 gene locus_tag LOCUS_04530 34258 35628 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440033.1 protein_id gnl|my_center|LOCUS_04530 35745 37277 gene locus_tag LOCUS_04540 35745 37277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 37297 38439 gene locus_tag LOCUS_04550 37297 38439 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023546.1 protein_id gnl|my_center|LOCUS_04550 38456 38854 gene locus_tag LOCUS_04560 38456 38854 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264782.1 protein_id gnl|my_center|LOCUS_04560 39168 41099 gene locus_tag LOCUS_04570 39168 41099 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861470.1 protein_id gnl|my_center|LOCUS_04570 41586 41763 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42305 42961 gene locus_tag LOCUS_04580 42305 42961 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296656.1 protein_id gnl|my_center|LOCUS_04580 42963 43781 gene locus_tag LOCUS_04590 42963 43781 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884064.1 protein_id gnl|my_center|LOCUS_04590 43821 44063 gene locus_tag LOCUS_04600 43821 44063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 44083 44940 gene locus_tag LOCUS_04610 44083 44940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 45076 49455 gene locus_tag LOCUS_04620 45076 49455 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382252.1 protein_id gnl|my_center|LOCUS_04620 49472 49945 gene locus_tag LOCUS_04630 49472 49945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 49982 50569 gene locus_tag LOCUS_04640 49982 50569 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_04640 50619 51695 gene locus_tag LOCUS_04650 50619 51695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 51893 51702 gene locus_tag LOCUS_04660 51893 51702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 51864 52952 gene locus_tag LOCUS_04670 gene aroC 51864 52952 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_04670 52969 54210 gene locus_tag LOCUS_04680 gene aroA 52969 54210 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896990.1 protein_id gnl|my_center|LOCUS_04680 54211 55068 gene locus_tag LOCUS_04690 54211 55068 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_04690 55121 55816 gene locus_tag LOCUS_04700 55121 55816 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_04700 55827 57716 gene locus_tag LOCUS_04710 55827 57716 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_04710 57755 58591 gene locus_tag LOCUS_04720 57755 58591 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_04720 58625 58804 gene locus_tag LOCUS_04730 58625 58804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 60199 58847 gene locus_tag LOCUS_04740 60199 58847 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_04740 61995 60199 gene locus_tag LOCUS_04750 61995 60199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence007 2039 1194 gene locus_tag LOCUS_04760 2039 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 3098 2196 gene locus_tag LOCUS_04770 3098 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 5014 3332 gene locus_tag LOCUS_04780 5014 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04780 5934 4984 gene locus_tag LOCUS_04790 5934 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04790 5015 5045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6931 6056 gene locus_tag LOCUS_04800 6931 6056 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 protein_id gnl|my_center|LOCUS_04800 8120 7041 gene locus_tag LOCUS_04810 gene mnmA 8120 7041 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_04810 9542 8262 gene locus_tag LOCUS_04820 9542 8262 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_04820 10513 9578 gene locus_tag LOCUS_04830 gene cysK 10513 9578 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_04830 10733 11164 gene locus_tag LOCUS_04840 10733 11164 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_04840 13248 11167 gene locus_tag LOCUS_04850 13248 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 14162 13275 gene locus_tag LOCUS_04860 14162 13275 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_04860 15065 14163 gene locus_tag LOCUS_04870 15065 14163 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052232.1 protein_id gnl|my_center|LOCUS_04870 16729 15341 gene locus_tag LOCUS_04880 16729 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04880 15516 15593 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16796 16867 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17539 17318 gene locus_tag LOCUS_04890 17539 17318 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903516.1 protein_id gnl|my_center|LOCUS_04890 17955 17650 gene locus_tag LOCUS_04900 17955 17650 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_04900 19486 18257 gene locus_tag LOCUS_04910 19486 18257 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435901.1 protein_id gnl|my_center|LOCUS_04910 20966 19506 gene locus_tag LOCUS_04920 gene guaB 20966 19506 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_04920 21522 21004 gene locus_tag LOCUS_04930 21522 21004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 23152 21542 gene locus_tag LOCUS_04940 23152 21542 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_04940 24158 23256 gene locus_tag LOCUS_04950 24158 23256 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_04950 24370 24197 gene locus_tag LOCUS_04960 24370 24197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 25322 24384 gene locus_tag LOCUS_04970 25322 24384 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_04970 26528 25347 gene locus_tag LOCUS_04980 26528 25347 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_04980 26842 26543 gene locus_tag LOCUS_04990 26842 26543 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_04990 27414 26842 gene locus_tag LOCUS_05000 27414 26842 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_05000 28739 27498 gene locus_tag LOCUS_05010 28739 27498 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965562.1 protein_id gnl|my_center|LOCUS_05010 29655 28858 gene locus_tag LOCUS_05020 gene pgeF 29655 28858 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_05020 30616 29672 gene locus_tag LOCUS_05030 30616 29672 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379732.1 protein_id gnl|my_center|LOCUS_05030 33060 30634 gene locus_tag LOCUS_05040 33060 30634 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_05040 34103 33060 gene locus_tag LOCUS_05050 34103 33060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 34714 34109 gene locus_tag LOCUS_05060 34714 34109 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_05060 35763 34825 gene locus_tag LOCUS_05070 35763 34825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 34854 34926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36680 35802 gene locus_tag LOCUS_05080 gene metF 36680 35802 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_05080 37687 36785 gene locus_tag LOCUS_05090 37687 36785 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 protein_id gnl|my_center|LOCUS_05090 38298 37717 gene locus_tag LOCUS_05100 38298 37717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 38876 38370 gene locus_tag LOCUS_05110 38876 38370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 39995 39261 gene locus_tag LOCUS_05120 39995 39261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 40827 40012 gene locus_tag LOCUS_05130 40827 40012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 41612 40839 gene locus_tag LOCUS_05140 41612 40839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 44007 41680 gene locus_tag LOCUS_05150 44007 41680 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_05150 44101 45123 gene locus_tag LOCUS_05160 gene holA 44101 45123 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460882.1 protein_id gnl|my_center|LOCUS_05160 45486 45157 gene locus_tag LOCUS_05170 45486 45157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 46595 45489 gene locus_tag LOCUS_05180 46595 45489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05180 45526 45621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47307 46615 gene locus_tag LOCUS_05190 47307 46615 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583597.1 protein_id gnl|my_center|LOCUS_05190 48004 47345 gene locus_tag LOCUS_05200 48004 47345 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836677.1 protein_id gnl|my_center|LOCUS_05200 49654 48080 gene locus_tag LOCUS_05210 49654 48080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 50863 49673 gene locus_tag LOCUS_05220 50863 49673 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_05220 51832 50906 gene locus_tag LOCUS_05230 gene argB 51832 50906 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_05230 53143 51911 gene locus_tag LOCUS_05240 gene argJ 53143 51911 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_05240 53657 53157 gene locus_tag LOCUS_05250 53657 53157 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851934.1 protein_id gnl|my_center|LOCUS_05250 54882 53662 gene locus_tag LOCUS_05260 54882 53662 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_05260 55198 55289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence008 109 552 gene locus_tag LOCUS_05270 109 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 571 1287 gene locus_tag LOCUS_05280 571 1287 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_05280 1397 2077 gene locus_tag LOCUS_05290 1397 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 2118 2915 gene locus_tag LOCUS_05300 2118 2915 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656001.1 protein_id gnl|my_center|LOCUS_05300 3064 3387 gene locus_tag LOCUS_05310 3064 3387 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_05310 3384 4142 gene locus_tag LOCUS_05320 3384 4142 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198679.1 protein_id gnl|my_center|LOCUS_05320 4142 4987 gene locus_tag LOCUS_05330 4142 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 5069 5737 gene locus_tag LOCUS_05340 5069 5737 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_05340 5907 6938 gene locus_tag LOCUS_05350 5907 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 7014 7931 gene locus_tag LOCUS_05360 7014 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 7969 9165 gene locus_tag LOCUS_05370 7969 9165 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470559.1 protein_id gnl|my_center|LOCUS_05370 10521 9232 gene locus_tag LOCUS_05380 10521 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 10712 11077 gene locus_tag LOCUS_05390 10712 11077 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_05390 11077 12648 gene locus_tag LOCUS_05400 11077 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 12714 13244 gene locus_tag LOCUS_05410 12714 13244 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464022.1 protein_id gnl|my_center|LOCUS_05410 13237 13650 gene locus_tag LOCUS_05420 13237 13650 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774977.1 protein_id gnl|my_center|LOCUS_05420 14251 13697 gene locus_tag LOCUS_05430 gene cobC 14251 13697 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 protein_id gnl|my_center|LOCUS_05430 14317 16917 gene locus_tag LOCUS_05440 14317 16917 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_05440 16966 18234 gene locus_tag LOCUS_05450 16966 18234 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_05450 18387 19304 gene locus_tag LOCUS_05460 18387 19304 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_05460 19550 20101 gene locus_tag LOCUS_05470 19550 20101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 20261 21649 gene locus_tag LOCUS_05480 20261 21649 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_05480 21702 22403 gene locus_tag LOCUS_05490 21702 22403 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_05490 23178 22408 gene locus_tag LOCUS_05500 gene folP 23178 22408 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_05500 23285 24949 gene locus_tag LOCUS_05510 23285 24949 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678845.1 protein_id gnl|my_center|LOCUS_05510 25134 26510 gene locus_tag LOCUS_05520 25134 26510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 28449 26596 gene locus_tag LOCUS_05530 28449 26596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 28599 29354 gene locus_tag LOCUS_05540 28599 29354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 29371 30255 gene locus_tag LOCUS_05550 29371 30255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 30276 31337 gene locus_tag LOCUS_05560 30276 31337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_05560 31337 32200 gene locus_tag LOCUS_05570 31337 32200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 32200 33660 gene locus_tag LOCUS_05580 32200 33660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 33693 34796 gene locus_tag LOCUS_05590 33693 34796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 34789 36276 gene locus_tag LOCUS_05600 34789 36276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 36364 36813 gene locus_tag LOCUS_05610 36364 36813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 36807 37043 gene locus_tag LOCUS_05620 36807 37043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 37170 38414 gene locus_tag LOCUS_05630 37170 38414 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965728.1 protein_id gnl|my_center|LOCUS_05630 38558 39031 gene locus_tag LOCUS_05640 gene ybaK 38558 39031 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_05640 39057 39953 gene locus_tag LOCUS_05650 39057 39953 CDS product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254509.1 protein_id gnl|my_center|LOCUS_05650 39969 40811 gene locus_tag LOCUS_05660 39969 40811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 40864 41562 gene locus_tag LOCUS_05670 40864 41562 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_05670 41594 42514 gene locus_tag LOCUS_05680 41594 42514 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288005.1 protein_id gnl|my_center|LOCUS_05680 42554 43453 gene locus_tag LOCUS_05690 42554 43453 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_05690 43515 44711 gene locus_tag LOCUS_05700 43515 44711 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_05700 44773 46251 gene locus_tag LOCUS_05710 gene abfA 44773 46251 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_05710 46406 46471 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46655 47896 gene locus_tag LOCUS_05720 46655 47896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 48472 47885 gene locus_tag LOCUS_05730 48472 47885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 49502 48483 gene locus_tag LOCUS_05740 49502 48483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 51114 49528 gene locus_tag LOCUS_05750 51114 49528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence009 610 368 gene locus_tag LOCUS_05760 610 368 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 protein_id gnl|my_center|LOCUS_05760 1430 660 gene locus_tag LOCUS_05770 gene cobS 1430 660 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989692.1 protein_id gnl|my_center|LOCUS_05770 1980 1432 gene locus_tag LOCUS_05780 1980 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3041 1977 gene locus_tag LOCUS_05790 gene cobT 3041 1977 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_05790 3824 3042 gene locus_tag LOCUS_05800 3824 3042 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054292.1 protein_id gnl|my_center|LOCUS_05800 4200 3880 gene locus_tag LOCUS_05810 gene azlD 4200 3880 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_05810 4870 4193 gene locus_tag LOCUS_05820 4870 4193 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_05820 5524 4889 gene locus_tag LOCUS_05830 5524 4889 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_05830 7058 5526 gene locus_tag LOCUS_05840 7058 5526 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_05840 8070 7051 gene locus_tag LOCUS_05850 gene cobD 8070 7051 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_05850 9025 8057 gene locus_tag LOCUS_05860 gene cbiB 9025 8057 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_05860 10385 9018 gene locus_tag LOCUS_05870 10385 9018 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861968.1 protein_id gnl|my_center|LOCUS_05870 11584 10382 gene locus_tag LOCUS_05880 11584 10382 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214081.1 protein_id gnl|my_center|LOCUS_05880 12391 11591 gene locus_tag LOCUS_05890 gene cobK 12391 11591 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392609.1 protein_id gnl|my_center|LOCUS_05890 14211 12391 gene locus_tag LOCUS_05900 14211 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 14966 14208 gene locus_tag LOCUS_05910 14966 14208 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891957.1 protein_id gnl|my_center|LOCUS_05910 16210 15020 gene locus_tag LOCUS_05920 gene cbiD 16210 15020 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836528.1 protein_id gnl|my_center|LOCUS_05920 17002 16235 gene locus_tag LOCUS_05930 17002 16235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 17414 16995 gene locus_tag LOCUS_05940 17414 16995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 17439 17594 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19165 18041 gene locus_tag LOCUS_05950 19165 18041 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682009.1 protein_id gnl|my_center|LOCUS_05950 20197 19235 gene locus_tag LOCUS_05960 20197 19235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 21329 20289 gene locus_tag LOCUS_05970 21329 20289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 22266 21757 gene locus_tag LOCUS_05980 22266 21757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 22808 22278 gene locus_tag LOCUS_05990 22808 22278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 23918 22914 gene locus_tag LOCUS_06000 23918 22914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 25556 23949 gene locus_tag LOCUS_06010 gene rho 25556 23949 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947979.1 protein_id gnl|my_center|LOCUS_06010 27435 25801 gene locus_tag LOCUS_06020 27435 25801 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_06020 28518 27595 gene locus_tag LOCUS_06030 28518 27595 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_06030 29452 28544 gene locus_tag LOCUS_06040 gene truB 29452 28544 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965111.1 protein_id gnl|my_center|LOCUS_06040 30410 29454 gene locus_tag LOCUS_06050 30410 29454 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_06050 30775 30413 gene locus_tag LOCUS_06060 gene rbfA 30775 30413 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_06060 32766 30802 gene locus_tag LOCUS_06070 32766 30802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 32904 33078 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34106 33750 gene locus_tag LOCUS_06080 34106 33750 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020853.1 protein_id gnl|my_center|LOCUS_06080 34365 34093 gene locus_tag LOCUS_06090 34365 34093 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_06090 35613 34393 gene locus_tag LOCUS_06100 gene nusA 35613 34393 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_06100 36102 35641 gene locus_tag LOCUS_06110 36102 35641 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_06110 37793 36234 gene locus_tag LOCUS_06120 gene gpmI 37793 36234 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_06120 37846 38793 gene locus_tag LOCUS_06130 37846 38793 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 protein_id gnl|my_center|LOCUS_06130 39486 38785 gene locus_tag LOCUS_06140 39486 38785 CDS product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107754.1 protein_id gnl|my_center|LOCUS_06140 40232 39498 gene locus_tag LOCUS_06150 40232 39498 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_06150 40974 40330 gene locus_tag LOCUS_06160 40974 40330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 42276 41149 gene locus_tag LOCUS_06170 42276 41149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 43348 42368 gene locus_tag LOCUS_06180 43348 42368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 43676 43407 gene locus_tag LOCUS_06190 43676 43407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence010 1184 237 gene locus_tag LOCUS_06200 1184 237 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966067.1 protein_id gnl|my_center|LOCUS_06200 2551 1184 gene locus_tag LOCUS_06210 2551 1184 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_06210 3706 2642 gene locus_tag LOCUS_06220 3706 2642 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_06220 4467 3844 gene locus_tag LOCUS_06230 gene lexA 4467 3844 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965137.1 protein_id gnl|my_center|LOCUS_06230 4714 5205 gene locus_tag LOCUS_06240 4714 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5844 5275 gene locus_tag LOCUS_06250 gene yqeK 5844 5275 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_06250 6544 5861 gene locus_tag LOCUS_06260 gene nadD 6544 5861 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360011.1 protein_id gnl|my_center|LOCUS_06260 6845 6546 gene locus_tag LOCUS_06270 gene yhbY 6845 6546 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358089.1 protein_id gnl|my_center|LOCUS_06270 8218 6878 gene locus_tag LOCUS_06280 gene obgE 8218 6878 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_06280 8567 8283 gene locus_tag LOCUS_06290 gene rpmA 8567 8283 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 protein_id gnl|my_center|LOCUS_06290 8901 8572 gene locus_tag LOCUS_06300 8901 8572 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816543.1 protein_id gnl|my_center|LOCUS_06300 9219 8914 gene locus_tag LOCUS_06310 gene rplU 9219 8914 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_06310 10466 10674 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcgctggtgcaggagctgg 12341 11274 gene locus_tag LOCUS_06320 12341 11274 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438072.1 protein_id gnl|my_center|LOCUS_06320 13048 12374 gene locus_tag LOCUS_06330 13048 12374 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_06330 14957 13071 gene locus_tag LOCUS_06340 14957 13071 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_06340 16264 14981 gene locus_tag LOCUS_06350 16264 14981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 16877 16293 gene locus_tag LOCUS_06360 