COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..55464 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..924 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097738.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene fliP CDS 937..1206 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187355.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene fliQ CDS 1211..2005 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616875.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene fliR CDS 2412..2939 product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097740.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene rcsA CDS complement(2996..3184) product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene dsrB CDS 3316..3549 product YodD family peroxide/acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097742.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene yodD CDS 3857..4075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 note possible pseudo, frameshifted CDS 3991..4668 product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948794.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 note possible pseudo, frameshifted CDS complement(4657..5640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 5719..6078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(6515..6649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(6740..7609) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 7951..8862 product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097747.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene yedA CDS complement(8930..9283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 note possible pseudo, frameshifted CDS complement(9287..10702) product DNA-cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene dcm CDS complement(10750..11436) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365890.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(11491..11709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(12268..12462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 12441..13571 product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096462.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 tRNA complement(13788..13877) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 13972..14763 product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881844.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene mtfA tRNA 14864..14939 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(14997..15947) product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097829.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene cbl CDS complement(16049..16966) product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432103.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene nac CDS 17308..17979 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 17998..19185 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097035.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 19278..20609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 note possible pseudo, frameshifted CDS 20536..20784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 note possible pseudo, frameshifted CDS 20786..22741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(22827..23465) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296118.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(23458..23751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 note possible pseudo, frameshifted assembly_gap 24071..24207 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24243..24455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 25337..26122 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086142.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 26142..26375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 26375..26623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(26818..27102) product type VI secretion system PAAR protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640144.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(27228..28169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(28178..29794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(29794..30618) product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776489.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(30621..32561) product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306807.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene tssI CDS complement(32786..33304) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142958.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 33945..34448 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037399.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene tssB CDS 34478..34690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 34739..36211 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056978.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene tssC CDS 36208..36624 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene tssE CDS 36629..37450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 37563..38366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 38330..39418 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348793.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene tssG CDS 39443..40294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 note possible pseudo, frameshifted CDS 40311..40691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 note possible pseudo, frameshifted CDS 40688..41221 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080153.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene tssJ CDS 41224..42201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 note possible pseudo, frameshifted CDS 42212..42529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 note possible pseudo, frameshifted CDS 42534..43292 product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343303.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene icmH CDS 43301..45022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 note possible pseudo, frameshifted CDS 44979..46070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 note possible pseudo, frameshifted CDS 46067..48169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 48187..49512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 note possible pseudo, frameshifted CDS 49433..51736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 note possible pseudo, frameshifted CDS 51747..52265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 assembly_gap 52125..52173 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 52327..52902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 52925..53404 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284958.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 53437..54312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 54485..54778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 54788..55156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 sequence002 source 1..41569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 189..272 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(611..784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 note possible pseudo, frameshifted CDS complement(819..1718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 note possible pseudo, frameshifted CDS 1982..3334 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene glpT CDS complement(3374..3628) product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135039.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene yfaE CDS complement(3630..4760) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene nrdB CDS complement(4815..5645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 note possible pseudo, internal stop codon CDS complement(5736..7100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 note possible pseudo, internal stop codon CDS 7032..7208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 7624..7854 product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene vapB CDS 7851..8267 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(8529..8762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 9561..10475 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007374408.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(10884..11108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(11380..11811) product silver-binding protein SilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790485.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene silE CDS complement(12062..13537) product copper/silver sensor histidine kinase SilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007374412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene silS CDS complement(13530..14213) product copper/silver response regulator transcription factor SilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene silR CDS 14511..15785 product Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001507116.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene silC CDS 15814..16167 product cation efflux system protein CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246153.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene cusF CDS 16443..17573 product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087116.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene silB CDS 17584..20730 product Cu(+)/Ag(+) efflux RND transporter permease subunit SilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene silA CDS 20816..21256 product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 22143..23825 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001378038.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 23866..24063 product DUF2933 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(24097..24834) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(25123..25572) product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023257.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 25807..27558 product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 27558..28454 product copper resistance outer membrane transporter PcoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001378118.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene pcoB CDS 28494..28874 product copper resistance system metallochaperone PcoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025662.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene pcoC CDS 28879..29808 product copper resistance inner membrane protein PcoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087112.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene pcoD CDS 29863..30543 product copper response regulator transcription factor PcoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188930.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene pcoR CDS 30540..31940 product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046494163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene pcoS CDS 32158..32592 product copper resistance system metallochaperone PcoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene pcoE CDS 33452..33718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175303.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 33740..34078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(34407..34634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(34672..34884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(35162..35407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 35719..36117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(36485..36700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(37054..37455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 37687..38961 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene hmpA CDS complement(39048..40007) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705307.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(41056..41544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 sequence003 source 1..41513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(173..325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 note possible pseudo, frameshifted CDS complement(277..951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 note possible pseudo, frameshifted CDS complement(1001..1315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 1573..1866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 1863..2876 product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096265.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene rssB CDS 3077..3985 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene galU CDS 4009..5352 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210664.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 5364..6374 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(6442..6855) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene hns CDS 7504..8019 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705104.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene tdk note possible pseudo, internal stop codon CDS complement(8098..10776) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301680.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene adhE CDS 11255..11902 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615840.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 12636..14195 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367070.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene oppA CDS 14306..14818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 note possible pseudo, frameshifted CDS 14742..15143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 note possible pseudo, frameshifted CDS 15158..15958 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene oppC CDS 15971..16972 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272969.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene oppD CDS 16974..17792 product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene sapF CDS 17898..18686 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene fabI CDS 18894..20054 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 20156..22090 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485012.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene rnb CDS 22390..24381 product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096381.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene pdeR CDS complement(24378..25250) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096380.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 25460..25642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096379.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 25820..26578 product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096378.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 26833..27048 product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene osmB CDS complement(27157..27483) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295580.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene yciH CDS complement(27483..28214) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176265.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene pyrF CDS complement(28397..28849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 note possible pseudo, internal stop codon, frameshifted CDS complement(28851..29591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 note possible pseudo, frameshifted CDS complement(29596..29901) product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876301.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 assembly_gap 30163..30204 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(30302..30814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 note possible pseudo, frameshifted CDS 30976..31611 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene ribA CDS complement(31658..32446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(32412..33857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 note possible pseudo, frameshifted CDS complement(33851..34030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 note possible pseudo, frameshifted CDS 34726..36024 product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene chiP CDS 36081..38438 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816825.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 38474..38788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 38775..39110 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385717.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene tnpB CDS 39138..40709 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 40909..41127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 sequence004 source 1..40054 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 836..840 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1007..1930) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622336.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 assembly_gap 1029..1050 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1927..2223) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700679.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene citD CDS complement(2220..3296) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467705.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene citC CDS 3654..5315 product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene dpiB CDS 5284..5964 product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138786.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene dpiA CDS complement(5959..7254) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038841.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 7727..9124 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895572.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 9121..10335 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(10453..10809) product DUF1937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083172.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(10848..10997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(10970..12058) product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083171.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene eutH CDS complement(12070..13512) product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114294.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 13916..14680 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(14871..16187) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112713.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(16207..17160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(17264..18088) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037490.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 18194..19132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(19195..19656) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 19807..20502 product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366894.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 20524..21417 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 tRNA complement(21706..21782) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 21997..22605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 note possible pseudo, frameshifted CDS 22608..22853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 note possible pseudo, frameshifted CDS 22855..23067 product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190278.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene ybcJ CDS complement(23112..23378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 note possible pseudo, frameshifted CDS complement(23336..24952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 24933..25118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(25125..25610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 26176..27612 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095927.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 27692..28426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 note possible pseudo, frameshifted CDS 28465..28683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 note possible pseudo, frameshifted CDS complement(28688..29416) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770966.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 29679..30203 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(30253..31638) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704630.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene cysS CDS 31816..32310 product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367878.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene ppiB CDS 32386..32835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 note possible pseudo, internal stop codon, frameshifted CDS 32759..33016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 note possible pseudo, frameshifted CDS 33176..33451 product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097697.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene yahO CDS complement(33615..34664) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(34795..36771) product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 assembly_gap 37432..37522 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 37536..38561 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene purK CDS 38689..39651 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095917.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene mnmH note possible pseudo, frameshifted sequence005 source 1..39663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(593..1267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(1268..1570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(1570..4671) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515491.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(4857..5411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(5510..6037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(5980..6699) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(6699..7403) product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113185.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 7467..7832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(7812..7991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(8013..8366) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(8366..10345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 note possible pseudo, frameshifted CDS complement(10384..11760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 note possible pseudo, frameshifted CDS complement(11818..12426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(12438..12770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(12894..13565) product DUF6246 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097711.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(13626..14381) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097712.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(14439..14822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097713.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(14819..15244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705871.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(15247..15597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095987.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(15600..15770) product DUF551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126356113.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(15770..16150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(16153..16284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(16365..17048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 assembly_gap 17080..17160 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17319..17750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(17754..19019) product DUF2213 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705878.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 assembly_gap 18485..18512 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19093..19326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(19421..20323) product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(20355..21824) product DUF1073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188035104.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(21837..22343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 note possible pseudo, frameshifted CDS complement(22384..23286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 note possible pseudo, frameshifted CDS complement(23286..23888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705883.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(23892..24098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(24095..24313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097720.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(24439..24993) product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095973.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(25251..25712) product lysis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092266.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(25712..26281) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061070701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(26283..26582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 tRNA complement(26781..26853) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(26865..27380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(27784..28911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(28908..29081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(29251..29493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(29475..29852) product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008200.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(29849..30139) product DUF1364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(30132..30314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(30301..30693) product DUF2591 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085071332.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(30859..31305) product recombination protein NinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814576.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(31435..31710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(31741..31971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(31968..32339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(32336..32683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(32646..32939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(32936..33205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(33215..33784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(34029..34928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(34939..35739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(35785..36078) product lambda phage CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251069.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(36181..36408) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180318.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 36487..37200 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250470.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 37299..37592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 37601..37909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 37914..38300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(38334..38543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098072.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 39147..39401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 39439..39645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 sequence006 source 1..39034 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..1091) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098297.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 note possible pseudo, frameshifted CDS complement(1082..1696) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 1855..3132 product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098299.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene csiE CDS complement(3129..3872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 note possible pseudo, frameshifted CDS complement(4328..4474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(4431..4943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117719.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(5135..6388) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098302.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 6713..7636 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene hmpA note possible pseudo, frameshifted CDS 7611..7871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 note possible pseudo, frameshifted CDS complement(7941..10997) product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178244.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene mscK CDS complement(10964..11293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 note possible pseudo, frameshifted CDS complement(11426..12070) product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101755.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene acrR CDS 12256..12801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 note possible pseudo, frameshifted CDS 12792..13349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 note possible pseudo, frameshifted CDS 13372..14604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 note possible pseudo, frameshifted CDS 14580..15842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 note possible pseudo, internal stop codon, frameshifted CDS 15885..16514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 note possible pseudo, internal stop codon CDS 16985..17359 product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499288.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene tomB CDS 17388..17606 product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291435.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 18045..18515 product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(18552..18692) product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859006.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene ykgO CDS complement(18695..18955) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367923.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 19214..20776 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213129.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(20784..21137) product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878140.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(21335..21553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367928.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(21550..21801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095876.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 22251..22571 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095875.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(22604..23176) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779831.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 23475..24335 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene tesB CDS complement(24391..25566) product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685029.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene amtB CDS complement(25640..25978) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367937.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene glnK CDS complement(26232..27074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 note possible pseudo, frameshifted CDS complement(27052..27999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 note possible pseudo, frameshifted CDS complement(27992..28810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(28770..29642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 note possible pseudo, frameshifted CDS complement(29705..30166) product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene decR CDS 30282..30869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 30806..31225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(31265..32083) product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095866.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene cof CDS complement(32110..32298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 32251..33702 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238179.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 note possible pseudo, frameshifted CDS 33722..33886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 note possible pseudo, frameshifted CDS 33957..34652 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095864.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene queC CDS complement(34688..35092) product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194534.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene fadM CDS complement(35243..35614) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(35761..37683) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095860.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene ppiD CDS complement(37812..38084) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002444653.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene hupB CDS complement(38295..38543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 note possible pseudo, frameshifted misc_feature complement(38455..>39034) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295325.1:endopeptidase La note possible pseudo, frameshifted locus_tag LOCUS_03020 sequence007 source 1..38937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 161..1054 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(1081..1647) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 2114..2557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 note possible pseudo, frameshifted CDS 2677..4800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 4885..6213 product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene uhpC CDS 6229..7059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 7168..9228 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095788.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 9414..10217 product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078833.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene fbpC note possible pseudo, frameshifted CDS 10693..11760 product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626060.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 11900..12586 product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388664.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 12579..13403 product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388665.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene eutJ CDS 13408..14088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 14100..14372 product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 14469..14795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 14902..16038 product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene tdcD CDS 16366..16647 product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene pduA CDS 16669..17454 product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388661.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene pduB CDS 17682..18980 product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 19062..19301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 19312..19887 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388657.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 19936..22230 product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388658.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(22137..22352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 22473..23390 product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388671.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 23535..24227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 note possible pseudo, frameshifted CDS 24170..24403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 note possible pseudo, frameshifted CDS complement(24518..24910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(24886..25038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 note possible pseudo, frameshifted CDS complement(25083..26234) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627231.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene metK CDS complement(26354..27418) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388674.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(27436..28665) product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388673.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(29300..29599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 29939..30928 product ferrioxamine uptake transcriptional regulator FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074609.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene foxR CDS 31069..33255 product ferrioxamine B receptor FoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127727.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene foxA CDS 33440..33763 product DUF1889 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369626.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 tRNA complement(33851..33926) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 34052..34558 product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098778.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene mug CDS complement(34611..36152) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene rpoD note possible pseudo, frameshifted CDS complement(36116..36397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 note possible pseudo, frameshifted CDS complement(36551..38305) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene dnaG CDS complement(38475..38690) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene rpsU sequence008 source 1..38647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..516 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002886687.1:FKBP-type peptidyl-prolyl cis-trans isomerase locus_tag LOCUS_03420 CDS 806..1663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 note possible pseudo, frameshifted CDS 1594..2157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 note possible pseudo, frameshifted CDS complement(2221..2769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 note possible pseudo, frameshifted CDS complement(2973..3857) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 assembly_gap 3354..3391 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3934..4761) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095315.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(4857..5687) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704185.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 5772..6170 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(6167..8119) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 8332..9072 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene cysQ CDS complement(9062..9619) product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 9955..10161 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501430.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(10237..11556) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095324.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(11605..12708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(12725..15250) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(15263..15979) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703410.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(16045..16512) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(16927..17562) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene msrA CDS 18068..18667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 note possible pseudo, frameshifted CDS 18669..19454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 note possible pseudo, frameshifted CDS 19451..23227 product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095334.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene tamB CDS 23230..23574 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027890.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 24366..24899 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 24979..25662 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 25662..26753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 note possible pseudo, frameshifted assembly_gap 26892..26965 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26992..28158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 note possible pseudo, frameshifted CDS 28158..29198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(29278..29694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 note possible pseudo, frameshifted CDS complement(29583..29852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 note possible pseudo, frameshifted CDS 30295..31209 product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014882271.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene ytfQ CDS 31278..32780 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095340.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 32793..33809 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799150.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 33802..34803 product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene yjfF CDS 34905..35384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 note possible pseudo, frameshifted assembly_gap 35654..35705 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 35726..36346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(36414..37412) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene fbp sequence009 source 1..37374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 277..359 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(413..1120) product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098661.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene endA CDS complement(1217..1726) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860035.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(1800..3182) product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene galP CDS complement(3530..4684) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098658.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene metK CDS 5654..6796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 note possible pseudo, frameshifted CDS 6711..7457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 note possible pseudo, frameshifted CDS complement(7715..7936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 7847..8533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 note possible pseudo, frameshifted CDS complement(8583..9341) product metalloprotease LoiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701842.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene loiP CDS 9630..11003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 assembly_gap 10877..10969 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11104..11472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(11522..12172) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(12166..12696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 assembly_gap 12485..12520 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12684..14042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 assembly_gap 13172..13297 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14062..14454) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218564.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 14835..15854 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene epd CDS 15904..16818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 assembly_gap 16237..16296 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17011..18087 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098634.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene fbaA CDS 18287..18562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 note possible pseudo, internal stop codon CDS 18581..19261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 note possible pseudo, internal stop codon CDS 19394..20029 product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703435.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene argO CDS 20100..20798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 note possible pseudo, frameshifted CDS 20683..20898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 note possible pseudo, frameshifted CDS complement(20930..21670) product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene argP note possible pseudo, frameshifted CDS 21962..22621 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene rpiA CDS 22892..24130 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098629.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene serA CDS complement(24238..24762) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098628.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 note possible pseudo, frameshifted CDS complement(25047..25376) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene zapA CDS 25532..26101 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027229.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 26127..27098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 note possible pseudo, frameshifted CDS 27047..27442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 note possible pseudo, frameshifted CDS 27439..28614 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111195.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene ubiH CDS 28625..29827 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703429.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene ubiI CDS 30239..31336 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068738.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene gcvT CDS 31363..31752 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene gcvH CDS 31863..34169 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene gcvP note possible pseudo, frameshifted CDS 34147..34707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 note possible pseudo, frameshifted CDS complement(35447..36838) product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784821.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene ccp sequence010 source 1..37273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 208..325 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 618..767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 note possible pseudo, frameshifted CDS complement(1243..1578) product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 1728..2000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(1997..2176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(2289..3176) product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene lpxP CDS complement(3664..5706) product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096778.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene dcp CDS 5856..6605 product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096779.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene ydfG CDS 6688..7377 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 7492..7695 product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096785.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene ydfZ CDS complement(7834..8907) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382183.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 note possible pseudo, frameshifted CDS complement(9227..9559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(9441..10742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(10841..12391) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096787.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(12419..13825) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096788.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene uxaC CDS complement(13871..15085) product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096791.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene rspA CDS complement(15233..15559) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314753.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 15949..16506 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138584.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene speG CDS complement(16522..17232) product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096795.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 17342..17644 product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096796.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(17680..19125) product PTS N-acetylmuramic acid transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703855.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene murP CDS complement(19136..20038) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369100.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene murQ CDS complement(20301..21515) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(21520..22662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 note possible pseudo, frameshifted CDS complement(22739..23407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 note possible pseudo, frameshifted CDS 23911..24621 product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096821.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene osmY CDS 24644..25546 product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211196.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene osmX CDS 25559..26206 product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808875.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene osmW assembly_gap 26347..26392 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26405..27100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(27136..27327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 note possible pseudo, frameshifted CDS complement(27354..27761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 note possible pseudo, frameshifted CDS complement(27885..29102) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(29209..30129) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 30329..31003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 note possible pseudo, frameshifted CDS 30963..31478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 note possible pseudo, frameshifted CDS 31550..33037 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705288.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 33328..34146 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(34173..34502) product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046661.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene mdtI CDS complement(34489..34851) product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882799.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene mdtJ CDS complement(35433..35837) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 sequence011 source 1..36792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(810..1280) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861706.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rpsG CDS complement(1376..1684) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene rpsL CDS complement(1809..2096) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903373.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene tusB CDS complement(2104..2466) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820720.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene tusC CDS complement(2466..2837) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene tusD CDS complement(2852..3580) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091466.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(3901..4632) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene fkpA note possible pseudo, frameshifted CDS complement(4854..5441) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene slyD CDS complement(5536..5730) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099038.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(5746..5895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 note possible pseudo, internal stop codon CDS complement(5932..7551) product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene kefB CDS complement(7551..8102) product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099040.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene kefG CDS 8309..10213 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 10241..11257 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099052.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 11254..11472 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 11581..12330 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274690.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(12389..12793) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 13097..13729 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene crp CDS 13777..15876 product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(15866..17083) product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963784.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene argD CDS complement(17169..17732) product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099059.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene pabA CDS complement(17763..18365) product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280679.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(18355..18525) product YhfG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519136.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(18631..19203) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene ppiA CDS 19480..20652 product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene tsgA CDS complement(20668..21966) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703651.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 22205..24751 product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049259.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene nirB CDS 24748..25074 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene nirD CDS 25266..26075 product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493575.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene nirC CDS 26087..27811 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349881.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene cysG CDS 28149..29486 product fructoselysine/psicoselysine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene frlA CDS 29508..30530 product fructoselysine 6-phosphate deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295163.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene frlB CDS 30583..31401 product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847833.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene frlC CDS 31410..32195 product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853351.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene frlD CDS 32296..33030 product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302327.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene frlR CDS complement(33073..34077) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369391.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene trpS CDS complement(34070..34831) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099068.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene gph CDS complement(34824..35501) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503032.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene rpe CDS complement(35542..36357) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene dam CDS complement(36424..36657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 sequence012 source 1..36594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1453 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704378.1:DNA polymerase II locus_tag LOCUS_04950 CDS 1584..2516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 note possible pseudo, frameshifted CDS 2504..4333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 note possible pseudo, frameshifted CDS 4480..5133 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002888348.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene rluA CDS complement(5173..5988) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200573.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene djlA CDS 6351..7343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 note possible pseudo, frameshifted CDS 7504..8715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 note possible pseudo, frameshifted CDS 8764..10050 product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene surA CDS 10050..11045 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095541.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene pdxA CDS 11042..11863 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065397.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene rsmA CDS 11867..12244 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095539.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene apaG CDS 12249..13112 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257211.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene apaH CDS complement(13156..13635) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene folA CDS 13904..14518 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166992.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 14807..15319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(15584..17446) product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene kefC CDS complement(17439..17858) product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene kefF note possible pseudo, frameshifted CDS complement(18002..19291) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(19334..19621) product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene fixX CDS complement(19618..20904) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(20961..21878) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032189.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(21890..22663) product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 23105..24619 product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787109.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene caiT CDS 24660..25802 product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene caiA CDS 25875..27095 product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349928.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene caiB CDS 27162..28718 product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene caiC CDS 28790..29575 product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene caiD CDS 29598..30188 product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122865.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene caiE CDS complement(30233..30628) product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene caiF CDS complement(30865..31098) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(31211..31777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(31892..32170) product biofilm development regulator YmgB/AriR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367639.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(32207..32524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(32689..32934) product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096960.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene ycgZ CDS 33378..34526 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704783.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 34976..35446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 note possible pseudo, frameshifted misc_feature complement(35500..>36594) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095532.1:carbamoyl-phosphate synthase large subunit locus_tag LOCUS_05310 sequence013 source 1..35785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..535 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097436.1:glutathione ABC transporter ATP-binding protein GsiA locus_tag LOCUS_05320 CDS 537..2075 product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097435.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene gsiB CDS 2121..3041 product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936043.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene gsiC CDS 3086..3955 product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704838.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene gsiD CDS complement(3997..5322) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097432.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene rimO CDS 5517..5717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(5714..6622) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816320.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 tRNA 6154..6232 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 6910..7209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 7361..7663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 note possible pseudo, frameshifted CDS 7675..8472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 note possible pseudo, frameshifted CDS complement(8473..8961) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 note possible pseudo, frameshifted CDS complement(8958..9107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 note possible pseudo, frameshifted CDS 9358..10563 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831210.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene dacC CDS complement(10605..11225) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097425.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene deoR assembly_gap 11263..11309 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11374..11982) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene ybjG CDS 12265..13290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 note possible pseudo, frameshifted CDS 13199..13489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 note possible pseudo, frameshifted CDS complement(13520..14332) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(14347..15540) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620242.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 15629..16189 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(16262..17353) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290950.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(17419..18039) product phage repressor protein CI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 18176..18397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097412.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 18430..18933 product phage regulatory CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 18941..19135 product DUF2724 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 19125..19553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 19550..19951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974860.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 20018..20263 product DUF2732 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551165.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 20254..20562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 20546..21382 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 21379..22023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 note possible pseudo, frameshifted CDS 21929..22573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 note possible pseudo, frameshifted CDS 22465..23376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 note possible pseudo, frameshifted CDS 23495..23707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(23681..23938) product ogr/Delta-like zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602735.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(23989..25014) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(25011..26786) product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097400.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 26946..27755 product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018795.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 27807..28829 product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003838043.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 28833..29537 product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene gpM CDS 29631..30083 product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024143839.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 30080..30559 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084223.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 30552..31235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 31254..32216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 note possible pseudo, frameshifted CDS 32168..32359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 note possible pseudo, frameshifted CDS 32362..32814 product DUF2597 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 32820..32987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 note possible pseudo, internal stop codon, frameshifted CDS 32981..33121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 note possible pseudo, internal stop codon, frameshifted CDS 33118..33459 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 33459..33824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097389.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 33769..33954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 33947..34213 product putative phage tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001738732.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 34401..35237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 note possible pseudo, frameshifted assembly_gap 35482..35631 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence014 source 1..35145 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(580..969) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901082.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(1006..3144) product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(3258..4217) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095666.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene accA CDS complement(4230..5489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 assembly_gap 5515..5705 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6000..7604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 note possible pseudo, internal stop codon, frameshifted CDS complement(7636..8232) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene rnhB CDS complement(8229..9263) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene lpxB CDS complement(9379..10167) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene lpxA CDS complement(10171..10626) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426706.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene fabZ CDS complement(10741..11766) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene lpxD CDS complement(11770..12264) product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095660.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene skp CDS complement(12384..14645) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene bamA CDS complement(14812..15951) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene rseP CDS complement(16108..16965) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene cdsA CDS complement(16978..17736) product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028110.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene ispU CDS complement(17925..18482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 note possible pseudo, frameshifted CDS complement(18472..19107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 note possible pseudo, frameshifted CDS complement(19234..19833) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368165.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene frr CDS complement(19961..20686) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene pyrH CDS complement(20825..21166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 note possible pseudo, internal stop codon, frameshifted CDS complement(21343..21684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 note possible pseudo, internal stop codon, frameshifted CDS complement(21804..21977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 note possible pseudo, frameshifted CDS complement(21940..22449) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004858107.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene rpsB note possible pseudo, frameshifted CDS 22769..23563 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene map CDS 23735..26203 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095651.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene glnD CDS 26194..26418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 note possible pseudo, frameshifted CDS 26450..27274 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene dapD CDS 27383..27769 product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(27810..28943) product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene cdaR CDS complement(29073..29894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 note possible pseudo, frameshifted CDS complement(29891..30454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 note possible pseudo, frameshifted CDS complement(30593..32107) product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057094.