>Feature sequence001 190 924 gene locus_tag LOCUS_00010 gene fliP 190 924 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097738.1 protein_id gnl|my_center|LOCUS_00010 937 1206 gene locus_tag LOCUS_00020 gene fliQ 937 1206 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187355.1 protein_id gnl|my_center|LOCUS_00020 1211 2005 gene locus_tag LOCUS_00030 gene fliR 1211 2005 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616875.1 protein_id gnl|my_center|LOCUS_00030 2412 2939 gene locus_tag LOCUS_00040 gene rcsA 2412 2939 CDS product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097740.1 protein_id gnl|my_center|LOCUS_00040 3184 2996 gene locus_tag LOCUS_00050 gene dsrB 3184 2996 CDS product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097741.1 protein_id gnl|my_center|LOCUS_00050 3316 3549 gene locus_tag LOCUS_00060 gene yodD 3316 3549 CDS product YodD family peroxide/acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097742.1 protein_id gnl|my_center|LOCUS_00060 3857 4075 gene locus_tag LOCUS_00070 3857 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00070 3991 4668 gene locus_tag LOCUS_00080 3991 4668 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948794.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00080 5640 4657 gene locus_tag LOCUS_00090 5640 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 5719 6078 gene locus_tag LOCUS_00100 5719 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6649 6515 gene locus_tag LOCUS_00110 6649 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 7609 6740 gene locus_tag LOCUS_00120 7609 6740 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097746.1 protein_id gnl|my_center|LOCUS_00120 7951 8862 gene locus_tag LOCUS_00130 gene yedA 7951 8862 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097747.1 protein_id gnl|my_center|LOCUS_00130 9283 8930 gene locus_tag LOCUS_00140 9283 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00140 10702 9287 gene locus_tag LOCUS_00150 gene dcm 10702 9287 CDS product DNA-cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157265.1 protein_id gnl|my_center|LOCUS_00150 11436 10750 gene locus_tag LOCUS_00160 11436 10750 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365890.1 protein_id gnl|my_center|LOCUS_00160 11709 11491 gene locus_tag LOCUS_00170 11709 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 12462 12268 gene locus_tag LOCUS_00180 12462 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 12441 13571 gene locus_tag LOCUS_00190 12441 13571 CDS product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096462.1 protein_id gnl|my_center|LOCUS_00190 13877 13788 gene locus_tag LOCUS_t00010 13877 13788 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13972 14763 gene locus_tag LOCUS_00200 gene mtfA 13972 14763 CDS product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881844.1 protein_id gnl|my_center|LOCUS_00200 14864 14939 gene locus_tag LOCUS_t00020 14864 14939 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 15947 14997 gene locus_tag LOCUS_00210 gene cbl 15947 14997 CDS product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097829.1 protein_id gnl|my_center|LOCUS_00210 16966 16049 gene locus_tag LOCUS_00220 gene nac 16966 16049 CDS product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432103.1 protein_id gnl|my_center|LOCUS_00220 17308 17979 gene locus_tag LOCUS_00230 17308 17979 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277074.1 protein_id gnl|my_center|LOCUS_00230 17998 19185 gene locus_tag LOCUS_00240 17998 19185 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097035.1 protein_id gnl|my_center|LOCUS_00240 19278 20609 gene locus_tag LOCUS_00250 19278 20609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00250 20536 20784 gene locus_tag LOCUS_00260 20536 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00260 20786 22741 gene locus_tag LOCUS_00270 20786 22741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 23465 22827 gene locus_tag LOCUS_00280 23465 22827 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296118.1 protein_id gnl|my_center|LOCUS_00280 23751 23458 gene locus_tag LOCUS_00290 23751 23458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00290 24071 24207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24455 24243 gene locus_tag LOCUS_00300 24455 24243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 25337 26122 gene locus_tag LOCUS_00310 25337 26122 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086142.1 protein_id gnl|my_center|LOCUS_00310 26142 26375 gene locus_tag LOCUS_00320 26142 26375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 26375 26623 gene locus_tag LOCUS_00330 26375 26623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 27102 26818 gene locus_tag LOCUS_00340 27102 26818 CDS product type VI secretion system PAAR protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640144.1 protein_id gnl|my_center|LOCUS_00340 28169 27228 gene locus_tag LOCUS_00350 28169 27228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 29794 28178 gene locus_tag LOCUS_00360 29794 28178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 30618 29794 gene locus_tag LOCUS_00370 30618 29794 CDS product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776489.1 protein_id gnl|my_center|LOCUS_00370 32561 30621 gene locus_tag LOCUS_00380 gene tssI 32561 30621 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306807.1 protein_id gnl|my_center|LOCUS_00380 33304 32786 gene locus_tag LOCUS_00390 33304 32786 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142958.1 protein_id gnl|my_center|LOCUS_00390 33945 34448 gene locus_tag LOCUS_00400 gene tssB 33945 34448 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037399.1 protein_id gnl|my_center|LOCUS_00400 34478 34690 gene locus_tag LOCUS_00410 34478 34690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 34739 36211 gene locus_tag LOCUS_00420 gene tssC 34739 36211 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056978.1 protein_id gnl|my_center|LOCUS_00420 36208 36624 gene locus_tag LOCUS_00430 gene tssE 36208 36624 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611748.1 protein_id gnl|my_center|LOCUS_00430 36629 37450 gene locus_tag LOCUS_00440 36629 37450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 37563 38366 gene locus_tag LOCUS_00450 37563 38366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 38330 39418 gene locus_tag LOCUS_00460 gene tssG 38330 39418 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348793.1 protein_id