gene hisB 16877 16293 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774805.1 protein_id gnl|my_center|LOCUS_06360 17595 16942 gene locus_tag LOCUS_06370 gene hisG 17595 16942 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358779.1 protein_id gnl|my_center|LOCUS_06370 18804 17623 gene locus_tag LOCUS_06380 18804 17623 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_06380 19882 18884 gene locus_tag LOCUS_06390 19882 18884 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_06390 20465 19884 gene locus_tag LOCUS_06400 20465 19884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 21268 20519 gene locus_tag LOCUS_06410 21268 20519 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_06410 22002 21301 gene locus_tag LOCUS_06420 22002 21301 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_06420 22644 22057 gene locus_tag LOCUS_06430 22644 22057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 23132 22644 gene locus_tag LOCUS_06440 gene coaD 23132 22644 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_06440 23683 23135 gene locus_tag LOCUS_06450 gene rsmD 23683 23135 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_06450 25960 23705 gene locus_tag LOCUS_06460 gene gyrA 25960 23705 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703396.1 protein_id gnl|my_center|LOCUS_06460 27928 26003 gene locus_tag LOCUS_06470 gene gyrB 27928 26003 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027445.1 protein_id gnl|my_center|LOCUS_06470 28089 28916 gene locus_tag LOCUS_06480 28089 28916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 30874 28913 gene locus_tag LOCUS_06490 30874 28913 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860962.1 protein_id gnl|my_center|LOCUS_06490 32798 30867 gene locus_tag LOCUS_06500 32798 30867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 33962 32802 gene locus_tag LOCUS_06510 33962 32802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 34045 35091 gene locus_tag LOCUS_06520 34045 35091 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_06520 35946 35149 gene locus_tag LOCUS_06530 35946 35149 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_06530 36550 35960 gene locus_tag LOCUS_06540 gene rsxA 36550 35960 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_06540 37367 36552 gene locus_tag LOCUS_06550 37367 36552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 37961 37380 gene locus_tag LOCUS_06560 37961 37380 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_06560 38929 37961 gene locus_tag LOCUS_06570 38929 37961 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_06570 40260 38938 gene locus_tag LOCUS_06580 gene rsxC 40260 38938 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_06580 40380 41492 gene locus_tag LOCUS_06590 40380 41492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 42345 41572 gene locus_tag LOCUS_06600 gene cheR 42345 41572 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 protein_id gnl|my_center|LOCUS_06600 <43534 42450 gene locus_tag LOCUS_06610 <43534 42450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986222.1:30S ribosomal protein S1 >Feature sequence011 186 1727 gene locus_tag LOCUS_06620 gene gguA 186 1727 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_06620 1729 2901 gene locus_tag LOCUS_06630 gene gguB 1729 2901 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_06630 2917 4083 gene locus_tag LOCUS_06640 gene gguB 2917 4083 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_06640 4286 5134 gene locus_tag LOCUS_06650 gene gmuE 4286 5134 CDS product fructokinase GmuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234095.1 protein_id gnl|my_center|LOCUS_06650 5231 6811 gene locus_tag LOCUS_06660 5231 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 6827 7924 gene locus_tag LOCUS_06670 6827 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 7927 8505 gene locus_tag LOCUS_06680 7927 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 9320 8547 gene locus_tag LOCUS_06690 9320 8547 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_06690 9536 9582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9742 10605 gene locus_tag LOCUS_06700 gene rsmA 9742 10605 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_06700 10610 11110 gene locus_tag LOCUS_06710 10610 11110 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 protein_id gnl|my_center|LOCUS_06710 11237 13036 gene locus_tag LOCUS_06720 11237 13036 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 protein_id gnl|my_center|LOCUS_06720 13115 13951 gene locus_tag LOCUS_06730 13115 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 13970 15775 gene locus_tag LOCUS_06740 13970 15775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 15959 19627 gene locus_tag LOCUS_06750 15959 19627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 19667 21580 gene locus_tag LOCUS_06760 gene glgB 19667 21580 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_06760 21655 22716 gene locus_tag LOCUS_06770 21655 22716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 22845 23783 gene locus_tag LOCUS_06780 gene hprK 22845 23783 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_06780 23806 24741 gene locus_tag LOCUS_06790 23806 24741 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_06790 24763 25716 gene locus_tag LOCUS_06800 gene murB 24763 25716 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_06800 25716 26576 gene locus_tag LOCUS_06810 gene rapZ 25716 26576 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_06810 26576 27217 gene locus_tag LOCUS_06820 26576 27217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 28148 27627 gene locus_tag LOCUS_06830 28148 27627 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_06830 28266 30314 gene locus_tag LOCUS_06840 28266 30314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 30465 31778 gene locus_tag LOCUS_06850 30465 31778 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288195.1 protein_id gnl|my_center|LOCUS_06850 31803 32798 gene locus_tag LOCUS_06860 31803 32798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 32819 33826 gene locus_tag LOCUS_06870 32819 33826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 33823 35346 gene locus_tag LOCUS_06880 33823 35346 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_06880 35382 35624 gene locus_tag LOCUS_06890 35382 35624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 35624 36424 gene locus_tag LOCUS_06900 35624 36424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 36441 37730 gene locus_tag LOCUS_06910 36441 37730 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942610.1 protein_id gnl|my_center|LOCUS_06910 37738 38118 gene locus_tag LOCUS_06920 37738 38118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 38111 38419 gene locus_tag LOCUS_06930 38111 38419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 38440 42105 gene locus_tag LOCUS_06940 38440 42105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 42102 42542 gene locus_tag LOCUS_06950 42102 42542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 42561 42767 gene locus_tag LOCUS_06960 42561 42767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence012 259 3042 gene locus_tag LOCUS_06970 259 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 3093 3881 gene locus_tag LOCUS_06980 gene proC 3093 3881 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783010.1 protein_id gnl|my_center|LOCUS_06980 3914 4348 gene locus_tag LOCUS_06990 gene mscL 3914 4348 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_06990 4602 5189 gene locus_tag LOCUS_07000 4602 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 5264 6418 gene locus_tag LOCUS_07010 5264 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 6430 7755 gene locus_tag LOCUS_07020 6430 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 7728 8513 gene locus_tag LOCUS_07030 7728 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 8529 9062 gene locus_tag LOCUS_07040 gene recU 8529 9062 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_07040 9092 10663 gene locus_tag LOCUS_07050 9092 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 10653 11444 gene locus_tag LOCUS_07060 10653 11444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 11470 11823 gene locus_tag LOCUS_07070 11470 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 11832 12587 gene locus_tag LOCUS_07080 11832 12587 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_07080 12729 13019 gene locus_tag LOCUS_07090 gene rpsF 12729 13019 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883586.1 protein_id gnl|my_center|LOCUS_07090 13035 13472 gene locus_tag LOCUS_07100 13035 13472 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902513.1 protein_id gnl|my_center|LOCUS_07100 13507 13773 gene locus_tag LOCUS_07110 gene rpsR 13507 13773 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_07110 13948 15903 gene locus_tag LOCUS_07120 13948 15903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 16074 16823 gene locus_tag LOCUS_07130 gene larB 16074 16823 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583894.1 protein_id gnl|my_center|LOCUS_07130 16827 18191 gene locus_tag LOCUS_07140 gene larC 16827 18191 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_07140 18193 18564 gene locus_tag LOCUS_07150 18193 18564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 18570 18893 gene locus_tag LOCUS_07160 18570 18893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 18890 20002 gene locus_tag LOCUS_07170 18890 20002 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_07170 20306 20388 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21048 22061 gene locus_tag LOCUS_07180 21048 22061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 22103 23566 gene locus_tag LOCUS_07190 22103 23566 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_07190 23625 24644 gene locus_tag LOCUS_07200 23625 24644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 24659 26404 gene locus_tag LOCUS_07210 24659 26404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_07210 26407 27435 gene locus_tag LOCUS_07220 26407 27435 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013281911.1 protein_id gnl|my_center|LOCUS_07220 27438 28187 gene locus_tag LOCUS_07230 27438 28187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 28199 29557 gene locus_tag LOCUS_07240 28199 29557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 29571 30662 gene locus_tag LOCUS_07250 29571 30662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 32109 30745 gene locus_tag LOCUS_07260 32109 30745 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_07260 32294 33403 gene locus_tag LOCUS_07270 32294 33403 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931322.1 protein_id gnl|my_center|LOCUS_07270 33441 34289 gene locus_tag LOCUS_07280 33441 34289 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892682.1 protein_id gnl|my_center|LOCUS_07280 34373 36832 gene locus_tag LOCUS_07290 34373 36832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 35149 35339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36857 38839 gene locus_tag LOCUS_07300 gene metG 36857 38839 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_07300 38952 39434 gene locus_tag LOCUS_07310 38952 39434 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766887.1 protein_id gnl|my_center|LOCUS_07310 39475 40881 gene locus_tag LOCUS_07320 39475 40881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence013 304 482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 552 752 gene locus_tag LOCUS_07330 552 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 771 1139 gene locus_tag LOCUS_07340 gene rplR 771 1139 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_07340 1158 1667 gene locus_tag LOCUS_07350 gene rpsE 1158 1667 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_07350 1682 1864 gene locus_tag LOCUS_07360 gene rpmD 1682 1864 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693169.1 protein_id gnl|my_center|LOCUS_07360 1927 2367 gene locus_tag LOCUS_07370 gene rplO 1927 2367 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_07370 2367 3689 gene locus_tag LOCUS_07380 gene secY 2367 3689 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_07380 3784 4425 gene locus_tag LOCUS_07390 3784 4425 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_07390 4471 5226 gene locus_tag LOCUS_07400 gene map 4471 5226 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_07400 5239 5457 gene locus_tag LOCUS_07410 gene infA 5239 5457 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_07410 6245 6280 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6385 6789 gene locus_tag LOCUS_07420 gene rpsK 6385 6789 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_07420 6810 7508 gene locus_tag LOCUS_07430 6810 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 7538 8506 gene locus_tag LOCUS_07440 7538 8506 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_07440 8638 9180 gene locus_tag LOCUS_07450 gene rplQ 8638 9180 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_07450 9343 10203 gene locus_tag LOCUS_07460 9343 10203 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_07460 10221 11066 gene locus_tag LOCUS_07470 10221 11066 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435657.1 protein_id gnl|my_center|LOCUS_07470 11087 11914 gene locus_tag LOCUS_07480 11087 11914 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_07480 11914 12711 gene locus_tag LOCUS_07490 gene truA 11914 12711 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_07490 12708 13985 gene locus_tag LOCUS_07500 12708 13985 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_07500 14409 14669 gene locus_tag LOCUS_07510 14409 14669 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_07510 14705 16318 gene locus_tag LOCUS_07520 gene ptsP 14705 16318 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_07520 17155 16400 gene locus_tag LOCUS_07530 17155 16400 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 protein_id gnl|my_center|LOCUS_07530 17490 18398 gene locus_tag LOCUS_07540 gene pfkB 17490 18398 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_07540 18421 20370 gene locus_tag LOCUS_07550 18421 20370 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_07550 20651 21010 gene locus_tag LOCUS_07560 20651 21010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 21044 22939 gene locus_tag LOCUS_07570 21044 22939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 22969 23217 gene locus_tag LOCUS_07580 22969 23217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 23468 23923 gene locus_tag LOCUS_07590 23468 23923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 23923 24684 gene locus_tag LOCUS_07600 23923 24684 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780022.1 protein_id gnl|my_center|LOCUS_07600 25497 25267 gene locus_tag LOCUS_07610 25497 25267 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_07610 25585 26382 gene locus_tag LOCUS_07620 25585 26382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 26445 26867 gene locus_tag LOCUS_07630 26445 26867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 26985 28136 gene locus_tag LOCUS_07640 26985 28136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 29002 28280 gene locus_tag LOCUS_07650 29002 28280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138616.1 protein_id gnl|my_center|LOCUS_07650 29191 30876 gene locus_tag LOCUS_07660 29191 30876 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_07660 30897 31376 gene locus_tag LOCUS_07670 30897 31376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 31659 31988 gene locus_tag LOCUS_07680 31659 31988 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_07680 31992 33356 gene locus_tag LOCUS_07690 31992 33356 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034616.1 protein_id gnl|my_center|LOCUS_07690 33547 34806 gene locus_tag LOCUS_07700 gene hisD 33547 34806 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861261.1 protein_id gnl|my_center|LOCUS_07700 34987 35664 gene locus_tag LOCUS_07710 34987 35664 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476110.1 protein_id gnl|my_center|LOCUS_07710 35731 37848 gene locus_tag LOCUS_07720 gene malZ 35731 37848 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482420.1 protein_id gnl|my_center|LOCUS_07720 37978 38580 gene locus_tag LOCUS_07730 37978 38580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 38666 39508 gene locus_tag LOCUS_07740 38666 39508 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_07740 39528 40088 gene locus_tag LOCUS_07750 39528 40088 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_07750 40129 40857 gene locus_tag LOCUS_07760 40129 40857 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_07760 41038 41131 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence014 1160 534 gene locus_tag LOCUS_07770 1160 534 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_07770 1432 2292 gene locus_tag LOCUS_07780 1432 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3502 2309 gene locus_tag LOCUS_07790 3502 2309 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948824.1 protein_id gnl|my_center|LOCUS_07790 5461 3533 gene locus_tag LOCUS_07800 5461 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5618 5454 gene locus_tag LOCUS_07810 5618 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 7582 5864 gene locus_tag LOCUS_07820 7582 5864 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_07820 8532 7657 gene locus_tag LOCUS_07830 8532 7657 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_07830 9551 8544 gene locus_tag LOCUS_07840 9551 8544 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_07840 10476 9820 gene locus_tag LOCUS_07850 10476 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 11258 10476 gene locus_tag LOCUS_07860 11258 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 13429 11366 gene locus_tag LOCUS_07870 13429 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 14488 13562 gene locus_tag LOCUS_07880 14488 13562 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_07880 16366 14540 gene locus_tag LOCUS_07890 16366 14540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 17406 16387 gene locus_tag LOCUS_07900 gene rsmH 17406 16387 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_07900 17662 18972 gene locus_tag LOCUS_07910 17662 18972 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_07910 19741 19040 gene locus_tag LOCUS_07920 19741 19040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 20733 19729 gene locus_tag LOCUS_07930 20733 19729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 23007 20779 gene locus_tag LOCUS_07940 23007 20779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 24132 23020 gene locus_tag LOCUS_07950 24132 23020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 24547 24155 gene locus_tag LOCUS_07960 24547 24155 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_07960 26460 24691 gene locus_tag LOCUS_07970 26460 24691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582944.1 protein_id gnl|my_center|LOCUS_07970 28197 26479 gene locus_tag LOCUS_07980 28197 26479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582943.1 protein_id gnl|my_center|LOCUS_07980 29629 28493 gene locus_tag LOCUS_07990 29629 28493 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_07990 31530 29650 gene locus_tag LOCUS_08000 gene asnB 31530 29650 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_08000 32627 31545 gene locus_tag LOCUS_08010 32627 31545 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808452.1 protein_id gnl|my_center|LOCUS_08010 33222 32710 gene locus_tag LOCUS_08020 33222 32710 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_08020 33758 33300 gene locus_tag LOCUS_08030 gene nifU 33758 33300 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_08030 34978 33797 gene locus_tag LOCUS_08040 gene nifS 34978 33797 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_08040 36083 35160 gene locus_tag LOCUS_08050 36083 35160 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 protein_id gnl|my_center|LOCUS_08050 36808 36122 gene locus_tag LOCUS_08060 36808 36122 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582683.1 protein_id gnl|my_center|LOCUS_08060 37663 36830 gene locus_tag LOCUS_08070 gene larE 37663 36830 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_08070 38466 37825 gene locus_tag LOCUS_08080 38466 37825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 38465 38650 gene locus_tag LOCUS_08090 38465 38650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 38727 38827 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38968 39063 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <40468 39354 gene locus_tag LOCUS_08100 <40468 39354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000031832.1:recombinase family protein 39427 39490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence015 2588 2085 gene locus_tag LOCUS_08110 2588 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 2721 3134 gene locus_tag LOCUS_08120 2721 3134 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805125.1 protein_id gnl|my_center|LOCUS_08120 3526 4659 gene locus_tag LOCUS_08130 3526 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 5364 4696 gene locus_tag LOCUS_08140 5364 4696 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_08140 6479 5469 gene locus_tag LOCUS_08150 gene pfkA 6479 5469 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_08150 10075 6548 gene locus_tag LOCUS_08160 10075 6548 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_08160 11281 10079 gene locus_tag LOCUS_08170 11281 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 11663 12844 gene locus_tag LOCUS_08180 gene metK 11663 12844 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_08180 13553 12924 gene locus_tag LOCUS_08190 13553 12924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 14772 13564 gene locus_tag LOCUS_08200 14772 13564 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_08200 16175 14880 gene locus_tag LOCUS_08210 16175 14880 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_08210 17871 16297 gene locus_tag LOCUS_08220 17871 16297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 19270 17885 gene locus_tag LOCUS_08230 19270 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 20025 19372 gene locus_tag LOCUS_08240 20025 19372 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723980.1 