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene dgt CDS 32200..32859 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene mtnN CDS 32852..33445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 note possible pseudo, frameshifted CDS 33445..33633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 note possible pseudo, frameshifted CDS 33643..34263 product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(34314..34658) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene erpA sequence015 source 1..34173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(109..564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 note possible pseudo, internal stop codon, frameshifted CDS complement(595..1137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 note possible pseudo, internal stop codon, frameshifted CDS complement(1118..1396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 note possible pseudo, frameshifted CDS 1530..2222 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642849.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 2384..3469 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882989.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene serC CDS 3541..3996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 note possible pseudo, frameshifted CDS 4008..4760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 note possible pseudo, frameshifted CDS 4935..5621 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125016.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene cmk CDS 5732..7405 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391091.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene rpsA CDS 7478..7780 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene ihfB CDS 7981..9045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 note possible pseudo, frameshifted CDS 8942..10243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 note possible pseudo, frameshifted CDS 10280..12028 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551259.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene msbA CDS 12025..13002 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704887.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene lpxK CDS 13032..14255 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 14303..14485 product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367465.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene ycaR CDS 14482..15228 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097299.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene kdsB CDS 15356..16141 product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 note possible pseudo, frameshifted CDS complement(16198..16977) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899546.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene elyC CDS 17111..17890 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene cmoM CDS 17894..19216 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288827.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene mukF CDS 19224..19907 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene mukE CDS 19900..22239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 note possible pseudo, frameshifted CDS 22310..22894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 note possible pseudo, internal stop codon, frameshifted CDS 22926..24263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 note possible pseudo, internal stop codon CDS 24479..25324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 note possible pseudo, frameshifted CDS 25339..26289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 note possible pseudo, frameshifted CDS 26414..27016 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295932.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 27052..27699 product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109455.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene gloC CDS complement(27744..27917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 note possible pseudo, frameshifted CDS complement(27871..28923) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene aspC CDS complement(29108..30220) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977709.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene ompF CDS complement(30802..32202) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene asnS CDS complement(32374..33576) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301736.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene pncB CDS 33575..33811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 sequence016 source 1..32945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..1083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 note possible pseudo, frameshifted assembly_gap 146..187 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1265..1957 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369222.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 2006..3025 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094979.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 3134..3883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703772.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 3887..4804 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 4907..5866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 note possible pseudo, frameshifted CDS 5751..6179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 note possible pseudo, frameshifted CDS 6246..7223 product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369217.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene ghrB CDS complement(7233..8426) product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 8505..9227 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703823.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(9241..10611) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703822.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(10608..10982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 note possible pseudo, frameshifted CDS complement(10979..11254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 note possible pseudo, frameshifted CDS complement(11209..12180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 note possible pseudo, frameshifted CDS complement(12376..13086) product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094974.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 13653..14594 product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 14610..15422 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 15432..16973 product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene yejF CDS complement(16977..17318) product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(17656..17868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(17859..18641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(18680..19387) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097990.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene rsuA CDS 19660..21150 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 note possible pseudo, frameshifted CDS 21355..21639 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene rplY CDS complement(21692..22696) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050806.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene yejK CDS 22831..23058 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135667.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 23078..24751 product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097996.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene yejM assembly_gap 24656..24668 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 25379..25807 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 26029..26703 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334592.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(26706..27479) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 27775..29973 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097826.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(30018..30980) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209407.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(31107..31964) product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027214.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(31954..32799) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 sequence017 source 1..32555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..945 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994102.1:cellulose biosynthesis protein BcsC locus_tag LOCUS_06910 CDS 947..1414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 1424..2419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(2456..3226) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095418.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(3362..3700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 3648..4505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 note possible pseudo, frameshifted CDS 4502..4885 product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095417.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(4892..5917) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819931.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 6093..7853 product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 7856..8284 product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706184.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 8295..8789 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706183.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 8800..9597 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 9597..10415 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706181.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(10453..11235) product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(11228..11788) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706187.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(11887..12801) product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127280.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene rihC CDS 13034..13861 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 13876..15303 product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314112.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene galP CDS 15320..16102 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(16165..17115) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368325.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene ispH CDS complement(17096..18046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(18046..18564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(18450..20738) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286823.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene ileS CDS complement(20793..21701) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704352.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene ribF CDS 22028..22291 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856458.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene rpsT CDS 22541..23662 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010829.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 23659..23937 product PTS sugar transporter subunit IIB SgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976132.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene sgcB CDS 23956..25269 product PTS sugar transporter subunit IIC SgcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460843.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene sgcC CDS 25281..26036 product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118614.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene sgcQ CDS 26184..26633 product SgcA family PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606406.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene sgcA CDS 26633..27274 product ribulose-phosphate 3 epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600614.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 27267..28058 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082780.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(28186..28971) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368331.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene nhaR CDS complement(29033..29668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 note possible pseudo, internal stop codon CDS complement(29708..30211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 note possible pseudo, internal stop codon CDS complement(30452..31075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 note possible pseudo, frameshifted CDS complement(31006..31488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 note possible pseudo, frameshifted CDS complement(31638..32555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 sequence018 source 1..31026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(400..942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(1003..1722) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene fliA CDS complement(1887..2939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 note possible pseudo, frameshifted CDS complement(3068..3367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 note possible pseudo, frameshifted CDS 3658..4626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 note possible pseudo, frameshifted CDS 4778..5020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 note possible pseudo, frameshifted CDS 5033..5437 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene fliS CDS 5443..5805 product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene fliT CDS 5894..7381 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene amyA CDS complement(7426..7839) product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096004.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene yedD CDS 8045..9259 product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118893.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene yedE CDS 9256..9489 product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene yedF CDS 9598..10602 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(10709..12016) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094819.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(12169..12471) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(12477..13865) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(13883..15211) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094821.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(15225..15539) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158553.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 15831..16793 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094823.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 17711..18253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 18427..19077 product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 19167..21740 product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095624.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 21744..22367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 22382..22960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 22975..23541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 23557..24711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 24704..26953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 27034..28716 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704284.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(28844..30928) product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene flhA sequence019 source 1..30970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..508 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000231887.1:electron transport complex subunit RsxD note possible pseudo, frameshifted locus_tag LOCUS_07580 CDS 529..657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 note possible pseudo, frameshifted CDS 667..1290 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920789.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene rsxG CDS 1290..1859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 note possible pseudo, frameshifted CDS 1745..1975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 note possible pseudo, frameshifted CDS 1972..2607 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705230.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene nth CDS 3180..4685 product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096905.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene dtpA CDS 4831..5436 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705228.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene gstA CDS complement(5479..6339) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366860.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene pdxY CDS complement(6430..7704) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366861.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene tyrS CDS complement(7961..8617) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282319.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene pdxH CDS complement(8675..8998) product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096910.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene mliC CDS complement(9089..9535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(9483..10124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 10402..10869 product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597179.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene slyB CDS 11274..12479 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830281.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(12512..12946) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445639.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene slyA CDS 13129..13371 product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366868.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 13371..14225 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 14229..16253 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777620.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(16243..16764) product superoxide dismutase [Cu-Zn] SodC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826818.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene sodC2 CDS complement(16845..17741) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(17793..18032) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 18176..18772 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041823.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 18827..19924 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096922.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 20005..20409 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene gloA CDS 20507..21157 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282267.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene rnt CDS complement(21202..21543) product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108176.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene grxD CDS 21980..22705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 assembly_gap 23335..23401 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23750..24523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 note possible pseudo, frameshifted CDS 25134..26159 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096929.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene purR CDS complement(26175..27086) product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269528.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene punR CDS 27221..28423 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182326.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene punC CDS 28677..29831 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098879.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene cfa assembly_gap 29856..29935 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 30579..30692 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence020 source 1..30441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(407..649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(689..1384) product MobC family replication-relaxation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene mobC CDS complement(1450..3186) product TraM recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602685.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(3446..3847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(3961..4266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168332.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(4667..5065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(5117..6091) product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125557.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene virB11 CDS complement(6081..6809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(7338..7895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 note possible pseudo, frameshifted CDS complement(7864..8223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 note possible pseudo, frameshifted CDS complement(8223..8906) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005327.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(8899..9036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(9128..10195) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(10207..10434) product EexN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949385.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(10453..11160) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848059.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(11178..13922) product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096399.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(13933..14226) product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600171.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(14223..14984) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001446637.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(15007..15228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(15888..16418) product DUF2857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(16542..16727) product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(18694..19962) product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954536.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 tRNA complement(20123..20198) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(20314..20889) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095254.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(20939..22624) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(22600..22923) product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene cutA CDS complement(23033..24334) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(24451..25887) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855923.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene aspA CDS 26228..26701 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267291.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene fxsA CDS 26839..27132 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 27180..28898 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene groL CDS 29152..29505 product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605289.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(29667..30347) product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229237.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 sequence021 source 1..29969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 283..645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 note possible pseudo, frameshifted CDS 558..1013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 note possible pseudo, frameshifted CDS complement(1179..1922) product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420186.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene mlrA CDS complement(2070..4100) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706086.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene metG CDS 4256..5335 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097927.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene apbC CDS complement(5341..5838) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017899343.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 5892..6290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 note possible pseudo, frameshifted CDS 6253..7572 product two-component regulatory system sensor histidine kinase BtsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene btsS note possible pseudo, frameshifted CDS 7566..8285 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene btsR CDS 8361..8834 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706088.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 8947..9897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 note possible pseudo, frameshifted CDS 9917..10729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 note possible pseudo, frameshifted CDS complement(10968..11672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 note possible pseudo, internal stop codon, frameshifted CDS 11907..12389 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776388.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene allA CDS 12514..13329 product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141275.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene allR CDS 13456..15237 product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene gcl CDS 15249..16025 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943556.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene hyi CDS 16107..16985 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765822.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene glxR CDS 17094..18563 product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 18636..19133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 note possible pseudo, frameshifted CDS 19073..20002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 note possible pseudo, frameshifted CDS 20280..21368 product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298336.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 21394..22539 product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706333.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene glxK CDS complement(22613..22912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 note possible pseudo, frameshifted CDS complement(22977..23408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 note possible pseudo, frameshifted CDS complement(23415..24299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 note possible pseudo, frameshifted CDS complement(24382..24642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 note possible pseudo, frameshifted CDS complement(24659..25708) product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703914.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene allD CDS 26023..27681 product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 27691..28902 product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495330.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 28970..29866 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855389.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 sequence022 source 1..29792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(175..846) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099181.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 1179..3074 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 3145..3825 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968036.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(3829..4452) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096819.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 4673..5695 product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 5963..6979 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 6972..7640 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096946.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 7662..8465 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096945.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(8522..10465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(10696..12237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 12505..12738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 12632..13312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 13309..13914 product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722957.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene ttdB CDS 13971..14657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 note possible pseudo, internal stop codon CDS 14685..15431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 note possible pseudo, internal stop codon CDS 15603..15887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(16018..16995) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095798.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene hemB CDS 17149..17493 product type II toxin-antitoxin system PrlF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087280.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 17496..17978 product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(18030..18419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 note possible pseudo, frameshifted assembly_gap 18725..18774 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 19088..19178 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19586..20572 product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301663.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene sbmA note possible pseudo, frameshifted CDS 20569..20730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 note possible pseudo, frameshifted CDS 20749..21834 product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092043.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene yaiW CDS complement(21837..22154) product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 22439..22654 product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295334.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(22658..23791) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413693.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene ddlA CDS 23887..24585 product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095808.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 24754..25965 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 26182..26442 product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095810.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene iraP CDS 26930..27154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 note possible pseudo, internal stop codon, frameshifted CDS 27263..28372 product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484042.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene adrA CDS complement(28387..29217) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704543.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene proC sequence023 source 1..29427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(194..1477) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099110.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene glgC CDS complement(1493..3475) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene glgX CDS complement(3472..5658) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098552.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene glgB CDS complement(5917..7023) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703691.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene asd CDS 7199..7792 product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene yhgN CDS complement(7837..9177) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833577.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene gntU CDS complement(9174..9707) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108320.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene gntK CDS complement(9853..10848) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene gntR CDS complement(10994..11689) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(12116..13738) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098705.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(13933..15672) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595080.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene ggt CDS 15792..16271 product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(16268..17008) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene ugpQ CDS complement(17005..18072) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(18074..18919) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703702.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene ugpE CDS complement(18916..19803) product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099126.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene ugpA CDS complement(19864..20316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 note possible pseudo, frameshifted CDS complement(20234..21103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 note possible pseudo, frameshifted assembly_gap 20371..20399 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21390..21689 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100678.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 21680..22165 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(22218..22931) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086538103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene livF CDS complement(22997..23407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 note possible pseudo, frameshifted assembly_gap 23438..23514 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23570..24847) product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene livM CDS complement(24844..25770) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099131.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene livH CDS complement(25818..26945) product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene livK CDS 27349..27732 product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene panM CDS complement(27887..28852) product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene livJ note possible pseudo, frameshifted sequence024 source 1..29133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 381..1433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 2883..3386 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098953.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(3483..4328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095380.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(4398..5156) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene miaE CDS complement(5202..5627) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002940.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene rraB CDS 5792..6796 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012908.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene argF CDS complement(6839..7291) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 7872..8807 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene pyrB CDS 8821..9132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 9276..9662 product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene ridA CDS complement(9758..10372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 note possible pseudo, frameshifted CDS complement(10392..10862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 note possible pseudo, frameshifted CDS complement(10877..11239) product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703888.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(11229..11576) product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(11636..13129) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828527.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(13126..14760) product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087177.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 14844..15698 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(15718..16443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(16493..18388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 assembly_gap 16498..16674 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18338..18640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 18762..19709 product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181321.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene treR CDS 19839..21260 product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420863.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene treB CDS 21300..22529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 note possible pseudo, frameshifted CDS 22453..22950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 note possible pseudo, frameshifted CDS 23323..25728 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187820.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene nrdD CDS 25649..25870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 note possible pseudo, frameshifted CDS complement(25904..26470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 note possible pseudo, frameshifted CDS complement(26442..26990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 note possible pseudo, frameshifted assembly_gap 27071..27120 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(27193..27753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 note possible pseudo, internal stop codon, frameshifted CDS complement(27775..28095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 note possible pseudo, frameshifted CDS complement(28040..28510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 note possible pseudo, frameshifted misc_feature complement(28507..>29133) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001139189.1:DgaE family pyridoxal phosphate-dependent ammonia lyase locus_tag LOCUS_09460 sequence025 source 1..29019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1025..1264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 1356..2612 product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114469.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(2660..3232) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(3430..4011) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704556.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene acpH CDS 4216..5283 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266503.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 5401..6489 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene tgt CDS 6511..6843 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007630.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene yajC CDS 6904..8412 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095833.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene secD CDS 8409..8585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 8596..8970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 note possible pseudo, frameshifted CDS 8967..9557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 note possible pseudo, frameshifted CDS 9678..10472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 note possible pseudo, frameshifted CDS 10514..11044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 note possible pseudo, frameshifted CDS complement(11080..11964) product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025756198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(12243..12791) product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 12941..13216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 note possible pseudo, frameshifted assembly_gap 13174..13187 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13213..13344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 note possible pseudo, frameshifted CDS 13510..14403 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095839.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene ribD note possible pseudo, frameshifted CDS 14495..14869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 14915..15334 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801120.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene nusB CDS 15393..16370 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742108.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene thiL CDS complement(16414..17388) product 1-deoxyxylulose-5-phosphate synthase YajO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene yajO CDS complement(17464..19326) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006808.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene dxs CDS complement(19348..20247) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene ispA CDS complement(20248..20490) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367987.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene xseB CDS 20694..22142 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene thiI CDS complement(22188..22955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 note possible pseudo, frameshifted CDS complement(22997..23551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 note possible pseudo, frameshifted CDS complement(23538..25721) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(25815..27167) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460991.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 sequence026 source 1..28329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 219..689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 note possible pseudo, frameshifted CDS 784..1113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 note possible pseudo, frameshifted CDS 1363..2961 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138870.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene aceB CDS 2986..4308 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene aceA CDS 4364..5251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 note possible pseudo, frameshifted CDS 5136..6116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 note possible pseudo, frameshifted CDS complement(6136..6972) product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene iclR CDS 7215..8315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 8312..10702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 10973..11221 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370257.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene rpsP CDS 11240..11788 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene rimM CDS 11819..12586 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene trmD CDS 12629..12976 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene rplS CDS 13108..13758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 14137..14562 product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 14616..15269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 note possible pseudo, frameshifted CDS 15185..15640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 note possible pseudo, frameshifted assembly_gap 15589..15607 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15615..15917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 note possible pseudo, frameshifted CDS complement(15926..16309) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098347.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(16420..17640) product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098346.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene dgcN CDS complement(17633..18055) product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098345.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(18330..18704) product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 18980..20050 product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene aroF CDS 20060..21250 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098342.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene tyrA CDS complement(21191..22351) product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098340.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene pheA CDS complement(22596..23006) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502470.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene raiA CDS complement(23193..23930) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098339.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene bamD CDS 24067..25047 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene rluD CDS 25044..25775 product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene yfiH CDS 25906..27975 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098336.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene clpB note possible pseudo, frameshifted sequence027 source 1..28252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(799..1197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 note possible pseudo, frameshifted CDS complement(1097..2389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 note possible pseudo, frameshifted CDS 2549..3577 product mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene malI CDS complement(3606..3821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 note possible pseudo, frameshifted CDS complement(3752..5125) product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(5215..6411) product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096880.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene manA CDS 6615..8261 product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096879.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene fumA assembly_gap 8470..8515 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8892..9015 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9037..9390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(9387..10313) product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene tus CDS complement(10446..10901) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 11015..12352 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174164.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 12276..12464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(12458..12781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 note possible pseudo, frameshifted CDS complement(12750..13667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 note possible pseudo, frameshifted CDS complement(13682..14404) product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene rstA CDS complement(14480..15202) product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520804.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene folM CDS complement(15244..16626) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096871.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(16817..17767) product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene ydgH CDS 18284..19813 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096869.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene pntA CDS 19824..20456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 assembly_gap 20345..20373 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20390..20998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 21245..22924 product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096407.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 22943..23413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 note possible pseudo, frameshifted CDS 23530..24231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 note possible pseudo, frameshifted CDS 24254..24484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 note possible pseudo, internal stop codon CDS 24497..25132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 note possible pseudo, internal stop codon CDS 25119..25961 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224671.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 25988..27040 product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096411.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 27059..27847 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420918.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 27861..28112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 note possible pseudo, frameshifted sequence028 source 1..27555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(898..1485) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017057.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 1688..2260 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955285.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(2226..2987) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079547.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(3255..4211) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706102.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene dusC CDS 4460..4882 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045719.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 5082..5534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 note possible pseudo, frameshifted CDS 5616..6500 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553529.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene cdd CDS 6619..7332 product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920064.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene sanA CDS 7473..8588 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(8634..9644) product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097952.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene mglC CDS complement(9660..11180) product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene mglA CDS complement(11264..12259) product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene mglB CDS complement(12532..12816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 note possible pseudo, frameshifted CDS complement(12824..13564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 note possible pseudo, frameshifted CDS complement(13718..14875) product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene yeiB CDS complement(14891..15352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(15568..16650) product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 16776..17495 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425438.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene yeiG CDS complement(17878..18180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(18353..20221) product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488257.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene cirA CDS 20223..20411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(20551..21909) product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534384.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene lysP CDS complement(22134..22631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 note possible pseudo, frameshifted CDS complement(22634..22999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 note possible pseudo, frameshifted CDS 23122..24168 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137966.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 24236..25093 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706116.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene nfo CDS complement(25151..26359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 note possible pseudo, frameshifted CDS complement(26356..26718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 note possible pseudo, frameshifted assembly_gap 26371..26398 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(26747..>27555) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000091263.1:1-phosphofructokinase locus_tag LOCUS_10650 sequence029 source 1..26883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1255 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115524.1:esterase EstA locus_tag LOCUS_10660 CDS complement(1290..1604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1494..1730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1740..3128) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168494.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 3357..4670 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931585.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(4667..5872) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047054668.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 6010..6870 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene yghU CDS complement(6913..7800) product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005010978.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene yghX CDS complement(7898..8416) product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(8485..8982) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098708.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 9086..9490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936453.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 9494..9943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098710.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 10030..10926 product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018760.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene yghA CDS complement(10982..11407) product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369671.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene exbD CDS complement(11414..12130) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene exbB CDS 12351..12983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 note possible pseudo, frameshifted CDS 12920..13534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 note possible pseudo, frameshifted CDS 13657..14310 product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098714.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene yghB CDS complement(14342..15238) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 15426..16589 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene yqhD CDS 16692..17519 product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098717.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene dkgA CDS complement(17676..18146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(18189..20363) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420579.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(20479..21900) product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene ftsP CDS complement(21958..22695) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098722.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene plsC CDS complement(22920..24563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 note possible pseudo, frameshifted CDS complement(24586..25185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 note possible pseudo, frameshifted CDS 25436..26017 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098727.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 26107..26421 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098728.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 sequence030 source 1..26414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 524..847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096003.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1045..1584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 note possible pseudo, frameshifted CDS 1555..1713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(1962..2411) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097204.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 2569..3807 product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene agp CDS complement(3842..4069) product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(4088..4684) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene wrbA CDS 5077..5259 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097201.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 5415..6332 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097200.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 6340..6975 product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367241.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene rutR CDS complement(6972..7355) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821059.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(7427..8440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 note possible pseudo, frameshifted CDS complement(8344..11325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 note possible pseudo, frameshifted assembly_gap 8457..8468 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11750..13258 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene putP CDS 13813..14601 product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097183.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene phoH CDS complement(14656..15180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 note possible pseudo, frameshifted assembly_gap 14855..14894 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(15120..15917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 note possible pseudo, frameshifted CDS complement(16293..16781) product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001752509.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 17488..18477 product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027935.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene araF CDS 18535..20049 product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096045.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene araG CDS 20063..21043 product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096046.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene araH CDS 21283..21579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 note possible pseudo, frameshifted CDS 21554..22051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 note possible pseudo, frameshifted CDS 22026..23450 product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089042.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene otsA CDS complement(23502..23921) product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122412.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene uspC CDS 24724..25074 product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096050.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene flhD CDS 25077..25655 product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096051.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene flhC assembly_gap 26113..26230 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence031 source 1..26383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..523 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001119449.1:OapA family protein locus_tag LOCUS_11220 CDS complement(495..1433) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095309.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1596..2045) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196062.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene rplI CDS complement(2087..2314) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene rpsR CDS complement(2319..2633) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene priB CDS complement(2639..3034) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene rpsF CDS 3388..3621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(3729..4481) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene yjfP CDS 4694..5008 product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586831.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene bsmA CDS 5161..5436 product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139152684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene yjfN CDS 5582..7474 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095297.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(7523..9157) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095296.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(9316..9744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943487.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(9784..10146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 note possible pseudo, frameshifted CDS complement(10146..10940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 note possible pseudo, frameshifted CDS complement(11548..11946) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547734.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(11951..12643) product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012534.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(12650..13693) product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769107.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(13693..14442) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(14429..14824) product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220121.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(14954..15685) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704174.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene rlmB CDS complement(15769..18213) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095293.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene rnr CDS complement(18324..18749) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene nsrR CDS complement(18902..19198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(19137..20306) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006178975.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 assembly_gap 19202..19233 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20409..20606) product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(20669..21673) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene hflC CDS complement(21676..22926) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312504.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene hflK CDS complement(23119..23991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 note possible pseudo, frameshifted CDS complement(23969..24397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 note possible pseudo, frameshifted CDS complement(24472..24780) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene hfq CDS complement(24881..25831) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene miaA CDS complement(25828..26382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 sequence032 source 1..26147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1367 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105494.1:ATP-dependent RNA helicase HrpA locus_tag LOCUS_11550 CDS 1771..2619 product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097310.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene focA CDS 2671..4560 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097311.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene pflB assembly_gap 4452..4473 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4503..4775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 4974..5714 product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene pflA CDS complement(5766..6467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 note possible pseudo, frameshifted CDS complement(6490..6858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 note possible pseudo, frameshifted CDS complement(6833..7006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 7211..7834 product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene ycaC CDS complement(7882..8457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(8399..8977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(9067..9525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 note possible pseudo, frameshifted CDS complement(9509..10417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 note possible pseudo, frameshifted CDS complement(10426..11037) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene lolA CDS complement(11185..11697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 note possible pseudo, frameshifted CDS complement(11721..11930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 note possible pseudo, frameshifted assembly_gap 11978..12112 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12377..12501 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12672..12875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(12776..13486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 note possible pseudo, frameshifted CDS complement(13398..14048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 note possible pseudo, frameshifted CDS complement(13996..14688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 note possible pseudo, frameshifted CDS complement(14809..15303) product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene lrp CDS 15869..16858 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097321.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene trxB CDS 16960..18726 product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene cydD CDS 18727..20460 product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704874.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene cydC CDS 20492..21199 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene aat CDS 21464..21682 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene infA CDS complement(21774..24047) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934041.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene clpA CDS complement(24076..24396) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174393.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene clpS CDS complement(24690..24890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(25008..26147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 sequence033 source 1..26078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(163..603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 note possible pseudo, frameshifted CDS complement(600..914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 note possible pseudo, frameshifted CDS complement(1039..1404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 note possible pseudo, frameshifted CDS complement(1539..2939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 note possible pseudo, frameshifted CDS complement(2896..3516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 note possible pseudo, frameshifted CDS 4081..4653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(4711..5964) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094960.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(5986..6123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 note possible pseudo, frameshifted CDS complement(6092..7168) product xylose ABC transporter permease XylH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045989.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene xylH note possible pseudo, frameshifted CDS complement(7146..8687) product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094962.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(8756..9748) product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094963.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene xylF CDS 10130..11458 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene xylA CDS 11502..12437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 note possible pseudo, frameshifted CDS 12364..12948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 note possible pseudo, frameshifted CDS 13056..13223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 note possible pseudo, frameshifted CDS 13211..13549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 note possible pseudo, frameshifted CDS 13546..14463 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094967.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(14456..15451) product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182664.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene wecH CDS 15653..15934 product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094969.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 16097..16234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 note possible pseudo, frameshifted CDS 16397..16990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 note possible pseudo, frameshifted CDS 17000..19069 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291774.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene glyS CDS 19834..19992 product type I toxin-antitoxin system toxin HokE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene hokE CDS complement(20140..20430) product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(20704..24276) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene uca CDS complement(24351..24986) product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(25053..25694) product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 sequence034 source 1..25747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..276) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758664.