gnl|my_center|LOCUS_00460 39443 40294 gene locus_tag LOCUS_00470 39443 40294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00470 40311 40691 gene locus_tag LOCUS_00480 40311 40691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00480 40688 41221 gene locus_tag LOCUS_00490 gene tssJ 40688 41221 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080153.1 protein_id gnl|my_center|LOCUS_00490 41224 42201 gene locus_tag LOCUS_00500 41224 42201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00500 42212 42529 gene locus_tag LOCUS_00510 42212 42529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 42534 43292 gene locus_tag LOCUS_00520 gene icmH 42534 43292 CDS product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343303.1 protein_id gnl|my_center|LOCUS_00520 43301 45022 gene locus_tag LOCUS_00530 43301 45022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00530 44979 46070 gene locus_tag LOCUS_00540 44979 46070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00540 46067 48169 gene locus_tag LOCUS_00550 46067 48169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 48187 49512 gene locus_tag LOCUS_00560 48187 49512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00560 49433 51736 gene locus_tag LOCUS_00570 49433 51736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00570 51747 52265 gene locus_tag LOCUS_00580 51747 52265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 52125 52173 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52327 52902 gene locus_tag LOCUS_00590 52327 52902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 52925 53404 gene locus_tag LOCUS_00600 52925 53404 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284958.1 protein_id gnl|my_center|LOCUS_00600 53437 54312 gene locus_tag LOCUS_00610 53437 54312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 54485 54778 gene locus_tag LOCUS_00620 54485 54778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 54788 55156 gene locus_tag LOCUS_00630 54788 55156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 >Feature sequence002 189 272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 784 611 gene locus_tag LOCUS_00640 784 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00640 1718 819 gene locus_tag LOCUS_00650 1718 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00650 1982 3334 gene locus_tag LOCUS_00660 gene glpT 1982 3334 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098018.1 protein_id gnl|my_center|LOCUS_00660 3628 3374 gene locus_tag LOCUS_00670 gene yfaE 3628 3374 CDS product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135039.1 protein_id gnl|my_center|LOCUS_00670 4760 3630 gene locus_tag LOCUS_00680 gene nrdB 4760 3630 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332020.1 protein_id gnl|my_center|LOCUS_00680 5645 4815 gene locus_tag LOCUS_00690 5645 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00690 7100 5736 gene locus_tag LOCUS_00700 7100 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00700 7032 7208 gene locus_tag LOCUS_00710 7032 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 7624 7854 gene locus_tag LOCUS_00720 gene vapB 7624 7854 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261287.1 protein_id gnl|my_center|LOCUS_00720 7851 8267 gene locus_tag LOCUS_00730 7851 8267 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044768.1 protein_id gnl|my_center|LOCUS_00730 8762 8529 gene locus_tag LOCUS_00740 8762 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 9561 10475 gene locus_tag LOCUS_00750 9561 10475 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007374408.1 protein_id gnl|my_center|LOCUS_00750 11108 10884 gene locus_tag LOCUS_00760 11108 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 11811 11380 gene locus_tag LOCUS_00770 gene silE 11811 11380 CDS product silver-binding protein SilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790485.1 protein_id gnl|my_center|LOCUS_00770 13537 12062 gene locus_tag LOCUS_00780 gene silS 13537 12062 CDS product copper/silver sensor histidine kinase SilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007374412.1 protein_id gnl|my_center|LOCUS_00780 14213 13530 gene locus_tag LOCUS_00790 gene silR 14213 13530 CDS product copper/silver response regulator transcription factor SilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697968.1 protein_id gnl|my_center|LOCUS_00790 14511 15785 gene locus_tag LOCUS_00800 gene silC 14511 15785 CDS product Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001507116.1 protein_id gnl|my_center|LOCUS_00800 15814 16167 gene locus_tag LOCUS_00810 gene cusF 15814 16167 CDS product cation efflux system protein CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246153.1 protein_id gnl|my_center|LOCUS_00810 16443 17573 gene locus_tag LOCUS_00820 gene silB 16443 17573 CDS product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087116.1 protein_id gnl|my_center|LOCUS_00820 17584 20730 gene locus_tag LOCUS_00830 gene silA 17584 20730 CDS product Cu(+)/Ag(+) efflux RND transporter permease subunit SilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574029.1 protein_id gnl|my_center|LOCUS_00830 20816 21256 gene locus_tag LOCUS_00840 20816 21256 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758228.1 protein_id gnl|my_center|LOCUS_00840 22143 23825 gene locus_tag LOCUS_00850 22143 23825 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001378038.1 protein_id gnl|my_center|LOCUS_00850 23866 24063 gene locus_tag LOCUS_00860 23866 24063 CDS product DUF2933 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843494.1 protein_id gnl|my_center|LOCUS_00860 24834 24097 gene locus_tag LOCUS_00870 24834 24097 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287501.1 protein_id gnl|my_center|LOCUS_00870 25572 25123 gene locus_tag LOCUS_00880 25572 25123 CDS product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023257.1 protein_id gnl|my_center|LOCUS_00880 25807 27558 gene locus_tag LOCUS_00890 25807 27558 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104780.1 protein_id gnl|my_center|LOCUS_00890 27558 28454 gene locus_tag LOCUS_00900 gene pcoB 27558 28454 CDS product copper resistance outer membrane transporter PcoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001378118.1 protein_id gnl|my_center|LOCUS_00900 28494 28874 gene locus_tag LOCUS_00910 gene pcoC 28494 28874 CDS product copper resistance system metallochaperone PcoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025662.1 protein_id gnl|my_center|LOCUS_00910 28879 