protein_id gnl|my_center|LOCUS_08240 20152 20418 gene locus_tag LOCUS_08250 20152 20418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 20536 21795 gene locus_tag LOCUS_08260 20536 21795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 23256 21892 gene locus_tag LOCUS_08270 23256 21892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 24266 23256 gene locus_tag LOCUS_08280 gene asnA 24266 23256 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_08280 25690 24299 gene locus_tag LOCUS_08290 gene asnS 25690 24299 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_08290 26694 25711 gene locus_tag LOCUS_08300 26694 25711 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_08300 26883 27857 gene locus_tag LOCUS_08310 26883 27857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 29083 27914 gene locus_tag LOCUS_08320 29083 27914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 30324 29236 gene locus_tag LOCUS_08330 gene gmd 30324 29236 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_08330 33963 30397 gene locus_tag LOCUS_08340 gene mfd 33963 30397 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_08340 34544 33975 gene locus_tag LOCUS_08350 gene pth 34544 33975 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_08350 35090 34596 gene locus_tag LOCUS_08360 35090 34596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 35793 35134 gene locus_tag LOCUS_08370 35793 35134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 36154 35900 gene locus_tag LOCUS_08380 gene spoVG 36154 35900 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_08380 37301 36177 gene locus_tag LOCUS_08390 gene glgD 37301 36177 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_08390 38572 37298 gene locus_tag LOCUS_08400 38572 37298 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence016 639 43 gene locus_tag LOCUS_08410 639 43 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963355.1 protein_id gnl|my_center|LOCUS_08410 1763 690 gene locus_tag LOCUS_08420 1763 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2025 1837 gene locus_tag LOCUS_08430 2025 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 3826 2090 gene locus_tag LOCUS_08440 3826 2090 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_08440 4547 3849 gene locus_tag LOCUS_08450 4547 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 5680 4565 gene locus_tag LOCUS_08460 5680 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 6384 5833 gene locus_tag LOCUS_08470 6384 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 7758 6415 gene locus_tag LOCUS_08480 7758 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 8599 7892 gene locus_tag LOCUS_08490 8599 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 9438 8620 gene locus_tag LOCUS_08500 9438 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 10014 9457 gene locus_tag LOCUS_08510 10014 9457 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_08510 10559 10011 gene locus_tag LOCUS_08520 10559 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 12076 10631 gene locus_tag LOCUS_08530 gene glgA 12076 10631 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_08530 13341 12124 gene locus_tag LOCUS_08540 13341 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 15149 13458 gene locus_tag LOCUS_08550 gene recN 15149 13458 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_08550 16035 15199 gene locus_tag LOCUS_08560 16035 15199 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_08560 16838 16032 gene locus_tag LOCUS_08570 16838 16032 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_08570 18739 16847 gene locus_tag LOCUS_08580 gene dxs 18739 16847 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_08580 19734 18814 gene locus_tag LOCUS_08590 19734 18814 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_08590 19963 19736 gene locus_tag LOCUS_08600 19963 19736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 21158 19953 gene locus_tag LOCUS_08610 gene xseA 21158 19953 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965382.1 protein_id gnl|my_center|LOCUS_08610 21565 21164 gene locus_tag LOCUS_08620 gene nusB 21565 21164 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_08620 21952 21584 gene locus_tag LOCUS_08630 21952 21584 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965385.1 protein_id gnl|my_center|LOCUS_08630 23339 22035 gene locus_tag LOCUS_08640 23339 22035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 25002 23407 gene locus_tag LOCUS_08650 25002 23407 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_08650 26373 25084 gene locus_tag LOCUS_08660 gene ftsZ 26373 25084 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_08660 27338 26520 gene locus_tag LOCUS_08670 27338 26520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 28479 27322 gene locus_tag LOCUS_08680 gene spoVE 28479 27322 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_08680 29849 28479 gene locus_tag LOCUS_08690 gene murD 29849 28479 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_08690 30863 29883 gene locus_tag LOCUS_08700 gene mraY 30863 29883 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_08700 33075 30865 gene locus_tag LOCUS_08710 33075 30865 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965429.1 protein_id gnl|my_center|LOCUS_08710 33509 33084 gene locus_tag LOCUS_08720 33509 33084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 34406 33525 gene locus_tag LOCUS_08730 gene rsmH 34406 33525 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_08730 34903 34472 gene locus_tag LOCUS_08740 gene mraZ 34903 34472 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_08740 36017 35088 gene locus_tag LOCUS_08750 gene lgt 36017 35088 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722614.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence017 346 1527 gene locus_tag LOCUS_08760 346 1527 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_08760 1740 2609 gene locus_tag LOCUS_08770 1740 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08770 2526 2601 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3216 3419 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3459 3833 gene locus_tag LOCUS_08780 3459 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 4160 4247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4259 5272 gene locus_tag LOCUS_08790 gene srtB 4259 5272 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_08790 5301 10181 gene locus_tag LOCUS_08800 5301 10181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 10185 11702 gene locus_tag LOCUS_08810 10185 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 11733 12947 gene locus_tag LOCUS_08820 11733 12947 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_08820 12981 13583 gene locus_tag LOCUS_08830 12981 13583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 13614 15110 gene locus_tag LOCUS_08840 13614 15110 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048317.1 protein_id gnl|my_center|LOCUS_08840 15122 16267 gene locus_tag LOCUS_08850 gene alr 15122 16267 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_08850 16412 17146 gene locus_tag LOCUS_08860 16412 17146 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_08860 17166 18116 gene locus_tag LOCUS_08870 17166 18116 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 protein_id gnl|my_center|LOCUS_08870 18119 20563 gene locus_tag LOCUS_08880 18119 20563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 20594 21043 gene locus_tag LOCUS_08890 20594 21043 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_08890 21046 21351 gene locus_tag LOCUS_08900 21046 21351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 21367 22407 gene locus_tag LOCUS_08910 21367 22407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 22408 22800 gene locus_tag LOCUS_08920 22408 22800 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 protein_id gnl|my_center|LOCUS_08920 22809 23387 gene locus_tag LOCUS_08930 22809 23387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 23657 23472 gene locus_tag LOCUS_08940 gene rpmB 23657 23472 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_08940 23864 25588 gene locus_tag LOCUS_08950 23864 25588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 25639 27105 gene locus_tag LOCUS_08960 25639 27105 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_08960 27207 27563 gene locus_tag LOCUS_08970 27207 27563 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395974.1 protein_id gnl|my_center|LOCUS_08970 27577 29238 gene locus_tag LOCUS_08980 27577 29238 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_08980 29245 31296 gene locus_tag LOCUS_08990 gene recG 29245 31296 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_08990 31357 32226 gene locus_tag LOCUS_09000 31357 32226 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286075.1 protein_id gnl|my_center|LOCUS_09000 32379 33632 gene locus_tag LOCUS_09010 32379 33632 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_09010 33703 34359 gene locus_tag LOCUS_09020 gene cmk 33703 34359 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence018 186 470 gene locus_tag LOCUS_09030 186 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 475 2418 gene locus_tag LOCUS_09040 475 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2526 3263 gene locus_tag LOCUS_09050 2526 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 3264 3638 gene locus_tag LOCUS_09060 3264 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 3635 5032 gene locus_tag LOCUS_09070 3635 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 5029 6450 gene locus_tag LOCUS_09080 5029 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 6413 9079 gene locus_tag LOCUS_09090 6413 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09090 9196 10593 gene locus_tag LOCUS_09100 9196 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10802 12310 gene locus_tag LOCUS_09110 10802 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 12459 13709 gene locus_tag LOCUS_09120 gene hisS 12459 13709 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_09120 13728 15569 gene locus_tag LOCUS_09130 gene aspS 13728 15569 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_09130 15652 16242 gene locus_tag LOCUS_09140 15652 16242 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964638.1 protein_id gnl|my_center|LOCUS_09140 16272 17621 gene locus_tag LOCUS_09150 16272 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 17723 19462 gene locus_tag LOCUS_09160 gene iorA 17723 19462 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_09160 19481 20050 gene locus_tag LOCUS_09170 19481 20050 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_09170 20101 20415 gene locus_tag LOCUS_09180 20101 20415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 21375 20497 gene locus_tag LOCUS_09190 21375 20497 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288377.1 protein_id gnl|my_center|LOCUS_09190 21541 21613 gene locus_tag LOCUS_t00110 21541 21613 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 21692 22075 gene locus_tag LOCUS_09200 21692 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 22121 23077 gene locus_tag LOCUS_09210 22121 23077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 23092 24693 gene locus_tag LOCUS_09220 23092 24693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 24729 26468 gene locus_tag LOCUS_09230 24729 26468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 26492 27187 gene locus_tag LOCUS_09240 26492 27187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 27214 28638 gene locus_tag LOCUS_09250 27214 28638 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_09250 28646 30055 gene locus_tag LOCUS_09260 28646 30055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 31470 30052 gene locus_tag LOCUS_09270 31470 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 31658 32854 gene locus_tag LOCUS_09280 31658 32854 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_09280 33044 34033 gene locus_tag LOCUS_09290 gene cysK 33044 34033 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_09290 34114 34179 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence019 2341 671 gene locus_tag LOCUS_09300 2341 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 3069 2338 gene locus_tag LOCUS_09310 3069 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4420 3089 gene locus_tag LOCUS_09320 4420 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 5376 4525 gene locus_tag LOCUS_09330 5376 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 5825 5376 gene locus_tag LOCUS_09340 gene fliJ 5825 5376 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392296.1 protein_id gnl|my_center|LOCUS_09340 7150 5843 gene locus_tag LOCUS_09350 gene fliI 7150 5843 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082899.1 protein_id gnl|my_center|LOCUS_09350 8006 7152 gene locus_tag LOCUS_09360 8006 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 9009 7999 gene locus_tag LOCUS_09370 gene fliG 9009 7999 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_09370 10629 9022 gene locus_tag LOCUS_09380 10629 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 11010 10687 gene locus_tag LOCUS_09390 11010 10687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 11516 11028 gene locus_tag LOCUS_09400 gene flgC 11516 11028 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858484.1 protein_id gnl|my_center|LOCUS_09400 11920 11531 gene locus_tag LOCUS_09410 gene flgB 11920 11531 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_09410 12997 12236 gene locus_tag LOCUS_09420 gene codY 12997 12236 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362579.1 protein_id gnl|my_center|LOCUS_09420 13862 12990 gene locus_tag LOCUS_09430 13862 12990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 13896 14039 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17831 14271 gene locus_tag LOCUS_09440 gene smc 17831 14271 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861158.1 protein_id gnl|my_center|LOCUS_09440 18544 17837 gene locus_tag LOCUS_09450 gene rnc 18544 17837 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_09450 18791 18546 gene locus_tag LOCUS_09460 18791 18546 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723866.1 protein_id gnl|my_center|LOCUS_09460 19804 18794 gene locus_tag LOCUS_09470 gene plsX 19804 18794 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_09470 20126 19947 gene locus_tag LOCUS_09480 gene rpmF 20126 19947 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_09480 22458 20218 gene locus_tag LOCUS_09490 22458 20218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 23558 22551 gene locus_tag LOCUS_09500 gene pta 23558 22551 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_09500 23790 24872 gene locus_tag LOCUS_09510 23790 24872 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475793.1 protein_id gnl|my_center|LOCUS_09510 26243 24879 gene locus_tag LOCUS_09520 26243 24879 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815306.1 protein_id gnl|my_center|LOCUS_09520 26566 26294 gene locus_tag LOCUS_09530 26566 26294 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_09530 27403 26606 gene locus_tag LOCUS_09540 27403 26606 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_09540 29511 27406 gene locus_tag LOCUS_09550 29511 27406 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964331.1 protein_id gnl|my_center|LOCUS_09550 30101 29514 gene locus_tag LOCUS_09560 gene coaE 30101 29514 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881297.1 protein_id gnl|my_center|LOCUS_09560 32847 30133 gene locus_tag LOCUS_09570 gene polA 32847 30133 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_09570 33167 32844 gene locus_tag LOCUS_09580 33167 32844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 33271 33353 gene locus_tag LOCUS_t00120 33271 33353 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <34609 33420 gene locus_tag LOCUS_09590 <34609 33420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965428.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence020 1941 88 gene locus_tag LOCUS_09600 gene typA 1941 88 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_09600 328 439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2158 3261 gene locus_tag LOCUS_09610 2158 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3776 3288 gene locus_tag LOCUS_09620 3776 3288 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043263.1 protein_id gnl|my_center|LOCUS_09620 4456 3776 gene locus_tag LOCUS_09630 gene thyX 4456 3776 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869567.1 protein_id gnl|my_center|LOCUS_09630 5886 4531 gene locus_tag LOCUS_09640 gene mgtE 5886 4531 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_09640 6582 5917 gene locus_tag LOCUS_09650 6582 5917 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_09650 6815 9478 gene locus_tag LOCUS_09660 6815 9478 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535017.1 protein_id gnl|my_center|LOCUS_09660 10212 9595 gene locus_tag LOCUS_09670 10212 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 10699 10232 gene locus_tag LOCUS_09680 10699 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 11246 10890 gene locus_tag LOCUS_09690 gene rplT 11246 10890 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_09690 11464 11267 gene locus_tag LOCUS_09700 gene rpmI 11464 11267 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_09700 12079 11504 gene locus_tag LOCUS_09710 gene infC 12079 11504 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355797.1 protein_id gnl|my_center|LOCUS_09710 13186 12365 gene locus_tag LOCUS_09720 13186 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 13244 13376 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14357 13848 gene locus_tag LOCUS_09730 14357 13848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 15828 14401 gene locus_tag LOCUS_09740 15828 14401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 14418 14518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16345 16181 gene locus_tag LOCUS_09750 16345 16181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 18259 16391 gene locus_tag LOCUS_09760 gene glmS 18259 16391 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_09760 18985 18305 gene locus_tag LOCUS_09770 18985 18305 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_09770 20459 19074 gene locus_tag LOCUS_09780 gene glmM 20459 19074 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521416.1 protein_id gnl|my_center|LOCUS_09780 21439 20504 gene locus_tag LOCUS_09790 21439 20504 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_09790 22753 21452 gene locus_tag LOCUS_09800 22753 21452 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_09800 23508 22897 gene locus_tag LOCUS_09810 gene sigH 23508 22897 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892548.1 protein_id gnl|my_center|LOCUS_09810 24287 23550 gene locus_tag LOCUS_09820 gene rlmB 24287 23550 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_09820 24817 24359 gene locus_tag LOCUS_09830 24817 24359 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_09830 26214 24802 gene locus_tag LOCUS_09840 gene cysS 26214 24802 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_09840 26848 26309 gene locus_tag LOCUS_09850 gene ispF 26848 26309 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_09850 27681 26866 gene locus_tag LOCUS_09860 27681 26866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 28451 27759 gene locus_tag LOCUS_09870 28451 27759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 30177 28531 gene locus_tag LOCUS_09880 30177 28531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 30815 30318 gene locus_tag LOCUS_09890 30815 30318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 31155 30808 gene locus_tag LOCUS_09900 31155 30808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 32410 31148 gene locus_tag LOCUS_09910 32410 31148 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 protein_id gnl|my_center|LOCUS_09910 32984 32424 gene locus_tag LOCUS_09920 32984 32424 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_09920 33143 33069 gene locus_tag LOCUS_t00130 33143 33069 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 33241 33169 gene locus_tag LOCUS_t00140 33241 33169 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 33538 33338 gene locus_tag LOCUS_09930 33538 33338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 33802 33836 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence021 33 1019 gene locus_tag LOCUS_09940 gene cysK 33 1019 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203747.1 protein_id gnl|my_center|LOCUS_09940 1023 2369 gene locus_tag LOCUS_09950 1023 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_09950 2382 3746 gene locus_tag LOCUS_09960 2382 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3958 4593 gene locus_tag LOCUS_09970 3958 4593 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531484.1 protein_id gnl|my_center|LOCUS_09970 4614 5762 gene locus_tag LOCUS_09980 4614 5762 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_09980 5812 6894 gene locus_tag LOCUS_09990 5812 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 6952 7299 gene locus_tag LOCUS_10000 6952 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 7414 8292 gene locus_tag LOCUS_10010 7414 8292 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_10010 8316 8573 gene locus_tag LOCUS_10020 gene remA 8316 8573 CDS product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 protein_id gnl|my_center|LOCUS_10020 8563 9195 gene locus_tag LOCUS_10030 gene gmk 8563 9195 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699957.1 protein_id gnl|my_center|LOCUS_10030 9199 9447 gene locus_tag LOCUS_10040 9199 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 9660 10139 gene locus_tag LOCUS_10050 9660 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 10349 11617 gene locus_tag LOCUS_10060 gene rimO 10349 11617 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_10060 11617 12237 gene locus_tag LOCUS_10070 gene pgsA 11617 12237 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965120.1 protein_id gnl|my_center|LOCUS_10070 12261 13559 gene locus_tag LOCUS_10080 12261 13559 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_10080 13950 15008 gene locus_tag LOCUS_10090 gene recA 13950 15008 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_10090 14995 15615 gene locus_tag LOCUS_10100 