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(448..675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 note possible pseudo, frameshifted CDS complement(599..1132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 note possible pseudo, frameshifted CDS 1814..2344 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene rppH CDS 2356..3108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 assembly_gap 2930..2968 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2991..4496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 4638..5522 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204645.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene lgt CDS 5529..6323 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098550.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene thyA CDS 6535..6975 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 7102..7527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 note possible pseudo, frameshifted CDS 7557..7940 product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703325.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 8267..9799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 note possible pseudo, frameshifted CDS 9682..11589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 note possible pseudo, frameshifted CDS 11739..12506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 note possible pseudo, frameshifted CDS 12424..14619 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene ptrA note possible pseudo, frameshifted CDS 14616..18158 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322794.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene recB CDS 18307..19971 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene recD assembly_gap 18348..18447 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19973..21214) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098542.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene argA CDS 21706..22758 product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene amiC note possible pseudo, frameshifted tRNA complement(22844..22920) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(22955..23031) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 23275..24336 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678646.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene mltA CDS 24386..25192 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117716.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene tcdA CDS complement(25196..25639) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene csdE sequence035 source 1..25621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 568..1311 product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445651.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene ygaZ CDS 1301..1636 product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119763.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene ygaH CDS 1726..2256 product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378431.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene mprA CDS 2394..3209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 note possible pseudo, frameshifted CDS 3143..3556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 note possible pseudo, frameshifted CDS 3571..5157 product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296316.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene emrB CDS complement(5166..5681) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098432.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene luxS CDS complement(5835..7364) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098433.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene gshA CDS complement(7425..7853) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152081995.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(7850..8416) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703238.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene yqaB tRNA complement(8543..8619) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(8623..8715) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(9010..9195) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene csrA CDS complement(9562..12192) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098436.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene alaS CDS complement(12331..12834) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140508.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene recX CDS complement(12886..13950) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963150.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene recA CDS complement(14040..14582) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene pncC CDS complement(14645..15733) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005051417.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene mltB CDS 15986..16522 product copper-binding periplasmic metallochaperone CueP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene cueP CDS 16800..17153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 note possible pseudo, frameshifted CDS 17101..19395 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene mutS CDS complement(19440..19676) product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(19692..21116) product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863205.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(21106..21690) product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 21875..22279 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(22355..23347) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene rpoS CDS complement(23463..24590) product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620533.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene nlpD CDS complement(24715..25341) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 sequence036 source 1..25488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(560..844) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705707.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(834..1211) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294876.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 1415..1843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(2361..3197) product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705710.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(3197..4054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(4054..5019) product primase-helicase zinc-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260358.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(5016..6680) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913116.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(7218..7505) product YdaS family helix-turn-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887453.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 7648..8337 product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048781225.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 8487..8810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 8794..8985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 8987..9442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 9612..9836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 9820..10179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 10176..10412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 10409..10627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 10624..11028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 11176..11619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097280.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 11631..12374 product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 12377..12748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047371030.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 12732..12977 product excisionase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097283.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 13033..14346 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362003.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 14373..14843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 note possible pseudo, frameshifted CDS 14803..15120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 note possible pseudo, frameshifted CDS 15190..15585 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096077.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 15625..16371 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019598.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene cmoA CDS 16368..17318 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096075.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene cmoB assembly_gap 16402..16492 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17353..18372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 note possible pseudo, frameshifted CDS complement(18445..21063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(21875..22615) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419924.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene cutC CDS complement(22785..23348) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096073.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 23542..25272 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705961.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene argS sequence037 source 1..25204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(131..2173) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene prlC CDS 2351..3193 product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602562.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene rlmJ CDS 3265..4617 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene gorA CDS complement(4814..5569) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094946.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 note possible pseudo, frameshifted CDS 5888..7285 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 7304..9265 product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(9345..10334) product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049034212.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(10584..10964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 note possible pseudo, frameshifted CDS complement(11336..12136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 note possible pseudo, frameshifted CDS complement(12123..12491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 note possible pseudo, frameshifted CDS complement(12637..13554) product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488351.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(13625..14137) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109977.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 14657..15934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 15958..17289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(17286..18059) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 18158..18379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(18497..19402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 assembly_gap 18631..18652 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19418..21013) product STY4199 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099200.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 21193..21735 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703751.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(21761..22519) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 22638..23537 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369250.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 23591..24625 product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099206.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene yhjD sequence038 source 1..25030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 352..397 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 413..886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 note possible pseudo, frameshifted CDS 949..1437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 note possible pseudo, frameshifted CDS 1450..2298 product DUF2950 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(2343..2627) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(2828..4231) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene lpdA CDS complement(4441..5721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(5736..8399) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095597.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene aceE CDS complement(8578..9342) product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368223.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene pdhR CDS 9879..11192 product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602166.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene aroP CDS complement(11258..12112) product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095591.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene ampE CDS complement(12109..12672) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923703.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene ampD CDS 12757..13650 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene nadC CDS complement(14068..14421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 14308..15036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 14934..15452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 15445..16647 product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114107.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene hofC CDS complement(16705..17748) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217357.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 17977..18597 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269520.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene coaE CDS 18597..19340 product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095583.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene zapD CDS 19350..19544 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene yacG CDS complement(19607..20008) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene mutT CDS complement(20021..20737) product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984827.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(20792..21118) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(21118..21885) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098672.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene trmB CDS 21988..23073 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene mutY CDS 23076..23351 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 23407..24486 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene mltC sequence039 source 1..24652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..996 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050717203.1:DUF5107 domain-containing protein note possible pseudo, frameshifted locus_tag LOCUS_13410 CDS 882..1598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 note possible pseudo, frameshifted CDS 1659..3098 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 3098..3943 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528174.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(4106..4444) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015492.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(4457..4816) product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene yeaR CDS complement(4998..5456) product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene fucU CDS complement(5459..5701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 note possible pseudo, frameshifted CDS complement(5689..6513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 note possible pseudo, frameshifted CDS complement(6537..6782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 note possible pseudo, frameshifted CDS complement(6831..8600) product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724159.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene fucI CDS 9129..10469 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene gguA CDS 10473..11456 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 11522..12511 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 12581..13567 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 13674..14321 product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440828.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene fucA CDS 14362..15237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 note possible pseudo, frameshifted CDS 15197..15514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 note possible pseudo, frameshifted CDS complement(15556..16836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 note possible pseudo, internal stop codon CDS complement(16870..17724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 note possible pseudo, internal stop codon CDS complement(17753..18304) product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene hydN CDS complement(18730..19362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 19840..20112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 20061..21821 product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816738.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene flhA CDS 22155..23150 product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene dctP CDS 23415..24041 product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105527.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene dctQ sequence040 source 1..24512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 95..985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(1195..2955) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156477.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 3138..3593 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877161.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene matP CDS complement(3684..4385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 note possible pseudo, frameshifted CDS complement(4438..4749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 note possible pseudo, frameshifted CDS complement(5102..5611) product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene sulA CDS 5829..6119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 note possible pseudo, internal stop codon CDS 6177..6443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 note possible pseudo, internal stop codon CDS complement(6429..8579) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097254.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene yccS CDS complement(8579..9025) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261236.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 9150..10016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 note possible pseudo, frameshifted CDS 9940..11157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 note possible pseudo, frameshifted CDS complement(11158..11616) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424181.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene mgsA CDS complement(11708..11977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 note possible pseudo, frameshifted CDS complement(11965..12357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 note possible pseudo, frameshifted CDS 12533..12946 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301418.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(12977..13294) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097248.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene hspQ CDS complement(13357..14547) product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene rlmI CDS 14638..14919 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene yccX CDS complement(14916..15245) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097245.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene tusE CDS complement(15349..16014) product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374046.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene yccA tRNA 16308..16395 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(16509..18662) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705180.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene fdhF CDS complement(18705..19250) product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene hydN CDS complement(19398..19853) product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene hycI CDS complement(19846..20256) product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(20256..21020) product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067392.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene hycG CDS complement(21034..21558) product formate hydrogenlyase subunit HycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493767.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene hycF CDS complement(21666..23198) product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370028.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene hycE assembly_gap 21670..21704 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23210..24112) product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 sequence041 source 1..24120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1480..1692 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368925.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene rpmE CDS complement(1747..2064) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862042.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene metJ CDS 2355..3515 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099309.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene metB CDS 3518..5950 product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene metL CDS 6177..7067 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene metF CDS complement(7300..9966) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene ppc CDS complement(10220..11380) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene argE CDS 11557..12561 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935365.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene argC CDS 12572..13345 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686923.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene argB CDS 13372..14589 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465152.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 14686..16059 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene argH CDS 16307..17224 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene oxyR CDS complement(17207..18607) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120789.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene sthA CDS 18803..19336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 note possible pseudo, frameshifted CDS 19415..19774 product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813838.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(19826..20935) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187001.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene trmA CDS 21296..22669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 note possible pseudo, frameshifted CDS 22683..23132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 note possible pseudo, frameshifted CDS 23077..23928 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201804.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene murI sequence042 source 1..23940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1270..2199 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299745.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 2312..4648 product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809818.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene arcB CDS 4877..5530 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703608.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene elbB CDS 5527..6255 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047087.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene mtgA CDS complement(6259..6531) product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene npr CDS complement(6528..7382) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene rapZ CDS complement(7443..7922) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609332.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene ptsN CDS complement(8003..8290) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176588.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene hpf CDS complement(8313..9746) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098942.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene rpoN CDS complement(9914..10639) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206203.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene lptB CDS complement(10646..11197) product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene lptA CDS complement(11166..12245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(12263..13249) product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098937.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene kdsD CDS complement(13263..13919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 note possible pseudo, frameshifted CDS 14458..15273 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438248.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene mlaF CDS 15281..16063 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925786.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene mlaE CDS 16067..16618 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193591.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene mlaD CDS 16634..17263 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098933.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene mlaC CDS 17263..17565 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene mlaB CDS 17693..17947 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900133.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene ibaG CDS 17999..19198 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098931.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene murA CDS complement(19299..19562) product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene sfsB CDS complement(19768..20739) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098929.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene ispB CDS 20999..21310 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025032.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene rplU CDS 21329..21586 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene rpmA CDS 21675..22640 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369509.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 22657..23544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 note possible pseudo, internal stop codon CDS 23629..23874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 note possible pseudo, internal stop codon sequence043 source 1..23756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..738 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099207.1:MFS transporter locus_tag LOCUS_14430 CDS complement(784..2256) product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098284.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene dtpB CDS complement(2495..2932) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene uspA CDS complement(3444..3641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(3756..5252) product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902764.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene pitA CDS 5480..6670 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(6887..7528) product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene fdnI CDS complement(7521..7940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(7945..10422) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154231912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene fdnG assembly_gap 7986..8127 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10471..11058) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 12003..12899 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815364.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 13032..14252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 14266..14841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 14834..15250 product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942200.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 15244..16008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 16843..18057 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096959.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(18101..19933) product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036278.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(19985..20332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 note possible pseudo, frameshifted CDS complement(20425..20841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 note possible pseudo, frameshifted CDS 21341..22087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(22082..22516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 23013..23450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 sequence044 source 1..23532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..689 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095096.1:sugar ABC transporter ATP-binding protein locus_tag LOCUS_14650 CDS 682..1467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 1603..2544 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237475.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 2625..3308 product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830337.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 3324..4184 product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 4194..5204 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 5870..6406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 6526..7206 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 7575..7871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 note possible pseudo, frameshifted CDS 7960..9687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 note possible pseudo, frameshifted CDS 9687..10664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 10770..11303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(11405..12136) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(12308..13411) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 13746..15077 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 15074..16753 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966867.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 16805..17710 product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136613.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene yagE CDS complement(17751..18506) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894191.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(18646..19923) product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368716.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene gltP CDS 20348..21922 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083869.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene acs CDS 21919..22401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 note possible pseudo, frameshifted CDS 22334..22606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 note possible pseudo, frameshifted CDS 22746..23060 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999620.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 sequence045 source 1..23381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 714..2207 product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940993.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene ravA CDS 2204..3655 product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956591.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene viaA CDS complement(3659..4651) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099401.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene asnA CDS 4804..5166 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene asnC note possible pseudo, frameshifted CDS 5402..5842 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene mioC CDS 6221..7405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 7320..7916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 assembly_gap 7354..7374 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7943..8593 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene rsmG CDS 9191..9574 product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145371.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene atpI CDS 9583..10401 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135632.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene atpB CDS 10450..10689 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene atpE CDS 10759..11229 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393038.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene atpF CDS 11244..11777 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288957.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene atpH CDS 11790..13331 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369006.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene atpA CDS 13382..14245 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896501.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene atpG CDS 14272..15654 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862362.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene atpD CDS 15675..16094 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251971.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 16527..17825 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933729.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene glmU CDS 18078..19907 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334099.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene glmS CDS 20217..21257 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099410.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene pstS CDS 21372..22331 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741630.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene pstC CDS 22331..23065 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251992.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene pstA note possible pseudo, frameshifted CDS 23052..23192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 note possible pseudo, frameshifted sequence046 source 1..23072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(45..1370) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219193.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene srmB CDS 1579..2235 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(2220..3806) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094491.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene nadB CDS 4269..4844 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176728.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene rpoE CDS 4876..5523 product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168379.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene rseA CDS 5613..6479 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene rseB CDS 6476..6955 product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703183.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene rseC CDS 7591..9126 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189772.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 9355..11154 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098320.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene lepA CDS 11169..12143 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098319.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene lepB CDS 12498..13112 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004151992.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene rnc CDS 13109..14014 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102231.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene era CDS 14166..14717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 note possible pseudo, frameshifted CDS complement(14793..15044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 15122..15508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 note possible pseudo, frameshifted CDS 15508..15888 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986043.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene acpS CDS complement(15885..16145) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370294.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(16416..16865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(17138..17524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 note possible pseudo, frameshifted CDS complement(17451..18032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 note possible pseudo, frameshifted CDS 18228..18863 product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene yfhb CDS 18946..19446 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene tadA CDS complement(19340..20890) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098308.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene mltF sequence047 source 1..22798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 369..719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 1291..1434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(1545..2153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039861821.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 2173..2382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 2510..2797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 2802..3092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 3207..3641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 3655..5187 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936861.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 5190..6467 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 6473..7153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 7165..8328 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 8365..8610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 8558..8890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 8951..9151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 9154..9462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 9455..9940 product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 9937..10302 product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072861.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 10351..10842 product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113190.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 10842..11051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 11014..11268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 11328..11498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 11571..11798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 11863..13776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 note possible pseudo, internal stop codon CDS 13786..14289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 note possible pseudo, internal stop codon CDS 14289..14627 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072856.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 14624..15379 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055651.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 15381..16091 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096343.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 16122..16457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 16420..17070 product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419708.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 assembly_gap 16446..16452 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17108..17365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(17379..17606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 17772..21254 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096345.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 21254..22210 product DUF6453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096346.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 sequence048 source 1..22087 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(500..775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 note possible pseudo, frameshifted CDS complement(786..1898) product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene mrdB CDS complement(1898..3796) product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776191.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene mrdA CDS complement(3823..4290) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776107.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene rlmH CDS complement(4294..4611) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene rsfS CDS complement(4851..5453) product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351014.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 5546..6631 product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene cobD CDS complement(6603..7208) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989126.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene nadD CDS complement(7201..7902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(8192..8788) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704738.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene lptE CDS complement(8803..11385) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704739.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene leuS CDS 11614..12096 product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831082.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(12148..12441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(12360..12749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(12749..13408) product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097580.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene gltK CDS complement(13501..14112) product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene gltJ note possible pseudo, frameshifted assembly_gap 13505..13513 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14312..15232) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588823.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(15587..17125) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367717.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene lnt CDS complement(17130..18008) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene corC CDS complement(18105..18572) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858677.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene ybeY CDS complement(18569..19630) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(19833..20483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 assembly_gap 20511..20586 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence049 source 1..21741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(172..717) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853982.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene hemG CDS complement(730..2181) product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099227.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene trkH CDS complement(2221..2739) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099228.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 note possible pseudo, frameshifted CDS complement(2812..4143) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene pepQ CDS 4335..6524 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965943.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene fadB CDS 6535..7698 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099231.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene fadA CDS complement(7810..8511) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209828.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene fre CDS complement(8557..10041) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496900.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene ubiD CDS 10224..10712 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099234.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene rfaH CDS complement(10713..11234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 note possible pseudo, frameshifted CDS complement(11544..12311) product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257554.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene tatC CDS complement(12314..12847) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459594.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene tatB CDS complement(12851..13102) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368844.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene tatA CDS complement(13288..14805) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene ubiB assembly_gap 13759..13766 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14802..15302) product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099240.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene ubiJ note possible pseudo, internal stop codon CDS complement(15429..16184) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099241.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene ubiE CDS complement(16263..17699) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene rmuC CDS complement(17876..18637) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene udp CDS 18880..19701 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099243.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 misc_feature complement(19755..>21741) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099244.1:5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase locus_tag LOCUS_16080 assembly_gap 21054..21131 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence050 source 1..21732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(426..1001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 note possible pseudo, frameshifted CDS complement(947..1666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 note possible pseudo, internal stop codon, frameshifted CDS 1547..1783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 1863..2576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 note possible pseudo, frameshifted CDS 2573..3148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 note possible pseudo, frameshifted CDS complement(3223..4218) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097511.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene pgl CDS 4373..5191 product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097512.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(5192..6250) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097513.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene modC CDS complement(6253..6942) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene modB CDS complement(6942..7727) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101994.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene modA CDS complement(7846..7995) product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097516.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 8121..8906 product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097517.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene modE CDS 8938..9981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 assembly_gap 9831..9884 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9927..10220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 10425..11441 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622345.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene galE CDS 11451..12506 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191517.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene galT CDS 12509..12751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 note possible pseudo, frameshifted CDS 12736..13599 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097521.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene galK note possible pseudo, frameshifted CDS 13593..14633 product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097522.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene galM CDS 14835..15587 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene gpmA CDS complement(15662..16714) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109233.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene aroG CDS 17039..17503 product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784342.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 17739..18491 product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene zitB note possible pseudo, frameshifted CDS complement(18488..19207) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345410.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene pnuC CDS complement(19253..20299) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene nadA CDS 20646..21206 product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 tRNA complement(21419..21494) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(21633..21708) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 sequence051 source 1..21571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..548 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001326970.1:acid-sensing system histidine kinase EvgS locus_tag LOCUS_16350 assembly_gap 457..501 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1026..1535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 1661..2182 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419182.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 2229..2903 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 2918..5188 product outer membrane usher protein LpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558680.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene lpfC CDS 5202..6227 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(6296..7858) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 8311..9327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 note possible pseudo, frameshifted CDS 9285..9779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 note possible pseudo, frameshifted CDS 9772..9906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 9925..11571 product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 11702..12481 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 12484..13533 product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 13550..14521 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040673.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 14576..15034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 15053..16561 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 16625..17656 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104372.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene cra CDS 18154..18720 product long polar fimbria major subunit LpfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756356.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 18853..19443 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 19449..19949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 sequence052 source 1..21480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(396..1616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 note possible pseudo, frameshifted CDS complement(1676..2761) product DUF4297 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 3534..3833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 3836..4456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(4642..4821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(4831..5643) product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483178.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(5665..6147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185130035.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(6223..7161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 7295..7531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 8046..8261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 8191..9411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(9751..10053) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 10561..11190 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056849.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(11257..13041) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301901.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 12950..13792 product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207574.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene lafU CDS complement(13793..14530) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089099.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(14576..15337) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065249.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(15352..15519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 note possible pseudo, internal stop codon CDS complement(15577..16071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 note possible pseudo, internal stop codon CDS complement(16132..17277) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410140.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 assembly_gap 16179..16183 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17323..17862) product 2,4'-dihydroxyacetophenone dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066672.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 18180..19088 product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095373.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene yagE CDS complement(19085..20515) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098403.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 misc_feature complement(20535..>21480) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098404.1:carbamate kinase family protein locus_tag LOCUS_16780 sequence053 source 1..21069 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 note possible pseudo, internal stop codon, frameshifted CDS complement(422..964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 note possible pseudo, internal stop codon, frameshifted CDS complement(1160..1321) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(1452..2075) product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene osmY CDS complement(2492..3922) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene prfC CDS complement(4019..4696) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene yjjG CDS complement(4721..5164) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095481.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene rimI CDS complement(5133..5546) product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095480.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 5673..6704 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272330.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene rsmC assembly_gap 6977..7008 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7062..7298) product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360092.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(7641..7841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 7791..8621 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211217.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 8702..9490 product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331566.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene fhuF CDS complement(9499..10842) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095475.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 11155..11613 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368396.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(11659..12306) product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095473.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene bglJ CDS complement(12282..12986) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688833.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 13817..14578 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882175.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 14689..15042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 note possible pseudo, internal stop codon CDS 15168..15713 product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098818.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene dnaT CDS 15716..16435 product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799923.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene dnaC CDS 16569..17072 product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704311.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 17314..19605 product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704310.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene opgB CDS 19642..20865 product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426433.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene dsdA sequence054 source 1..21058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 108..1061 product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573621.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene metR CDS complement(949..1881) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703990.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1971..2777) product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285349.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene yigL CDS complement(2825..3817) product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099248.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene pldB CDS 3964..4584 product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099249.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene rhtB CDS complement(4585..5226) product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703986.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene rhtC CDS complement(5267..7096) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene recQ CDS complement(7164..8033) product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259700.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene pldA CDS 8204..8674 product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004097567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene yigI CDS 8725..9486 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339085.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene rarD CDS 9486..9782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 10281..10661 product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(10709..11659) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947159.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene corA CDS complement(12014..13291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 note possible pseudo, frameshifted CDS complement(13372..14169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 note possible pseudo, frameshifted CDS complement(14231..14947) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene yigB CDS complement(14947..15852) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703983.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene xerC CDS complement(15849..17036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(17220..17423) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703981.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 17595..17915 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368867.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene cyaY CDS complement(17916..19859) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene cyaA note possible pseudo, frameshifted CDS complement(19909..20463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 note possible pseudo, frameshifted sequence055 source 1..20982 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(630..1028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 1183..1368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1432..2307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(3020..3541) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene fldB CDS complement(3621..4877) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033613.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(5092..5442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 note possible pseudo, frameshifted CDS complement(5454..6833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 note possible pseudo, frameshifted CDS complement(7176..8714) product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226977.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(8728..9504) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283536.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(9514..10359) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(10373..11158) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843394.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 11392..12015 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298021.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(12275..13012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(13397..13834) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044768.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(13831..14133) product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261287.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene vapB CDS 14415..14705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111771.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 14695..15594 product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963206.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(15644..17470) product P-loop NTPase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(17865..18059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 note possible pseudo, frameshifted CDS complement(18013..18885) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130100443.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 note possible pseudo, frameshifted CDS 19307..19723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 19826..20605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 sequence056 source 1..20899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(229..705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 note possible pseudo, frameshifted assembly_gap 265..270 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 871..1545 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380129.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene radC CDS 1762..1998 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436699.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene rpmB CDS 2019..2186 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208990.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene rpmG CDS 2259..3068 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114533.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene mutM CDS complement(3076..3564) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene coaD CDS complement(3561..4337) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(4337..5443) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369159.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene waaA CDS complement(5754..7382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(7397..8368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(8377..9360) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094898.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(9519..10772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 11103..12197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(12194..13306) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(13303..13707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(13673..14392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 note possible pseudo, frameshifted CDS complement(14385..15383) product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703798.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene rfaC CDS complement(15386..16432) product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699210.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene rfaF CDS complement(16442..17365) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene rfaD CDS 17595..18794 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene kbl CDS 18804..19832 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369171.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene tdh CDS 20074..20772 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152082698.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 sequence057 source 1..20793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1203 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099109.1:glycogen synthase GlgA locus_tag LOCUS_17690 CDS 1223..2812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 note possible pseudo, frameshifted CDS 2787..3623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 note possible pseudo, frameshifted CDS complement(3667..4449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 assembly_gap 4495..4540 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5157..5486 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833569.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene glpE CDS 5533..6363 product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099104.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene glpG CDS 6388..7146 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099103.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(7172..9877) product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420753.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene malT CDS 10371..12755 product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082255.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene malP CDS 12765..14873 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444319.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene malQ CDS complement(14938..15513) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene nfuA CDS complement(15572..16036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 16290..17075 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703680.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene bioH CDS 17190..17459 product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369359.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(17518..17754) product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703679.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene feoC CDS complement(17764..20082) product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099092.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene feoB CDS complement(20104..20328) product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436417.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene feoA sequence058 source 1..20746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 287..2221 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409451.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene sltY CDS 2262..2612 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068679.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene trpR CDS complement(2603..3016) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene yjjX CDS 3165..3812 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942359.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene gpmB CDS complement(3713..4657) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704329.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene robA CDS 4848..5330 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368367.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene creA CDS 5343..6032 product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188664.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene creB CDS 6032..7459 product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704331.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene creC CDS 7537..8292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 note possible pseudo, internal stop codon CDS 8383..8901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 note possible pseudo, internal stop codon CDS complement(8953..9669) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene arcA CDS 10304..10990 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095507.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 11346..11834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 note possible pseudo, frameshifted CDS 11821..13746 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264731.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene thrA note possible pseudo, frameshifted CDS 13748..14482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 14601..15569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 note possible pseudo, frameshifted CDS 15533..15886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 note possible pseudo, frameshifted CDS complement(15940..16713) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095513.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene yaaA CDS complement(16792..18225) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095514.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 18501..19376 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095515.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene tal CDS 19510..20103 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166957.