29808 gene locus_tag LOCUS_00920 gene pcoD 28879 29808 CDS product copper resistance inner membrane protein PcoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087112.1 protein_id gnl|my_center|LOCUS_00920 29863 30543 gene locus_tag LOCUS_00930 gene pcoR 29863 30543 CDS product copper response regulator transcription factor PcoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188930.1 protein_id gnl|my_center|LOCUS_00930 30540 31940 gene locus_tag LOCUS_00940 gene pcoS 30540 31940 CDS product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046494163.1 protein_id gnl|my_center|LOCUS_00940 32158 32592 gene locus_tag LOCUS_00950 gene pcoE 32158 32592 CDS product copper resistance system metallochaperone PcoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087108.1 protein_id gnl|my_center|LOCUS_00950 33452 33718 gene locus_tag LOCUS_00960 33452 33718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175303.1 protein_id gnl|my_center|LOCUS_00960 33740 34078 gene locus_tag LOCUS_00970 33740 34078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 34634 34407 gene locus_tag LOCUS_00980 34634 34407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 34884 34672 gene locus_tag LOCUS_00990 34884 34672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 35407 35162 gene locus_tag LOCUS_01000 35407 35162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 35719 36117 gene locus_tag LOCUS_01010 35719 36117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 36700 36485 gene locus_tag LOCUS_01020 36700 36485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 37455 37054 gene locus_tag LOCUS_01030 37455 37054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 37687 38961 gene locus_tag LOCUS_01040 gene hmpA 37687 38961 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063898.1 protein_id gnl|my_center|LOCUS_01040 40007 39048 gene locus_tag LOCUS_01050 40007 39048 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705307.1 protein_id gnl|my_center|LOCUS_01050 41544 41056 gene locus_tag LOCUS_01060 41544 41056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 >Feature sequence003 325 173 gene locus_tag LOCUS_01070 325 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01070 951 277 gene locus_tag LOCUS_01080 951 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01080 1315 1001 gene locus_tag LOCUS_01090 1315 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 1573 1866 gene locus_tag LOCUS_01100 1573 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 1863 2876 gene locus_tag LOCUS_01110 gene rssB 1863 2876 CDS product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096265.1 protein_id gnl|my_center|LOCUS_01110 3077 3985 gene locus_tag LOCUS_01120 gene galU 3077 3985 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 protein_id gnl|my_center|LOCUS_01120 4009 5352 gene locus_tag LOCUS_01130 4009 5352 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210664.1 protein_id gnl|my_center|LOCUS_01130 5364 6374 gene locus_tag LOCUS_01140 5364 6374 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 protein_id gnl|my_center|LOCUS_01140 6855 6442 gene locus_tag LOCUS_01150 gene hns 6855 6442 CDS product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287383.1 protein_id gnl|my_center|LOCUS_01150 7504 8019 gene locus_tag LOCUS_01160 gene tdk 7504 8019 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705104.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01160 10776 8098 gene locus_tag LOCUS_01170 gene adhE 10776 8098 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301680.1 protein_id gnl|my_center|LOCUS_01170 11255 11902 gene locus_tag LOCUS_01180 11255 11902 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615840.1 protein_id gnl|my_center|LOCUS_01180 12636 14195 gene locus_tag LOCUS_01190 gene oppA 12636 14195 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367070.1 protein_id gnl|my_center|LOCUS_01190 14306 14818 gene locus_tag LOCUS_01200 14306 14818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01200 14742 15143 gene locus_tag LOCUS_01210 14742 15143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01210 15158 15958 gene locus_tag LOCUS_01220 gene oppC 15158 15958 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 protein_id gnl|my_center|LOCUS_01220 15971 16972 gene locus_tag LOCUS_01230 gene oppD 15971 16972 CDS product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272969.1 protein_id gnl|my_center|LOCUS_01230 16974 17792 gene locus_tag LOCUS_01240 gene sapF 16974 17792 CDS product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 protein_id gnl|my_center|LOCUS_01240 17898 18686 gene locus_tag LOCUS_01250 gene fabI 17898 18686 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 protein_id gnl|my_center|LOCUS_01250 18894 20054 gene locus_tag LOCUS_01260 18894 20054 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705732.1 protein_id gnl|my_center|LOCUS_01260 20156 22090 gene locus_tag LOCUS_01270 gene rnb 20156 22090 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000485012.1 protein_id gnl|my_center|LOCUS_01270 22390 24381 gene locus_tag LOCUS_01280 gene pdeR 22390 24381 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096381.1 protein_id gnl|my_center|LOCUS_01280 25250 24378 gene locus_tag LOCUS_01290 25250 24378 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096380.1 protein_id gnl|my_center|LOCUS_01290 25460 25642 gene locus_tag LOCUS_01300 25460 25642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096379.1 protein_id gnl|my_center|LOCUS_01300 25820 26578 gene locus_tag LOCUS_01310 25820 26578 CDS product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096378.1 protein_id gnl|my_center|LOCUS_01310 26833 27048 gene locus_tag LOCUS_01320 gene osmB 26833 27048 CDS product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501216.1 protein_id gnl|my_center|LOCUS_01320 27483 27157 gene locus_tag LOCUS_01330 gene yciH 27483 27157 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295580.1 protein_id gnl|my_center|LOCUS_01330 28214 27483 gene locus_tag LOCUS_01340 gene pyrF 28214 27483 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176265.1 protein_id gnl|my_center|LOCUS_01340 28849 28397 gene locus_tag LOCUS_01350 28849 28397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01350 29591 28851 gene locus_tag LOCUS_01360 29591 28851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 29901 29596 gene locus_tag LOCUS_01370 29901 29596 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876301.1 protein_id gnl|my_center|LOCUS_01370 