14995 15615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 15729 17285 gene locus_tag LOCUS_10110 gene rny 15729 17285 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_10110 17492 17575 gene locus_tag LOCUS_t00150 17492 17575 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17637 18056 gene locus_tag LOCUS_10120 17637 18056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 18148 18232 gene locus_tag LOCUS_t00160 18148 18232 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18403 20133 gene locus_tag LOCUS_10130 18403 20133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 22113 20134 gene locus_tag LOCUS_10140 22113 20134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 23392 22643 gene locus_tag LOCUS_10150 23392 22643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 23333 23605 gene locus_tag LOCUS_10160 23333 23605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 24618 23677 gene locus_tag LOCUS_10170 24618 23677 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_10170 24781 27078 gene locus_tag LOCUS_10180 24781 27078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 27208 27735 gene locus_tag LOCUS_10190 27208 27735 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_10190 28792 29005 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29697 30680 gene locus_tag LOCUS_10200 29697 30680 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_10200 30694 31542 gene locus_tag LOCUS_10210 30694 31542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 31593 33863 gene locus_tag LOCUS_10220 31593 33863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence022 229 1302 gene locus_tag LOCUS_10230 229 1302 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311043.1 protein_id gnl|my_center|LOCUS_10230 1378 2895 gene locus_tag LOCUS_10240 1378 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3008 3091 gene locus_tag LOCUS_t00170 3008 3091 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3403 4248 gene locus_tag LOCUS_10250 3403 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4348 9303 gene locus_tag LOCUS_10260 4348 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 9335 10012 gene locus_tag LOCUS_10270 9335 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 10009 13773 gene locus_tag LOCUS_10280 10009 13773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 13754 13987 gene locus_tag LOCUS_10290 13754 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 14192 18985 gene locus_tag LOCUS_10300 14192 18985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 19086 19967 gene locus_tag LOCUS_10310 19086 19967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 20013 21620 gene locus_tag LOCUS_10320 20013 21620 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_10320 21623 23071 gene locus_tag LOCUS_10330 21623 23071 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288002.1 protein_id gnl|my_center|LOCUS_10330 23376 24368 gene locus_tag LOCUS_10340 23376 24368 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_10340 24504 26021 gene locus_tag LOCUS_10350 24504 26021 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_10350 26014 27093 gene locus_tag LOCUS_10360 26014 27093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_10360 27098 28147 gene locus_tag LOCUS_10370 gene yjfF 27098 28147 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_10370 28174 29412 gene locus_tag LOCUS_10380 28174 29412 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_10380 29463 30479 gene locus_tag LOCUS_10390 29463 30479 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_10390 30519 30854 gene locus_tag LOCUS_10400 30519 30854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 30865 31362 gene locus_tag LOCUS_10410 30865 31362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 32455 31340 gene locus_tag LOCUS_10420 32455 31340 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence023 146 1117 gene locus_tag LOCUS_10430 146 1117 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047820.1 protein_id gnl|my_center|LOCUS_10430 1232 1897 gene locus_tag LOCUS_10440 1232 1897 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_10440 1948 2442 gene locus_tag LOCUS_10450 1948 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2606 4345 gene locus_tag LOCUS_10460 2606 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4351 4758 gene locus_tag LOCUS_10470 4351 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 4783 6939 gene locus_tag LOCUS_10480 4783 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 6970 7572 gene locus_tag LOCUS_10490 6970 7572 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_10490 7644 8552 gene locus_tag LOCUS_10500 7644 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 8556 9782 gene locus_tag LOCUS_10510 8556 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 10367 9774 gene locus_tag LOCUS_10520 10367 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 11215 10400 gene locus_tag LOCUS_10530 gene coaW 11215 10400 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440556.1 protein_id gnl|my_center|LOCUS_10530 11296 11835 gene locus_tag LOCUS_10540 11296 11835 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 protein_id gnl|my_center|LOCUS_10540 11853 12464 gene locus_tag LOCUS_10550 11853 12464 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005646.1 protein_id gnl|my_center|LOCUS_10550 12583 13551 gene locus_tag LOCUS_10560 12583 13551 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_10560 13565 15598 gene locus_tag LOCUS_10570 13565 15598 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_10570 15605 16762 gene locus_tag LOCUS_10580 gene nagA 15605 16762 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861065.1 protein_id gnl|my_center|LOCUS_10580 16778 17449 gene locus_tag LOCUS_10590 16778 17449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 19911 17524 gene locus_tag LOCUS_10600 19911 17524 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_10600 20267 21550 gene locus_tag LOCUS_10610 20267 21550 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_10610 21687 23450 gene locus_tag LOCUS_10620 21687 23450 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_10620 23487 24050 gene locus_tag LOCUS_10630 23487 24050 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194850.1 protein_id gnl|my_center|LOCUS_10630 24285 25169 gene locus_tag LOCUS_10640 gene xerD 24285 25169 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_10640 25301 25777 gene locus_tag LOCUS_10650 25301 25777 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_10650 26652 25828 gene locus_tag LOCUS_10660 26652 25828 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_10660 26762 27265 gene locus_tag LOCUS_10670 gene rlmH 26762 27265 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048404.1 protein_id gnl|my_center|LOCUS_10670 27281 27724 gene locus_tag LOCUS_10680 27281 27724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 28425 27760 gene locus_tag LOCUS_10690 28425 27760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 28594 29574 gene locus_tag LOCUS_10700 28594 29574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 29587 30576 gene locus_tag LOCUS_10710 29587 30576 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089248.1 protein_id gnl|my_center|LOCUS_10710 30833 32449 gene locus_tag LOCUS_10720 30833 32449 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence024 1203 544 gene locus_tag LOCUS_10730 1203 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2724 1270 gene locus_tag LOCUS_10740 2724 1270 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_10740 3357 2749 gene locus_tag LOCUS_10750 3357 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3566 3378 gene locus_tag LOCUS_10760 3566 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3718 4740 gene locus_tag LOCUS_10770 3718 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5078 4749 gene locus_tag LOCUS_10780 5078 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6323 5151 gene locus_tag LOCUS_10790 6323 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 7007 6324 gene locus_tag LOCUS_10800 7007 6324 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_10800 7934 7020 gene locus_tag LOCUS_10810 7934 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 8871 8164 gene locus_tag LOCUS_10820 8871 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 9796 8882 gene locus_tag LOCUS_10830 9796 8882 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_10830 10803 9808 gene locus_tag LOCUS_10840 10803 9808 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_10840 12645 10912 gene locus_tag LOCUS_10850 12645 10912 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_10850 14423 12828 gene locus_tag LOCUS_10860 14423 12828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 16206 14437 gene locus_tag LOCUS_10870 16206 14437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 15010 15082 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19268 16344 gene locus_tag LOCUS_10880 19268 16344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 22717 19268 gene locus_tag LOCUS_10890 gene xynA 22717 19268 CDS product endo-1,4-beta-xylanase XynA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082550.1 protein_id gnl|my_center|LOCUS_10890 23901 22870 gene locus_tag LOCUS_10900 23901 22870 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_10900 24539 23901 gene locus_tag LOCUS_10910 24539 23901 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477517.1 protein_id gnl|my_center|LOCUS_10910 24811 26211 gene locus_tag LOCUS_10920 gene uxaC 24811 26211 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_10920 27658 26306 gene locus_tag LOCUS_10930 27658 26306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 29685 28030 gene locus_tag LOCUS_10940 29685 28030 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_10940 30489 29707 gene locus_tag LOCUS_10950 30489 29707 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_10950 31197 30490 gene locus_tag LOCUS_10960 31197 30490 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence025 573 217 gene locus_tag LOCUS_10970 573 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1000 584 gene locus_tag LOCUS_10980 1000 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 13254 1105 gene locus_tag LOCUS_10990 13254 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 14324 13419 gene locus_tag LOCUS_11000 14324 13419 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_11000 14835 14314 gene locus_tag LOCUS_11010 gene lspA 14835 14314 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364048.1 protein_id gnl|my_center|LOCUS_11010 15950 14835 gene locus_tag LOCUS_11020 gene aroB 15950 14835 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261933.1 protein_id gnl|my_center|LOCUS_11020 16516 16055 gene locus_tag LOCUS_11030 16516 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 17370 16678 gene locus_tag LOCUS_11040 17370 16678 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_11040 18955 17588 gene locus_tag LOCUS_11050 18955 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 19446 19033 gene locus_tag LOCUS_11060 19446 19033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_11060 20539 19547 gene locus_tag LOCUS_11070 20539 19547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 20918 20523 gene locus_tag LOCUS_11080 20918 20523 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438060.1 protein_id gnl|my_center|LOCUS_11080 22067 20949 gene locus_tag LOCUS_11090 gene rodA 22067 20949 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_11090 24929 22071 gene locus_tag LOCUS_11100 24929 22071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 25353 24919 gene locus_tag LOCUS_11110 25353 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 26317 25451 gene locus_tag LOCUS_11120 gene mreC 26317 25451 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700471.1 protein_id gnl|my_center|LOCUS_11120 27337 26342 gene locus_tag LOCUS_11130 27337 26342 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_11130 28357 27404 gene locus_tag LOCUS_11140 gene miaA 28357 27404 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_11140 <29526 28372 gene locus_tag LOCUS_11150 <29526 28372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965141.1:DNA mismatch repair endonuclease MutL >Feature sequence026 9028 272 gene locus_tag LOCUS_11160 9028 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 9860 9042 gene locus_tag LOCUS_11170 9860 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 10445 9990 gene locus_tag LOCUS_11180 10445 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 11048 10494 gene locus_tag LOCUS_11190 11048 10494 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130171.1 protein_id gnl|my_center|LOCUS_11190 11375 14599 gene locus_tag LOCUS_11200 gene carB 11375 14599 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_11200 15258 14752 gene locus_tag LOCUS_11210 15258 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 17485 15344 gene locus_tag LOCUS_11220 17485 15344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 18011 17478 gene locus_tag LOCUS_11230 18011 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 18062 18230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21078 18688 gene locus_tag LOCUS_11240 21078 18688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 22599 21226 gene locus_tag LOCUS_11250 22599 21226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 24642 22618 gene locus_tag LOCUS_11260 24642 22618 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_11260 24778 24813 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26109 24838 gene locus_tag LOCUS_11270 26109 24838 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_11270 26330 26121 gene locus_tag LOCUS_11280 26330 26121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 26599 26880 gene locus_tag LOCUS_11290 26599 26880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 27579 26944 gene locus_tag LOCUS_11300 27579 26944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 27967 27611 gene locus_tag LOCUS_11310 27967 27611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence027 161 964 gene locus_tag LOCUS_11320 161 964 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943655.1 protein_id gnl|my_center|LOCUS_11320 1007 1519 gene locus_tag LOCUS_11330 1007 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1559 2545 gene locus_tag LOCUS_11340 gene fliM 1559 2545 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_11340 2545 3393 gene locus_tag LOCUS_11350 2545 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11350 3294 3341 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3366 3770 gene locus_tag LOCUS_11360 3366 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11360 3775 4158 gene locus_tag LOCUS_11370 3775 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 4211 5008 gene locus_tag LOCUS_11380 4211 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 5112 5208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5329 6117 gene locus_tag LOCUS_11390 5329 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11390 6117 7238 gene locus_tag LOCUS_11400 gene flhB 6117 7238 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_11400 7275 9314 gene locus_tag LOCUS_11410 gene flhA 7275 9314 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_11410 9363 10619 gene locus_tag LOCUS_11420 gene flhF 9363 10619 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_11420 10674 11573 gene locus_tag LOCUS_11430 10674 11573 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460747.1 protein_id gnl|my_center|LOCUS_11430 11563 12288 gene locus_tag LOCUS_11440 11563 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 12413 13444 gene locus_tag LOCUS_11450 12413 13444 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083251.1 protein_id gnl|my_center|LOCUS_11450 13492 15576 gene locus_tag LOCUS_11460 13492 15576 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965518.1 protein_id gnl|my_center|LOCUS_11460 15590 16033 gene locus_tag LOCUS_11470 15590 16033 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066438.1 protein_id gnl|my_center|LOCUS_11470 16051 16662 gene locus_tag LOCUS_11480 16051 16662 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_11480 16682 17167 gene locus_tag LOCUS_11490 16682 17167 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_11490 17170 17454 gene locus_tag LOCUS_11500 17170 17454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 17503 18270 gene locus_tag LOCUS_11510 gene whiG 17503 18270 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_11510 19455 19600 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19622 19978 gene locus_tag LOCUS_11520 19622 19978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 20014 20958 gene locus_tag LOCUS_11530 20014 20958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 20977 21720 gene locus_tag LOCUS_11540 20977 21720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 21829 23328 gene locus_tag LOCUS_11550 21829 23328 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_11550 23415 24371 gene locus_tag LOCUS_11560 23415 24371 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973851.1 protein_id gnl|my_center|LOCUS_11560 24371 25201 gene locus_tag LOCUS_11570 24371 25201 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384741.1 protein_id gnl|my_center|LOCUS_11570 25744 25870 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26438 26556 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence028 <1 671 gene locus_tag LOCUS_11580 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965898.1:L-fucose/L-arabinose isomerase family protein 861 2987 gene locus_tag LOCUS_11590 861 2987 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_11590 3064 3855 gene locus_tag LOCUS_11600 3064 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4490 3852 gene locus_tag LOCUS_11610 4490 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4760 6202 gene locus_tag LOCUS_11620 4760 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 6299 7288 gene locus_tag LOCUS_11630 6299 7288 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_11630 7291 8169 gene locus_tag LOCUS_11640 7291 8169 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_11640 8312 9022 gene locus_tag LOCUS_11650 8312 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 9483 9025 gene locus_tag LOCUS_11660 9483 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 9595 9666 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10097 10975 gene locus_tag LOCUS_11670 10097 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11670 10927 10940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11043 11219 gene locus_tag LOCUS_11680 11043 11219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11680 11242 12786 gene locus_tag LOCUS_11690 11242 12786 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_11690 12890 15730 gene locus_tag LOCUS_11700 12890 15730 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_11700 15748 17370 gene locus_tag LOCUS_11710 15748 17370 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_11710 17932 17414 gene locus_tag LOCUS_11720 17932 17414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 18875 17901 gene locus_tag LOCUS_11730 18875 17901 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_11730 20027 18879 gene locus_tag LOCUS_11740 20027 18879 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_11740 20411 20902 gene locus_tag LOCUS_11750 20411 20902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 21060 23009 gene locus_tag LOCUS_11760 gene ligA 21060 23009 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_11760 23084 24004 gene locus_tag LOCUS_11770 gene metA 23084 24004 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080711.