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene mog sequence059 source 1..20744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(375..509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 note possible pseudo, frameshifted CDS complement(502..1437) product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene macA note possible pseudo, frameshifted CDS 1591..2550 product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097328.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(2547..4205) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704871.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 4588..5283 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704870.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene aqpZ CDS 5407..5910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 note possible pseudo, frameshifted CDS 5951..6283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 note possible pseudo, frameshifted CDS 6357..6683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 note possible pseudo, frameshifted CDS 6661..8001 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene hcp note possible pseudo, frameshifted CDS 8011..8979 product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene hcr CDS complement(9015..9443) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704866.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 9589..10905 product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704865.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene poxB note possible pseudo, frameshifted CDS 10875..11276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 note possible pseudo, frameshifted CDS 11315..12265 product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566403.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene ltaE CDS 12278..12964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 note possible pseudo, frameshifted CDS 12997..13713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 note possible pseudo, frameshifted CDS 13801..14811 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(14808..15638) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367510.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(15635..15922) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160725.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 16091..16627 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097359.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 16843..17571 product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene artP CDS 17592..18323 product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756586.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene artJ CDS 18331..19047 product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367517.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene artQ CDS 19047..19868 product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene artM CDS 19893..20627 product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367519.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene artJ sequence060 source 1..20647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 63..818 product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046464.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene yihT note possible pseudo, frameshifted CDS 908..2149 product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099370.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene yihS CDS 2178..3014 product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 3042..5078 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 5125..6012 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 6042..7418 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099372.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 7442..8866 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420847.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 8946..9632 product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene ompL CDS complement(9681..11504) product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099375.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene typA CDS 11873..13195 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099376.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene glnA assembly_gap 12850..12857 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13339..14388 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501857.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene glnL CDS 14406..14834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 14788..15723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(15994..17367) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116087.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene hemN CDS complement(17554..18060) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099380.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene yihI CDS 18723..19142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 misc_feature complement(19445..>20647) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099383.1:DNA polymerase I locus_tag LOCUS_18480 sequence061 source 1..20584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..728 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000934214.1:alpha,alpha-trehalase locus_tag LOCUS_18490 CDS complement(746..2710) product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301045.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene rlhA CDS complement(2945..3475) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096643.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 3576..4691 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096644.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(4746..5315) product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(5647..6240) product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218282.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene tehB CDS complement(6237..7064) product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096651.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene tehA note possible pseudo, frameshifted CDS complement(7073..7252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 note possible pseudo, frameshifted CDS 7377..8357 product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096652.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene ydcK CDS complement(8370..8930) product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140873.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene rimL CDS complement(9010..9726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 note possible pseudo, frameshifted CDS complement(9707..9961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 note possible pseudo, frameshifted CDS complement(9990..10643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 note possible pseudo, frameshifted CDS complement(11258..12004) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096655.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(12191..12607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 note possible pseudo, frameshifted CDS complement(12582..13109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 note possible pseudo, frameshifted CDS 13232..13567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 note possible pseudo, internal stop codon, frameshifted CDS 13705..14079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 note possible pseudo, internal stop codon, frameshifted CDS complement(14119..15462) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013762.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 15745..16668 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096674.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 16760..17815 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(17868..18788) product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930756.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(18691..18885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(18892..20220) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061782.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 sequence062 source 1..20582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..508 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704038.1:chorismate lyase locus_tag LOCUS_18730 CDS 508..1377 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455249.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene ubiA CDS complement(1411..3840) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017354.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene plsB CDS 3973..4341 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368764.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 4450..5058 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene lexA CDS 5145..6479 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene dinF CDS 6703..6912 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981150.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(6984..7505) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416263.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene zur CDS 7814..9067 product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 9218..10159 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602639.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene dusA CDS 10282..10539 product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095061.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene pspG CDS complement(10717..11052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 note possible pseudo, frameshifted CDS complement(10998..11303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 note possible pseudo, frameshifted CDS complement(11272..11646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 note possible pseudo, frameshifted CDS 11786..13192 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918353.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene dnaB CDS 13347..14426 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene alr CDS 14540..15742 product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486998.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene tyrB CDS 15912..16625 product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704046.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene aphA CDS 16883..17236 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095068.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(17237..17815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(17823..19988) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357740.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene uvrA sequence063 source 1..20323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(935..2023) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439846.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene aroB CDS complement(2080..2601) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861630.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene aroK CDS complement(2901..4130) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832818.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene hofQ CDS complement(4087..4479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(4469..4879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(4942..5436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(5487..6275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874746.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 6466..8946 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301905.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene mrcA CDS complement(8998..9558) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519362.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene nudE CDS 9878..12016 product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099081.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 12079..12792 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520508.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene yrfG CDS 12770..13171 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660483.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene hslR CDS 13196..14074 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001753131.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene hslO CDS 14431..16056 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265689.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene pckA CDS complement(16131..17483) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882169.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene envZ CDS complement(17480..17725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 note possible pseudo, frameshifted CDS complement(17692..18195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 note possible pseudo, frameshifted CDS 18743..19927 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815487.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene uxuA sequence064 source 1..20308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..533 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098977.1:p-hydroxybenzoic acid efflux pump subunit AaeB note possible pseudo, frameshifted locus_tag LOCUS_19130 CDS 523..1887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 note possible pseudo, frameshifted CDS 1989..2858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 note possible pseudo, internal stop codon, frameshifted CDS 2836..3432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 note possible pseudo, internal stop codon, frameshifted CDS 3498..3776 product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029013.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(3831..4097) product DUF1471 family stress response protein YhcN-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene yhcN-B CDS complement(4191..4454) product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695690.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene yhcN CDS complement(4803..5273) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369474.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene argR CDS 5696..6634 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307415.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene mdh CDS complement(6691..7755) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497726.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene degS CDS complement(7802..9220) product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716695.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene degQ CDS complement(9398..9796) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene zapG CDS 9979..11052 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098968.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene zapE CDS 11296..11724 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene rplM CDS 11740..12132 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene rpsI CDS 12446..13087 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257300.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene sspA CDS 13093..13584 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366127.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene sspB CDS complement(13638..14189) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501414.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene yjgA CDS 14296..15648 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852994.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene pmbA CDS 15705..16091 product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene cybC CDS 16400..16738 product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 16749..17111 product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006179053.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 17114..17413 product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810338.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 17437..18213 product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478578.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 18225..18869 product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368573.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 18914..20047 product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459938.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 sequence065 source 1..20210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1310..2497 product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303128.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene ygeW CDS 2565..3761 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705214.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene dpaL CDS 3833..5050 product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705213.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 5101..6486 product D-phenylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264435.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene hyuA CDS 6540..7472 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene arcC CDS complement(7526..9169) product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020384.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene yqeB CDS complement(9195..9812) product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835685.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene yqeC CDS 10079..10567 product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705210.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 10891..12831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 note possible pseudo, frameshifted CDS 12920..13978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 note possible pseudo, frameshifted CDS 13981..15309 product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906289.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene ssnA CDS 15357..16052 product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene ygfM CDS 16049..18919 product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583615.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 18871..19053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 19054..19563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 sequence066 source 1..20147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(502..1014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 note possible pseudo, frameshifted CDS 1769..2920 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200769.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(2982..3185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 note possible pseudo, frameshifted CDS complement(3154..4110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 note possible pseudo, frameshifted CDS complement(4385..5098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 note possible pseudo, frameshifted CDS complement(5041..5559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 note possible pseudo, frameshifted CDS 5931..6869 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 7174..8439 product tagatose-bisphosphate aldolase subunit GatZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853833.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene gatZ CDS 8450..9499 product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene gatD CDS 9503..10372 product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469985.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 10411..10836 product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene fucU CDS 10868..12391 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene gguA CDS 12392..12895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 note possible pseudo, frameshifted CDS 12945..13448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 note possible pseudo, frameshifted CDS 13495..14451 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311043.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 14528..15547 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 15584..17071 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene xylB CDS 17205..17885 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 note possible pseudo, frameshifted CDS complement(17962..18117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 assembly_gap 18146..18181 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 18678..18781 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19409..19828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 sequence067 source 1..20057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..502 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000838944.1:RpoE-regulated lipoprotein locus_tag LOCUS_19740 CDS 603..758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 note possible pseudo, frameshifted CDS 764..1498 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098206.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 note possible pseudo, frameshifted CDS complement(1553..2323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 note possible pseudo, frameshifted CDS complement(2317..2805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 note possible pseudo, frameshifted CDS complement(2922..3308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(3312..4589) product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726706.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene frc CDS complement(4604..5365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 note possible pseudo, frameshifted CDS complement(5356..6357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 note possible pseudo, frameshifted CDS complement(6397..7677) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902070.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 7941..8840 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193481.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 9086..9688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 note possible pseudo, frameshifted CDS 9682..10062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 note possible pseudo, frameshifted CDS 10062..10895 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458408.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene cysT CDS 10895..11128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 note possible pseudo, frameshifted CDS 11100..11309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 note possible pseudo, frameshifted CDS 11323..11772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 note possible pseudo, frameshifted CDS 11762..12514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 note possible pseudo, frameshifted CDS 12462..13697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 assembly_gap 12831..12839 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13751..14401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 note possible pseudo, frameshifted CDS 14343..14573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 note possible pseudo, frameshifted CDS complement(14627..15130) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene crr CDS complement(15174..16901) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098199.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene ptsI CDS complement(16945..17202) product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene ptsH CDS complement(17583..18554) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878168.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene cysK CDS complement(18717..19478) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255008.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene cysZ sequence068 source 1..19796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097163.1:glucans biosynthesis glucosyltransferase MdoH note possible pseudo, frameshifted locus_tag LOCUS_20000 CDS 478..1017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 note possible pseudo, frameshifted CDS 1090..1317 product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097162.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(1319..1693) product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180050.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(1832..2752) product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367212.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 3015..4016 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097157.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(4053..4628) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097156.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(4649..5158) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419093.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(5435..5560) product YceO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367210.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(5638..6732) product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419095.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene solA CDS complement(6961..7215) product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414441.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene bssS CDS complement(7583..7828) product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097151.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene dinI CDS complement(7910..8437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 note possible pseudo, frameshifted CDS complement(8449..8691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 note possible pseudo, frameshifted CDS complement(8663..8911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 note possible pseudo, frameshifted CDS complement(9038..9598) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097149.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(9706..10353) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene grxB CDS complement(10415..11623) product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092170.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene mdtH CDS 11932..12582 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468186.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene rimJ CDS 12488..13093 product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877137.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 13113..13556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 note possible pseudo, frameshifted CDS 13549..14043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 note possible pseudo, frameshifted CDS 14152..15687 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050683.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene murJ CDS complement(15735..16157) product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197547.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene flgN CDS complement(16162..16458) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020880.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene flgM CDS complement(16645..16842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 note possible pseudo, frameshifted CDS complement(16760..17221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 note possible pseudo, frameshifted CDS 17375..17791 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene flgB CDS 17794..17979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 note possible pseudo, frameshifted CDS 17943..18197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 note possible pseudo, frameshifted CDS 18208..18894 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020450.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene flgD sequence069 source 1..19676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 731..1504 product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099209.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene pdeH CDS 1608..3623 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(3664..4062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 note possible pseudo, frameshifted CDS complement(4121..5125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 note possible pseudo, frameshifted CDS complement(5323..6609) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099213.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(6712..8550) product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014344205.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene hmsP CDS 9666..12101 product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063447004.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene pgaA CDS 12111..14129 product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368678.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene pgaB CDS 14122..15450 product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368679.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene pgaC CDS 15450..15953 product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212041.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene pgaD CDS 16289..16696 product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene vapC CDS complement(16789..17319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201267.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 17453..17644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(17697..18731) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694624.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(18731..19042) product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005672747.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(19027..19350) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661200.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 sequence070 source 1..19246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 note possible pseudo, internal stop codon CDS 584..1240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 note possible pseudo, internal stop codon CDS 1237..2550 product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097559.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene potE CDS complement(2651..4234) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297249.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene pgm CDS complement(4259..4804) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848387.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene seqA CDS 4987..5754 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773301.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene ybfF CDS 5897..6178 product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300829.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene ybfE CDS 6328..6858 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene fldA CDS 7152..7592 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428651.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene fur CDS 7898..8512 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703599.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(8619..9836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 note possible pseudo, frameshifted CDS complement(9731..10273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 note possible pseudo, frameshifted CDS complement(10450..10644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 note possible pseudo, frameshifted CDS complement(10652..12493) product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816827.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene nagE CDS 12818..13465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 note possible pseudo, frameshifted CDS 13368..13616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 note possible pseudo, frameshifted CDS 13640..14788 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367708.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene nagA CDS 14797..16023 product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097570.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 16085..16837 product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153143.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene nagD CDS 17123..18787 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704746.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene asnB tRNA 19037..19113 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 19121..19205 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 sequence071 source 1..19141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(430..1287) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630043.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene pdxY CDS complement(1299..2561) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815557.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene mtr CDS complement(2673..4043) product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015962.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 4900..5559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 assembly_gap 6488..6587 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7095..7289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 7301..7702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 8109..8870 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603502.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene kduD CDS complement(8974..9297) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 9458..10156 product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098567.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(10143..11069) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703333.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 11195..12457 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369915.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene lysA CDS 12488..12937 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(12934..13941) product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098559.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene galR CDS 13823..14152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 14570..16726 product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098558.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene aas CDS 16719..17912 product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene lplT CDS complement(17943..18983) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369921.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 sequence072 source 1..19097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 357..1184 product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene nhoA CDS 1285..2094 product sugar-phosphatase YbiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083006.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene ybiV CDS complement(2095..2448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(2468..3079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 3396..5789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 5843..6166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 6163..7329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 7598..7891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(7924..8679) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930359.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 8941..10176 product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene umuC CDS complement(10288..10869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(10876..11373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(11366..13189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 13257..15146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 15321..15806 product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705072.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 15842..16381 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367123.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 16427..16948 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038010816.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(17021..18094) product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704800.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene pmrB CDS complement(18091..18771) product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697895.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene pmrA sequence073 source 1..19045 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 note possible pseudo, internal stop codon CDS 1189..1482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 note possible pseudo, internal stop codon assembly_gap 2008..2093 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2118..3272) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366002.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene purT CDS 3400..3720 product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 3826..4167 product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042123.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene yebF CDS 4283..4939 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024751.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 5022..7082 product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936997.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene ptrB CDS complement(7079..7747) product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366006.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene exoX CDS complement(7771..8496) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100250.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(8612..8842) product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096102.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 8984..9367 product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168393.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene yobA CDS 9550..10221 product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096104.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene copD note possible pseudo, frameshifted CDS 10247..10585 product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096105.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 11353..11661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 note possible pseudo, frameshifted CDS 11618..11974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 note possible pseudo, frameshifted CDS complement(11975..12166) product DUF1482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457838.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(12274..12513) product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978523.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(12628..14064) product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057022.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene rsmF CDS complement(14142..16631) product lipid-binding membrane homeostasis protein YebT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene yebT CDS complement(16744..18027) product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419906.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene yebS CDS 18155..18652 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 sequence074 source 1..19004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 369..1598 product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706112.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 1611..2036 product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065786.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene arsC CDS 2409..2681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 note possible pseudo, frameshifted CDS 2882..3523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 note possible pseudo, frameshifted CDS 4120..4548 product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109071.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene umuD CDS 4548..5819 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 6251..6529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 note possible pseudo, frameshifted CDS 6699..6959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 note possible pseudo, frameshifted CDS 7518..8672 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211752.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 8669..9640 product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215070.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 10145..10825 product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 10822..11046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211748.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 11098..11523 product DUF1380 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087145.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 11933..12433 product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211746.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 12473..12676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072050670.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 12865..13122 product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097727.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 13768..14313 product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860284.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene ssb1 CDS 14373..14603 product DUF905 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194654.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 14674..16680 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211744.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 16726..17157 product conjugation system SOS inhibitor PsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845908.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene psiB CDS 17154..17885 product plasmid SOS inhibition protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087158.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 17882..18208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 18455..18670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 sequence075 source 1..18797 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(151..1086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 note possible pseudo, frameshifted assembly_gap 177..227 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1454..2413) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703235.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene nrdF CDS complement(2418..4562) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098421.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene nrdE CDS complement(4550..4945) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080944.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene nrdI CDS complement(4942..5187) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223227.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene nrdH CDS complement(5448..5777) product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519557.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 5944..6288 product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098417.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(6308..6760) product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098416.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene alaE CDS 7359..7661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 8197..9243 product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394189.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene ansB CDS 9547..9744 product cold shock protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163087.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene cspG CDS 9894..10328 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094870.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 10720..11805 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704680.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 11855..13066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 note possible pseudo, frameshifted CDS 13134..13979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 note possible pseudo, frameshifted CDS 14078..16045 product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 16206..16823 product acid-sensing system DNA-binding response regulator EvgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991370.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene evgA CDS 16827..17588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 note possible pseudo, frameshifted assembly_gap 18342..18439 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence076 source 1..17998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(39..524) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097046.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 assembly_gap 289..299 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 700..2550 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097047.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene sppA CDS 2621..2788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 note possible pseudo, frameshifted CDS 2766..3482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 note possible pseudo, frameshifted CDS 3632..4291 product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097049.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene pncA CDS complement(4319..4597) product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097051.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(4639..4950) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705785.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene msrB note possible pseudo, frameshifted CDS 5392..6471 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097053.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene gapA CDS 6547..7431 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366147.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(7473..8333) product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186343.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene yeaE CDS complement(8346..9446) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882373.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 9637..10791 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 assembly_gap 10623..10629 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10892..11962 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 11972..12988 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 13038..13508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 note possible pseudo, frameshifted CDS 13541..14512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 note possible pseudo, frameshifted CDS 14522..15583 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095405.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(15616..16362) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705786.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 16789..17475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 sequence077 source 1..17827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 157..200 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 231..1364 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene lolE CDS 1380..2291 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291270.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene nagK CDS 2415..3125 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097094.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene cobB CDS complement(3163..3708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 note possible pseudo, frameshifted CDS complement(3656..4210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 note possible pseudo, frameshifted CDS complement(4231..5025) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097091.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene potC CDS complement(5099..5845) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705059.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene potB note possible pseudo, frameshifted CDS complement(5829..7094) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705060.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene potA CDS 7275..8498 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359463.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene pepT CDS complement(8670..9635) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097085.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(9700..10317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 note possible pseudo, frameshifted CDS complement(10335..11060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 note possible pseudo, frameshifted assembly_gap 10353..10389 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11057..11731) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367146.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene phoP CDS complement(11817..12740) product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901609.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(12843..14213) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419121.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene purB CDS complement(14231..14677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 note possible pseudo, frameshifted CDS complement(14674..14832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 note possible pseudo, frameshifted CDS complement(14894..15154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 note possible pseudo, frameshifted CDS complement(15168..15998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 note possible pseudo, frameshifted assembly_gap 15178..15183 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16053..16511) product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476089.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene nudJ CDS complement(16521..17174) product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097078.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene rluE CDS 17291..17566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 note possible pseudo, frameshifted sequence078 source 1..17791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 331..492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 note possible pseudo, frameshifted CDS 447..1286 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096274.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene oppF note possible pseudo, frameshifted CDS 1397..2329 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045367413.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2253..2582) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425070.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2617..2856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 note possible pseudo, frameshifted CDS complement(2835..4070) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene cls note possible pseudo, frameshifted CDS complement(4444..4740) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967595.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 5050..5616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 note possible pseudo, frameshifted CDS complement(5662..6063) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096281.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene yciA CDS complement(6060..6599) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808682.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(6697..7407) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096283.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(7434..7745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 8529..8693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 note possible pseudo, frameshifted CDS complement(8755..9162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 note possible pseudo, frameshifted CDS complement(9086..9550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 note possible pseudo, frameshifted CDS complement(9550..10743) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209521.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene trpB CDS complement(10754..11155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 note possible pseudo, frameshifted CDS complement(11061..12083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 note possible pseudo, frameshifted CDS complement(12087..13682) product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763524.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene trpD CDS complement(13682..15244) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883574.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 15497..15760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 note possible pseudo, frameshifted CDS 15654..16400 product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705744.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene rnm note possible pseudo, frameshifted CDS 16397..17017 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096362.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 sequence079 source 1..17746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 978..1370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 1367..1573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 1693..1974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(2257..3630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 3949..4566 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703812.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 4874..6841 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269419.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 7295..7606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(7569..8444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 note possible pseudo, frameshifted CDS 8698..9093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 note possible pseudo, frameshifted CDS 8999..9328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 note possible pseudo, frameshifted CDS 9383..9658 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene rpoZ CDS 9678..10343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 note possible pseudo, frameshifted CDS 10352..10615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 note possible pseudo, frameshifted CDS 10612..11022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 note possible pseudo, frameshifted CDS 11073..11807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 note possible pseudo, frameshifted CDS 11812..12534 product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068431.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene trmH CDS 12535..12810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 note possible pseudo, frameshifted CDS 12813..13097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 note possible pseudo, frameshifted CDS 13097..13666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 note possible pseudo, frameshifted CDS 13566..14582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 note possible pseudo, frameshifted CDS 14743..16134 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094877.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 16254..17402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 note possible pseudo, internal stop codon, frameshifted sequence080 source 1..17483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(862..1488) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860560.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene upp CDS 1712..2749 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098241.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene purM CDS 2749..3390 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098242.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene purN CDS 3614..5641 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098243.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene ppk1 CDS 5645..7192 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832869.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene ppx CDS complement(7189..9300) product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773655.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 9779..9970 product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528036.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(10267..11766) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138293.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene guaA CDS complement(11889..12269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 note possible pseudo, frameshifted CDS complement(12310..13383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 note possible pseudo, frameshifted CDS 13529..14830 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098266.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene xseA CDS complement(14835..15050) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098270.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(15095..16567) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882245.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene der misc_feature complement(16689..>17483) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001177037.1:outer membrane protein assembly factor BamB locus_tag LOCUS_22640 sequence081 source 1..17372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 300..1283 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128215.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene dcyD CDS 1304..1972 product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096022.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene tcyL CDS 1969..2721 product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene yecC CDS 3089..3664 product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078446.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene sdiA CDS complement(3730..3954) product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365908.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 4441..5097 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611323.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene uvrY CDS 5103..6137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 note possible pseudo, frameshifted CDS 6023..6904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 note possible pseudo, frameshifted CDS 6962..7177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 note possible pseudo, frameshifted CDS 7104..7511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 note possible pseudo, frameshifted tRNA 7663..7738 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 7792..7865 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 7876..7962 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(8138..9046) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058303659.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(9337..10677) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(10903..12417) product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene abfA CDS complement(12438..13760) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224212.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 14214..15143 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(15173..15580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 note possible pseudo, frameshifted CDS complement(15523..15924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 note possible pseudo, frameshifted CDS complement(15934..16821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 misc_feature complement(16824..>17372) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093232.1:ethanolamine ammonia-lyase subunit EutB locus_tag LOCUS_22830 sequence082 source 1..17082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..510 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705659.1:L-Ala-D/L-Glu epimerase locus_tag LOCUS_22840 CDS complement(501..953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 note possible pseudo, frameshifted CDS complement(976..1173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 note possible pseudo, frameshifted CDS 1378..2997 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096426.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 3124..3771 product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007767.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene zinT CDS complement(3822..4169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366895.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(4184..4786) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 4830..4964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 5099..5365 product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(5362..6507) product membrane-associated sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819461.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 6690..7673 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387372.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene zntB CDS 7949..8080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(8112..9047) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157412.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene ttcA CDS 9239..9565 product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 9737..9934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 assembly_gap 10202..10312 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10733..10800 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11009..11208 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11720..11758 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12059..14200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 assembly_gap 12092..12190 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14464..14730 product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200680.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(14727..15149) product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296048.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene hslJ CDS complement(15240..16229) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096773.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 16442..16615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 note possible pseudo, internal stop codon, frameshifted sequence083 source 1..16982 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 229..669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 note possible pseudo, frameshifted assembly_gap 265..301 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 666..2075 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136930.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 2062..2640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097384.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 2650..4104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 4181..4495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 4470..4811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 4814..5335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 5325..6047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267960.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 6019..6588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200801.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 6575..8275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977539.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(8861..9034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(9349..10983) product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097376.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 11370..11636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(11678..11944) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495513.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 12141..12431 product YbjC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259133.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 12415..13137 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189165.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene nfsA CDS 13215..14117 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684361.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene rimK CDS 14252..14731 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367528.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 15043..16215 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126098.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene potF sequence084 source 1..16971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(106..864) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099005.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(873..1976) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351330.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(1987..3168) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019643.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(3242..4267) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(4752..4973) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825639.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(5284..5502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 note possible pseudo, frameshifted CDS complement(5543..8305) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099000.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(8298..9326) product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160348.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene acrE CDS 9873..10523 product acrEF/envCD operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446923.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene envR CDS complement(10593..10889) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene fis CDS complement(10993..11907) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369451.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene dusB CDS complement(12303..13043) product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(13191..14072) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703628.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene prmA CDS complement(14084..15190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 note possible pseudo, frameshifted CDS complement(15087..15533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 note possible pseudo, frameshifted CDS complement(15523..15765) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098993.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(15866..16522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 assembly_gap 16534..16555 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence085 source 1..16765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(61..903) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940500.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene epmB CDS 1131..1697 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855940.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene efp CDS 1752..1889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 1992..2138 product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239598.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene ecnB CDS complement(2176..2643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 3037..3354 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118469.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene sugE CDS complement(3351..3881) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095269.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(3949..5166) product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029244.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 5337..6878 product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838205.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene ptsG CDS 6908..9523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 9567..10391 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261394.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 assembly_gap 9790..9799 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10375..10767 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094795.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 10767..11039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(11084..11443) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609650.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene frdD CDS complement(11453..11848) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene frdC CDS complement(11859..12593) product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704156.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene frdB CDS complement(12586..14382) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095275.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene frdA CDS 14702..15679 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene epmA CDS complement(15720..16607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 note possible pseudo, frameshifted sequence086 source 1..16650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(368..715) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096342.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(719..1693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 note possible pseudo, frameshifted CDS complement(1827..3335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 note possible pseudo, frameshifted CDS complement(3316..3621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(3630..4037) product phage minor tail protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299690.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(4072..4809) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(4817..5215) product phage tail terminator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096337.