30163 30204 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30814 30302 gene locus_tag LOCUS_01380 30814 30302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01380 30976 31611 gene locus_tag LOCUS_01390 gene ribA 30976 31611 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176295.1 protein_id gnl|my_center|LOCUS_01390 32446 31658 gene locus_tag LOCUS_01400 32446 31658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 33857 32412 gene locus_tag LOCUS_01410 33857 32412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01410 34030 33851 gene locus_tag LOCUS_01420 34030 33851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01420 34726 36024 gene locus_tag LOCUS_01430 gene chiP 34726 36024 CDS product chitoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097565.1 protein_id gnl|my_center|LOCUS_01430 36081 38438 gene locus_tag LOCUS_01440 36081 38438 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816825.1 protein_id gnl|my_center|LOCUS_01440 38474 38788 gene locus_tag LOCUS_01450 38474 38788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 38775 39110 gene locus_tag LOCUS_01460 gene tnpB 38775 39110 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385717.1 protein_id gnl|my_center|LOCUS_01460 39138 40709 gene locus_tag LOCUS_01470 39138 40709 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 protein_id gnl|my_center|LOCUS_01470 40909 41127 gene locus_tag LOCUS_01480 40909 41127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 >Feature sequence004 836 840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1930 1007 gene locus_tag LOCUS_01490 1930 1007 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622336.1 protein_id gnl|my_center|LOCUS_01490 1029 1050 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2223 1927 gene locus_tag LOCUS_01500 gene citD 2223 1927 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700679.1 protein_id gnl|my_center|LOCUS_01500 3296 2220 gene locus_tag LOCUS_01510 gene citC 3296 2220 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467705.1 protein_id gnl|my_center|LOCUS_01510 3654 5315 gene locus_tag LOCUS_01520 gene dpiB 3654 5315 CDS product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121811.1 protein_id gnl|my_center|LOCUS_01520 5284 5964 gene locus_tag LOCUS_01530 gene dpiA 5284 5964 CDS product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138786.1 protein_id gnl|my_center|LOCUS_01530 7254 5959 gene locus_tag LOCUS_01540 7254 5959 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038841.1 protein_id gnl|my_center|LOCUS_01540 7727 9124 gene locus_tag LOCUS_01550 7727 9124 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895572.1 protein_id gnl|my_center|LOCUS_01550 9121 10335 gene locus_tag LOCUS_01560 9121 10335 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114295.1 protein_id gnl|my_center|LOCUS_01560 10809 10453 gene locus_tag LOCUS_01570 10809 10453 CDS product DUF1937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083172.1 protein_id gnl|my_center|LOCUS_01570 10997 10848 gene locus_tag LOCUS_01580 10997 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 12058 10970 gene locus_tag LOCUS_01590 gene eutH 12058 10970 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083171.1 protein_id gnl|my_center|LOCUS_01590 13512 12070 gene locus_tag LOCUS_01600 13512 12070 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114294.1 protein_id gnl|my_center|LOCUS_01600 13916 14680 gene locus_tag LOCUS_01610 13916 14680 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085220.1 protein_id gnl|my_center|LOCUS_01610 16187 14871 gene locus_tag LOCUS_01620 16187 14871 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112713.1 protein_id gnl|my_center|LOCUS_01620 17160 16207 gene locus_tag LOCUS_01630 17160 16207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 18088 17264 gene locus_tag LOCUS_01640 18088 17264 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037490.1 protein_id gnl|my_center|LOCUS_01640 18194 19132 gene locus_tag LOCUS_01650 18194 19132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 19656 19195 gene locus_tag LOCUS_01660 19656 19195 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481688.1 protein_id gnl|my_center|LOCUS_01660 19807 20502 gene locus_tag LOCUS_01670 19807 20502 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366894.1 protein_id gnl|my_center|LOCUS_01670 20524 21417 gene locus_tag LOCUS_01680 20524 21417 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705975.1 protein_id gnl|my_center|LOCUS_01680 21782 21706 gene locus_tag LOCUS_t00030 21782 21706 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21997 22605 gene locus_tag LOCUS_01690 21997 22605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01690 22608 22853 gene locus_tag LOCUS_01700 22608 22853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01700 22855 23067 gene locus_tag LOCUS_01710 gene ybcJ 22855 23067 CDS product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190278.1 protein_id gnl|my_center|LOCUS_01710 23378 23112 gene locus_tag LOCUS_01720 23378 23112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01720 24952 23336 gene locus_tag LOCUS_01730 24952 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 24933 25118 gene locus_tag LOCUS_01740 24933 25118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 25610 25125 gene locus_tag LOCUS_01750 25610 25125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 26176 27612 gene locus_tag LOCUS_01760 26176 27612 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095927.1 protein_id gnl|my_center|LOCUS_01760 27692 28426 gene locus_tag LOCUS_01770 27692 28426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01770 28465 28683 gene locus_tag LOCUS_01780 28465 28683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01780 29416 28688 gene locus_tag LOCUS_01790 29416 28688 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770966.1 protein_id gnl|my_center|LOCUS_01790 29679 30203 gene locus_tag LOCUS_01800 29679 30203 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143546.1 protein_id gnl|my_center|LOCUS_01800 31638 30253 gene locus_tag LOCUS_01810 gene cysS 31638 30253 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704630.1 protein_id gnl|my_center|LOCUS_01810 31816 32310 gene locus_tag LOCUS_01820 gene ppiB 31816 32310 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367878.1 protein_id gnl|my_center|LOCUS_01820 32386 32835 gene locus_tag LOCUS_01830 32386 32835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01830 32759 33016 gene locus_tag LOCUS_01840 32759 33016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01840 33176 33451 gene locus_tag LOCUS_01850 gene yahO 33176 33451 CDS product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097697.1 protein_id gnl|my_center|LOCUS_01850 34664 33615 gene locus_tag LOCUS_01860 34664 33615 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096767.1 protein_id gnl|my_center|LOCUS_01860 36771 34795 gene locus_tag LOCUS_01870 36771 34795 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096766.1 protein_id gnl|my_center|LOCUS_01870 37432 37522 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37536 38561 gene locus_tag LOCUS_01880 gene purK 37536 38561 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815527.1 protein_id gnl|my_center|LOCUS_01880 38689 39651 gene locus_tag LOCUS_01890 gene mnmH 38689 39651 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095917.