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence029 250 1761 gene locus_tag LOCUS_11780 250 1761 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_11780 1764 2849 gene locus_tag LOCUS_11790 1764 2849 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_11790 2842 3876 gene locus_tag LOCUS_11800 gene yjfF 2842 3876 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_11800 3898 4959 gene locus_tag LOCUS_11810 3898 4959 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_11810 5991 5011 gene locus_tag LOCUS_11820 5991 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6250 7185 gene locus_tag LOCUS_11830 6250 7185 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583074.1 protein_id gnl|my_center|LOCUS_11830 7196 8320 gene locus_tag LOCUS_11840 7196 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 8324 9625 gene locus_tag LOCUS_11850 8324 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 9610 10680 gene locus_tag LOCUS_11860 9610 10680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 10704 11219 gene locus_tag LOCUS_11870 10704 11219 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_11870 11959 11306 gene locus_tag LOCUS_11880 11959 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 12193 12702 gene locus_tag LOCUS_11890 12193 12702 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286069.1 protein_id gnl|my_center|LOCUS_11890 12734 13336 gene locus_tag LOCUS_11900 12734 13336 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393868.1 protein_id gnl|my_center|LOCUS_11900 13488 14498 gene locus_tag LOCUS_11910 13488 14498 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_11910 14614 16821 gene locus_tag LOCUS_11920 14614 16821 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 protein_id gnl|my_center|LOCUS_11920 16842 17756 gene locus_tag LOCUS_11930 16842 17756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 17857 18252 gene locus_tag LOCUS_11940 17857 18252 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358764.1 protein_id gnl|my_center|LOCUS_11940 18279 19436 gene locus_tag LOCUS_11950 18279 19436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 19469 20101 gene locus_tag LOCUS_11960 19469 20101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 20147 21130 gene locus_tag LOCUS_11970 20147 21130 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_11970 21130 21309 gene locus_tag LOCUS_11980 21130 21309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 21524 22078 gene locus_tag LOCUS_11990 21524 22078 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840041.1 protein_id gnl|my_center|LOCUS_11990 22075 22896 gene locus_tag LOCUS_12000 22075 22896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 23350 23814 gene locus_tag LOCUS_12010 23350 23814 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493263.1 protein_id gnl|my_center|LOCUS_12010 23850 24647 gene locus_tag LOCUS_12020 23850 24647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence030 680 348 gene locus_tag LOCUS_12030 680 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 806 1387 gene locus_tag LOCUS_12040 806 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1775 2476 gene locus_tag LOCUS_12050 1775 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2874 3431 gene locus_tag LOCUS_12060 2874 3431 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_12060 3947 3570 gene locus_tag LOCUS_12070 3947 3570 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_12070 4159 4371 gene locus_tag LOCUS_12080 4159 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 4520 6517 gene locus_tag LOCUS_12090 gene feoB 4520 6517 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399646.1 protein_id gnl|my_center|LOCUS_12090 6601 6738 gene locus_tag LOCUS_12100 6601 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 6835 7170 gene locus_tag LOCUS_12110 6835 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 7301 8221 gene locus_tag LOCUS_12120 7301 8221 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_12120 8222 9385 gene locus_tag LOCUS_12130 8222 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 9385 11628 gene locus_tag LOCUS_12140 9385 11628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 11834 12754 gene locus_tag LOCUS_12150 11834 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 12816 12992 gene locus_tag LOCUS_12160 12816 12992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 13063 15342 gene locus_tag LOCUS_12170 13063 15342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 15404 17095 gene locus_tag LOCUS_12180 15404 17095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 18112 17099 gene locus_tag LOCUS_12190 18112 17099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 18368 19078 gene locus_tag LOCUS_12200 18368 19078 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213908.1 protein_id gnl|my_center|LOCUS_12200 19068 19925 gene locus_tag LOCUS_12210 19068 19925 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_12210 19931 20410 gene locus_tag LOCUS_12220 19931 20410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 21343 20462 gene locus_tag LOCUS_12230 21343 20462 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_12230 21525 23060 gene locus_tag LOCUS_12240 gene putP 21525 23060 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_12240 23642 23953 gene locus_tag LOCUS_12250 gene rpsJ 23642 23953 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720954.1 protein_id gnl|my_center|LOCUS_12250 24074 24757 gene locus_tag LOCUS_12260 gene rplC 24074 24757 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence031 1197 7 gene locus_tag LOCUS_12270 1197 7 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811798.1 protein_id gnl|my_center|LOCUS_12270 2189 1233 gene locus_tag LOCUS_12280 2189 1233 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_12280 3451 2276 gene locus_tag LOCUS_12290 3451 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 3946 3482 gene locus_tag LOCUS_12300 3946 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 4392 3979 gene locus_tag LOCUS_12310 4392 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5276 4392 gene locus_tag LOCUS_12320 5276 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 6953 5436 gene locus_tag LOCUS_12330 6953 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 7144 6959 gene locus_tag LOCUS_12340 7144 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 8629 7160 gene locus_tag LOCUS_12350 8629 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 9448 8633 gene locus_tag LOCUS_12360 9448 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 10583 9372 gene locus_tag LOCUS_12370 10583 9372 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_12370 11613 10573 gene locus_tag LOCUS_12380 11613 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 12066 11629 gene locus_tag LOCUS_12390 12066 11629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 14646 12352 gene locus_tag LOCUS_12400 14646 12352 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_12400 15976 14852 gene locus_tag LOCUS_12410 15976 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12410 15662 15688 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17117 16005 gene locus_tag LOCUS_12420 17117 16005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12420 16017 16026 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17392 17117 gene locus_tag LOCUS_12430 17392 17117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 17121 17144 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17843 17511 gene locus_tag LOCUS_12440 17843 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 21159 18022 gene locus_tag LOCUS_12450 gene ileS 21159 18022 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_12450 21518 21174 gene locus_tag LOCUS_12460 21518 21174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 21838 21506 gene locus_tag LOCUS_12470 21838 21506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 22389 22889 gene locus_tag LOCUS_12480 22389 22889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 23237 24439 gene locus_tag LOCUS_12490 23237 24439 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972561.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence032 747 834 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1463 1540 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2054 3088 gene locus_tag LOCUS_12500 2054 3088 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107732.1 protein_id gnl|my_center|LOCUS_12500 4699 3101 gene locus_tag LOCUS_12510 4699 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 4914 5981 gene locus_tag LOCUS_12520 4914 5981 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_12520 6510 5989 gene locus_tag LOCUS_12530 6510 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 6714 7556 gene locus_tag LOCUS_12540 6714 7556 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938910.1 protein_id gnl|my_center|LOCUS_12540 7584 8294 gene locus_tag LOCUS_12550 7584 8294 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812980.1 protein_id gnl|my_center|LOCUS_12550 8402 8947 gene locus_tag LOCUS_12560 8402 8947 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 protein_id gnl|my_center|LOCUS_12560 9097 9828 gene locus_tag LOCUS_12570 9097 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 9880 10533 gene locus_tag LOCUS_12580 gene fabG 9880 10533 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_12580 11265 10621 gene locus_tag LOCUS_12590 11265 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 12415 11228 gene locus_tag LOCUS_12600 12415 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 12655 14025 gene locus_tag LOCUS_12610 12655 14025 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_12610 14065 14202 gene locus_tag LOCUS_12620 14065 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 14712 14776 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15309 16763 gene locus_tag LOCUS_12630 15309 16763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 16765 16941 gene locus_tag LOCUS_12640 16765 16941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 16970 18010 gene locus_tag LOCUS_12650 16970 18010 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_12650 18045 19037 gene locus_tag LOCUS_12660 18045 19037 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775927.1 protein_id gnl|my_center|LOCUS_12660 19034 19921 gene locus_tag LOCUS_12670 19034 19921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 19953 20423 gene locus_tag LOCUS_12680 19953 20423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 20414 21457 gene locus_tag LOCUS_12690 20414 21457 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775924.1 protein_id gnl|my_center|LOCUS_12690 21474 22472 gene locus_tag LOCUS_12700 21474 22472 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775923.1 protein_id gnl|my_center|LOCUS_12700 22469 23413 gene locus_tag LOCUS_12710 22469 23413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 23541 24272 gene locus_tag LOCUS_12720 gene nadE 23541 24272 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869673.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence033 2755 1265 gene locus_tag LOCUS_12730 2755 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4258 2771 gene locus_tag LOCUS_12740 4258 2771 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_12740 5240 4359 gene locus_tag LOCUS_12750 5240 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 5643 7235 gene locus_tag LOCUS_12760 5643 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 7308 8012 gene locus_tag LOCUS_12770 7308 8012 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_12770 10727 8148 gene locus_tag LOCUS_12780 10727 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 12088 10751 gene locus_tag LOCUS_12790 gene dnaB 12088 10751 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_12790 12551 12102 gene locus_tag LOCUS_12800 gene rplI 12551 12102 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_12800 14600 12552 gene locus_tag LOCUS_12810 14600 12552 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_12810 16153 14630 gene locus_tag LOCUS_12820 16153 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 17008 16337 gene locus_tag LOCUS_12830 17008 16337 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_12830 19761 17038 gene locus_tag LOCUS_12840 19761 17038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 19955 19764 gene locus_tag LOCUS_12850 19955 19764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 21511 19976 gene locus_tag LOCUS_12860 21511 19976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 22288 21515 gene locus_tag LOCUS_12870 22288 21515 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963364.1 protein_id gnl|my_center|LOCUS_12870 22903 22412 gene locus_tag LOCUS_12880 22903 22412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence034 3496 812 gene locus_tag LOCUS_12890 gene mutS 3496 812 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_12890 4902 3490 gene locus_tag LOCUS_12900 gene miaB 4902 3490 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_12900 6143 4902 gene locus_tag LOCUS_12910 6143 4902 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_12910 6730 6134 gene locus_tag LOCUS_12920 6730 6134 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_12920 6954 6742 gene locus_tag LOCUS_12930 6954 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 7848 6997 gene locus_tag LOCUS_12940 gene proB 7848 6997 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_12940 9248 7890 gene locus_tag LOCUS_12950 9248 7890 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_12950 9285 9354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9490 9560 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10457 9570 gene locus_tag LOCUS_12960 10457 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 11842 10391 gene locus_tag LOCUS_12970 11842 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 10524 10589 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13071 11863 gene locus_tag LOCUS_12980 13071 11863 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 protein_id gnl|my_center|LOCUS_12980 14699 13071 gene locus_tag LOCUS_12990 14699 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 15233 14724 gene locus_tag LOCUS_13000 gene ybeY 15233 14724 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_13000 15261 16640 gene locus_tag LOCUS_13010 15261 16640 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_13010 17440 16637 gene locus_tag LOCUS_13020 17440 16637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 19606 17486 gene locus_tag LOCUS_13030 19606 17486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 20473 19637 gene locus_tag LOCUS_13040 gene folD 20473 19637 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_13040 21900 20539 gene locus_tag LOCUS_13050 21900 20539 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048375.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13050 21934 22066 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence035 1434 334 gene locus_tag LOCUS_13060 1434 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2068 1463 gene locus_tag LOCUS_13070 2068 1463 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_13070 3498 2146 gene locus_tag LOCUS_13080 3498 2146 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_13080 4135 3521 gene locus_tag LOCUS_13090 4135 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 4832 4356 gene locus_tag LOCUS_13100 4832 4356 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_13100 6154 4967 gene locus_tag LOCUS_13110 6154 4967 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_13110 7411 6197 gene locus_tag LOCUS_13120 7411 6197 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_13120 8056 7424 gene locus_tag LOCUS_13130 8056 7424 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_13130 8821 8120 gene locus_tag LOCUS_13140 8821 8120 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_13140 8149 8213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9591 8833 gene locus_tag LOCUS_13150 9591 8833 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_13150 10550 9639 gene locus_tag LOCUS_13160 10550 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 11907 10711 gene locus_tag LOCUS_13170 11907 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 13844 11931 gene locus_tag LOCUS_13180 13844 11931 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_13180 14810 14004 gene locus_tag LOCUS_13190 14810 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 15777 14929 gene locus_tag LOCUS_13200 15777 14929 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207778.1 protein_id gnl|my_center|LOCUS_13200 15924 17294 gene locus_tag LOCUS_13210 15924 17294 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_13210 17442 17627 gene locus_tag LOCUS_13220 17442 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 18157 17645 gene locus_tag LOCUS_13230 18157 17645 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_13230 18931 18191 gene locus_tag LOCUS_13240 18931 18191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 20300 19011 gene locus_tag LOCUS_13250 20300 19011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 20863 20297 gene locus_tag LOCUS_13260 20863 20297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence036 1824 1546 gene locus_tag LOCUS_13270 1824 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 4235 1887 gene locus_tag LOCUS_13280 4235 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6560 4239 gene locus_tag LOCUS_13290 gene pcrA 6560 4239 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674369.1 protein_id gnl|my_center|LOCUS_13290 7720 6728 gene locus_tag LOCUS_13300 7720 6728 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459940.1 protein_id gnl|my_center|LOCUS_13300 8433 7720 gene locus_tag LOCUS_13310 8433 7720 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_13310 8814 8572 gene locus_tag LOCUS_13320 8814 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 10279 8825 gene locus_tag LOCUS_13330 gene purB 10279 8825 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_13330 11532 10306 gene locus_tag LOCUS_13340 11532 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 12368 11532 gene locus_tag LOCUS_13350 12368 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 13685 12378 gene locus_tag LOCUS_13360 13685 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 17282 13689 gene locus_tag LOCUS_13370 17282 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 17757 17467 gene locus_tag LOCUS_13380 17757 17467 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_13380 <20744 17876 gene locus_tag LOCUS_13390 <20744 17876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:efflux RND transporter permease subunit >Feature sequence037 2014 938 gene locus_tag LOCUS_13400 2014 938 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_13400 2719 2075 gene locus_tag LOCUS_13410 gene deoC 2719 2075 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_13410 3936 2737 gene locus_tag LOCUS_13420 gene deoB 3936 2737 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 protein_id gnl|my_center|LOCUS_13420 4771 3923 gene locus_tag LOCUS_13430 gene udp 4771 3923 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_13430 5164 4859 gene locus_tag LOCUS_13440 5164 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 5189 5398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6903 6055 gene locus_tag LOCUS_13450 6903 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 8466 6940 gene locus_tag LOCUS_13460 8466 6940 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027392.1 protein_id gnl|my_center|LOCUS_13460 9857 8583 gene locus_tag LOCUS_13470 9857 8583 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_13470 11153 9873 gene locus_tag LOCUS_13480 11153 9873 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_13480 12070 11174 gene locus_tag LOCUS_13490 gene ftsX 12070 11174 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_13490 12722 12060 gene locus_tag LOCUS_13500 gene ftsE 12722 12060 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_13500 12723 12853 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14259 13168 gene locus_tag LOCUS_13510 14259 13168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 15033 14416 gene locus_tag LOCUS_13520 15033 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 15226 15417 gene locus_tag LOCUS_13530 15226 15417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 16910 15522 gene locus_tag LOCUS_13540 gene gltA 16910 15522 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_13540 17824 16946 gene locus_tag LOCUS_13550 17824 16946 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_13550 19083 17899 gene locus_tag LOCUS_13560 gene hydF 19083 17899 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_13560 20220 19138 gene locus_tag LOCUS_13570 20220 19138 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence038 954 340 gene locus_tag LOCUS_13580 954 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1313 978 gene locus_tag LOCUS_13590 1313 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1999 1328 gene locus_tag LOCUS_13600 1999 1328 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 protein_id gnl|my_center|LOCUS_13600 2790 2113 gene locus_tag LOCUS_13610 2790 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3491 3030 gene locus_tag LOCUS_13620 3491 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4196 3501 gene locus_tag LOCUS_13630 4196 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 7896 4198 gene locus_tag LOCUS_13640 7896 4198 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263812.1 protein_id gnl|my_center|LOCUS_13640 10508 7914 gene locus_tag LOCUS_13650 10508 7914 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279797.1 protein_id gnl|my_center|LOCUS_13650 10735 10508 gene locus_tag LOCUS_13660 10735 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 11479 11006 gene locus_tag LOCUS_13670 11479 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 11846 11463 gene locus_tag LOCUS_13680 11846 11463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964626.1 protein_id gnl|my_center|LOCUS_13680 13008 11944 gene locus_tag LOCUS_13690 13008 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 13751 13170 gene locus_tag LOCUS_13700 13751 13170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 14903 13929 gene locus_tag LOCUS_13710 14903 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 15345 15058 gene locus_tag LOCUS_13720 15345 15058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 16520 15456 gene locus_tag LOCUS_13730 16520 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 17626 16664 gene locus_tag LOCUS_13740 17626 16664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 18944 17742 gene locus_tag LOCUS_13750 18944 17742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 19380 19003 gene locus_tag LOCUS_13760 19380 19003 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109280.1 protein_id gnl|my_center|LOCUS_13760 19604 19455 gene locus_tag LOCUS_13770 19604 19455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence039 197 1123 gene locus_tag LOCUS_13780 197 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1353 1934 gene locus_tag LOCUS_13790 1353 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1924 2637 gene locus_tag LOCUS_13800 1924 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2690 3361 gene locus_tag LOCUS_13810 2690 3361 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_13810 3573 4598 gene locus_tag LOCUS_13820 3573 4598 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_13820 4807 5565 gene locus_tag LOCUS_13830 4807 5565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027523.1 protein_id gnl|my_center|LOCUS_13830 5702 7813 gene locus_tag LOCUS_13840 5702 7813 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_13840 9907 7883 gene locus_tag LOCUS_13850 9907 7883 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_13850 10155 11444 gene locus_tag LOCUS_13860 10155 11444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 11566 11961 gene locus_tag LOCUS_13870 11566 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 11972 12469 gene locus_tag LOCUS_13880 11972 12469 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_13880 12508 13497 gene locus_tag LOCUS_13890 12508 13497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 13513 13674 gene locus_tag LOCUS_13900 13513 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 14021 14512 gene locus_tag LOCUS_13910 14021 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 14546 15001 gene locus_tag LOCUS_13920 gene bcp 14546 15001 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_13920 15132 15860 gene locus_tag LOCUS_13930 gene cobI 15132 15860 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_13930 16530 17063 gene locus_tag LOCUS_13940 16530 17063 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_13940 17352 18515 gene locus_tag LOCUS_13950 17352 18515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 18610 19305 gene locus_tag LOCUS_13960 18610 