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene gpU repeat_region 5233..5382 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttctccacgcacgtggaggtgtttc CDS complement(5385..5942) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096336.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(5952..6227) product DNA breaking-rejoining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220710484.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(6220..6543) product DUF2190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097065.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(6625..8604) product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081097245.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(8573..10078) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096321.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(10075..10299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309515.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(10296..12398) product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096319.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(12398..12898) product DUF1441 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020884621.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(13128..13472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(13598..14596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(15487..15627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(15602..15952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(15949..16455) product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403797.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 sequence087 source 1..16599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1402..2391 product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene mgrA CDS 2536..2862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 3050..4609 product maltose/glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387436.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene malX CDS 4670..5977 product adenylosuccinate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034850905.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 5967..7178 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582637.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene nagA CDS complement(7171..8667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(8761..9999) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186369.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 10351..11550 product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878156.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene nupC CDS complement(11600..11764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(11808..13157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 note possible pseudo, frameshifted CDS complement(13165..13470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 note possible pseudo, frameshifted assembly_gap 13768..13861 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14101..14463 product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472034.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 14467..14853 product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472021.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(14904..15983) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695623.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene gltX note possible pseudo, internal stop codon CDS complement(16044..16319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 note possible pseudo, internal stop codon sequence088 source 1..16340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(531..1118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 note possible pseudo, frameshifted CDS complement(1240..2331) product DNA-binding transcriptional repressor LacI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene lacI CDS complement(2554..2766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(2799..3164) product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878136.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(3196..3417) product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703392.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(3426..3899) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703840.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene radC CDS complement(3967..4785) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007869723.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(4885..5490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878130.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(5850..6743) product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878129.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 7554..7862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(8303..9934) product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481742.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(10036..10434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 10896..11732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 13167..13889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 13890..14522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 15098..15649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 assembly_gap 15976..16003 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16025..16324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 sequence089 source 1..16286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..277 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006817270.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene rplR CDS 292..765 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene rpsE assembly_gap 850..912 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 932..1204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 1212..2543 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene secY CDS complement(2601..2774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 2837..3193 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099021.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene rpsM CDS 3210..3599 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388621.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene rpsK CDS 3631..4251 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene rpsD CDS 4277..4858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 note possible pseudo, frameshifted CDS 4767..5207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 note possible pseudo, frameshifted CDS 5248..5634 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216372.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene rplQ CDS 5735..6106 product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266531.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 6106..6525 product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369432.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene zntR CDS 6577..6792 product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092695.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene arfA CDS complement(6793..7206) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022450.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene mscL CDS complement(7347..8723) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369435.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene trkA CDS complement(8759..10051) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744595.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene rsmB CDS complement(10112..11023) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004453.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene fmt CDS complement(11048..11458) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114992.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene def note possible pseudo, frameshifted CDS 11690..12811 product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228544.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene dprA CDS 12783..13256 product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369440.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene smg CDS 13282..13833 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099010.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 13826..14398 product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420961.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene tsaC CDS 14403..15221 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451211.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene aroE CDS 15218..15475 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070563.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(15451..16005) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099006.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 sequence090 source 1..16143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..526 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000377800.1:phosphate signaling complex protein PhoU locus_tag LOCUS_24370 CDS complement(523..1188) product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703909.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene yieH CDS 1368..2705 product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301685.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene adeP CDS complement(2740..3306) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369022.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(3299..4081) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(4313..5206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 note possible pseudo, frameshifted CDS complement(5368..5568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 note possible pseudo, frameshifted CDS complement(5674..7089) product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295247.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene tnaA CDS 7371..7574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(7676..8392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 note possible pseudo, frameshifted CDS complement(8397..8966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 assembly_gap 8429..8444 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9060..9392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 note possible pseudo, frameshifted CDS complement(9386..10597) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378272.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene yidC note possible pseudo, frameshifted CDS complement(10821..11147) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703902.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene rnpA CDS 12011..13321 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014068246.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene dnaA CDS 13326..14426 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369032.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene dnaN CDS 14426..15499 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094779.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene recF CDS 15528..15998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 note possible pseudo, frameshifted sequence091 source 1..16118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 728..2227 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095904.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene ushA CDS complement(2274..2753) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428207.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene ybaK CDS complement(2836..3633) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367896.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(3719..6148) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816861.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene copA assembly_gap 4415..4518 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6380..6601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 7149..9182 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933627.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 9183..10694 product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene casA CDS 10691..11206 product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933629.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene casB CDS 11203..11838 product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933630.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene cas6e CDS 11854..12900 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933631.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene cas7e CDS 12904..13605 product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933632.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene cas5e CDS 13637..14134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 note possible pseudo, internal stop codon CDS 14258..14503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 note possible pseudo, internal stop codon CDS 14500..14790 product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933634.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene cas2e repeat_region 14810..>16118 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttctccacgtacgtggaggtgtttc sequence092 source 1..15912 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(909..1184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(1196..1924) product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848059.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(1947..2435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 note possible pseudo, frameshifted CDS complement(2419..2664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 note possible pseudo, frameshifted CDS complement(2607..3989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 note possible pseudo, frameshifted CDS complement(4172..4642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 note possible pseudo, frameshifted CDS complement(4654..4932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 assembly_gap 5244..5342 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5595..5696 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 5949..5954 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6258..6467) product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112403.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(6457..6651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(9114..9788) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338540.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 10199..11371 product multidrug efflux MFS transporter outer membrane subunit VceC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798631.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene vceC CDS 11371..12570 product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 12574..14106 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193982.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 14212..15117 product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239434.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene cyoA sequence093 source 1..15736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(118..1374) product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209313.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(1608..2807) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851503.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 tRNA complement(2983..3057) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(3131..4090) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098160.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 4290..4820 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370110.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene ccmA note possible pseudo, frameshifted CDS 4891..5550 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971732.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene ccmB CDS 5597..6307 product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006798169.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 6304..6522 product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006798167.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene ccmD CDS 6519..6998 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158631.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene ccmE CDS 6995..8944 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158627.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 8944..9090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 note possible pseudo, frameshifted CDS 9227..9487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 note possible pseudo, frameshifted CDS 9484..9942 product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703210.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 9939..11141 product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815901.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene ccmI CDS 11171..11923 product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776787.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene mlaA CDS complement(11993..13360) product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420287.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene fadL CDS 13730..14014 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030904.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 14181..15491 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420286.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene fadI sequence094 source 1..15551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 411..773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 note possible pseudo, frameshifted CDS 835..1338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 note possible pseudo, frameshifted CDS 1343..3253 product aldehyde oxidoreductase molybdenum-binding subunit PaoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667043.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene paoC note possible pseudo, frameshifted CDS 3207..3518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 note possible pseudo, frameshifted CDS 3727..4407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 note possible pseudo, frameshifted CDS complement(4747..5346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 5464..6891 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159678901.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(7017..8237) product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032715566.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 8615..9601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 9605..10612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 10745..11407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(11571..12179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(12172..13035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(13010..13345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 13360..14496 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705543.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 assembly_gap 15041..15227 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence095 source 1..15335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(232..504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 note possible pseudo, frameshifted CDS complement(569..4366) product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253574.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene yhdP CDS complement(4418..5887) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene rng CDS complement(5896..6339) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 note possible pseudo, frameshifted CDS complement(6436..6852) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098985.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene mreD CDS complement(6852..7907) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098986.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene mreC CDS complement(7977..9020) product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene mreB CDS complement(9330..11270) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098987.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene csrD CDS 11492..12466 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148479.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 12577..13131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 assembly_gap 13093..13126 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13136..13501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 13502..14101 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703627.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene msrQ CDS 14336..14788 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098991.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene aroQ CDS 14810..15286 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354626.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene accB sequence096 source 1..15197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(155..739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 note possible pseudo, frameshifted CDS complement(764..2086) product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(2083..2739) product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339055.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene atoA CDS complement(2742..3398) product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene atoD CDS complement(3606..4979) product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene atoC CDS complement(4976..6748) product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559125.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene atoS CDS 6994..9843 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098008.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene rcsC CDS complement(9877..10527) product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061910.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene rcsB CDS complement(10544..11128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 note possible pseudo, frameshifted CDS complement(11116..13194) product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619743.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene rcsD note possible pseudo, frameshifted CDS 14021..15139 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865526.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 sequence097 source 1..15146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 267..1214 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593260.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene gshB CDS 1351..1914 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369734.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 1914..2330 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811925.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene ruvX CDS complement(2341..3318) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001683272.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 3426..4049 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098666.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 4065..4631 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369729.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 4628..4915 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369728.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene yggU CDS 4931..5524 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 5517..6653 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098670.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene hemW CDS complement(6725..7648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 note possible pseudo, frameshifted CDS complement(7648..8403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 assembly_gap 7707..7722 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 8410..8576 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9176..9610) product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704404.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene secM CDS complement(9925..10842) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095578.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene lpxC CDS complement(10944..12080) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004857884.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene ftsZ CDS complement(12141..12710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 note possible pseudo, frameshifted CDS complement(12673..13380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 note possible pseudo, frameshifted CDS complement(13377..14105) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095577.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene ftsQ CDS complement(14194..14766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 note possible pseudo, frameshifted CDS complement(14735..15112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 note possible pseudo, frameshifted sequence098 source 1..15075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1279..1869) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097014.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(1978..2304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 assembly_gap 2370..2425 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2678..3346) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097012.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene hxpB CDS 3607..4038 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097011.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(4068..4928) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097010.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(5032..5325) product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146149.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene ghoS CDS complement(5403..5561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 assembly_gap 5591..5751 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5905..6228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 6768..7409 product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097007.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 7906..9117 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198300234.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(9072..9311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(9356..9703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(9994..11103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(11114..13816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(13953..14327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(14336..14518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 sequence099 source 1..15044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..796 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000822139.1:dTDP-glucose 4,6-dehydratase locus_tag LOCUS_25750 CDS 814..1695 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676077.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene rfbA CDS 2056..2352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 note possible pseudo, frameshifted CDS 2357..3487 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene rffA CDS 3489..4739 product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050302.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene wzxE CDS 4736..5812 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099271.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 5809..7167 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055119.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene wzyE CDS 7176..7979 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064038.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene wecG CDS 8107..9492 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774741.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 assembly_gap 9616..9812 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10506..11600) product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099267.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene hemY CDS complement(11600..12787) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139074.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene hemX CDS complement(12809..13546) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703978.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene hemD CDS complement(13543..14481) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001338644.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene hemC sequence100 source 1..14984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1167..2294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 note possible pseudo, frameshifted assembly_gap 2470..2518 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2535..3023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 note possible pseudo, frameshifted CDS complement(3033..3941) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097495.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene yvcK CDS 4280..5269 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704804.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene moaA CDS 5291..5803 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084629.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene moaB CDS 5806..6285 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080893.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene moaC CDS 6285..6530 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598612.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene moaD CDS 6532..6984 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852296.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene moaE CDS 7047..7757 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428846.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(7731..8765) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129824.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(8775..10007) product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650337.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 gene clsB CDS complement(10004..10429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 note possible pseudo, frameshifted CDS complement(10365..10760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 note possible pseudo, frameshifted CDS 10891..11307 product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704808.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(11269..12375) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469031.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(12386..13345) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045765.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 note possible pseudo, frameshifted CDS complement(13351..13485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 note possible pseudo, frameshifted CDS complement(13482..14585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 note possible pseudo, frameshifted assembly_gap 14598..14630 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence101 source 1..14967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(527..2818) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098876.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene pflB CDS complement(2860..4068) product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661584.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene tdcD CDS complement(4123..5457) product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107720.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene tdcC CDS complement(5482..6474) product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815409.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene tdcB CDS 7005..8210 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154617.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(8291..8962) product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968968.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 9197..9661 product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799375.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene marR CDS 9679..10053 product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502237.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene marA CDS 10095..10298 product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096628.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene marB CDS complement(10266..11084) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096629.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene eamA CDS 11284..12042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 assembly_gap 11912..11925 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11981..12343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 12429..12638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(12673..13077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 assembly_gap 13091..13128 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13272..14072) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096633.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene urtD CDS complement(14069..14662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 assembly_gap 14669..14733 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence102 source 1..14914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(829..1338) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099148.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(1381..2358) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(2526..2813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 2955..3620 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099151.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 3692..4249 product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099152.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(4311..4613) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931180.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(4624..5937) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733949.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(5949..7367) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989440.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(7367..7699) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261351.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS 7899..8810 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047372561.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 8830..9804 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189263.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(9834..11072) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 11161..12231 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297848.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 12739..13128 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 13197..14267 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 assembly_gap 14483..14636 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14658..14852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 sequence103 source 1..14841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1120 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003861487.1:NADH-quinone oxidoreductase subunit NuoF locus_tag LOCUS_26390 CDS 1206..2660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 note possible pseudo, internal stop codon CDS 2667..3941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 note possible pseudo, internal stop codon CDS 3938..4915 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365589.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene nuoH CDS 4930..5472 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861491.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene nuoI assembly_gap 5694..5733 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5871..6173 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene nuoK CDS 6170..6454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 6381..7892 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832758.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene nuoL assembly_gap 8113..8266 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8277..8627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 8509..9156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 9163..10464 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098101.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene nuoN note possible pseudo, frameshifted CDS 10412..10582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 note possible pseudo, frameshifted CDS 10715..12268 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244800.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(12304..12537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(12537..12995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 assembly_gap 12607..12648 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13061..13510 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574091.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 13577..13888 product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028061.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene elaB CDS 13932..14624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 assembly_gap 14548..14570 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence104 source 1..14830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1417 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703899.1:DNA topoisomerase (ATP-hydrolyzing) subunit B note possible pseudo, frameshifted locus_tag LOCUS_26570 CDS 1414..1596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 note possible pseudo, frameshifted CDS 1744..2523 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985571.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene yidA CDS 2721..3431 product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369039.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene dgoR CDS 3513..4661 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094786.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene dgoD CDS 4795..5070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 4994..5971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 note possible pseudo, frameshifted CDS 6004..7263 product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(7254..7580) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369045.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 7878..8291 product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene ibpA CDS 8399..8827 product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094790.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene ibpB CDS 8982..9305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 note possible pseudo, frameshifted CDS 9290..10669 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 note possible pseudo, frameshifted CDS 10786..11133 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703889.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 11126..11464 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113457.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(11461..12072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 note possible pseudo, frameshifted CDS complement(12017..12622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 note possible pseudo, frameshifted CDS complement(12791..13414) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705174.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 assembly_gap 14627..14683 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence105 source 1..14677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 627..1337 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764731.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene folP note possible pseudo, frameshifted CDS 1330..2667 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071169.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene glmM CDS complement(2702..3601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 note possible pseudo, frameshifted CDS complement(3607..4170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 note possible pseudo, frameshifted CDS complement(4181..5314) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128783587.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene iadA CDS 5482..6384 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262090.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 6546..6878 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295556.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene secG tRNA 6923..7009 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 7069..7145 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 7328..7810 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524507.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene rimP CDS 7837..9324 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369524.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene nusA CDS 9349..12063 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098916.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene infB CDS 12131..12532 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene rbfA CDS 12532..13476 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098915.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene truB CDS 13562..13885 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene rpsO CDS 14131..14460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 note possible pseudo, frameshifted sequence106 source 1..14663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(653..871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 assembly_gap 934..996 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1129..1539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(1526..3412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 assembly_gap 1548..1618 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3650..4402) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862621.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(4416..5156) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(5168..6478) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990033.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(6483..6761) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723637.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(6790..7143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(7140..7871) product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990032.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(7880..8851) product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723635.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(9117..10547) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815892.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(10696..11805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 note possible pseudo, frameshifted CDS 12176..13189 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815890.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(13224..14093) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096380.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 sequence107 source 1..14546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 558..803 product DUF2526 family protein YdcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018633.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene ydcY CDS complement(800..1249) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096484.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(1246..1764) product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310799.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene mddA CDS complement(1830..2003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 1921..2388 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366420.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 2536..3204 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096488.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(3566..5566) product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446029.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene pqqU CDS 5917..6975 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550626.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(6990..8123) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531199.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(8244..9344) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456065.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(9475..10521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(10662..12155) product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684770.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene ansP CDS 12417..13034 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096501.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 13077..13301 product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096502.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene pptA sequence108 source 1..14535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1090..1851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 note possible pseudo, frameshifted CDS complement(1853..2932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 note possible pseudo, frameshifted CDS complement(2929..4380) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206268.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene selA CDS complement(4390..4998) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766681.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(5097..5348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 note possible pseudo, frameshifted CDS complement(5345..6163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 note possible pseudo, frameshifted CDS complement(6166..6501) product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478200.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 7140..9044 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094933.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 9150..10100 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645424.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene mtlD note possible pseudo, frameshifted CDS 10087..10281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 note possible pseudo, frameshifted CDS 10341..10868 product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094931.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene mtlR CDS 10925..11287 product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665687.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 11626..13281 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene lldP CDS 13278..14060 product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369184.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene lldR sequence109 source 1..14273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 110..886 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095486.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(881..1378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 note possible pseudo, frameshifted CDS complement(1431..1679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 note possible pseudo, frameshifted CDS complement(1699..3249) product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 3515..4294 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031624265.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene deoC CDS 4351..5673 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477838.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene deoA CDS 5773..6996 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095491.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene deoB CDS 7050..7769 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887789.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene deoD CDS 7997..9037 product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807739.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene kch assembly_gap 8880..8906 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9065..9241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 note possible pseudo, frameshifted CDS complement(9228..10058) product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209755.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene lplA note possible pseudo, frameshifted CDS complement(10083..10724) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124615.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 10830..11801 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095495.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene serB CDS 11814..12470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 assembly_gap 12430..12461 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12482..13048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 sequence110 source 1..14061 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 note possible pseudo, internal stop codon CDS 412..987 product Slp family lipoprotein YeaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290576.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene yeaY CDS 1192..2877 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705923.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene fadD CDS 2946..4067 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162182289.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 gene rnd CDS complement(4172..4438) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185665.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene minE CDS complement(4442..5254) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101055.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene minD CDS complement(5279..5971) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366055.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene minC CDS 6098..6373 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295992.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 6449..7522 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298239.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 7551..8210 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366057.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 8302..8559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 note possible pseudo, frameshifted CDS 8898..9134 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 9295..9468 product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096478.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(9525..10064) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028084.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene dsbB CDS complement(10221..10460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(10385..11500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 11717..12436 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234823.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene fadR CDS complement(12681..13193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(13355..13585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 note possible pseudo, frameshifted sequence111 source 1..13969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(494..763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 note possible pseudo, frameshifted CDS complement(828..1487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 note possible pseudo, frameshifted assembly_gap 842..875 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1484..2581) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501583.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(2591..4396) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561746.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(4599..4880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 note possible pseudo, frameshifted assembly_gap 4915..5063 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6102..6671) product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241015.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene mepS CDS 6773..6964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(7087..7800) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136374357.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(7847..8824) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097980.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(8945..10411) product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706121.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(10660..11232) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136827.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene yeiP CDS 11388..11642 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365691.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(11639..12820) product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097970.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene setB CDS 13171..13776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 note possible pseudo, frameshifted sequence112 source 1..13722 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..1592) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003071.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene lysS CDS complement(1602..2261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 note possible pseudo, frameshifted CDS complement(2230..2442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 note possible pseudo, frameshifted CDS complement(2801..4465) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813190.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene recJ CDS complement(4517..5194) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745614.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene dsbC CDS complement(5220..6182) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434302.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene xerD CDS 6221..6742 product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369793.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene fldB CDS complement(6747..7166) product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369792.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(7147..7413) product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene sdhE CDS 7654..8667 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886049.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene ygfZ CDS complement(8702..9361) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863433.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(9491..9802) product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182957.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene yqfB CDS 9916..10653 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 10777..12213 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098619.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 12297..13286 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 13428..13718 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002942403.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene rpsF sequence113 source 1..13712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2104..3300) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095689.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene ackA CDS 3709..4086 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098114.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene yfbV CDS 4159..4653 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426135.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 4666..5091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 5342..7186 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098111.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(7175..7774) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706162.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene yfbR CDS complement(7853..9067) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098109.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene alaA CDS 10186..10971 product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881734.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene lrhA CDS 11585..12031 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913181.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene nuoA assembly_gap 12061..12131 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12638..13477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 note possible pseudo, frameshifted sequence114 source 1..13709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(427..960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 note possible pseudo, frameshifted CDS complement(1141..2550) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973343.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(2754..4112) product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098524.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene gudP CDS complement(4184..4405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(4369..4929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(4922..5710) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 note possible pseudo, frameshifted CDS complement(5843..7147) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895440.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(7197..8909) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726981.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 9187..9900 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(9943..10824) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096168.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene gap note possible pseudo, frameshifted CDS complement(10781..10960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 note possible pseudo, frameshifted CDS complement(11103..12023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 note possible pseudo, frameshifted CDS 12608..13039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 13050..13352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 sequence115 source 1..13596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..1381) product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006621.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene wecC CDS complement(1378..2508) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866686.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene wecB CDS complement(2564..3613) product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193415.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene wzzE CDS complement(3624..4727) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050971.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene wecA CDS complement(4976..6187) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883293.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene rho CDS complement(6540..6869) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene trxA CDS 6988..7896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 note possible pseudo, frameshifted CDS 7944..8231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 note possible pseudo, frameshifted CDS 8237..9694 product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099280.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene gppA CDS complement(9760..11736) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099281.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene rep CDS 11858..12139 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368892.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene ppiC CDS 12187..12468 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096806.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene ppiC CDS complement(12516..13337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 note possible pseudo, frameshifted sequence116 source 1..13363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(445..924) product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393539.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene gmm CDS complement(927..1892) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(1895..3016) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863514.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene gmd CDS complement(3051..3608) product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene wcaF CDS complement(3719..4471) product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097876.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene wcaE CDS complement(4474..5703) product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097877.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene wcaD CDS complement(5678..6160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 note possible pseudo, frameshifted CDS 6151..6579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(6704..6847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 note possible pseudo, frameshifted CDS complement(6844..7308) product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097879.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene wcaB CDS complement(7308..8066) product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097880.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene wcaA assembly_gap 7611..7680 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8134..10293) product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137223.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene wzc CDS complement(10296..11783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 sequence117 source 1..13245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1170..1397 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750393.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 1755..2672 product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene gcvA CDS 2734..3114 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862756.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 3101..4306 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098534.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene rlmM assembly_gap 4181..4244 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4450..4701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(4933..6300) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene sdaA CDS 6266..6430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(6512..7021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(7031..8215) product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855029.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene pabB CDS 8312..8491 product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500497.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(8561..8989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 9266..10996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(11054..11398) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096138.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 11411..13024 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096139.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 note possible pseudo, frameshifted assembly_gap 11435..11469 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12952..13203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 note possible pseudo, frameshifted sequence118 source 1..13233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 203..796 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112218.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 assembly_gap 1156..1301 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2097..2170 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2178..3047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28620 note possible pseudo, frameshifted CDS 3167..3703 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306523.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene cybB CDS 4146..5294 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815933.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 5350..5646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(5838..7289) product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854618.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene uxaB CDS complement(7471..8514) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096607.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(8652..9359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 note possible pseudo, frameshifted CDS complement(9251..10096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 note possible pseudo, frameshifted CDS complement(10195..11064) product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257423.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene glsB CDS complement(11091..12680) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096611.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 sequence119 source 1..13138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 19..609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(596..1570) product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605880.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene uvsE CDS complement(1682..3118) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095421.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 3294..3455 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095422.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 3604..4773 product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098822.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 tRNA complement(4878..4953) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(5109..6008) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210024.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(6005..7135) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210025.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(7185..8567) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(8684..9184) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210027.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene rbsD CDS complement(9214..10125) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210028.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(10198..10899) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210030.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene deoC CDS 11131..12018 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210026.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 misc_feature complement(12035..>13138) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095746.1:glutamate-5-semialdehyde dehydrogenase locus_tag LOCUS_28840 sequence120 source 1..13100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(293..1444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 note possible pseudo, frameshifted assembly_gap 420..439 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1991..2968 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705035.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene rluC CDS complement(3031..3579) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028074.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 3720..4241 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174481.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene yceD CDS 4292..4465 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290727.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene rpmF CDS 4539..5636 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197585.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene plsX CDS 5643..6425 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288132.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene fabH CDS 6503..6964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 note possible pseudo, internal stop codon CDS 7028..7372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 note possible pseudo, internal stop codon CDS 7386..8120 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008535.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene fabG CDS 8396..8542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 8651..9892 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705037.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene fabF CDS 9998..10804 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705038.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 gene pabC CDS 10818..11843 product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097117.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene yceG CDS 11821..12456 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256997.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene tmk sequence121 source 1..13017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(164..532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 note possible pseudo, frameshifted assembly_gap 171..175 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 720..1436 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097539.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(1525..2391) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501094.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene sucD CDS complement(2391..3557) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367670.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene sucC CDS complement(3667..4902) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099820.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene odhB CDS complement(4917..7628) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622290.