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01890 >Feature sequence005 1267 593 gene locus_tag LOCUS_01900 1267 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 1570 1268 gene locus_tag LOCUS_01910 1570 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 4671 1570 gene locus_tag LOCUS_01920 4671 1570 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515491.1 protein_id gnl|my_center|LOCUS_01920 5411 4857 gene locus_tag LOCUS_01930 5411 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 6037 5510 gene locus_tag LOCUS_01940 6037 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 6699 5980 gene locus_tag LOCUS_01950 6699 5980 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140759.1 protein_id gnl|my_center|LOCUS_01950 7403 6699 gene locus_tag LOCUS_01960 7403 6699 CDS product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113185.1 protein_id gnl|my_center|LOCUS_01960 7467 7832 gene locus_tag LOCUS_01970 7467 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 7991 7812 gene locus_tag LOCUS_01980 7991 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 8366 8013 gene locus_tag LOCUS_01990 8366 8013 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447253.1 protein_id gnl|my_center|LOCUS_01990 10345 8366 gene locus_tag LOCUS_02000 10345 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02000 11760 10384 gene locus_tag LOCUS_02010 11760 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02010 12426 11818 gene locus_tag LOCUS_02020 12426 11818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 12770 12438 gene locus_tag LOCUS_02030 12770 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 13565 12894 gene locus_tag LOCUS_02040 13565 12894 CDS product DUF6246 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097711.1 protein_id gnl|my_center|LOCUS_02040 14381 13626 gene locus_tag LOCUS_02050 14381 13626 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097712.1 protein_id gnl|my_center|LOCUS_02050 14822 14439 gene locus_tag LOCUS_02060 14822 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097713.1 protein_id gnl|my_center|LOCUS_02060 15244 14819 gene locus_tag LOCUS_02070 15244 14819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705871.1 protein_id gnl|my_center|LOCUS_02070 15597 15247 gene locus_tag LOCUS_02080 15597 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095987.1 protein_id gnl|my_center|LOCUS_02080 15770 15600 gene locus_tag LOCUS_02090 15770 15600 CDS product DUF551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126356113.1 protein_id gnl|my_center|LOCUS_02090 16150 15770 gene locus_tag LOCUS_02100 16150 15770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705874.1 protein_id gnl|my_center|LOCUS_02100 16284 16153 gene locus_tag LOCUS_02110 16284 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 17048 16365 gene locus_tag LOCUS_02120 17048 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 17080 17160 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17750 17319 gene locus_tag LOCUS_02130 17750 17319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705877.1 protein_id gnl|my_center|LOCUS_02130 19019 17754 gene locus_tag LOCUS_02140 19019 17754 CDS product DUF2213 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705878.1 protein_id gnl|my_center|LOCUS_02140 18485 18512 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19326 19093 gene locus_tag LOCUS_02150 19326 19093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 20323 19421 gene locus_tag LOCUS_02160 20323 19421 CDS product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705880.1 protein_id gnl|my_center|LOCUS_02160 21824 20355 gene locus_tag LOCUS_02170 21824 20355 CDS product DUF1073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188035104.1 protein_id gnl|my_center|LOCUS_02170 22343 21837 gene locus_tag LOCUS_02180 22343 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02180 23286 22384 gene locus_tag LOCUS_02190 23286 22384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02190 23888 23286 gene locus_tag LOCUS_02200 23888 23286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705883.1 protein_id gnl|my_center|LOCUS_02200 24098 23892 gene locus_tag LOCUS_02210 24098 23892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 24313 24095 gene locus_tag LOCUS_02220 24313 24095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097720.1 protein_id gnl|my_center|LOCUS_02220 24993 24439 gene locus_tag LOCUS_02230 24993 24439 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095973.1 protein_id gnl|my_center|LOCUS_02230 25712 25251 gene locus_tag LOCUS_02240 25712 25251 CDS product lysis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092266.1 protein_id gnl|my_center|LOCUS_02240 26281 25712 gene locus_tag LOCUS_02250 26281 25712 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061070701.1 protein_id gnl|my_center|LOCUS_02250 26582 26283 gene locus_tag LOCUS_02260 26582 26283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 26853 26781 gene locus_tag LOCUS_t00040 26853 26781 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27380 26865 gene locus_tag LOCUS_02270 27380 26865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 28911 27784 gene locus_tag LOCUS_02280 28911 27784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 29081 28908 gene locus_tag LOCUS_02290 29081 28908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 29493 29251 gene locus_tag LOCUS_02300 29493 29251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 29852 29475 gene locus_tag LOCUS_02310 29852 29475 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008200.1 