19305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence040 5025 484 gene locus_tag LOCUS_13970 5025 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 5717 5247 gene locus_tag LOCUS_13980 5717 5247 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_13980 6442 5762 gene locus_tag LOCUS_13990 6442 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 7915 6482 gene locus_tag LOCUS_14000 7915 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 9369 7957 gene locus_tag LOCUS_14010 9369 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 10720 9554 gene locus_tag LOCUS_14020 10720 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 11790 10738 gene locus_tag LOCUS_14030 11790 10738 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_14030 12415 11819 gene locus_tag LOCUS_14040 gene recR 12415 11819 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_14040 12756 12415 gene locus_tag LOCUS_14050 12756 12415 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_14050 14366 12816 gene locus_tag LOCUS_14060 gene dnaX 14366 12816 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963452.1 protein_id gnl|my_center|LOCUS_14060 15483 14410 gene locus_tag LOCUS_14070 15483 14410 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_14070 15612 18149 gene locus_tag LOCUS_14080 15612 18149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 <19313 18118 gene locus_tag LOCUS_14090 <19313 18118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810412.1:ferrous iron transport protein B >Feature sequence041 142 149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 780 1355 gene locus_tag LOCUS_14100 780 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1897 1962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1999 2571 gene locus_tag LOCUS_14110 1999 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2568 3638 gene locus_tag LOCUS_14120 2568 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 3724 3915 gene locus_tag LOCUS_14130 3724 3915 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_14130 4153 4213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5678 4506 gene locus_tag LOCUS_14140 5678 4506 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459619.1 protein_id gnl|my_center|LOCUS_14140 6157 5675 gene locus_tag LOCUS_14150 6157 5675 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_14150 7091 6183 gene locus_tag LOCUS_14160 7091 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 7255 7836 gene locus_tag LOCUS_14170 7255 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 8451 7822 gene locus_tag LOCUS_14180 gene nth 8451 7822 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_14180 9151 9322 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10053 9580 gene locus_tag LOCUS_14190 10053 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 11226 10081 gene locus_tag LOCUS_14200 11226 10081 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272513.1 protein_id gnl|my_center|LOCUS_14200 14113 11246 gene locus_tag LOCUS_14210 14113 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 14464 14246 gene locus_tag LOCUS_14220 14464 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 16397 14526 gene locus_tag LOCUS_14230 gene uvrC 16397 14526 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_14230 17467 16403 gene locus_tag LOCUS_14240 17467 16403 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861983.1 protein_id gnl|my_center|LOCUS_14240 17929 17495 gene locus_tag LOCUS_14250 17929 17495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence042 2146 1115 gene locus_tag LOCUS_14260 gene pheS 2146 1115 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_14260 2818 2480 gene locus_tag LOCUS_14270 2818 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3396 2824 gene locus_tag LOCUS_14280 3396 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 3548 3736 gene locus_tag LOCUS_14290 3548 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 3942 4012 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5959 6171 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6238 7968 gene locus_tag LOCUS_14300 6238 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 8912 8007 gene locus_tag LOCUS_14310 8912 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 9183 8935 gene locus_tag LOCUS_14320 9183 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 10763 9273 gene locus_tag LOCUS_14330 10763 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 11064 11150 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13794 11290 gene locus_tag LOCUS_14340 13794 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 13912 13977 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14918 13980 gene locus_tag LOCUS_14350 14918 13980 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_14350 16379 14961 gene locus_tag LOCUS_14360 16379 14961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 16506 17240 gene locus_tag LOCUS_14370 16506 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 <18000 17275 gene locus_tag LOCUS_14380 <18000 17275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_082100799.1:EAL domain-containing protein >Feature sequence043 <1 1550 gene locus_tag LOCUS_14390 <1 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584017.1:alpha-galactosidase 1543 3075 gene locus_tag LOCUS_14400 1543 3075 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582688.1 protein_id gnl|my_center|LOCUS_14400 3213 4805 gene locus_tag LOCUS_14410 3213 4805 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_14410 4973 6007 gene locus_tag LOCUS_14420 4973 6007 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016893.1 protein_id gnl|my_center|LOCUS_14420 6026 6439 gene locus_tag LOCUS_14430 6026 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 6450 7538 gene locus_tag LOCUS_14440 6450 7538 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942069.1 protein_id gnl|my_center|LOCUS_14440 7562 10207 gene locus_tag LOCUS_14450 7562 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 10207 10929 gene locus_tag LOCUS_14460 10207 10929 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_14460 10970 12325 gene locus_tag LOCUS_14470 gene trkA 10970 12325 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_14470 12325 13770 gene locus_tag LOCUS_14480 12325 13770 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_14480 13807 14511 gene locus_tag LOCUS_14490 13807 14511 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_14490 14624 15361 gene locus_tag LOCUS_14500 14624 15361 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017120.1 protein_id gnl|my_center|LOCUS_14500 15475 16134 gene locus_tag LOCUS_14510 15475 16134 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358516.1 protein_id gnl|my_center|LOCUS_14510 16310 17401 gene locus_tag LOCUS_14520 gene hydE 16310 17401 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433972.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence044 1074 1182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1190 1756 gene locus_tag LOCUS_14530 1190 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14530 1836 2288 gene locus_tag LOCUS_14540 1836 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2333 2974 gene locus_tag LOCUS_14550 2333 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 3062 3766 gene locus_tag LOCUS_14560 3062 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4184 5437 gene locus_tag LOCUS_14570 4184 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14570 5400 6863 gene locus_tag LOCUS_14580 5400 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14580 5413 5432 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6996 8276 gene locus_tag LOCUS_14590 6996 8276 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_14590 8381 8668 gene locus_tag LOCUS_14600 8381 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 8682 10100 gene locus_tag LOCUS_14610 8682 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 10193 10642 gene locus_tag LOCUS_14620 10193 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 10776 12197 gene locus_tag LOCUS_14630 gene potA 10776 12197 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762997.1 protein_id gnl|my_center|LOCUS_14630 12198 12998 gene locus_tag LOCUS_14640 12198 12998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778456.1 protein_id gnl|my_center|LOCUS_14640 13010 13795 gene locus_tag LOCUS_14650 13010 13795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993119.1 protein_id gnl|my_center|LOCUS_14650 13808 15217 gene locus_tag LOCUS_14660 13808 15217 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_14660 16202 15318 gene locus_tag LOCUS_14670 16202 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14670 16738 16160 gene locus_tag LOCUS_14680 16738 16160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14680 >Feature sequence045 1368 490 gene locus_tag LOCUS_14690 1368 490 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_14690 1998 1567 gene locus_tag LOCUS_14700 gene dutA 1998 1567 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_14700 2546 2010 gene locus_tag LOCUS_14710 gene nrdG 2546 2010 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_14710 4728 2566 gene locus_tag LOCUS_14720 gene nrdD 4728 2566 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_14720 5926 4943 gene locus_tag LOCUS_14730 5926 4943 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_14730 6122 5943 gene locus_tag LOCUS_14740 6122 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 6647 6156 gene locus_tag LOCUS_14750 gene rnhA 6647 6156 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 protein_id gnl|my_center|LOCUS_14750 8353 6656 gene locus_tag LOCUS_14760 8353 6656 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287495.1 protein_id gnl|my_center|LOCUS_14760 8801 8370 gene locus_tag LOCUS_14770 8801 8370 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_14770 9235 8876 gene locus_tag LOCUS_14780 9235 8876 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_14780 10120 9251 gene locus_tag LOCUS_14790 10120 9251 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942263.1 protein_id gnl|my_center|LOCUS_14790 11960 10188 gene locus_tag LOCUS_14800 11960 10188 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_14800 12779 11988 gene locus_tag LOCUS_14810 12779 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 14352 12865 gene locus_tag LOCUS_14820 gene thrC 14352 12865 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_14820 15121 14408 gene locus_tag LOCUS_14830 15121 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 <16677 15255 gene locus_tag LOCUS_14840 <16677 15255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002355994.1:oxaloacetate decarboxylase subunit alpha 16152 16182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence046 1187 342 gene locus_tag LOCUS_14850 gene dapF 1187 342 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_14850 2774 1383 gene locus_tag LOCUS_14860 2774 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2943 4124 gene locus_tag LOCUS_14870 2943 4124 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_14870 6065 4212 gene locus_tag LOCUS_14880 6065 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 5760 5796 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6130 6152 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7214 6264 gene locus_tag LOCUS_14890 7214 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 7868 7311 gene locus_tag LOCUS_14900 gene efp 7868 7311 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_14900 8894 7983 gene locus_tag LOCUS_14910 8894 7983 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_14910 9226 8930 gene locus_tag LOCUS_14920 9226 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 9390 10352 gene locus_tag LOCUS_14930 9390 10352 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_14930 11484 10411 gene locus_tag LOCUS_14940 gene prfA 11484 10411 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_14940 12339 11503 gene locus_tag LOCUS_14950 gene prmC 12339 11503 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897583.1 protein_id gnl|my_center|LOCUS_14950 13331 12336 gene locus_tag LOCUS_14960 13331 12336 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_14960 13626 13420 gene locus_tag LOCUS_14970 gene rpmE 13626 13420 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_14970 14422 13805 gene locus_tag LOCUS_14980 14422 13805 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_14980 15610 14459 gene locus_tag LOCUS_14990 15610 14459 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence047 1595 2461 gene locus_tag LOCUS_15000 1595 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2520 3314 gene locus_tag LOCUS_15010 2520 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 3328 5043 gene locus_tag LOCUS_15020 3328 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 5048 5599 gene locus_tag LOCUS_15030 5048 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5613 7484 gene locus_tag LOCUS_15040 5613 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 8074 9132 gene locus_tag LOCUS_15050 8074 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 9259 11304 gene locus_tag LOCUS_15060 gene topA 9259 11304 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_15060 11337 12560 gene locus_tag LOCUS_15070 gene ilvA 11337 12560 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_15070 12673 13008 gene locus_tag LOCUS_15080 12673 13008 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_15080 13040 13966 gene locus_tag LOCUS_15090 13040 13966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15090 13861 13925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14448 14690 gene locus_tag LOCUS_15100 gene rpsP 14448 14690 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_15100 14730 14960 gene locus_tag LOCUS_15110 14730 14960 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_15110 15074 15595 gene locus_tag LOCUS_15120 gene rimM 15074 15595 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_15120 15600 16409 gene locus_tag LOCUS_15130 gene trmD 15600 16409 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence048 1534 719 gene locus_tag LOCUS_15140 1534 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1556 1690 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3414 2035 gene locus_tag LOCUS_15150 3414 2035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897687.1 protein_id gnl|my_center|LOCUS_15150 2046 2176 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4234 3488 gene locus_tag LOCUS_15160 4234 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4322 4402 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6241 4907 gene locus_tag LOCUS_15170 6241 4907 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837071.1 protein_id gnl|my_center|LOCUS_15170 6930 6295 gene locus_tag LOCUS_15180 gene upp 6930 6295 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 protein_id gnl|my_center|LOCUS_15180 8579 7110 gene locus_tag LOCUS_15190 8579 7110 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_15190 9747 8617 gene locus_tag LOCUS_15200 9747 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 10163 9826 gene locus_tag LOCUS_tm00010 10163 9826 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 10678 10193 gene locus_tag LOCUS_15210 gene smpB 10678 10193 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_15210 12885 10693 gene locus_tag LOCUS_15220 gene rnr 12885 10693 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434984.1 protein_id gnl|my_center|LOCUS_15220 13437 13204 gene locus_tag LOCUS_15230 13437 13204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 14307 13528 gene locus_tag LOCUS_15240 gene murI 14307 13528 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229860.1 protein_id gnl|my_center|LOCUS_15240 15049 14333 gene locus_tag LOCUS_15250 gene rluF 15049 14333 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963354.1 protein_id gnl|my_center|LOCUS_15250 15750 15076 gene locus_tag LOCUS_15260 15750 15076 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 protein_id gnl|my_center|LOCUS_15260 <16403 15765 gene locus_tag LOCUS_15270 <16403 15765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949116.1:imidazole glycerol phosphate synthase subunit HisF >Feature sequence049 1493 2614 gene locus_tag LOCUS_15280 1493 2614 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_15280 3831 2641 gene locus_tag LOCUS_15290 gene dnaJ 3831 2641 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_15290 4477 3914 gene locus_tag LOCUS_15300 4477 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4574 4762 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5449 5539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6510 5908 gene locus_tag LOCUS_15310 gene grpE 6510 5908 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_15310 7596 6529 gene locus_tag LOCUS_15320 gene hrcA 7596 6529 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_15320 8524 7712 gene locus_tag LOCUS_15330 8524 7712 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_15330 9642 8623 gene locus_tag LOCUS_15340 9642 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 10681 9722 gene locus_tag LOCUS_15350 10681 9722 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_15350 11429 10662 gene locus_tag LOCUS_15360 11429 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 13652 11433 gene locus_tag LOCUS_15370 gene clpA 13652 11433 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965130.1 protein_id gnl|my_center|LOCUS_15370 13964 13659 gene locus_tag LOCUS_15380 13964 13659 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668196.1 protein_id gnl|my_center|LOCUS_15380 14543 14268 gene locus_tag LOCUS_15390 14543 14268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 14784 15575 gene locus_tag LOCUS_15400 14784 15575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942799.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence050 51 248 gene locus_tag LOCUS_15410 51 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 175 375 gene locus_tag LOCUS_15420 175 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 442 618 gene locus_tag LOCUS_15430 442 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 655 1893 gene locus_tag LOCUS_15440 655 1893 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861092.1 protein_id gnl|my_center|LOCUS_15440 2117 2284 gene locus_tag LOCUS_15450 2117 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2372 3982 gene locus_tag LOCUS_15460 2372 3982 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_15460 3985 5616 gene locus_tag LOCUS_15470 3985 5616 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_15470 5683 7401 gene locus_tag LOCUS_15480 gene iorA 5683 7401 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_15480 7417 7992 gene locus_tag LOCUS_15490 7417 7992 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_15490 8196 9794 gene locus_tag LOCUS_15500 8196 9794 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_15500 9822 10517 gene locus_tag LOCUS_15510 9822 10517 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_15510 10572 11906 gene locus_tag LOCUS_15520 10572 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 11922 14132 gene locus_tag LOCUS_15530 11922 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 14226 15026 gene locus_tag LOCUS_15540 14226 15026 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101871.1 protein_id gnl|my_center|LOCUS_15540 15030 15839 gene locus_tag LOCUS_15550 gene larE 15030 15839 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence051 824 955 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1130 1540 gene locus_tag LOCUS_15560 1130 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1741 3069 gene locus_tag LOCUS_15570 1741 3069 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_15570 3506 3695 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4463 5161 gene locus_tag LOCUS_15580 gene plsY 4463 5161 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_15580 5346 6365 gene locus_tag LOCUS_15590 5346 6365 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_15590 6356 7279 gene locus_tag LOCUS_15600 6356 7279 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_15600 7173 8423 gene locus_tag LOCUS_15610 7173 8423 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_15610 7195 7268 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8427 10427 gene locus_tag LOCUS_15620 8427 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 10431 11492 gene locus_tag LOCUS_15630 10431 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 12577 11510 gene locus_tag LOCUS_15640 12577 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 13757 12597 gene locus_tag LOCUS_15650 13757 12597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 14150 13827 gene locus_tag LOCUS_15660 14150 13827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 15273 14182 gene locus_tag LOCUS_15670 15273 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 14229 14303 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15428 15493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence052 <1 1375 gene locus_tag LOCUS_15680 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003731956.1:ABC-F type ribosomal protection protein 1403 3673 gene locus_tag LOCUS_15690 1403 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3735 5324 gene locus_tag LOCUS_15700 3735 5324 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_15700 5340 6035 gene locus_tag LOCUS_15710 5340 6035 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_15710 6053 7426 gene locus_tag LOCUS_15720 6053 7426 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964711.1 protein_id gnl|my_center|LOCUS_15720 7457 8224 gene locus_tag LOCUS_15730 gene surE 7457 8224 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948033.1 protein_id gnl|my_center|LOCUS_15730 8243 9121 gene locus_tag LOCUS_15740 8243 9121 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_15740 9154 9591 gene locus_tag LOCUS_15750 9154 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 9607 10530 gene locus_tag LOCUS_15760 9607 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 10906 12396 gene locus_tag LOCUS_15770 gene trpE 10906 12396 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_15770 12377 12949 gene locus_tag LOCUS_15780 12377 12949 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_15780 13049 13120 gene locus_tag LOCUS_t00180 13049 13120 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 