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene sucA assembly_gap 5541..5549 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7850..8566) product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501090.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene sdhB CDS complement(8583..9284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 note possible pseudo, frameshifted assembly_gap 9298..9315 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9397..10140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 note possible pseudo, frameshifted CDS complement(10197..10544) product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501088.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene sdhD CDS complement(10538..10942) product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684965.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene sdhC CDS 11582..12868 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785834.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene gltA sequence122 source 1..12919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 302..369 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 567..1367 product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859914.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene manY CDS 1371..2240 product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175979.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 2304..2762 product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096131.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 3146..3709 product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518359.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene mntP CDS complement(3706..4518) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene rlmA CDS complement(4654..4863) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene cspE CDS complement(5654..5941) product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000660.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(6014..6163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 6314..6550 product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705933.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(6581..7372) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262203.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene kdgR CDS 7569..7772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 7806..9536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 10153..10689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 10779..11063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 11082..11270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 11267..11707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 12261..12872 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103083.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 sequence123 source 1..12865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(26..301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(485..1240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582232.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(1237..1725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(1716..2252) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001603282.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene yfdR CDS complement(2345..3274) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368016.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene rdgC CDS 3614..3865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(4263..4472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 note possible pseudo, frameshifted CDS complement(4462..4896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 note possible pseudo, frameshifted CDS 5014..5238 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067727.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 5267..5818 product protein YmfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515848.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene ymfL CDS 5994..6113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 6166..7038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 7035..7478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 7478..8671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 8665..8985 product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210143.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 8982..9380 product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767110.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 9708..10259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 note possible pseudo, frameshifted CDS 10288..11256 product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360050.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 11274..12104 product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705710.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 sequence124 source 1..12679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 447..1115 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096700.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 1474..2946 product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919708.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene proP CDS 3037..3567 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096695.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene cybB CDS 3666..4016 product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248993.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene yeaR CDS 4027..4209 product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513737.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 4341..4553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(5571..5726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 5888..6484 product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104860.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 6665..7246 product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039271.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(7387..7752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 7960..8235 product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 8268..9218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(9259..10140) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984498.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene htpX misc_feature complement(10332..>12679) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096119.1:carboxy terminal-processing peptidase locus_tag LOCUS_29610 assembly_gap 12231..12282 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence125 source 1..12578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..511 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000887629.1:alkyl hydroperoxide reductase subunit F locus_tag LOCUS_29620 CDS complement(578..1006) product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097606.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene uspG CDS 1264..2502 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646173.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 2960..3493 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163272.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 3562..3945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 4166..5494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 note possible pseudo, frameshifted CDS 5442..6044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 note possible pseudo, frameshifted CDS 6037..6669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 note possible pseudo, frameshifted CDS 6688..7437 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018304.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 7461..8033 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095779.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 8062..8421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 8538..8945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 8989..9402 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208091882.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 9411..9938 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725949.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 10142..11677 product O-antigen ligase-like protein WaaL-xs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815615.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene waaL-xs CDS complement(11710..12120) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097604.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene rnk sequence126 source 1..12436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 151..279 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 501..1445 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251315.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 1435..2241 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096476.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 2266..3690 product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096477.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene patD CDS 4411..4596 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071524879.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(4680..5441) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096615.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(5443..5973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 note possible pseudo, internal stop codon CDS complement(5986..6429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 note possible pseudo, internal stop codon CDS complement(6422..7684) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410744.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 7864..8829 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096618.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 note possible pseudo, internal stop codon, frameshifted CDS 8951..9835 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096619.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 9912..10985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 note possible pseudo, frameshifted CDS 10973..11314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 note possible pseudo, frameshifted CDS 11316..11867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 note possible pseudo, internal stop codon, frameshifted CDS 11882..12409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 note possible pseudo, internal stop codon, frameshifted sequence127 source 1..12373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(354..1016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 assembly_gap 1294..1355 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1376..2425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(2472..2837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(2916..3080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 note possible pseudo, frameshifted CDS complement(3029..3499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 note possible pseudo, frameshifted CDS complement(3502..3855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211716.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(3857..3994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(3997..4338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 note possible pseudo, frameshifted CDS complement(4341..5750) product P22 phage major capsid protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705696.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(5767..6558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705697.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(6644..7129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 note possible pseudo, frameshifted CDS complement(7194..7739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 note possible pseudo, frameshifted CDS complement(7741..8388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(8391..9062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(9067..10638) product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816477.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(10635..11123) product DUF2280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211724.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(11155..11781) product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095975.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(12087..12227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30090 sequence128 source 1..12185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 251..445 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 470..877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 1004..1234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 1721..2407 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 2408..3487 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 3508..3759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 3798..4598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 note possible pseudo, frameshifted CDS 4636..5097 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033059696.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 5169..6014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 note possible pseudo, frameshifted CDS 6004..6411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 note possible pseudo, frameshifted CDS complement(6481..7227) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 7396..8151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 note possible pseudo, frameshifted CDS 8148..8507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 note possible pseudo, frameshifted CDS 8830..9597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 note possible pseudo, internal stop codon CDS 9607..11262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 note possible pseudo, internal stop codon CDS 11276..11902 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene dmsB sequence129 source 1..12143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(293..886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 note possible pseudo, frameshifted CDS complement(931..1368) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099363.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene dtd CDS complement(1365..2237) product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(2231..2830) product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099365.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene yihX CDS complement(2961..3758) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(3883..4530) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775173.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene eda CDS complement(4577..5884) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728426.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(5927..6916) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495856.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(6936..7952) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267365.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(7996..9150) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435962.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(9379..10206) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099366.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(10220..11116) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420843.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 sequence130 source 1..11693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1538..2383 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095563.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 gene leuO CDS 2776..4503 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425609.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene ilvI CDS 4506..4997 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252744.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene ilvN CDS 5174..6136 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762401.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene cra CDS complement(6258..6386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 6737..7195 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488291.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene mraZ CDS 7199..8140 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970463.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene rsmH CDS 8137..8502 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501989.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene ftsL CDS 8627..8842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 note possible pseudo, frameshifted CDS 8976..10211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 note possible pseudo, frameshifted CDS complement(10261..10437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 10387..11313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30480 note possible pseudo, frameshifted CDS 11297..11665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 note possible pseudo, frameshifted sequence131 source 1..11550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 214..310 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 842..2053 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705033.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 2240..3484 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283067.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 3469..4119 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502952.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(4211..4339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 note possible pseudo, frameshifted CDS complement(4326..5183) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212782.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene flgL CDS complement(5199..6842) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096524.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene flgK CDS complement(6919..7866) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578683.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene flgJ CDS complement(7876..8217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 note possible pseudo, frameshifted CDS complement(8214..8969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 note possible pseudo, frameshifted CDS complement(8981..9679) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857987.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene flgH CDS complement(9735..10517) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene flgG CDS complement(10530..11285) product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349284.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 sequence132 source 1..11487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..917 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000214156.1:fatty acid oxidation complex subunit alpha FadJ note possible pseudo, frameshifted locus_tag LOCUS_30620 CDS 935..1450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 note possible pseudo, frameshifted CDS 1642..2136 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365538.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene sixA CDS complement(2172..2723) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730817.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene smrB CDS 2887..3819 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098152.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene prmB CDS 3963..4958 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297933.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene aroC CDS 4964..5788 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043820.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene mepA CDS 5799..6596 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098149.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 6596..7144 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365544.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 7199..7477 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559749.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 7828..9933 product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043160.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene cstA CDS 10014..10211 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460431.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 10221..11333 product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770183.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene yjiA sequence133 source 1..11435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..758 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000973130.1:acyl-CoA dehydrogenase FadE locus_tag LOCUS_30750 CDS 893..1699 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111965864.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(1696..2094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 assembly_gap 2133..2193 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2593..2832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(3174..3905) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670675.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene dnaQ CDS 3958..4434 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095689.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene rnhA CDS complement(4427..4774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 note possible pseudo, frameshifted CDS complement(4806..5147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 note possible pseudo, frameshifted CDS 5181..5936 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052736.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene gloB CDS 6155..7339 product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644706.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene mltD note possible pseudo, frameshifted CDS complement(7413..8174) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368130.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(8244..9053) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230964.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 9300..10205 product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648572.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene yafC tRNA complement(10266..10342) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 rRNA complement(10401..10511) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 assembly_gap 10927..10965 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence134 source 1..11400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2254 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097901.1:multidrug efflux RND transporter permease subunit MdtC locus_tag LOCUS_30880 assembly_gap 319..359 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2258..3664 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706067.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 3664..4635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 4635..4976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 4973..5695 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137875.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene baeR CDS 5832..7097 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476011.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene yegQ assembly_gap 6303..6319 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7351..8253 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273393.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene yegS CDS complement(8250..8723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(8710..9201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 assembly_gap 9149..9154 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9214..9441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(9496..10200) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298844.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 misc_feature complement(10172..>11400) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_175628126.1:fimbrial usher protein StbD locus_tag LOCUS_30990 sequence135 source 1..11392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 420..890 product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605256.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 gene nanQ CDS 962..1837 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433673.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(1834..3321) product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108473.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene nanT CDS complement(3383..4285) product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029662.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene nanA CDS complement(4407..5198) product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382926.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene nanR CDS 5548..5754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 5908..6810 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094818.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(6854..7684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 note possible pseudo, frameshifted CDS complement(7659..8594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 note possible pseudo, frameshifted CDS complement(8528..8851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 note possible pseudo, frameshifted CDS complement(8902..9231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 assembly_gap 9278..9346 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9396..10856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 note possible pseudo, frameshifted assembly_gap 10914..11109 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence136 source 1..11351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(121..405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 note possible pseudo, frameshifted CDS complement(399..1271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 note possible pseudo, frameshifted CDS complement(1334..1861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 note possible pseudo, frameshifted CDS complement(1858..2220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 note possible pseudo, frameshifted CDS complement(2255..2776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 note possible pseudo, frameshifted CDS complement(3008..4336) product galactarate/glucarate/glycerate transporter GarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979025.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene garP CDS 4734..6305 product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273719.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene garD CDS 6660..7130 product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080443.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene gatA CDS 7145..7429 product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824293.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene gatB CDS 7435..8781 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490608.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 9002..9775 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(9786..10796) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(10800..10982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 note possible pseudo, frameshifted sequence137 source 1..11342 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1154 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000249157.1:penicillin-binding protein activator LpoA note possible pseudo, frameshifted locus_tag LOCUS_31250 assembly_gap 239..350 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1159..1866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 note possible pseudo, frameshifted CDS 1824..2213 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098898.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 2243..2818 product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861754.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 gene diaA CDS 2828..3403 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643280.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene dolP CDS complement(3440..4087) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298741.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 4205..4723 product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037599.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene yhbO CDS complement(4727..5149) product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369539.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(5486..5989) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908562.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(5983..6507) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098906.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 6735..7730 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098907.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 7741..8619 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301318.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 8747..9751 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130415.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(9783..11027) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224334.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene mtr sequence138 source 1..11254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..646 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000165637.1:virulence-associated effector SrfC locus_tag LOCUS_31390 assembly_gap 728..812 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(938..1636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 note possible pseudo, frameshifted CDS complement(1633..2697) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS complement(2694..3476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 note possible pseudo, frameshifted CDS complement(3473..3736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 note possible pseudo, frameshifted CDS complement(3788..4972) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 5140..5724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 note possible pseudo, frameshifted CDS 5744..6094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31460 note possible pseudo, frameshifted CDS complement(6124..6522) product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776348.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 6753..7256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 7270..7713 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096670.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 7729..8226 product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024810.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(8294..9178) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112660.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 9367..11172 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105049.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 sequence139 source 1..11121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 132..311 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1210..1650 product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094815.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(1692..3023) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791486.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(3085..3930) product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966764.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(3994..4212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 note possible pseudo, internal stop codon CDS complement(4306..4968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 note possible pseudo, internal stop codon CDS complement(5168..5884) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572570.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 5998..7188 product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136983.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene mdtM CDS 7258..7452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096722.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 7454..8059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096723.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(8087..8521) product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096287.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene uspF CDS complement(8705..9139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 9234..9452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31640 sequence140 source 1..11094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 388..582 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 932..1009 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1100..2665) product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367217.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene mdoG CDS 2907..4067 product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097165.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene mdoC CDS complement(4068..5564) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976323.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(5488..6030) product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857405.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene ymdB CDS complement(6088..6399) product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097167.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(6579..6908) product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097168.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene csgC CDS complement(6963..7454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(7494..7949) product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791653.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene csgB CDS 8722..9372 product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097171.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene csgD CDS 9376..9654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 note possible pseudo, frameshifted CDS 9791..10207 product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264088.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene csgF CDS 10231..11064 product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097174.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene csgG sequence141 source 1..11088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 258..497 product DUF905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007869725.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 601..1059 product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098170.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 1075..1551 product RadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098171.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 1560..1787 product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098172.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 1801..2118 product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007869729.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 2139..2465 product type IV toxin-antitoxin system toxin YkfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854672.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene ykfI CDS 2781..3023 product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 3007..3255 product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517660.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(3711..4949) product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785931.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene alaC assembly_gap 5765..5877 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5882..6418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 6428..7630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 note possible pseudo, frameshifted assembly_gap 7024..7110 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7641..7910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 note possible pseudo, frameshifted CDS 7920..8651 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098180.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(8676..9596) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098181.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene glk CDS 9801..10067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 note possible pseudo, frameshifted CDS 10079..10732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 note possible pseudo, frameshifted CDS 10705..10953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 note possible pseudo, frameshifted sequence142 source 1..10986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..674 product toxin YdaT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705719.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 687..941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 1056..1919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 1916..2662 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096299.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 2670..3269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 3266..3679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 3679..3810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(4014..5030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(5495..6199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 6635..6865 product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217670.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 6970..7161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 7219..7821 product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929790.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 7824..8429 product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096560.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 8655..9452 product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047634.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 10142..10402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 sequence143 source 1..10847 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1102..2388) product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450470.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene sdaC CDS complement(2854..4218) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene ppnN CDS complement(4333..5178) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100463.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene queF CDS 5246..5794 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343990.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene syd CDS 6427..6756 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098527.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 6753..7538 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703313.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene truC CDS 7557..8006 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807735.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 8478..9836 product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097082.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene gudP CDS 9833..10777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32170 note possible pseudo, frameshifted sequence144 source 1..10769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1768..3042) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095858.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene clpX CDS complement(3175..3798) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095857.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene clpP CDS complement(4114..5412) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367952.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene tig CDS complement(5761..6078) product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095855.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene bolA CDS 6380..7009 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095854.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 7051..8484 product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095853.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene ampG CDS complement(8647..8853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 8976..9914 product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095851.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene cyoA sequence145 source 1..10739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(573..1154) product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964735.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 1296..1655 product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420764.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(1673..1939) product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369314.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(1929..2525) product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703709.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene rsmD CDS 2719..3795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 note possible pseudo, frameshifted CDS 3758..4120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 note possible pseudo, frameshifted CDS 4123..4791 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099140.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene ftsE CDS 4769..5305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 note possible pseudo, frameshifted CDS 5238..5807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 note possible pseudo, frameshifted CDS 6062..6919 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500093.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene rpoH CDS complement(7370..8173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(8298..9773) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 sequence146 source 1..10637 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 236..778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 note possible pseudo, frameshifted CDS complement(824..2833) product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098212.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene maeB CDS 3405..4355 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098213.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene tal CDS 4411..6405 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087308.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene tkt CDS complement(6437..7480) product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270542.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(7561..8190) product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138361092.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene nudK CDS complement(8278..8607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 note possible pseudo, frameshifted CDS complement(8573..8881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 note possible pseudo, frameshifted CDS complement(8890..9360) product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835182.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 gene napB misc_feature complement(9336..>10637) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000013506.1:quinol dehydrogenase ferredoxin subunit NapH locus_tag LOCUS_32470 assembly_gap 10298..10313 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence147 source 1..10613 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1481..2347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 note possible pseudo, frameshifted CDS complement(2319..2783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 note possible pseudo, frameshifted CDS 2839..3036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 note possible pseudo, frameshifted CDS 3065..5572 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene barA CDS complement(5624..5851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 note possible pseudo, internal stop codon CDS complement(5855..6334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 note possible pseudo, internal stop codon CDS complement(6336..7052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(7033..7464) product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948809.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene agaF CDS complement(7464..8297) product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369553.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene agaE CDS complement(8311..9078) product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387359.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene agaW CDS complement(9075..9551) product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098888.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene agaV misc_feature complement(9982..>10613) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098521.1:glycerate kinase locus_tag LOCUS_32590 sequence148 source 1..10550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 319..1338 product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125557.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene virB11 CDS 1495..1701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 2310..4169 product TraM recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602685.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 4179..4925 product MobC family replication-relaxation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909124.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene mobC CDS complement(5119..6066) product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155898.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 6611..8536 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047326435.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 8533..10200 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775114.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 sequence149 source 1..10526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 690..1502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 note possible pseudo, frameshifted CDS 1462..1788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 note possible pseudo, frameshifted CDS 1824..3260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 note possible pseudo, frameshifted CDS complement(3309..3707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045361668.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 3881..4243 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095603.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene yacL CDS 4725..5723 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784004.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 5770..6291 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 6291..7592 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(7661..8455) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095609.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene speD CDS complement(8499..9215) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829972.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene speE assembly_gap 8530..8538 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9367..9714) product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704423.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 sequence150 source 1..10361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 368..676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 note possible pseudo, frameshifted CDS 673..858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 779..3724 product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817193.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 3865..4305 product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103088.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene pagP assembly_gap 4173..4187 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4508..4717 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439184.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene cspE CDS complement(4923..5306) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939753.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene crcB CDS 5412..6200 product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704731.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 6327..6530 product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097596.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene tatE CDS complement(6618..7571) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097595.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene lipA CDS complement(7770..8201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 note possible pseudo, frameshifted CDS complement(8140..8409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32880 note possible pseudo, frameshifted CDS complement(8507..8770) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858718.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene ybeD CDS complement(8875..9978) product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092082.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene dacA assembly_gap 10083..10087 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10226..10360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 sequence151 source 1..10305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32920 note possible pseudo, frameshifted assembly_gap 193..235 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(632..1270) product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295278.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(1332..1577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(1940..3589) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789986.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene pgi CDS 3928..4119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 note possible pseudo, frameshifted CDS 4085..5107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 note possible pseudo, frameshifted assembly_gap 4983..5055 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5059..5205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 5396..6343 product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene panS CDS 6456..6728 product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207628.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(6730..7605) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095030.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene rluF CDS complement(7704..8021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(8021..8281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(8467..10065) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956822.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 sequence152 source 1..10229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 335..688 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 685..981 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212552.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(1004..1564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 note possible pseudo, frameshifted CDS complement(1599..2288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 note possible pseudo, frameshifted CDS 2420..3259 product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288348.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene alkA CDS complement(3241..6549) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420943.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 6889..7530 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500855.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene udk CDS 7620..8201 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234783.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 gene dcd CDS 8225..9967 product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252360.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene asmA sequence153 source 1..10187 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(342..2249) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097265.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(2256..2780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 assembly_gap 2823..2957 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3308..3544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(3656..4237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 note possible pseudo, frameshifted CDS 4350..5459 product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224084.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(5456..6001) product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097268.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 gene zapC CDS complement(6161..7171) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305914.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene pyrD CDS 7407..7982 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263931.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene ssuE CDS complement(8020..8307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 note possible pseudo, frameshifted misc_feature complement(8304..>10187) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704896.1:aminopeptidase N note possible pseudo, frameshifted locus_tag LOCUS_33230 sequence154 source 1..9967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 279..1067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 note possible pseudo, frameshifted CDS 1024..1869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 note possible pseudo, frameshifted CDS 1880..3172 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866776.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene purD CDS complement(3207..3908) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083923.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(3915..4187) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044509.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene hupA CDS complement(4374..4964) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704016.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(5009..5680) product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362359.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene nfi CDS complement(5695..6759) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137652.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene hemE CDS complement(6795..7490) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373941.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene nudC CDS 7672..8190 product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095013.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 sequence155 source 1..9933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(390..1253) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267498.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(1397..2110) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501631.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(2226..2513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 note possible pseudo, frameshifted CDS complement(2468..3205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 note possible pseudo, frameshifted CDS complement(3222..4100) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494019.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene dapA CDS 4246..4818 product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176187.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 4818..5288 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene bcp CDS complement(5339..6406) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098230.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 6624..7391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 assembly_gap 7325..7346 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7348..7962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 7974..8330 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365459.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene arsC CDS complement(8363..9040) product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 misc_feature complement(9162..>9933) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098238.1:uracil permease locus_tag LOCUS_33460 sequence156 source 1..9775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..788 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000081804.1:phage tail tape measure protein locus_tag LOCUS_33470 CDS 805..2313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 2419..2802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 3260..3439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119356.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 3701..3940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 note possible pseudo, frameshifted CDS 4015..4365 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096342.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 4365..5135 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211709.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 5148..5879 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096343.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 5867..6460 product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113183.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 6543..7157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 7222..8739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 note possible pseudo, frameshifted sequence157 source 1..9749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1431 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099398.1:low affinity potassium transporter Kup locus_tag LOCUS_33580 CDS 1600..3507 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099396.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene rbsA CDS 3510..4475 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368991.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene rbsC CDS 4502..5389 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368990.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene rbsB CDS 5444..6373 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420966.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene rbsK CDS 6377..7369 product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224487.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene rbsR CDS complement(7372..8739) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene mdtD CDS complement(8780..9475) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131144.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 sequence158 source 1..9694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(260..586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 note possible pseudo, frameshifted assembly_gap 277..286 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(583..1146) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438940.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene tag CDS 1326..2039 product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620076.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 2214..2630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 note possible pseudo, frameshifted CDS 2516..3373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 note possible pseudo, frameshifted CDS 3555..5213 product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269197.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene eptB tRNA 5303..5379 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 assembly_gap 5410..5415 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5705..7201 product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 7182..7667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(7648..9204) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038812.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(9269..9694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33750 sequence159 source 1..9579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 157..288 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 352..672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 662..1348 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704525.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(1375..2157) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209416.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene map CDS complement(2154..2402) product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079039.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 2748..2966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 3188..3667 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS complement(3705..4235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963497.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 4744..5709 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705307.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 6062..8416 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096775.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(8472..8771) product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703845.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 8915..9112 product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703844.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(9173..9346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 sequence160 source 1..9424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 229..486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 note possible pseudo, frameshifted assembly_gap 271..292 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 563..895 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 895..1404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 note possible pseudo, frameshifted assembly_gap 1277..1295 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1322..1510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 note possible pseudo, frameshifted CDS 1621..3507 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682145.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene htpG CDS 3680..4339 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809841.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene adk CDS 4470..5432 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250088.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene hemH CDS 5495..6646 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671594.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene gsk CDS 6610..6783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 note possible pseudo, frameshifted CDS complement(6857..8533) product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095902.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene ybaL misc_feature complement(8801..>9424) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095903.1:MFS transporter locus_tag LOCUS_33980 assembly_gap 8953..8999 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence161 source 1..9415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 212..370 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(395..1498) product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706301.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene nrfF CDS complement(1491..2585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 note possible pseudo, frameshifted assembly_gap 2619..2649 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2684..3286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(3299..4249) product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199631.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene nrfD CDS complement(4246..4413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 note possible pseudo, frameshifted CDS complement(4386..4919) product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278023.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene nrfC note possible pseudo, frameshifted CDS complement(4916..5482) product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115063.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene nrfB CDS complement(5528..6973) product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101783.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene nrfA CDS 7638..8468 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182015315.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 8470..9288 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704527.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 sequence162 source 1..9342 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 186..245 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(291..2981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 note possible pseudo, frameshifted CDS complement(2962..5244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 note possible pseudo, frameshifted CDS 5465..6310 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205251.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene sseA CDS complement(6340..7119) product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098290.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 gene sseB CDS complement(7352..8413) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098291.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene pepB note possible pseudo, internal stop codon CDS complement(8476..8676) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860650.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene iscX CDS complement(8690..9025) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124471.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 gene fdx CDS 9142..9318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 sequence163 source 1..9338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(109..585) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460251.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(588..2921) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460252.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS 3092..3784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 3882..5543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 5551..6252 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083022.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS 6262..7887 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 note possible pseudo, frameshifted CDS 7859..8170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 note possible pseudo, frameshifted CDS 8216..8557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 sequence164 source 1..9327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 687..2390 product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309642.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene narQ CDS 2426..3070 product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115500.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene narP CDS 3222..4604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 4598..6073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 6756..7112 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258247.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 7117..8244 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098221.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene dapE CDS 8268..8459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(8500..8949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 note possible pseudo, frameshifted CDS complement(8975..9163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34330 note possible pseudo, frameshifted sequence165 source 1..9320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..1133) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209587.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 tRNA complement(1445..1539) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 1831..2979 product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703825.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 note possible pseudo, frameshifted CDS 2957..3211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34360 note possible pseudo, frameshifted CDS 3215..5368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34370 assembly_gap 3634..3713 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5403..6317) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387201.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(6710..7639) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368963.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene fdhE CDS complement(7649..8230) product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368962.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene fdoI CDS complement(8227..8586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34410 assembly_gap 8658..8843 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence166 source 1..9275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(252..734) product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016606.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene xdhC CDS complement(731..1138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 note possible pseudo, frameshifted CDS complement(1290..1433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS complement(1576..2121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 note possible pseudo, internal stop codon CDS complement(2155..3783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34460 note possible pseudo, internal stop codon CDS 4230..4811 product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369803.