protein_id gnl|my_center|LOCUS_02310 30139 29849 gene locus_tag LOCUS_02320 30139 29849 CDS product DUF1364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774491.1 protein_id gnl|my_center|LOCUS_02320 30314 30132 gene locus_tag LOCUS_02330 30314 30132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 30693 30301 gene locus_tag LOCUS_02340 30693 30301 CDS product DUF2591 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085071332.1 protein_id gnl|my_center|LOCUS_02340 31305 30859 gene locus_tag LOCUS_02350 31305 30859 CDS product recombination protein NinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814576.1 protein_id gnl|my_center|LOCUS_02350 31710 31435 gene locus_tag LOCUS_02360 31710 31435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 31971 31741 gene locus_tag LOCUS_02370 31971 31741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 32339 31968 gene locus_tag LOCUS_02380 32339 31968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 32683 32336 gene locus_tag LOCUS_02390 32683 32336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 32939 32646 gene locus_tag LOCUS_02400 32939 32646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 33205 32936 gene locus_tag LOCUS_02410 33205 32936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 33784 33215 gene locus_tag LOCUS_02420 33784 33215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 34928 34029 gene locus_tag LOCUS_02430 34928 34029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 35739 34939 gene locus_tag LOCUS_02440 35739 34939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 36078 35785 gene locus_tag LOCUS_02450 36078 35785 CDS product lambda phage CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251069.1 protein_id gnl|my_center|LOCUS_02450 36408 36181 gene locus_tag LOCUS_02460 36408 36181 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180318.1 protein_id gnl|my_center|LOCUS_02460 36487 37200 gene locus_tag LOCUS_02470 36487 37200 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250470.1 protein_id gnl|my_center|LOCUS_02470 37299 37592 gene locus_tag LOCUS_02480 37299 37592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 37601 37909 gene locus_tag LOCUS_02490 37601 37909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 37914 38300 gene locus_tag LOCUS_02500 37914 38300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691733.1 protein_id gnl|my_center|LOCUS_02500 38543 38334 gene locus_tag LOCUS_02510 38543 38334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098072.1 protein_id gnl|my_center|LOCUS_02510 39147 39401 gene locus_tag LOCUS_02520 39147 39401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 39439 39645 gene locus_tag LOCUS_02530 39439 39645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 >Feature sequence006 1091 225 gene locus_tag LOCUS_02540 1091 225 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098297.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02540 1696 1082 gene locus_tag LOCUS_02550 1696 1082 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098298.1 protein_id gnl|my_center|LOCUS_02550 1855 3132 gene locus_tag LOCUS_02560 gene csiE 1855 3132 CDS product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098299.1 protein_id gnl|my_center|LOCUS_02560 3872 3129 gene locus_tag LOCUS_02570 3872 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02570 4474 4328 gene locus_tag LOCUS_02580 4474 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 4943 4431 gene locus_tag LOCUS_02590 4943 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117719.1 protein_id gnl|my_center|LOCUS_02590 6388 5135 gene locus_tag LOCUS_02600 6388 5135 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098302.1 protein_id gnl|my_center|LOCUS_02600 6713 7636 gene locus_tag LOCUS_02610 gene hmpA 6713 7636 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883143.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02610 7611 7871 gene locus_tag LOCUS_02620 7611 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02620 10997 7941 gene locus_tag LOCUS_02630 gene mscK 10997 7941 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178244.1 protein_id gnl|my_center|LOCUS_02630 11293 10964 gene locus_tag LOCUS_02640 11293 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02640 12070 11426 gene locus_tag LOCUS_02650 gene acrR 12070 11426 CDS product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101755.1 protein_id gnl|my_center|LOCUS_02650 12256 12801 gene locus_tag LOCUS_02660 12256 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02660 12792 13349 gene locus_tag LOCUS_02670 12792 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02670 13372 14604 gene locus_tag LOCUS_02680 13372 14604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02680 14580 15842 gene locus_tag LOCUS_02690 14580 15842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02690 15885 16514 gene locus_tag LOCUS_02700 15885 16514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02700 16985 17359 gene locus_tag LOCUS_02710 gene tomB 16985 17359 CDS product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499288.1 protein_id gnl|my_center|LOCUS_02710 17388 17606 gene locus_tag LOCUS_02720 17388 17606 CDS product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291435.1 protein_id gnl|my_center|LOCUS_02720 18045 18515 gene locus_tag LOCUS_02730 18045 18515 CDS product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 protein_id gnl|my_center|LOCUS_02730 18692 18552 gene locus_tag LOCUS_02740 gene ykgO 18692 18552 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859006.1 protein_id gnl|my_center|LOCUS_02740 18955 18695 gene locus_tag LOCUS_02750 18955 18695 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367923.1 protein_id gnl|my_center|LOCUS_02750 19214 20776 gene locus_tag LOCUS_02760 19214 20776 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213129.1 protein_id gnl|my_center|LOCUS_02760 21137 20784 gene locus_tag LOCUS_02770 21137 20784 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878140.1 protein_id gnl|my_center|LOCUS_02770 21553 21335 gene locus_tag LOCUS_02780 21553 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367928.1 protein_id gnl|my_center|LOCUS_02780 21801 21550 gene locus_tag LOCUS_02790 21801 21550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095876.1 protein_id gnl|my_center|LOCUS_02790 22251 22571 gene locus_tag LOCUS_02800 22251 22571 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095875.1 protein_id gnl|my_center|LOCUS_02800 23176 