13237 14295 gene locus_tag LOCUS_15790 13237 14295 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_15790 14297 15163 gene locus_tag LOCUS_15800 gene hslO 14297 15163 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence053 392 454 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1597 692 gene locus_tag LOCUS_15810 1597 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15810 2078 1620 gene locus_tag LOCUS_15820 2078 1620 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948908.1 protein_id gnl|my_center|LOCUS_15820 2355 3473 gene locus_tag LOCUS_15830 2355 3473 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459090.1 protein_id gnl|my_center|LOCUS_15830 4272 5327 gene locus_tag LOCUS_15840 4272 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 5327 7159 gene locus_tag LOCUS_15850 5327 7159 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942801.1 protein_id gnl|my_center|LOCUS_15850 8634 7231 gene locus_tag LOCUS_15860 8634 7231 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_15860 9735 8665 gene locus_tag LOCUS_15870 9735 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 9913 11280 gene locus_tag LOCUS_15880 9913 11280 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_15880 12013 11270 gene locus_tag LOCUS_15890 12013 11270 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947920.1 protein_id gnl|my_center|LOCUS_15890 12935 12048 gene locus_tag LOCUS_15900 12935 12048 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_15900 14155 12956 gene locus_tag LOCUS_15910 14155 12956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 14917 14213 gene locus_tag LOCUS_15920 14917 14213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 15162 15088 gene locus_tag LOCUS_t00190 15162 15088 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence054 1235 720 gene locus_tag LOCUS_15930 1235 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15930 728 765 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1898 1338 gene locus_tag LOCUS_15940 1898 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2573 1926 gene locus_tag LOCUS_15950 2573 1926 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763533.1 protein_id gnl|my_center|LOCUS_15950 3300 2587 gene locus_tag LOCUS_15960 3300 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3731 3372 gene locus_tag LOCUS_15970 3731 3372 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948678.1 protein_id gnl|my_center|LOCUS_15970 4089 3778 gene locus_tag LOCUS_15980 4089 3778 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392518.1 protein_id gnl|my_center|LOCUS_15980 4484 4098 gene locus_tag LOCUS_15990 4484 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 4491 4687 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6663 5890 gene locus_tag LOCUS_16000 6663 5890 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_16000 6418 6487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8709 6667 gene locus_tag LOCUS_16010 8709 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 9423 8773 gene locus_tag LOCUS_16020 gene lepB 9423 8773 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_16020 10267 9416 gene locus_tag LOCUS_16030 gene ylqF 10267 9416 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_16030 10944 10285 gene locus_tag LOCUS_16040 10944 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 11381 11034 gene locus_tag LOCUS_16050 gene rplS 11381 11034 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_16050 12379 11501 gene locus_tag LOCUS_16060 12379 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 14397 12382 gene locus_tag LOCUS_16070 14397 12382 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861272.1 protein_id gnl|my_center|LOCUS_16070 <15077 14502 gene locus_tag LOCUS_16080 <15077 14502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009896767.1:ABC transporter ATP-binding protein 14514 14536 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence055 2058 511 gene locus_tag LOCUS_16090 2058 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 2652 2107 gene locus_tag LOCUS_16100 2652 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3322 2684 gene locus_tag LOCUS_16110 gene trmB 3322 2684 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_16110 3523 4935 gene locus_tag LOCUS_16120 3523 4935 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_16120 5390 4941 gene locus_tag LOCUS_16130 5390 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 6455 5478 gene locus_tag LOCUS_16140 6455 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 6584 6513 gene locus_tag LOCUS_t00200 6584 6513 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6752 7315 gene locus_tag LOCUS_16150 6752 7315 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840041.1 protein_id gnl|my_center|LOCUS_16150 7308 8672 gene locus_tag LOCUS_16160 7308 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 8600 8664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9013 9861 gene locus_tag LOCUS_16170 9013 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 10643 9963 gene locus_tag LOCUS_16180 10643 9963 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_16180 12038 10728 gene locus_tag LOCUS_16190 gene thiC 12038 10728 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_16190 12550 12311 gene locus_tag LOCUS_16200 12550 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 13072 12617 gene locus_tag LOCUS_16210 13072 12617 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289814.1 protein_id gnl|my_center|LOCUS_16210 13906 13499 gene locus_tag LOCUS_16220 13906 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 14130 13930 gene locus_tag LOCUS_16230 14130 13930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 14675 14130 gene locus_tag LOCUS_16240 14675 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence056 665 2047 gene locus_tag LOCUS_16250 665 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1108 1144 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2073 3377 gene locus_tag LOCUS_16260 2073 3377 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_16260 3448 4554 gene locus_tag LOCUS_16270 3448 4554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_16270 4565 5458 gene locus_tag LOCUS_16280 4565 5458 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550063.1 protein_id gnl|my_center|LOCUS_16280 5484 6350 gene locus_tag LOCUS_16290 5484 6350 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355144.1 protein_id gnl|my_center|LOCUS_16290 6350 7954 gene locus_tag LOCUS_16300 6350 7954 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601692.1 protein_id gnl|my_center|LOCUS_16300 8385 8561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9031 9267 gene locus_tag LOCUS_16310 9031 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 9438 10694 gene locus_tag LOCUS_16320 9438 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 11951 10731 gene locus_tag LOCUS_16330 11951 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 12215 12619 gene locus_tag LOCUS_16340 12215 12619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 12882 13967 gene locus_tag LOCUS_16350 12882 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence057 188 229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1360 365 gene locus_tag LOCUS_16360 1360 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1775 1347 gene locus_tag LOCUS_16370 1775 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1889 1998 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2628 2023 gene locus_tag LOCUS_16380 2628 2023 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_16380 3900 2944 gene locus_tag LOCUS_16390 3900 2944 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_16390 4191 4118 gene locus_tag LOCUS_t00210 4191 4118 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5212 4286 gene locus_tag LOCUS_16400 gene cysK 5212 4286 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762272.1 protein_id gnl|my_center|LOCUS_16400 6318 5290 gene locus_tag LOCUS_16410 6318 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16410 7430 6333 gene locus_tag LOCUS_16420 7430 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16420 6367 6432 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8755 7460 gene locus_tag LOCUS_16430 8755 7460 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_16430 9427 8783 gene locus_tag LOCUS_16440 9427 8783 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288107.1 protein_id gnl|my_center|LOCUS_16440 9915 9427 gene locus_tag LOCUS_16450 9915 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 10259 9933 gene locus_tag LOCUS_16460 10259 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 11168 10284 gene locus_tag LOCUS_16470 11168 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16470 11238 11306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12259 11993 gene locus_tag LOCUS_16480 12259 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 12709 12287 gene locus_tag LOCUS_16490 gene ruvX 12709 12287 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_16490 12987 12706 gene locus_tag LOCUS_16500 12987 12706 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence058 2085 2223 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4549 3491 gene locus_tag LOCUS_16510 gene ispG 4549 3491 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_16510 5708 4551 gene locus_tag LOCUS_16520 gene rseP 5708 4551 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090228.1 protein_id gnl|my_center|LOCUS_16520 6708 5728 gene locus_tag LOCUS_16530 gene dxr 6708 5728 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986796.1 protein_id gnl|my_center|LOCUS_16530 6724 6904 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8461 7751 gene locus_tag LOCUS_16540 8461 7751 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_16540 9087 8536 gene locus_tag LOCUS_16550 gene frr 9087 8536 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_16550 9827 9135 gene locus_tag LOCUS_16560 gene pyrH 9827 9135 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_16560 10446 9895 gene locus_tag LOCUS_16570 10446 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 11218 10478 gene locus_tag LOCUS_16580 11218 10478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 10498 10535 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12174 11239 gene locus_tag LOCUS_16590 12174 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 12435 13145 gene locus_tag LOCUS_16600 gene tsaA 12435 13145 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence059 1791 400 gene locus_tag LOCUS_16610 1791 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16610 2768 1686 gene locus_tag LOCUS_16620 2768 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16620 1813 1908 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4030 2813 gene locus_tag LOCUS_16630 gene pncB 4030 2813 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192078.1 protein_id gnl|my_center|LOCUS_16630 4380 4120 gene locus_tag LOCUS_16640 4380 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 6095 4365 gene locus_tag LOCUS_16650 6095 4365 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_16650 7175 6108 gene locus_tag LOCUS_16660 7175 6108 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868678.1 protein_id gnl|my_center|LOCUS_16660 8711 7179 gene locus_tag LOCUS_16670 8711 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 8936 10000 gene locus_tag LOCUS_16680 8936 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 10090 10371 gene locus_tag LOCUS_16690 10090 10371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 10542 11369 gene locus_tag LOCUS_16700 10542 11369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 12593 11625 gene locus_tag LOCUS_16710 12593 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 12720 12764 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13060 13071 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13333 13085 gene locus_tag LOCUS_16720 13333 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 13475 13326 gene locus_tag LOCUS_16730 13475 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence060 382 68 gene locus_tag LOCUS_16740 382 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1139 375 gene locus_tag LOCUS_16750 1139 375 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368777.1 protein_id gnl|my_center|LOCUS_16750 1310 2677 gene locus_tag LOCUS_16760 1310 2677 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_16760 2738 3337 gene locus_tag LOCUS_16770 2738 3337 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_16770 3432 5051 gene locus_tag LOCUS_16780 3432 5051 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_16780 5102 5794 gene locus_tag LOCUS_16790 gene sfsA 5102 5794 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_16790 5886 6119 gene locus_tag LOCUS_16800 5886 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6173 6550 gene locus_tag LOCUS_16810 6173 6550 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_16810 8211 6637 gene locus_tag LOCUS_16820 8211 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 8268 8327 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8666 8436 gene locus_tag LOCUS_16830 8666 8436 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_16830 9123 8677 gene locus_tag LOCUS_16840 9123 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 9298 10047 gene locus_tag LOCUS_16850 9298 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 10074 10364 gene locus_tag LOCUS_16860 10074 10364 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221875345.1 protein_id gnl|my_center|LOCUS_16860 10465 10611 gene locus_tag LOCUS_16870 gene scfA 10465 10611 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_16870 10705 12096 gene locus_tag LOCUS_16880 gene scfB 10705 12096 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_16880 12083 13453 gene locus_tag LOCUS_16890 12083 13453 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930436.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence061 456 1823 gene locus_tag LOCUS_16900 456 1823 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_16900 1889 3055 gene locus_tag LOCUS_16910 1889 3055 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_16910 3062 3694 gene locus_tag LOCUS_16920 3062 3694 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_16920 3697 4338 gene locus_tag LOCUS_16930 3697 4338 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_16930 4359 5129 gene locus_tag LOCUS_16940 4359 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 6064 5192 gene locus_tag LOCUS_16950 6064 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 6285 7649 gene locus_tag LOCUS_16960 6285 7649 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_16960 9203 7728 gene locus_tag LOCUS_16970 9203 7728 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_16970 9764 9291 gene locus_tag LOCUS_16980 9764 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 9742 9972 gene locus_tag LOCUS_16990 9742 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 10627 11136 gene locus_tag LOCUS_17000 10627 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 11138 11965 gene locus_tag LOCUS_17010 11138 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence062 1525 287 gene locus_tag LOCUS_17020 gene hacA 1525 287 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_17020 1659 1528 gene locus_tag LOCUS_17030 1659 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1762 1865 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3242 2082 gene locus_tag LOCUS_17040 3242 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3503 3684 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4897 4394 gene locus_tag LOCUS_17050 gene ilvN 4897 4394 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 protein_id gnl|my_center|LOCUS_17050 5455 4979 gene locus_tag LOCUS_17060 gene ilvN 5455 4979 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_17060 7082 5469 gene locus_tag LOCUS_17070 7082 5469 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_17070 7272 7778 gene locus_tag LOCUS_17080 7272 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 8758 7877 gene locus_tag LOCUS_17090 8758 7877 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_17090 9225 8755 gene locus_tag LOCUS_17100 9225 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 10059 9244 gene locus_tag LOCUS_17110 10059 9244 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_17110 10287 10108 gene locus_tag LOCUS_17120 10287 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 10907 10332 gene locus_tag LOCUS_17130 10907 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 11516 10968 gene locus_tag LOCUS_17140 11516 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 12637 11540 gene locus_tag LOCUS_17150 12637 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 12757 12857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence063 736 1374 gene locus_tag LOCUS_17160 736 1374 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_17160 3800 1440 gene locus_tag LOCUS_17170 gene secA2 3800 1440 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836745.1 protein_id gnl|my_center|LOCUS_17170 4257 3808 gene locus_tag LOCUS_17180 4257 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 5789 4257 gene locus_tag LOCUS_17190 gene asp2 5789 4257 CDS product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836744.1 protein_id gnl|my_center|LOCUS_17190 7365 5776 gene locus_tag LOCUS_17200 gene asp1 7365 5776 CDS product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468347.1 protein_id gnl|my_center|LOCUS_17200 8604 7372 gene locus_tag LOCUS_17210 gene secY 8604 7372 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894513.1 protein_id gnl|my_center|LOCUS_17210 12262 8687 gene locus_tag LOCUS_17220 12262 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence064 22 837 gene locus_tag LOCUS_17230 22 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1208 891 gene locus_tag LOCUS_17240 1208 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1372 1992 gene locus_tag LOCUS_17250 1372 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2032 3036 gene locus_tag LOCUS_17260 gene trpS 2032 3036 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_17260 3072 4184 gene locus_tag LOCUS_17270 3072 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17270 4103 4173 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4533 5588 gene locus_tag LOCUS_17280 4533 5588 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785546.1 protein_id gnl|my_center|LOCUS_17280 5605 6738 gene locus_tag LOCUS_17290 gene tgt 5605 6738 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_17290 6739 9573 gene locus_tag LOCUS_17300 6739 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 9618 10079 gene locus_tag LOCUS_17310 9618 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 10090 10674 gene locus_tag LOCUS_17320 10090 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence065 <1 1390 gene locus_tag LOCUS_17330 <1 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000195472.1:formate C-acetyltransferase 1450 1668 gene locus_tag LOCUS_17340 1450 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1687 1932 gene locus_tag LOCUS_17350 1687 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2018 2770 gene locus_tag LOCUS_17360 gene pflA 2018 2770 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238461.1 protein_id gnl|my_center|LOCUS_17360 2891 3061 gene locus_tag LOCUS_17370 2891 3061 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_17370 3619 3110 gene locus_tag LOCUS_17380 3619 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3644 3844 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5252 4551 gene locus_tag LOCUS_17390 5252 4551 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_17390 6459 5275 gene locus_tag LOCUS_17400 6459 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 7648 6476 gene locus_tag LOCUS_17410 7648 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17410 6487 6497 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7745 9160 gene locus_tag LOCUS_17420 7745 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 9214 10158 gene locus_tag LOCUS_17430 9214 10158 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_17430 10151 11551 gene locus_tag LOCUS_17440 gene rlmD 10151 11551 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722228.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence066 1917 709 gene locus_tag LOCUS_17450 1917 709 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_17450 3517 1922 gene locus_tag LOCUS_17460 3517 1922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_17460 4896 3799 gene locus_tag LOCUS_17470 4896 3799 CDS product glycosyltransferase family 52 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058925.1 protein_id gnl|my_center|LOCUS_17470 5695 4889 gene locus_tag LOCUS_17480 5695 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 6882 5842 gene locus_tag LOCUS_17490 6882 5842 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526112.1 protein_id gnl|my_center|LOCUS_17490 8038 6896 gene locus_tag LOCUS_17500 8038 6896 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_17500 9291 8038 gene locus_tag LOCUS_17510 9291 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 11190 9322 gene locus_tag LOCUS_17520 gene asnB 11190 9322 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073062.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence067 2211 1240 gene locus_tag LOCUS_17530 gene dusB 2211 1240 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_17530 2984 2211 gene locus_tag LOCUS_17540 2984 2211 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_17540 3359 3024 gene locus_tag LOCUS_17550 3359 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 4332 3352 gene locus_tag LOCUS_17560 4332 3352 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 protein_id gnl|my_center|LOCUS_17560 5339 4332 gene locus_tag LOCUS_17570 gene argF 5339 4332 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_17570 6598 5351 gene locus_tag LOCUS_17580 gene lysA 6598 5351 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939836.1 protein_id gnl|my_center|LOCUS_17580 6924 6655 gene locus_tag LOCUS_17590 6924 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 7963 7031 gene locus_tag LOCUS_17600 7963 7031 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_17600 8437 7982 gene locus_tag LOCUS_17610 8437 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 8639 10153 gene locus_tag LOCUS_17620 8639 10153 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_17620 11070 10150 gene locus_tag LOCUS_17630 11070 10150 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896738.