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene actS tRNA 4891..4964 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 6055..6621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 assembly_gap 6560..6581 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6657..8639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 8713..9099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 9053..9232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 sequence167 source 1..9236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(414..2075) product DUF927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305743.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(2072..2686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 note possible pseudo, frameshifted CDS complement(2743..2949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(3017..3496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(3475..3651) product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480576.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(3726..4340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(4543..5787) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525821.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(5963..6826) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621352.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 6950..7666 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369149.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene rph CDS 7747..8388 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094889.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene pyrE misc_feature complement(8420..>9236) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001311223.1:nucleoid occlusion factor SlmA locus_tag LOCUS_34620 sequence168 source 1..9193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 47..898 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368199.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene panC CDS 1019..1387 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856284.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene panD CDS complement(1415..2662) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420882.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(2739..3170) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095618.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(3293..4027) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368203.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(4024..4767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 assembly_gap 4480..4501 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4875..5537 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651599.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 gene can CDS complement(5564..6112) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene hpt CDS 6379..8598 product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704425.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 assembly_gap 8766..8826 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence169 source 1..9148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 261..1733 product citrate/succinate antiporter CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050328.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene citT CDS 1888..2862 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS 2933..4375 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025997.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene norV CDS 4372..5505 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064713.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene norW assembly_gap 5650..5790 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6082..6294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 6501..6941 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083525.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene nikR CDS 7221..7835 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816728.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 assembly_gap 8246..8252 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence170 source 1..9115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(873..1976) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(2175..3119) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367784.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 3327..4268 product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209434.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 4281..4874 product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167399.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 4874..6388 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167401.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 6390..7490 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209437.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS 7578..8408 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209438.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 sequence171 source 1..9052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 389..733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096037.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(767..1045) product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719058.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS 1615..3012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 3301..4905 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418469.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(4827..5219) product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095071.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene soxS CDS 5303..5767 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412424.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene soxR CDS 6034..6702 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958574.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 7032..8378 product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095074.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene ghxP sequence172 source 1..8993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(1133..1393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34950 note possible pseudo, frameshifted CDS complement(1374..1973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34960 note possible pseudo, frameshifted CDS 2350..3345 product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704632.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene kdgT CDS complement(3413..4288) product diguanylate cyclase regulator RdcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882903.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS complement(4285..5415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 note possible pseudo, frameshifted CDS complement(5357..5902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35000 note possible pseudo, frameshifted CDS complement(5874..6602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35010 note possible pseudo, frameshifted CDS 7184..7519 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095115.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 sequence173 source 1..8961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..605 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096690.1:HlyD family type I secretion periplasmic adaptor subunit locus_tag LOCUS_35030 CDS complement(642..1124) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene smpB CDS 1276..1713 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242603.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 1703..1993 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117834.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS complement(2070..2414) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863121.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene bamE CDS complement(2635..4296) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098357.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene recN CDS complement(4329..5207) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059176.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene nadK CDS 5328..5918 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370253.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene grpE CDS complement(5963..7204) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028086.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(7310..8065) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537507.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 sequence174 source 1..8926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..1289) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095745.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene proB CDS 1582..2574 product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749863.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene phoE CDS complement(2645..3046) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174677.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene crl CDS complement(3104..4345) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189532.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene frsA CDS complement(4459..4917) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene gpt CDS 5175..5672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 note possible pseudo, frameshifted CDS 5708..6634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35190 note possible pseudo, frameshifted CDS complement(6670..7182) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(7207..8262) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene dinB CDS complement(8362..8925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 sequence175 source 1..8769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(289..459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35230 note possible pseudo, frameshifted CDS complement(531..1415) product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705524.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 gene yddG CDS complement(1483..2310) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705762.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 gene nadE CDS 2555..2902 product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039301.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 gene osmE CDS complement(2985..3647) product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387039.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(3644..5629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(5824..8073) product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019093.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene katE CDS 8241..8480 product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241561.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 gene cedA sequence176 source 1..8734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 107..442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35310 note possible pseudo, frameshifted CDS complement(551..871) product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685902.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(912..1592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35330 note possible pseudo, frameshifted CDS complement(1547..2275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35340 note possible pseudo, internal stop codon, frameshifted CDS complement(2387..3562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35350 note possible pseudo, frameshifted CDS complement(3504..5051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 note possible pseudo, frameshifted CDS complement(5084..5785) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098331.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene tapT CDS complement(5865..6284) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098330.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene trxC CDS 6489..7547 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098329.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(7586..8224) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262723.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 gene ung sequence177 source 1..8681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(19..675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(714..1121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35420 assembly_gap 1398..1413 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1683..1949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 2679..3548 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301664.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 4112..4411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(4448..5968) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703226.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(6216..6365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 6327..6872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 note possible pseudo, frameshifted CDS 6862..7932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 note possible pseudo, frameshifted CDS complement(7949..8338) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096638.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 sequence178 source 1..8593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 36..111 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(127..1038) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446236.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(1089..2345) product xanthosine/proton symporter XapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020402.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 gene xapB CDS complement(2401..2994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35530 note possible pseudo, frameshifted CDS 3395..3718 product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098192.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(3709..4650) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098193.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS 4737..4979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 note possible pseudo, frameshifted CDS 4900..5700 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765569.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 note possible pseudo, frameshifted CDS complement(5703..5924) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861328.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(5917..7944) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098195.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 gene ligA CDS complement(8014..8262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35600 assembly_gap 8308..8409 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence179 source 1..8542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..564 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_120727113.1:multidrug efflux MATE transporter EmmdR note possible pseudo, frameshifted locus_tag LOCUS_35610 CDS 545..1312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 note possible pseudo, frameshifted CDS complement(1275..2105) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703270.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(2098..2958) product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370015.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene sitC CDS complement(2955..3755) product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385381.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(3752..4666) product iron/manganese ABC transporter substrate-binding protein SitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949004.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene sitA assembly_gap 5449..5534 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5802..6278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160202.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 6492..6749 product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288812.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 6750..7082 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373724.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 8146..8526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 sequence180 source 1..8481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1796..2695) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097441.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 2833..3498 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420897.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 gene fsa CDS complement(3531..3659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(3842..4387) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704162.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene orn CDS 4498..5550 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene rsgA CDS 5651..6622 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095278.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene asd sequence181 source 1..8383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(64..1047) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915326.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene thiB CDS complement(1215..1580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35780 note possible pseudo, frameshifted CDS complement(1549..2862) product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139028.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene sgrR note possible pseudo, frameshifted CDS 3165..4517 product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095558.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS complement(4715..5005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35810 note possible pseudo, frameshifted assembly_gap 4803..4829 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5017..6417) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095560.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene leuC CDS complement(6420..7511) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095561.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene leuB misc_feature complement(7511..>8383) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095562.1:2-isopropylmalate synthase locus_tag LOCUS_35840 sequence182 source 1..8296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088985.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(763..1074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS 1284..2210 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319943.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene pbpG CDS complement(2211..2765) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097939.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(2872..3924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35890 assembly_gap 3999..4124 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4663..6960 product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871488.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene bglX CDS 7106..8014 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097936.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 sequence183 source 1..8200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..593 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767194.1:L-fucose/L-arabinose isomerase family protein note possible pseudo, frameshifted locus_tag LOCUS_35920 CDS 568..900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35930 note possible pseudo, frameshifted CDS 1099..2133 product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063537.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene rhaT CDS complement(2164..2763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 note possible pseudo, frameshifted CDS complement(2768..3001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35960 note possible pseudo, frameshifted CDS complement(3138..3974) product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099335.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene rhaS CDS 4395..5708 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144073.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene rhaB CDS 5705..6964 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301857.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene rhaA CDS 7023..7307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36000 note possible pseudo, frameshifted CDS 7271..7813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 note possible pseudo, frameshifted sequence184 source 1..8132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(344..871) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278878.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene cobO note possible pseudo, frameshifted CDS complement(868..1629) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559310.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 1879..2928 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422053.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene sohB CDS complement(2965..3216) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856804.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(3173..3445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 3616..5430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36070 note possible pseudo, internal stop codon CDS 5440..6081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 note possible pseudo, internal stop codon, frameshifted CDS 6271..7233 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175683.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene cysB assembly_gap 7418..7468 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7522..7683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 sequence185 source 1..8072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1851..2744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(2735..3283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 3913..4686 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543582.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene dapB CDS 5154..6302 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298633.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene carA assembly_gap 6858..7017 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence186 source 1..7987 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(721..1896) product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene rhmD CDS complement(1910..2692) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894172.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS complement(2891..4090) product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098022.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(4184..4690) product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300392.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 5000..6673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 6754..7179 product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249902.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene nudI misc_feature complement(7181..>7987) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098091.1:o-succinylbenzoate--CoA ligase locus_tag LOCUS_36210 sequence187 source 1..7970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 247..275 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2634..3839) product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703474.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(3854..5125) product oligosaccharide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369698.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 5367..6233 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369696.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(6306..7694) product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019848.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene narK sequence188 source 1..7927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..541 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703307.1:GTP diphosphokinase locus_tag LOCUS_36260 CDS 634..1320 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703306.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene mazG note possible pseudo, frameshifted CDS 1619..3256 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703305.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene pyrG CDS 3339..4637 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036734.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 gene eno CDS complement(4700..5221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 note possible pseudo, frameshifted CDS complement(5248..6024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 note possible pseudo, frameshifted CDS 6325..6996 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098510.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene queE CDS complement(7044..7406) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001329795.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene queD sequence189 source 1..7851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(554..1105) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367908.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene apt CDS complement(1258..1635) product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095896.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 1701..2228 product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704614.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene priC CDS 2245..2403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(2446..2784) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene glnB CDS complement(2879..4216) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298983.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene glrR CDS complement(4283..4903) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098305.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene qseG CDS complement(4969..6357) product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420402.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene qseE misc_feature complement(6938..>7851) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000970035.1:phosphoribosylformylglycinamidine synthase locus_tag LOCUS_36420 sequence190 source 1..7824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..877 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095635.1:ATP-dependent helicase HrpB locus_tag LOCUS_36430 CDS 972..3104 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918132.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene mrcB note possible pseudo, internal stop codon CDS 3105..3491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 note possible pseudo, internal stop codon CDS 3758..4837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 note possible pseudo, internal stop codon CDS 4862..5671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 note possible pseudo, internal stop codon CDS 5687..5968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36480 note possible pseudo, internal stop codon CDS 6016..6747 product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158929.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene fhuC CDS 6761..7216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36500 note possible pseudo, frameshifted sequence191 source 1..7811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1249 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704325.1:energy-dependent translational throttle protein EttA locus_tag LOCUS_36510 CDS complement(1280..2194) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095499.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 2310..3311 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095498.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(3356..4942) product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703560.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 gene lsrK CDS complement(4986..5309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(5306..5818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 6037..7233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 assembly_gap 7068..7171 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7184..7468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 sequence192 source 1..7790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 431..1990 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861179.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 1994..2746 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925505.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 2731..3675 product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361636.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(3672..4691) product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169835.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene malI CDS 5140..5559 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202900.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 gene psiE CDS complement(5653..6543) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368774.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene malG CDS complement(6555..7511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 note possible pseudo, frameshifted sequence193 source 1..7784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1572..2411 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266520.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(2414..3223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(3213..3485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(3507..4793) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209057.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 5044..6003 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209056.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(6049..6660) product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198752.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(6786..7583) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383134.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 sequence194 source 1..7781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..808 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001041008.1:DNA-binding transcriptional regulator YhaJ locus_tag LOCUS_36730 CDS complement(836..1201) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369567.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(1331..2317) product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531180.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene yqjG CDS complement(2385..2777) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603618.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(2974..3264) product YqjK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095496.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(3261..3659) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS complement(3661..3963) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031219.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(3997..4365) product DUF1090 family protein YqjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298323.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene yqjC CDS complement(4510..4887) product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703569.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene mzrA CDS complement(4892..5554) product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422149.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene yqjA CDS complement(5876..6655) product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098862.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene exuR misc_feature complement(6781..>7781) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703568.1:hexuronate transporter ExuT locus_tag LOCUS_36840 sequence195 source 1..7737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 400..528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 954..1526 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096226.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene pth CDS 1665..2756 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene ychF CDS complement(2811..3155) product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808895.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene yajD CDS 3308..3553 product YmjA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015110.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS complement(3643..4026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36900 note possible pseudo, frameshifted CDS complement(4023..4388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36910 note possible pseudo, frameshifted CDS 4574..6958 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965926.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 misc_feature complement(6955..>7737) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094912.1:MFS transporter locus_tag LOCUS_36930 sequence196 source 1..7735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(178..660) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301248.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 note possible pseudo, frameshifted CDS complement(723..1301) product tellurium resistance membrane protein TerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116677.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene terD CDS complement(1350..2393) product tellurium resistance membrane protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255079.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene terC CDS complement(2416..2871) product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007449.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(2894..4033) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054789.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(4030..4617) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254140.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 4944..6020 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035169.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 6013..7035 product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285478.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 sequence197 source 1..7711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(139..1491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37020 note possible pseudo, frameshifted assembly_gap 174..181 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1475..1798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37030 note possible pseudo, frameshifted CDS 1994..3328 product adenine permease AdeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001513042.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene adeQ CDS complement(3411..3671) product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367588.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene ybiJ CDS complement(4076..4336) product DUF1471 family periplasmic protein McbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710619.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene mcbA CDS 4715..5476 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275941.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 gene rlmF note possible pseudo, frameshifted CDS complement(5631..7445) product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097466.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 gene ybiO note possible pseudo, frameshifted assembly_gap 7455..7549 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence198 source 1..7666 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 411..453 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(654..1340) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367886.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 1278..1937 product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene tesA CDS 1966..2736 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095912.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 2796..2984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37120 note possible pseudo, frameshifted CDS 2935..3660 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095911.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 note possible pseudo, frameshifted CDS 3916..4722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 5259..6173 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906145.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 6170..6595 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561177.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS complement(6641..7057) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095907.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 gene cueR assembly_gap 7399..7534 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence199 source 1..7616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 862..1512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37190 note possible pseudo, frameshifted CDS 1460..1849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 note possible pseudo, frameshifted CDS 1868..2170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37210 note possible pseudo, frameshifted assembly_gap 2557..2621 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2663..3010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 note possible pseudo, frameshifted assembly_gap 2944..2955 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3216..3350) product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705564.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS complement(3350..4360) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151052.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 gene cydB CDS complement(4360..5763) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393706.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS complement(6121..6723) product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705291.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene dmsD CDS complement(6733..7596) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247794.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 sequence200 source 1..7603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001214346.1:NapC/NirT family cytochrome c locus_tag LOCUS_37280 CDS 587..2413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37290 note possible pseudo, frameshifted CDS 2298..2885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 note possible pseudo, internal stop codon, frameshifted CDS 2904..3035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 note possible pseudo, internal stop codon CDS complement(3080..3469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37320 note possible pseudo, frameshifted CDS complement(3796..4233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 note possible pseudo, frameshifted CDS 4439..4678 product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377230.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(4709..5206) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365960.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene ftnA CDS complement(5446..5790) product YecR-like lipofamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803230.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 6011..6649 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096040.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 misc_feature complement(6685..>7603) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705969.1:MFS transporter locus_tag LOCUS_37380 sequence201 source 1..7600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 231..1013 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097114.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 1319..2296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37400 note possible pseudo, frameshifted CDS 2211..2732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 note possible pseudo, frameshifted CDS complement(2849..3799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37420 note possible pseudo, frameshifted CDS complement(3799..4992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37430 note possible pseudo, frameshifted CDS 5404..6453 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS 6640..6999 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097111.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene hinT CDS 7001..7375 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225291.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 sequence202 source 1..7524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..568 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557877.1:ADP-ribosylglycohydrolase family protein locus_tag LOCUS_37470 CDS 604..1326 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764005.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 1411..1860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37490 note possible pseudo, frameshifted CDS 1860..2654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37500 note possible pseudo, frameshifted CDS complement(2699..3466) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862019.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene tpiA CDS complement(3574..4173) product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369137.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS 4284..4703 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155257.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(4705..5451) product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796330.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene fpr CDS complement(5545..6561) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250644.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene glpX CDS complement(6677..6997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 misc_feature complement(6888..>7524) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000137244.1:glycerol kinase GlpK locus_tag LOCUS_37570 assembly_gap 7124..7145 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence203 source 1..7514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(905..1822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37580 note possible pseudo, frameshifted CDS complement(1844..2527) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211998.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS complement(2570..3010) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176232.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(3543..4595) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129551.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene fbaB CDS 4838..6115 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 6112..7110 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097909.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 sequence204 source 1..7502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..591 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096416.1:ABC transporter ATP-binding protein locus_tag LOCUS_37640 CDS complement(588..1361) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095552.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(1485..2336) product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095551.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 gene araC CDS 2676..4154 product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095550.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene araB note possible pseudo, frameshifted CDS 4147..4347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37680 note possible pseudo, frameshifted CDS 4358..5803 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151734.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene araA CDS 5863..6558 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888666.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene araD CDS 6641..7312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 note possible pseudo, frameshifted sequence205 source 1..7429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 456..1124 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617139.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene narI CDS complement(1144..1707) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046824.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene smrA CDS complement(1980..2159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 2239..2754 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096864.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene ogt CDS 2922..3674 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene fnr CDS 3812..4762 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096866.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene uspE CDS 4888..5910 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075361.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(5975..6898) product OmpG family monomeric porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419574.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 sequence206 source 1..7393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 315..1457 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 1644..2267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 2150..2836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 2806..3615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS 3637..5508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(5547..6194) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651594.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 assembly_gap 6195..6212 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6351..6779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37860 note possible pseudo, internal stop codon, frameshifted CDS 6901..7206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37870 note possible pseudo, frameshifted sequence207 source 1..7360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(242..928) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974074.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(941..1618) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383131.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS complement(1633..2541) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS complement(2541..2906) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525805.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene rpiB CDS complement(2930..3673) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525813.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 4362..4655 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110456.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS 4877..5140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 5317..5610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37950 note possible pseudo, frameshifted CDS 5988..6215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 6184..6486 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 6675..7352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 note possible pseudo, frameshifted sequence208 source 1..7183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1480 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000467180.1:cytochrome o ubiquinol oxidase subunit I locus_tag LOCUS_37990 CDS 1470..2090 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS 2090..2419 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 2431..3318 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095848.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene cyoE CDS 3458..4825 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216662111.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(4852..5343) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503327.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS 5457..6371 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705865.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene panE CDS 6331..6921 product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367984.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene yajL sequence209 source 1..7118 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(710..1639) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208528.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene ilvE CDS complement(1656..1925) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368897.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 gene ilvM CDS complement(1922..3487) product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703962.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene ilvG CDS 4142..5662 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058957.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS complement(5688..6026) product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 gene maoP CDS 6146..6967 product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379246.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene hdfR sequence210 source 1..6959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 577..822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705919.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS 833..961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 1355..1552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS 1619..1864 product excisionase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065276.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS 1910..2734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 note possible pseudo, frameshifted CDS 2757..3167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38180 note possible pseudo, frameshifted CDS complement(3203..3514) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097729.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene fliE CDS 3676..5343 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097730.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 gene fliF CDS 5340..6335 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500327.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 gene fliG sequence211 source 1..6813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(154..1173) product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938843.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 gene dppB CDS complement(1392..1877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38230 note possible pseudo, frameshifted CDS complement(1897..2865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 note possible pseudo, frameshifted CDS 3622..4356 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470719.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 note possible pseudo, internal stop codon, frameshifted CDS complement(4494..5324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 5564..6223 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194414.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 sequence212 source 1..6754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1115..1636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38280 note possible pseudo, frameshifted CDS complement(1590..2081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38290 note possible pseudo, frameshifted CDS complement(2078..3151) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239803.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene ftsW CDS complement(3069..3248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(3248..4564) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796441.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 gene murD CDS complement(4567..5577) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964131.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 gene mraY CDS complement(5571..6044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 note possible pseudo, frameshifted misc_feature complement(5999..>6754) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000626688.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase note possible pseudo, frameshifted locus_tag LOCUS_38350 sequence213 source 1..6749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(7..82) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(222..1676) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428186.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 2073..3188 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366474.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS 3284..4198 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705514.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 4209..5531 product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705513.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 gene livM CDS 5467..6321 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366477.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 sequence214 source 1..6692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(288..1196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38410 note possible pseudo, frameshifted CDS complement(1210..2817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38420 note possible pseudo, frameshifted CDS complement(2814..4130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38430 note possible pseudo, frameshifted CDS 4334..4939 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096706.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene azoR CDS complement(4997..5326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(5405..5617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38460 misc_feature complement(5614..>6692) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096772.1:YdbH family protein locus_tag LOCUS_38470 sequence215 source 1..6684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(37..354) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704005.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(357..617) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704006.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 857..2182 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene celB CDS 2197..3255 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726689.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 note possible pseudo, frameshifted CDS 3252..3500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38520 note possible pseudo, frameshifted CDS complement(3477..4220) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476241.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 4308..5453 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209877.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(5486..6613) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847432.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene thiH sequence216 source 1..6676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 275..348 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(374..1159) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096087.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene znuB CDS complement(1156..1911) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832401.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene znuC CDS 2050..2934 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001376899.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene znuA CDS 2950..4125 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184019.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene mepM note possible pseudo, frameshifted CDS 4013..4216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38600 note possible pseudo, frameshifted CDS 4342..5316 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032705956.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene lpxM CDS complement(5431..5694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 misc_feature complement(6080..>6676) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096092.1:pyruvate kinase locus_tag LOCUS_38630 sequence217 source 1..6650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(259..1395) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047447.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS complement(1729..2805) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096471.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 note possible pseudo, frameshifted assembly_gap 2858..2987 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3364..3768 product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704153.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(3801..5018) product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090144.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(5022..5870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38680 note possible pseudo, frameshifted CDS complement(5831..6286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38690 note possible pseudo, frameshifted sequence218 source 1..6634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 300..442 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(580..1128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS complement(1222..2004) product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737621.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene hisJ CDS complement(2279..3034) product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098132.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene argT CDS complement(3307..3549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38730 note possible pseudo, frameshifted CDS complement(3564..3827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38740 note possible pseudo, frameshifted assembly_gap 3580..3585 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3979..4284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(4248..5417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 assembly_gap 4286..4296 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5456..5941) product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene cvpA sequence219 source 1..6584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1338..2321) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367044.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 gene pheS CDS complement(2614..2970) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene rplT CDS complement(3018..3215) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene rpmI CDS complement(3303..3737) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene infC CDS complement(3849..5699) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144226.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 gene thrS sequence220 source 1..6553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(260..781) product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132914.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(816..1862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 note possible pseudo, frameshifted CDS complement(1828..2766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38850 note possible pseudo, frameshifted CDS 3069..4415 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529494.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS 4426..4617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 4608..5000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS 5050..5958 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969842.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 6007..6252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38900 note possible pseudo, frameshifted sequence221 source 1..6514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(629..2149) product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493127.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 gene nikA CDS 2556..2900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 note possible pseudo, internal stop codon CDS 2901..3698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38930 note possible pseudo, internal stop codon CDS 3831..4019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS 4016..4300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(4315..4935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(4981..5502) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096965.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(5515..6192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38980 note possible pseudo, internal stop codon, frameshifted sequence222 source 1..6457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 note possible pseudo, frameshifted CDS complement(281..1822) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260716.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 gene proS CDS complement(1929..2636) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095676.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 gene tsaA CDS complement(2633..3037) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202315.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene rcsF CDS complement(3153..3968) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene metQ CDS complement(4001..4654) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS complement(4647..5678) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095679.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene metN CDS 5868..6014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39060 note possible pseudo, frameshifted sequence223 source 1..6420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 97..447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 note possible pseudo, frameshifted CDS 450..1493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 note possible pseudo, frameshifted CDS 1465..2424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39090 note possible pseudo, frameshifted CDS 2421..3380 product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096060.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 3479..5026 product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096061.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene tar CDS complement(5023..6222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39120 sequence224 source 1..6417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 56..835 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 assembly_gap 207..270 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 828..1301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 note possible pseudo, frameshifted CDS 1319..1546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 note possible pseudo, frameshifted CDS 1663..2730 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524498.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 2745..3230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 3227..4279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 4758..6287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39190 note possible pseudo, frameshifted assembly_gap 6060..6181 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence225 source 1..6393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..573 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877056.1:ornithine carbamoyltransferase locus_tag LOCUS_39200 CDS 662..2098 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS 2151..3002 product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963698.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS 3126..4052 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100033.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene arcC CDS 4179..5564 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(5610..6044) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096423.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 gene tpx sequence226 source 1..6258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 155..604 product beta-galactosidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004900777.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 727..2160 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369594.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 2198..3202 product protein YgjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703555.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 gene ygjJ CDS 3278..5629 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703556.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene ygjK CDS complement(5669..5929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 note possible pseudo, frameshifted sequence227 source 1..6238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(19..633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(888..1166) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132230.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 1372..1674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS 1980..2141 product host cell division inhibitory peptide Kil inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098077.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 gene kil CDS 2075..2242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 2239..2421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS 2430..3167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 3168..3581 product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168305.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 gene ssb1 CDS 3709..3930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 3941..4105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 4102..4602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 4599..4874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 4871..5566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 5572..5877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098055.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 sequence228 source 1..6221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 158..244 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 282..1286 product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081721.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 gene hybA CDS 1279..2454 product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017694.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 gene hybB CDS 2451..4151 product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817177.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 gene hybC CDS 4151..4648 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173947.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS 4633..5121 product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173946.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene hybE CDS 5145..5393 product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817175.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 gene hybG CDS complement(5452..5733) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171826.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 gene ilvN sequence229 source 1..6214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1117..2268) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797087.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene flhB CDS 2871..3854 product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816705.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 3961..5442 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081001.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 5435..5896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39560 note possible pseudo, internal stop codon, frameshifted sequence230 source 1..6176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..571 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001116587.1:thiamine kinase note possible pseudo, internal stop codon locus_tag LOCUS_39570 CDS 647..1276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39580 note possible pseudo, frameshifted CDS 1318..1644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39590 note possible pseudo, frameshifted CDS 1678..2220 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367178.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene ycfP CDS 2444..3748 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097105.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS 3941..4480 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043459.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS complement(4560..4709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS complement(5067..5783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39640 note possible pseudo, frameshifted assembly_gap 5878..5896 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence231 source 1..6138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(524..1312) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS complement(1323..2210) product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 gene ntrB CDS complement(2207..3469) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705089.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(3694..4710) product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096246.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 gene nasR assembly_gap 4355..4371 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4795..5133 product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705087.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 5458..5694 product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705086.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 sequence232 source 1..6130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(490..711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39710 note possible pseudo, frameshifted CDS 953..2008 product alkaline phosphatase isozyme conversion aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490413.