22604 gene locus_tag LOCUS_02810 23176 22604 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779831.1 protein_id gnl|my_center|LOCUS_02810 23475 24335 gene locus_tag LOCUS_02820 gene tesB 23475 24335 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095873.1 protein_id gnl|my_center|LOCUS_02820 25566 24391 gene locus_tag LOCUS_02830 gene amtB 25566 24391 CDS product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685029.1 protein_id gnl|my_center|LOCUS_02830 25978 25640 gene locus_tag LOCUS_02840 gene glnK 25978 25640 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367937.1 protein_id gnl|my_center|LOCUS_02840 27074 26232 gene locus_tag LOCUS_02850 27074 26232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02850 27999 27052 gene locus_tag LOCUS_02860 27999 27052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02860 28810 27992 gene locus_tag LOCUS_02870 28810 27992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 29642 28770 gene locus_tag LOCUS_02880 29642 28770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02880 30166 29705 gene locus_tag LOCUS_02890 gene decR 30166 29705 CDS product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884593.1 protein_id gnl|my_center|LOCUS_02890 30282 30869 gene locus_tag LOCUS_02900 30282 30869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 30806 31225 gene locus_tag LOCUS_02910 30806 31225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 32083 31265 gene locus_tag LOCUS_02920 gene cof 32083 31265 CDS product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095866.1 protein_id gnl|my_center|LOCUS_02920 32298 32110 gene locus_tag LOCUS_02930 32298 32110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 32251 33702 gene locus_tag LOCUS_02940 32251 33702 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238179.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02940 33722 33886 gene locus_tag LOCUS_02950 33722 33886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 33957 34652 gene locus_tag LOCUS_02960 gene queC 33957 34652 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095864.1 protein_id gnl|my_center|LOCUS_02960 35092 34688 gene locus_tag LOCUS_02970 gene fadM 35092 34688 CDS product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194534.1 protein_id gnl|my_center|LOCUS_02970 35614 35243 gene locus_tag LOCUS_02980 35614 35243 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680312.1 protein_id gnl|my_center|LOCUS_02980 37683 35761 gene locus_tag LOCUS_02990 gene ppiD 37683 35761 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095860.1 protein_id gnl|my_center|LOCUS_02990 38084 37812 gene locus_tag LOCUS_03000 gene hupB 38084 37812 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002444653.1 protein_id gnl|my_center|LOCUS_03000 38543 38295 gene locus_tag LOCUS_03010 38543 38295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03010 <39034 38455 gene locus_tag LOCUS_03020 <39034 38455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295325.1:endopeptidase La note possible pseudo, frameshifted >Feature sequence007 161 1054 gene locus_tag LOCUS_03030 161 1054 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714563.1 protein_id gnl|my_center|LOCUS_03030 1647 1081 gene locus_tag LOCUS_03040 1647 1081 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983441.1 protein_id gnl|my_center|LOCUS_03040 2114 2557 gene locus_tag LOCUS_03050 2114 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03050 2677 4800 gene locus_tag LOCUS_03060 2677 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 4885 6213 gene locus_tag LOCUS_03070 gene uhpC 4885 6213 CDS product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543352.1 protein_id gnl|my_center|LOCUS_03070 6229 7059 gene locus_tag LOCUS_03080 6229 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 7168 9228 gene locus_tag LOCUS_03090 7168 9228 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095788.1 protein_id gnl|my_center|LOCUS_03090 9414 10217 gene locus_tag LOCUS_03100 gene fbpC 9414 10217 CDS product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078833.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03100 10693 11760 gene locus_tag LOCUS_03110 10693 11760 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626060.1 protein_id gnl|my_center|LOCUS_03110 11900 12586 gene locus_tag LOCUS_03120 11900 12586 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388664.1 protein_id gnl|my_center|LOCUS_03120 12579 13403 gene locus_tag LOCUS_03130 gene eutJ 12579 13403 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388665.1 protein_id gnl|my_center|LOCUS_03130 13408 14088 gene locus_tag LOCUS_03140 13408 14088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 14100 14372 gene locus_tag LOCUS_03150 14100 14372 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_03150 14469 14795 gene locus_tag LOCUS_03160 14469 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 14902 16038 gene locus_tag LOCUS_03170 gene tdcD 14902 16038 CDS product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661584.1 protein_id gnl|my_center|LOCUS_03170 16366 16647 gene locus_tag LOCUS_03180 gene pduA 16366 16647 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_03180 16669 17454 gene locus_tag LOCUS_03190 gene pduB 16669 17454 CDS product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388661.1 protein_id gnl|my_center|LOCUS_03190 17682 18980 gene locus_tag LOCUS_03200 17682 18980 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_03200 19062 19301 gene locus_tag LOCUS_03210 19062 19301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388670.1 protein_id gnl|my_center|LOCUS_03210 19312 19887 gene locus_tag LOCUS_03220 19312 19887 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388657.1 protein_id gnl|my_center|LOCUS_03220 19936 22230 gene locus_tag LOCUS_03230 19936 22230 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388658.1 protein_id gnl|my_center|LOCUS_03230 22352 22137 gene locus_tag LOCUS_03240 22352 22137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 22473 23390 gene locus_tag LOCUS_03250 22473 23390 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388671.1 protein_id gnl|my_center|LOCUS_03250 23535 24227 gene locus_tag LOCUS_03260 23535 24227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03260 24170 24403 gene locus_tag LOCUS_03270 24170 24403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03270 24910 24518 gene locus_tag LOCUS_03280 24910 24518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 25038 24886 gene