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence068 2157 718 gene locus_tag LOCUS_17640 2157 718 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288002.1 protein_id gnl|my_center|LOCUS_17640 3763 2138 gene locus_tag LOCUS_17650 3763 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 4789 3818 gene locus_tag LOCUS_17660 4789 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 5679 4858 gene locus_tag LOCUS_17670 5679 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 7048 5666 gene locus_tag LOCUS_17680 7048 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 7661 7194 gene locus_tag LOCUS_17690 gene ribE 7661 7194 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_17690 8924 7701 gene locus_tag LOCUS_17700 8924 7701 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_17700 9589 8936 gene locus_tag LOCUS_17710 9589 8936 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_17710 10706 9570 gene locus_tag LOCUS_17720 gene ribD 10706 9570 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence069 158 1522 gene locus_tag LOCUS_17730 158 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2814 1636 gene locus_tag LOCUS_17740 2814 1636 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_17740 3621 2905 gene locus_tag LOCUS_17750 3621 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 3956 4381 gene locus_tag LOCUS_17760 3956 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245685.1 protein_id gnl|my_center|LOCUS_17760 4503 5237 gene locus_tag LOCUS_17770 4503 5237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963591.1 protein_id gnl|my_center|LOCUS_17770 5260 6930 gene locus_tag LOCUS_17780 5260 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 6984 7607 gene locus_tag LOCUS_17790 6984 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 7600 7746 gene locus_tag LOCUS_17800 7600 7746 CDS product CD1871A family CXXC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674194.1 protein_id gnl|my_center|LOCUS_17800 7746 8633 gene locus_tag LOCUS_17810 7746 8633 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_17810 8666 9193 gene locus_tag LOCUS_17820 8666 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 9357 9695 gene locus_tag LOCUS_17830 9357 9695 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461711.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence070 101 646 gene locus_tag LOCUS_17840 101 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 869 937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1178 2248 gene locus_tag LOCUS_17850 1178 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2363 2965 gene locus_tag LOCUS_17860 gene ruvA 2363 2965 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_17860 2965 3975 gene locus_tag LOCUS_17870 gene ruvB 2965 3975 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_17870 4020 4424 gene locus_tag LOCUS_17880 4020 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4506 6731 gene locus_tag LOCUS_17890 4506 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 6732 9530 gene locus_tag LOCUS_17900 6732 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence071 <1 866 gene locus_tag LOCUS_17910 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435963.1:molecular chaperone HtpG note possible pseudo, internal stop codon, frameshifted 800 813 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 814 1035 gene locus_tag LOCUS_17920 814 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2478 1126 gene locus_tag LOCUS_17930 2478 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3368 2478 gene locus_tag LOCUS_17940 3368 2478 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_17940 3463 3657 gene locus_tag LOCUS_17950 3463 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 5509 3710 gene locus_tag LOCUS_17960 5509 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 7178 5496 gene locus_tag LOCUS_17970 7178 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 7448 7182 gene locus_tag LOCUS_17980 7448 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 7751 7452 gene locus_tag LOCUS_17990 7751 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence072 429 1538 gene locus_tag LOCUS_18000 429 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1583 2344 gene locus_tag LOCUS_18010 1583 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2457 2942 gene locus_tag LOCUS_18020 gene greA 2457 2942 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_18020 3127 4251 gene locus_tag LOCUS_18030 3127 4251 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_18030 4388 6613 gene locus_tag LOCUS_18040 4388 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 6653 7048 gene locus_tag LOCUS_18050 6653 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 7045 8988 gene locus_tag LOCUS_18060 7045 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 9099 9380 gene locus_tag LOCUS_18070 9099 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence073 883 671 gene locus_tag LOCUS_18080 883 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1079 930 gene locus_tag LOCUS_18090 gene rpmG 1079 930 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_18090 1444 2748 gene locus_tag LOCUS_18100 1444 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4463 2799 gene locus_tag LOCUS_18110 4463 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5160 4486 gene locus_tag LOCUS_18120 5160 4486 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271203.1 protein_id gnl|my_center|LOCUS_18120 5835 5161 gene locus_tag LOCUS_18130 5835 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 7094 5898 gene locus_tag LOCUS_18140 7094 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 6313 6379 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8270 7110 gene locus_tag LOCUS_18150 8270 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 8610 8410 gene locus_tag LOCUS_18160 8610 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 8848 8591 gene locus_tag LOCUS_18170 8848 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence074 1291 1219 gene locus_tag LOCUS_t00220 1291 1219 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2384 1392 gene locus_tag LOCUS_18180 2384 1392 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_18180 4831 2381 gene locus_tag LOCUS_18190 gene glgB 4831 2381 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324338.1 protein_id gnl|my_center|LOCUS_18190 6092 4851 gene locus_tag LOCUS_18200 6092 4851 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_18200 6265 6555 gene locus_tag LOCUS_18210 6265 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 6983 6672 gene locus_tag LOCUS_18220 6983 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18220 7068 7153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8961 7876 gene locus_tag LOCUS_18230 gene serC 8961 7876 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence075 <1 740 gene locus_tag LOCUS_18240 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461752.1:DNA polymerase III subunit alpha 1009 2364 gene locus_tag LOCUS_18250 1009 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2421 4145 gene locus_tag LOCUS_18260 2421 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 4235 4307 gene locus_tag LOCUS_t00230 4235 4307 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4435 5766 gene locus_tag LOCUS_18270 4435 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 5778 6005 gene locus_tag LOCUS_18280 5778 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 6143 8221 gene locus_tag LOCUS_18290 6143 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence076 2488 716 gene locus_tag LOCUS_18300 gene dnaG 2488 716 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_18300 3508 2504 gene locus_tag LOCUS_18310 3508 2504 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_18310 4987 3617 gene locus_tag LOCUS_18320 4987 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 6507 5044 gene locus_tag LOCUS_18330 6507 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 7405 6509 gene locus_tag LOCUS_18340 7405 6509 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_18340 <8700 7505 gene locus_tag LOCUS_18350 <8700 7505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964962.1:phosphoribosylformylglycinamidine synthase >Feature sequence077 3001 302 gene locus_tag LOCUS_18360 3001 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 3386 3096 gene locus_tag LOCUS_18370 3386 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 3930 3517 gene locus_tag LOCUS_18380 3930 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 6059 3942 gene locus_tag LOCUS_18390 6059 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 4015 4211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7848 6127 gene locus_tag LOCUS_18400 7848 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 6313 6469 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <8555 8056 gene locus_tag LOCUS_18410 <8555 8056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767778.1:aldose 1-epimerase family protein >Feature sequence078 1227 577 gene locus_tag LOCUS_18420 1227 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2166 1231 gene locus_tag LOCUS_18430 gene era 2166 1231 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_18430 4813 2186 gene locus_tag LOCUS_18440 4813 2186 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_18440 4838 4914 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5559 5155 gene locus_tag LOCUS_18450 5559 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 6335 5592 gene locus_tag LOCUS_18460 6335 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 7306 6350 gene locus_tag LOCUS_18470 7306 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 <8379 7333 gene locus_tag LOCUS_18480 <8379 7333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986885.1:alanine--tRNA ligase >Feature sequence079 2215 929 gene locus_tag LOCUS_18490 gene serS 2215 929 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_18490 2765 2256 gene locus_tag LOCUS_18500 2765 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3749 2871 gene locus_tag LOCUS_18510 3749 2871 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 protein_id gnl|my_center|LOCUS_18510 4555 3794 gene locus_tag LOCUS_18520 4555 3794 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_18520 5276 4602 gene locus_tag LOCUS_18530 5276 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 5295 5422 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7195 5867 gene locus_tag LOCUS_18540 7195 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 6494 6563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence080 380 1213 gene locus_tag LOCUS_18550 380 1213 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563826.1 protein_id gnl|my_center|LOCUS_18550 1350 1523 gene locus_tag LOCUS_18560 1350 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1674 2585 gene locus_tag LOCUS_18570 1674 2585 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966060.1 protein_id gnl|my_center|LOCUS_18570 2588 3373 gene locus_tag LOCUS_18580 2588 3373 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_18580 3400 4005 gene locus_tag LOCUS_18590 gene scpB 3400 4005 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_18590 4181 5569 gene locus_tag LOCUS_18600 4181 5569 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_18600 5604 6419 gene locus_tag LOCUS_18610 5604 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 6443 6811 gene locus_tag LOCUS_18620 6443 6811 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence081 264 49 gene locus_tag LOCUS_18630 264 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1635 361 gene locus_tag LOCUS_18640 1635 361 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434194.1 protein_id gnl|my_center|LOCUS_18640 3361 1673 gene locus_tag LOCUS_18650 3361 1673 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_18650 4185 3412 gene locus_tag LOCUS_18660 4185 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 5672 4185 gene locus_tag LOCUS_18670 5672 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 6910 5714 gene locus_tag LOCUS_18680 6910 5714 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_18680 7391 6951 gene locus_tag LOCUS_18690 7391 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence082 973 281 gene locus_tag LOCUS_18700 973 281 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_18700 4597 1091 gene locus_tag LOCUS_18710 4597 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 5675 4743 gene locus_tag LOCUS_18720 5675 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 7276 5927 gene locus_tag LOCUS_18730 7276 5927 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016159.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence083 957 202 gene locus_tag LOCUS_18740 957 202 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_18740 1835 1080 gene locus_tag LOCUS_18750 1835 1080 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 protein_id gnl|my_center|LOCUS_18750 3071 1980 gene locus_tag LOCUS_18760 3071 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 4513 3215 gene locus_tag LOCUS_18770 4513 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 5171 4683 gene locus_tag LOCUS_18780 gene tadA 5171 4683 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_18780 5770 5189 gene locus_tag LOCUS_18790 5770 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 5825 5898 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7007 5943 gene locus_tag LOCUS_18800 7007 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence084 <1 1439 gene locus_tag LOCUS_18810 <1 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043943600.1:ABC transporter ATP-binding protein 1529 1876 gene locus_tag LOCUS_18820 1529 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1987 3336 gene locus_tag LOCUS_18830 gene tilS 1987 3336 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966480.1 protein_id gnl|my_center|LOCUS_18830 3743 3840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3930 5756 gene locus_tag LOCUS_18840 gene ftsH 3930 5756 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_18840 6242 6670 gene locus_tag LOCUS_18850 gene rplM 6242 6670 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650450.1 protein_id gnl|my_center|LOCUS_18850 6690 7094 gene locus_tag LOCUS_18860 gene rpsI 6690 7094 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence085 <1 587 gene locus_tag LOCUS_18870 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011166633.1:DUF2779 domain-containing protein 462 513 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 690 971 gene locus_tag LOCUS_18880 690 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 989 1231 gene locus_tag LOCUS_18890 989 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1276 1683 gene locus_tag LOCUS_18900 1276 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1754 2770 gene locus_tag LOCUS_18910 1754 2770 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389640.1 protein_id gnl|my_center|LOCUS_18910 2811 4034 gene locus_tag LOCUS_18920 2811 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4163 6235 gene locus_tag LOCUS_18930 4163 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence086 2020 1418 gene locus_tag LOCUS_18940 2020 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18940 1497 1523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3037 2078 gene locus_tag LOCUS_18950 3037 2078 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_18950 3123 4475 gene locus_tag LOCUS_18960 3123 4475 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence087 2094 1465 gene locus_tag LOCUS_18970 2094 1465 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_18970 4427 2121 gene locus_tag LOCUS_18980 4427 2121 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_18980 5012 4488 gene locus_tag LOCUS_18990 5012 4488 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902332.1 protein_id gnl|my_center|LOCUS_18990 5572 5129 gene locus_tag LOCUS_19000 5572 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19000 5597 5674 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence088 144 207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 486 256 gene locus_tag LOCUS_19010 486 256 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_19010 1076 516 gene locus_tag LOCUS_19020 1076 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1774 1286 gene locus_tag LOCUS_19030 1774 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 1993 1793 gene locus_tag LOCUS_19040 1993 1793 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262994.1 protein_id gnl|my_center|LOCUS_19040 2245 1997 gene locus_tag LOCUS_19050 2245 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2277 2337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3324 2479 gene locus_tag LOCUS_19060 3324 2479 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994275.1 protein_id gnl|my_center|LOCUS_19060 3646 3341 gene locus_tag LOCUS_19070 3646 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3768 5003 gene locus_tag LOCUS_19080 3768 5003 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence089 426 483 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 502 720 gene locus_tag LOCUS_19090 502 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 807 1607 gene locus_tag LOCUS_19100 807 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1604 2608 gene locus_tag LOCUS_19110 1604 2608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_19110 2608 4755 gene locus_tag LOCUS_19120 2608 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence090 318 1847 gene locus_tag LOCUS_19130 318 1847 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963849.1 protein_id gnl|my_center|LOCUS_19130 1897 2670 gene locus_tag LOCUS_19140 1897 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 3346 2684 gene locus_tag LOCUS_19150 3346 2684 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_19150 4169 3321 gene locus_tag LOCUS_19160 4169 3321 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_19160 3382 3465 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence091 131 1534 gene locus_tag LOCUS_19170 131 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1491 2639 gene locus_tag LOCUS_19180 1491 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2870 4246 gene locus_tag LOCUS_19190 gene argH 2870 4246 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence092 1264 212 gene locus_tag LOCUS_19200 1264 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19200 276 361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3000 1321 gene locus_tag LOCUS_19210 gene ilvD 3000 1321 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_19210 3882 3106 gene locus_tag LOCUS_19220 3882 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 4166 4588 gene locus_tag LOCUS_19230 4166 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence093 477 1865 gene locus_tag LOCUS_19240 477 1865 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_19240 1852 2799 gene locus_tag LOCUS_19250 1852 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2809 4098 gene locus_tag LOCUS_19260 2809 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence094 <1 1746 gene locus_tag LOCUS_19270 <1 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein 1792 2502 gene locus_tag LOCUS_19280 gene rgaR 1792 2502 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_19280 2520 3704 gene locus_tag LOCUS_19290 gene thiI 2520 3704 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_19290 4019 3786 gene locus_tag LOCUS_19300 4019 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence095 2083 929 gene locus_tag LOCUS_19310 2083 929 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_19310 2879 2085 gene locus_tag LOCUS_19320 2879 2085 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_19320 3866 2886 gene locus_tag LOCUS_19330 gene prmA 3866 2886 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence096 35 2491 gene locus_tag LOCUS_19340 35 2491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986151.1 protein_id gnl|my_center|LOCUS_19340 2532 3233 gene locus_tag LOCUS_19350 2532 3233 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965298.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence097 159 206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 405 890 gene locus_tag LOCUS_19360 405 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence098 1537 830 gene locus_tag LOCUS_19370 1537 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2722 1649 gene locus_tag LOCUS_19380 gene tsf 2722 1649 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808080.1 protein_id gnl|my_center|LOCUS_19380 <3381 2858 gene locus_tag LOCUS_19390 <3381 2858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003220918.1:30S ribosomal protein S2 >Feature sequence099 1776 28 gene locus_tag LOCUS_19400 1776 28 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964921.1 protein_id gnl|my_center|LOCUS_19400 1981 1778 gene locus_tag LOCUS_19410 1981 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2792 2250 gene locus_tag LOCUS_19420 2792 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19420 <3371 2758 gene locus_tag LOCUS_19430 <3371 2758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810321.1:carbamoyl-phosphate synthase large subunit note possible pseudo, frameshifted 2793 2816 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence100 2716 656 gene locus_tag LOCUS_19440 2716 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2937 3124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence101 2015 405 gene locus_tag LOCUS_19450 2015 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence102 375 752 gene locus_tag LOCUS_19460 375 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19460 727 742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 757 1086 gene locus_tag LOCUS_19470 757 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19470 1434 1922 gene locus_tag LOCUS_19480 gene rplJ 1434 1922 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048982.1 protein_id gnl|my_center|LOCUS_19480 1982 2347 gene locus_tag LOCUS_19490 gene rplL 1982 2347 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence103 <2686 1338 gene locus_tag LOCUS_19500 <2686 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860925.1:phenylalanine--tRNA ligase subunit beta