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 gene iap CDS complement(2070..2222) product Hok/Gef family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956460.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS complement(2483..3217) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098507.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene cysH CDS complement(3238..4554) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420501.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 gene cysI CDS complement(4637..4864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(4864..5643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39770 note possible pseudo, frameshifted assembly_gap 5793..5803 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence233 source 1..6122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 254..994 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948872.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene sufC CDS 969..1547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 note possible pseudo, frameshifted CDS 1658..2206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 note possible pseudo, frameshifted CDS 2203..3279 product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705131.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 gene sufS assembly_gap 3193..3208 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3357..3590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39820 note possible pseudo, frameshifted CDS 3577..3771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39830 note possible pseudo, frameshifted CDS 3872..4921 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165628.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(4986..5222) product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082307.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 gene lpp misc_feature complement(5530..>6122) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705134.1:pyruvate kinase PykF locus_tag LOCUS_39860 sequence234 source 1..6090 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 699..1877 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706175.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 gene pdxB assembly_gap 1137..1188 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1945..2958 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098141.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 2958..3770 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098140.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene truA CDS 3795..4454 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365553.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 4626..5546 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118383.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 gene accD assembly_gap 5718..5854 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence235 source 1..6068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 300..420 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(725..2218) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098744.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 gene tolC CDS 2576..3064 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098743.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene nudF CDS 3067..3495 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862516.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 3520..4347 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098742.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene cpdA CDS 4347..4922 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 gene yqiA sequence236 source 1..5986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 384..818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(815..1939) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211386.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 gene sstT assembly_gap 1434..1479 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2317..3285) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703564.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(3458..3814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40000 note possible pseudo, frameshifted CDS complement(3744..4412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40010 note possible pseudo, frameshifted CDS complement(4485..4985) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026744.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 sequence237 source 1..5872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 221..359 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 692..1960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 2044..2508 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209795.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 2856..3572 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096995.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS 3637..5082 product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175719.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 gene selO CDS complement(5083..5346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40070 note possible pseudo, frameshifted CDS complement(5304..5810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40080 note possible pseudo, frameshifted sequence238 source 1..5814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2287..2703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(2731..3408) product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367692.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 gene kdpE CDS complement(3405..5390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40110 note possible pseudo, frameshifted sequence239 source 1..5787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..1405) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884372.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 gene cydA note possible pseudo, frameshifted CDS complement(1420..1758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40130 note possible pseudo, frameshifted CDS complement(2423..3289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40140 note possible pseudo, frameshifted CDS complement(3286..4902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40150 note possible pseudo, frameshifted misc_feature complement(4915..>5787) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097538.1:PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC locus_tag LOCUS_40160 sequence240 source 1..5771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..1283) product peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583298.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 gene sapB CDS complement(1280..2893) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250215.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 gene sapA CDS complement(3011..3991) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298101.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene pspF CDS 4167..4835 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511000.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene pspA CDS 4892..5116 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274964.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 gene pspB CDS 5116..5475 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096405.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 gene pspC CDS 5494..5679 product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295585.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 gene pspD sequence241 source 1..5763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1435..2694) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267749.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(2841..3755) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104205.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS 4032..4319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 4477..4689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(4748..4996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40280 sequence242 source 1..5731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 244..377 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(833..1348) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098293.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 gene hscB CDS complement(1494..1817) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540868.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 gene iscA CDS complement(1842..2228) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703172.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 gene iscU CDS complement(2257..3471) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 gene iscS CDS complement(3590..4078) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098294.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 gene iscR CDS complement(4205..4948) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370313.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene trmJ sequence243 source 1..5688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..1270 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097611.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS complement(1273..2187) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097608.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS complement(2303..3061) product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597117.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene dsbG CDS 3402..3965 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859485.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 gene ahpC CDS 4098..5666 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314555.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene ahpF sequence244 source 1..5673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 732..1562 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS complement(1577..2356) product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097602.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 gene rna CDS complement(2450..3823) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958619.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 gene dcuC CDS 4247..4651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817189.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS 4718..5053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40440 assembly_gap 5381..5449 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence245 source 1..5660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(389..1168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40450 note possible pseudo, frameshifted CDS 1767..2516 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099384.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS complement(2537..3160) product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368980.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 gene dsbA CDS complement(3187..4125) product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065519.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 gene srkA CDS complement(4249..4518) product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS 4587..5159 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052181.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 gene mobA CDS 5368..5601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40510 note possible pseudo, frameshifted sequence246 source 1..5619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(617..904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40520 note possible pseudo, frameshifted CDS complement(922..1305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40530 note possible pseudo, frameshifted CDS 1826..2065 product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296623.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene zapB CDS 2230..3252 product lipoprotein NlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779426.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene nlpA CDS 3150..3398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS complement(3671..4600) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139635.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 gene menA misc_feature complement(4773..>5619) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099313.1:HslU--HslV peptidase ATPase subunit locus_tag LOCUS_40580 sequence247 source 1..5505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..909 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000402206.1:Na+/H+ antiporter locus_tag LOCUS_40590 CDS complement(913..1806) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095076.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS complement(1937..3247) product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463069.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS complement(3273..4541) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 misc_feature complement(4911..>5505) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095079.1:cation/acetate symporter ActP locus_tag LOCUS_40630 sequence248 source 1..5397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1625..1912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40640 note possible pseudo, frameshifted CDS 1890..2201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40650 note possible pseudo, frameshifted CDS 2249..2827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40660 note possible pseudo, frameshifted CDS 2767..3015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40670 note possible pseudo, frameshifted CDS complement(2986..3723) product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095729.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 gene dpaA sequence249 source 1..5349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1449..2090) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145971.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 gene rlmE CDS 2234..2527 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene yhbY CDS complement(2889..3218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40710 note possible pseudo, frameshifted CDS 3506..4855 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420697.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 gene dacB misc_feature complement(4839..>5349) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000673554.1:Obg family GTPase CgtA locus_tag LOCUS_40730 sequence250 source 1..5344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..695 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001364217.1:glutamate synthase large subunit note possible pseudo, frameshifted locus_tag LOCUS_40740 CDS 695..3577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40750 note possible pseudo, frameshifted CDS 3625..3864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40760 note possible pseudo, frameshifted CDS 3839..4969 product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081705.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 gene gltD sequence251 source 1..5334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 220..254 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2192..2869) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096968.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS complement(2925..3365) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419182.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 3796..4458 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096970.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS 4541..5173 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703599.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 sequence252 source 1..5246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(531..1463) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096711.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS 1563..1997 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096712.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS 2007..2495 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206857.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 2710..2982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 2986..3261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS complement(3322..4248) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972039.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 gene gcvA CDS 4349..4978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 note possible pseudo, frameshifted sequence253 source 1..5136 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(52..792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS 1143..1661 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097260.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 gene fabA CDS complement(1725..1892) product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704906.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 gene rmf CDS complement(2146..2712) product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367436.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 gene pqiC CDS complement(2709..2999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 note possible pseudo, frameshifted CDS complement(2975..4354) product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097263.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 gene pqiB note possible pseudo, frameshifted CDS complement(4341..4592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 note possible pseudo, frameshifted CDS complement(4576..5136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40960 note possible pseudo, frameshifted sequence254 source 1..5131 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 206..625 product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS 695..1777 product hydroxycarboxylate dehydrogenase HcXB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443495.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 gene hcxB CDS complement(1827..2675) product 5-methylcytosine-specific endonuclease McrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557907.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 gene mcrA CDS complement(2741..3325) product tetrathionate respiration response regulator TtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190927.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 gene ttrR CDS complement(3325..4833) product tetrathionate respiration histidine kinase TtrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816070.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 gene ttrS sequence255 source 1..5063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 241..380 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 419..2191 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705958.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 gene aspS CDS 2193..2636 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620451.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 gene nudB CDS 2664..3404 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096082.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 3435..3956 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295503.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 gene ruvC CDS 4067..4678 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580323.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 gene ruvA CDS 4687..5031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41070 assembly_gap 4897..4905 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence256 source 1..5051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1014..1484) product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091016.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 gene mntR CDS 2106..3059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41090 note possible pseudo, frameshifted CDS 2996..3670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41100 note possible pseudo, frameshifted CDS complement(3734..4123) product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704823.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 gene ompX sequence257 source 1..4963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 258..638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41120 note possible pseudo, frameshifted CDS complement(673..1005) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369597.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS 1227..2210 product transcriptional regulator EbgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009485173.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 gene ebgR CDS 2374..2898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41150 note possible pseudo, frameshifted assembly_gap 3437..3549 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4635..4639 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence258 source 1..4938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 185..338 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(693..2003) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893648.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 gene phoR CDS complement(2027..2716) product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428026.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene phoB CDS 2851..4119 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095823.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 gene sbcD sequence259 source 1..4920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..623 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369639.1:bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE locus_tag LOCUS_41190 CDS complement(657..1001) product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098757.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 gene ubiK CDS 1419..2072 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076993.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 gene ribB CDS complement(2135..2578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41220 assembly_gap 2635..2708 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2950..3738 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098747.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 gene ygiD CDS complement(3772..4752) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442833.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 sequence260 source 1..4817 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..967 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097505.1:histidine ammonia-lyase locus_tag LOCUS_41250 CDS complement(998..1252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41260 note possible pseudo, frameshifted CDS complement(1525..2814) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123603.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 gene bioA assembly_gap 3350..3403 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3407..3769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41280 assembly_gap 4040..4132 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4455..4608 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence261 source 1..4814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..1426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41290 note possible pseudo, frameshifted CDS 1763..2596 product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620693.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 gene ppsR CDS 2751..3881 product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419178.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 gene aroH CDS 4003..4212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 assembly_gap 4145..4157 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4485..4620 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence262 source 1..4813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..735 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705065.1:NADP-dependent isocitrate dehydrogenase locus_tag LOCUS_41330 CDS complement(786..974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS 1136..1381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS complement(1544..1783) product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096351.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS 2202..2441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS 2628..2897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS complement(2948..3298) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097067.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS 3554..4261 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097066.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS complement(4263..4598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41410 note possible pseudo, frameshifted sequence263 source 1..4761 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1087 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096469.1:cytochrome ubiquinol oxidase subunit I locus_tag LOCUS_41420 CDS 1084..1734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41430 note possible pseudo, frameshifted CDS 1628..2068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41440 note possible pseudo, frameshifted CDS 2068..2199 product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096467.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS complement(2394..3632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460 sequence264 source 1..4708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 640..912 product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097042.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS complement(872..1285) product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781888.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 gene nudG CDS complement(1305..2111) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673924.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene xthA CDS 2533..3330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 3338..3613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS 3610..4194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41520 note possible pseudo, frameshifted assembly_gap 4392..4492 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence265 source 1..4692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(892..2004) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420700.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene lptF CDS 2273..3784 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098951.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 gene pepA assembly_gap 4302..4444 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence266 source 1..4675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 295..459 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(711..1463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41550 note possible pseudo, frameshifted CDS complement(1549..2718) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582864.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(2721..3005) product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS complement(3198..3332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS 3399..4481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41590 assembly_gap 4365..4465 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4502..4654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41600 sequence267 source 1..4615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41610 note possible pseudo, frameshifted CDS complement(854..2161) product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095047.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS complement(2250..2930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41630 note possible pseudo, frameshifted CDS complement(2878..3342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41640 note possible pseudo, frameshifted sequence268 source 1..4526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 805..1329 product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095816.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 gene aroL CDS 1376..1567 product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095817.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 gene yaiA CDS 1824..2429 product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276434.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS 2615..2899 product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941953.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 gene ppnP CDS complement(2932..3882) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964305.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 gene rdgC sequence269 source 1..4500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 308..1897 product hydrogenase 4 catalytic subunit HyfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102329.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene hyfG assembly_gap 522..585 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1908..2459 product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816732.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 gene hyfH CDS 2456..3238 product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298699.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS 3231..3647 product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816734.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS 3644..4141 product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816735.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 gene hycI sequence270 source 1..4398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(795..1253) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209402.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 gene rpiB CDS 1656..3038 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201828.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 sequence271 source 1..4383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2068..2952) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098912.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 gene nlpI CDS complement(3069..3887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41780 assembly_gap 3916..4024 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence272 source 1..4381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(570..1187) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095518.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 gene satP CDS 1828..2931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 3098..3751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41810 sequence273 source 1..4367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(189..737) product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097026.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 gene ves CDS complement(1021..1512) product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228991.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 gene spy CDS complement(1862..2824) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097028.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 gene astE CDS complement(2834..4018) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097029.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 gene astB assembly_gap 4113..4193 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence274 source 1..4357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(454..1107) product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002283.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 gene phnJ note possible pseudo, frameshifted CDS complement(1040..1276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41870 note possible pseudo, frameshifted CDS complement(1269..1646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41880 note possible pseudo, frameshifted CDS complement(1592..2017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41890 note possible pseudo, frameshifted assembly_gap 2041..2100 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2276..2860) product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095108.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 gene phnH CDS complement(2857..3297) product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368696.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 gene phnG CDS complement(3297..3884) product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309142.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 gene phnF note possible pseudo, frameshifted sequence275 source 1..4332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(330..515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41930 note possible pseudo, frameshifted CDS complement(529..774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS complement(868..1083) product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366849.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 gene ydgT CDS 1656..2177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41960 note possible pseudo, frameshifted CDS 2120..2485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41970 note possible pseudo, frameshifted CDS 2467..2688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41980 note possible pseudo, frameshifted CDS complement(2731..3732) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565566.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 gene add sequence276 source 1..4318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 745..1365 product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861999.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 gene sodA CDS 1435..2124 product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703947.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 gene yiiM CDS 2205..3041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 note possible pseudo, frameshifted CDS 3013..3591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42030 note possible pseudo, frameshifted misc_feature complement(3625..>4318) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369183.1:FMN-dependent L-lactate dehydrogenase LldD locus_tag LOCUS_42040 assembly_gap 4013..4058 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence277 source 1..4317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 50..385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42050 note possible pseudo, frameshifted CDS 382..597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42060 note possible pseudo, frameshifted CDS complement(614..1849) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098762.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS complement(1946..2566) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369636.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS 2811..4247 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046301.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 gene ygiF assembly_gap 4006..4142 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence278 source 1..4298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 195..256 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 415..1953 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192512.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS complement(1954..2187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42110 note possible pseudo, frameshifted CDS complement(2121..3443) product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394983.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 gene yoaE note possible pseudo, frameshifted sequence279 source 1..4233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(997..1848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42130 note possible pseudo, frameshifted CDS 2305..3012 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812168.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS complement(3056..3811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42150 note possible pseudo, frameshifted assembly_gap 3932..4035 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence280 source 1..4221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 713..952 product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096351.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS 952..1224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(1481..1903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS complement(2101..3570) product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079784.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 sequence281 source 1..4221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..1064 product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098848.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 gene lsrD assembly_gap 1027..1037 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1051..1491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42210 note possible pseudo, frameshifted CDS 1488..1922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42220 note possible pseudo, internal stop codon, frameshifted CDS 2033..2869 product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917724.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene lsrF CDS 2866..3165 product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181386.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 gene lsrG CDS 3315..3791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42250 note possible pseudo, frameshifted sequence282 source 1..4207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1525..2322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42260 note possible pseudo, frameshifted CDS 2686..3528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42270 note possible pseudo, frameshifted CDS 3470..3886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42280 note possible pseudo, frameshifted CDS 3879..4058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42290 note possible pseudo, frameshifted sequence283 source 1..4206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(942..2315) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211002.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS 2529..3476 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211003.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS complement(3528..3797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42320 assembly_gap 3841..3869 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence284 source 1..4184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(272..1402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42330 misc_feature complement(3587..>4184) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000610375.1:DUF551 domain-containing protein locus_tag LOCUS_42340 sequence285 source 1..4180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(95..502) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282098.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 gene fliN CDS complement(499..1503) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502815.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 gene fliM CDS complement(1508..1975) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132172.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 gene fliL CDS complement(2072..2560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42380 note possible pseudo, frameshifted CDS complement(2565..3149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42390 note possible pseudo, frameshifted CDS complement(3146..3589) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097733.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene fliJ misc_feature complement(3611..>4180) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000213259.1:flagellar protein export ATPase FliI locus_tag LOCUS_42410 sequence286 source 1..4165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..554 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095104.1:phosphonate C-P lyase system protein PhnL locus_tag LOCUS_42420 assembly_gap 687..702 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 710..1210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42430 assembly_gap 1061..1098 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1550..1654 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2051..2482 product aminoalkylphosphonate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110514.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 gene phnO CDS 2492..3250 product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059910.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 gene phnP CDS complement(3247..3570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS complement(3647..4165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42470 sequence287 source 1..4096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1144..1575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42480 note possible pseudo, frameshifted CDS complement(1617..3119) product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445555.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 gene proY CDS complement(3156..3791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42500 note possible pseudo, frameshifted sequence288 source 1..4050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1187 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096236.1:invasion regulator SirB1 locus_tag LOCUS_42510 assembly_gap 336..397 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1390..1487 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1743..1915 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2091..3062) product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 gene chaA assembly_gap 2370..2390 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3335..3565 product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096240.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 gene chaB sequence289 source 1..4009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 977..1049 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1533..2738) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096232.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 gene hemA CDS 2941..3564 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130678.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 gene lolB sequence290 source 1..3955 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(362..1387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42570 assembly_gap 373..453 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1411..1531 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1705..3363) product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421580.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS complement(3501..3722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42590 note possible pseudo, frameshifted sequence291 source 1..3948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 201..293 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(895..1761) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056719.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS 2108..2716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42610 assembly_gap 2663..2682 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2923..3085 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3305..3472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42620 note possible pseudo, frameshifted sequence292 source 1..3941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(112..549) product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS 678..1676 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971188.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS 1765..2265 product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS complement(2293..2718) product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406008.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS 2935..3801 product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102910.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 gene amiA sequence293 source 1..3887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(158..616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42680 note possible pseudo, frameshifted CDS complement(629..1804) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704758.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 gene phrB note possible pseudo, frameshifted CDS complement(1776..1994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42700 note possible pseudo, frameshifted CDS complement(2152..2949) product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367132.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 note possible pseudo, frameshifted CDS complement(3007..3492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42720 sequence294 source 1..3885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 295..1020 product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833686.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 gene uxuR CDS complement(1057..1545) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458979.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 gene greB CDS 1681..3750 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703676.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 sequence295 source 1..3826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 402..1031 product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566559.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 gene yfcG CDS 1109..1471 product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365570.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 gene folX CDS 1490..2383 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS complement(2415..3695) product RbtT/DalT/CsbX family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706071.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 sequence296 source 1..3790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 435..1124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS complement(1162..1605) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098729.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 gene lysM CDS 1779..2279 product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989016.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS 2340..2786 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460698.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS complement(2792..2920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42840 assembly_gap 3013..3077 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3476..3581 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence297 source 1..3770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 420..1160 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085988.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS 2091..2999 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704306.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS 2999..3646 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116472.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 sequence298 source 1..3758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 461..576 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1074..1919 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097369.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 gene potI CDS 2001..2471 product DUF2593 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763976.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS 2597..3640 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097367.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 gene rlmC sequence299 source 1..3673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(405..1322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42910 misc_feature complement(1336..>3673) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263700.1:cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB locus_tag LOCUS_42920 sequence300 source 1..3592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1092..1217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42930 note possible pseudo, frameshifted assembly_gap 1311..1495 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1863..1930 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2156..2611) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007373199.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 gene dksA CDS complement(2790..3494) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899414.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 gene sfsA sequence301 source 1..3591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 95..994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS 1014..1559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42970 note possible pseudo, frameshifted CDS 1499..1711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42980 note possible pseudo, frameshifted assembly_gap 1904..2014 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2300..3295) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095281.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 gene queG sequence302 source 1..3545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(158..367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43000 note possible pseudo, frameshifted CDS complement(364..1059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43010 note possible pseudo, frameshifted CDS 1262..2872 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367567.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 misc_feature complement(2916..>3545) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097884.1:TerC family protein locus_tag LOCUS_43030 sequence303 source 1..3535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1242 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529488.1:ABC transporter substrate-binding protein locus_tag LOCUS_43040 CDS 1244..1870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43050 assembly_gap 1747..1806 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1825..1995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS 1992..2873 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970497.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 assembly_gap 3140..3264 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence304 source 1..3534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2637 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001235807.1:DNA topoisomerase III locus_tag LOCUS_43080 CDS complement(2818..3258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43090 note possible pseudo, frameshifted sequence305 source 1..3504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1282..1428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 1580..2011 product peroxiredoxin OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152305.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 gene osmC CDS 2093..2308 product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096944.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 gene fumD misc_feature complement(2784..>3504) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001175077.1:multidrug efflux MATE transporter MdtK locus_tag LOCUS_43130 sequence306 source 1..3503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 728..1231 product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100805.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 gene dps CDS 1595..1879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43150 note possible pseudo, frameshifted CDS 1935..2342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43160 note possible pseudo, frameshifted CDS 2443..3039 product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858462.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 gene glnP sequence307 source 1..3430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 178..197 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 807..1673 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023068.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 gene coaA CDS complement(1700..2662) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099224.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 gene birA misc_feature complement(2659..>3430) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099225.1:UDP-N-acetylmuramate dehydrogenase locus_tag LOCUS_43200 sequence308 source 1..3425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 530..567 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 582..1223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43210 note possible pseudo, frameshifted CDS 1126..1932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43220 note possible pseudo, frameshifted CDS 2156..3088 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086538.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 sequence309 source 1..3345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(85..1611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS complement(1536..2249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43250 assembly_gap 1670..1697 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2499..2747) product DUF2766 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365964.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 sequence310 source 1..3304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43270 note possible pseudo, frameshifted CDS complement(593..2029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43280 note possible pseudo, internal stop codon, frameshifted CDS complement(2042..2812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43290 note possible pseudo, internal stop codon CDS complement(2809..3072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43300 note possible pseudo, frameshifted sequence311 source 1..3248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(213..1148) product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705839.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 gene ldcA CDS 1288..1899 product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776974.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 gene emtA CDS complement(1900..2631) product flagellar brake protein YcgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017410.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 gene ycgR CDS 2849..3103 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 sequence312 source 1..3200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 69..392 product type IV toxin-antitoxin system antitoxin YagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030800.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 gene yagB CDS 459..779 product type IV toxin-antitoxin system toxin YpjF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094400.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 gene ypjF CDS 1468..2343 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141174869.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 misc_feature complement(2558..>3200) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095674.1:envelope stress response activation lipoprotein NlpE locus_tag LOCUS_43380 sequence313 source 1..3192 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 255..1679 product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005128983.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS complement(1723..2232) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147302.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 gene cheW CDS complement(2248..2910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43410 assembly_gap 2913..2992 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence314 source 1..3112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 112..906 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096623.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS complement(950..1876) product diguanylate cyclase DgcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592774.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 gene dgcZ CDS complement(2096..2956) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096613.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 sequence315 source 1..3046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(89..631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43450 note possible pseudo, frameshifted CDS complement(628..1653) product hematinate-forming heme oxygenase ChuS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096984.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 gene chuS misc_feature complement(1676..>3046) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096983.1:TonB-dependent hemoglobin/transferrin/lactoferrin family receptor locus_tag LOCUS_43470 sequence316 source 1..2990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 388..2763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43480 note possible pseudo, frameshifted assembly_gap 2722..2759 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence317 source 1..2967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..643 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187753.1:NAD(P)H-dependent oxidoreductase locus_tag LOCUS_43490 CDS complement(658..783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43500 note possible pseudo, frameshifted CDS complement(800..1924) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045295.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 gene hemL note possible pseudo, frameshifted sequence318 source 1..2962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 225..656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43520 note possible pseudo, frameshifted CDS 562..2409 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704815.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 gene dinG note possible pseudo, frameshifted sequence319 source 1..2949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(875..2440) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730077.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 gene kdpA assembly_gap 2481..2486 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence320 source 1..2946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..659 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000055936.1:metalloprotease TldD locus_tag LOCUS_43550 CDS complement(698..1630) product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098979.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 gene aaeR CDS 1802..2005 product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051840.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 gene aaeX CDS 1998..2840 product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098978.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 gene aaeA assembly_gap 2737..2810 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence321 source 1..2940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..598 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000619478.1:L-rhamnose mutarotase locus_tag LOCUS_43590 CDS complement(632..1180) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368954.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS 1283..1942 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683586.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS 2094..2216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43620 note possible pseudo, frameshifted CDS complement(2256..2465) product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099352.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 assembly_gap 2483..2490 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence322 source 1..2929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(909..1028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS complement(1000..2202) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 gene uxaC sequence323 source 1..2929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(620..1408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43660 note possible pseudo, frameshifted assembly_gap 1424..1476 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1595..2470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43670 note possible pseudo, frameshifted misc_feature complement(2409..>2929) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703518.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase note possible pseudo, frameshifted locus_tag LOCUS_43680 assembly_gap 2505..2517 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence324 source 1..2928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(836..1192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 note possible pseudo, frameshifted assembly_gap 904..934 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1132..1833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43700 note possible pseudo, frameshifted CDS complement(1882..2469) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002882824.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 sequence325 source 1..2904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 61..291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS 272..874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS 1067..2806 product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096163.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 sequence326 source 1..2878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..1474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43750 note possible pseudo, frameshifted CDS complement(1602..2339) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704791.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 sequence327 source 1..2874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 338..355 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 376..678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43770 note possible pseudo, frameshifted CDS 671..1153 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704166.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 gene tsaE CDS 1204..2532 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990321.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 gene amiB sequence328 source 1..2870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(701..1735) product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368928.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 gene cytR CDS complement(1895..2443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43810 note possible pseudo, frameshifted assembly_gap 2454..2554 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence329 source 1..2818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 442..1092 product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070491.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 gene narL CDS complement(1074..2477) product YchO/YchP family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419841.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 sequence330 source 1..2818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(181..492) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862095.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 gene ftsB CDS complement(669..992) product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098502.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS complement(1044..1649) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098503.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 gene cysC CDS complement(1649..2278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43870 note possible pseudo, frameshifted sequence331 source 1..2805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 317..354 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(571..1959) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198245.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS complement(2245..2460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43890 note possible pseudo, frameshifted CDS complement(2450..2791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43900 note possible pseudo, frameshifted sequence332 source 1..2802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(314..736) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095673.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 gene arfB CDS complement(733..1278) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185290.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS 1492..1692 product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417058.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS 1679..1939 product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830722.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 gene rof CDS complement(1862..2245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43950 misc_feature complement(2248..>2802) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000210062.1:tRNA lysidine(34) synthetase TilS locus_tag LOCUS_43960 sequence333 source 1..2794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(151..819) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602542.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS complement(940..1416) product tellurium resistance protein TerW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176766.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 gene terW CDS complement(1555..2511) product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797363.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 sequence334 source 1..2763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS 360..824 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963837.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 gene ndk CDS 845..1252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS 1182..1814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS 2192..2629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44040 note possible pseudo, frameshifted assembly_gap 2536..2554 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence335 source 1..2760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 188..354 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1236..1433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS 1750..2463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44060 note possible pseudo, frameshifted sequence336 source 1..2709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1003..1569 product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096056.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS 1584..2087 product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027938.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 sequence337 source 1..2708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 441..490 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 500..1048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44090 note possible pseudo, frameshifted misc_feature complement(1086..>2708) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098021.1:anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC locus_tag LOCUS_44100 sequence338 source 1..2704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44110 note possible pseudo, frameshifted CDS 255..2654 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419180.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 note possible pseudo, frameshifted sequence339 source 1..2692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1266..2222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 note possible pseudo, frameshifted CDS 2392..2547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44140 sequence340 source 1..2596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(387..1055) product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847882.1 transl_table 11 codon_start 1 locus_tag LOCUS_44150 gene yecA CDS complement(1189..1326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44160 sequence341 source 1..2570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 137..562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44170 note possible pseudo, frameshifted CDS 540..1259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44180 note possible pseudo, frameshifted CDS 1264..1956 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117262.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS 1943..2428 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132911.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 sequence342 source 1..2558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 745..1425 product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097480.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 gene cecR CDS 1425..2429 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097481.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 gene hlyD sequence343 source 1..2508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 381..507 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 532..660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS 653..1291 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889716.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS 1295..1891 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368115.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 gene nqrE assembly_gap 2001..2075 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence344 source 1..2504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 236..892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS complement(926..1801) product DNA-binding transcriptional activator TtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935206.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 gene ttdR