locus_tag LOCUS_03290 25038 24886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03290 26234 25083 gene locus_tag LOCUS_03300 gene metK 26234 25083 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627231.1 protein_id gnl|my_center|LOCUS_03300 27418 26354 gene locus_tag LOCUS_03310 27418 26354 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388674.1 protein_id gnl|my_center|LOCUS_03310 28665 27436 gene locus_tag LOCUS_03320 28665 27436 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388673.1 protein_id gnl|my_center|LOCUS_03320 29599 29300 gene locus_tag LOCUS_03330 29599 29300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 29939 30928 gene locus_tag LOCUS_03340 gene foxR 29939 30928 CDS product ferrioxamine uptake transcriptional regulator FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074609.1 protein_id gnl|my_center|LOCUS_03340 31069 33255 gene locus_tag LOCUS_03350 gene foxA 31069 33255 CDS product ferrioxamine B receptor FoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127727.1 protein_id gnl|my_center|LOCUS_03350 33440 33763 gene locus_tag LOCUS_03360 33440 33763 CDS product DUF1889 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369626.1 protein_id gnl|my_center|LOCUS_03360 33926 33851 gene locus_tag LOCUS_t00050 33926 33851 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 34052 34558 gene locus_tag LOCUS_03370 gene mug 34052 34558 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098778.1 protein_id gnl|my_center|LOCUS_03370 36152 34611 gene locus_tag LOCUS_03380 gene rpoD 36152 34611 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098777.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03380 36397 36116 gene locus_tag LOCUS_03390 36397 36116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03390 38305 36551 gene locus_tag LOCUS_03400 gene dnaG 38305 36551 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098776.1 protein_id gnl|my_center|LOCUS_03400 38690 38475 gene locus_tag LOCUS_03410 gene rpsU 38690 38475 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence008 <1 516 gene locus_tag LOCUS_03420 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002886687.1:FKBP-type peptidyl-prolyl cis-trans isomerase 806 1663 gene locus_tag LOCUS_03430 806 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03430 1594 2157 gene locus_tag LOCUS_03440 1594 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03440 2769 2221 gene locus_tag LOCUS_03450 2769 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03450 3857 2973 gene locus_tag LOCUS_03460 3857 2973 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095314.1 protein_id gnl|my_center|LOCUS_03460 3354 3391 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4761 3934 gene locus_tag LOCUS_03470 4761 3934 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095315.1 protein_id gnl|my_center|LOCUS_03470 5687 4857 gene locus_tag LOCUS_03480 5687 4857 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704185.1 protein_id gnl|my_center|LOCUS_03480 5772 6170 gene locus_tag LOCUS_03490 5772 6170 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201297.1 protein_id gnl|my_center|LOCUS_03490 8119 6167 gene locus_tag LOCUS_03500 8119 6167 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589381.1 protein_id gnl|my_center|LOCUS_03500 8332 9072 gene locus_tag LOCUS_03510 gene cysQ 8332 9072 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893400.1 protein_id gnl|my_center|LOCUS_03510 9619 9062 gene locus_tag LOCUS_03520 9619 9062 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095323.1 protein_id gnl|my_center|LOCUS_03520 9955 10161 gene locus_tag LOCUS_03530 9955 10161 CDS product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501430.1 protein_id gnl|my_center|LOCUS_03530 11556 10237 gene locus_tag LOCUS_03540 11556 10237 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095324.1 protein_id gnl|my_center|LOCUS_03540 12708 11605 gene locus_tag LOCUS_03550 12708 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 15250 12725 gene locus_tag LOCUS_03560 15250 12725 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 protein_id gnl|my_center|LOCUS_03560 15979 15263 gene locus_tag LOCUS_03570 15979 15263 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703410.1 protein_id gnl|my_center|LOCUS_03570 16512 16045 gene locus_tag LOCUS_03580 16512 16045 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521426.1 protein_id gnl|my_center|LOCUS_03580 17562 16927 gene locus_tag LOCUS_03590 gene msrA 17562 16927 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305659.1 protein_id gnl|my_center|LOCUS_03590 18068 18667 gene locus_tag LOCUS_03600 18068 18667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03600 18669 19454 gene locus_tag LOCUS_03610 18669 19454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03610 19451 23227 gene locus_tag LOCUS_03620 gene tamB 19451 23227 CDS product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095334.1 protein_id gnl|my_center|LOCUS_03620 23230 23574 gene locus_tag LOCUS_03630 23230 23574 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027890.1 protein_id gnl|my_center|LOCUS_03630 24366 24899 gene locus_tag LOCUS_03640 24366 24899 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097473.1 protein_id gnl|my_center|LOCUS_03640 24979 25662 gene locus_tag LOCUS_03650 24979 25662 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 protein_id gnl|my_center|LOCUS_03650 25662 26753 gene locus_tag LOCUS_03660 25662 26753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03660 26892 26965 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26992 28158 gene locus_tag LOCUS_03670 26992 28158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03670 28158 29198 gene locus_tag LOCUS_03680 28158 29198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 29694 29278 gene locus_tag LOCUS_03690 29694 29278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03690 29852 29583 gene locus_tag LOCUS_03700 29852 29583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03700 30295 31209 gene locus_tag LOCUS_03710 gene ytfQ 30295 31209 CDS product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014882271.1 protein_id gnl|my_center|LOCUS_03710 31278 32780 gene locus_tag LOCUS_03720 31278 32780 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095340.1 protein_id gnl|my_center|LOCUS_03720 32793 33809 gene locus_tag LOCUS_03730 32793 33809 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799150.1 protein_id gnl|my_center|LOCUS_03730 33802 34803 gene locus_tag LOCUS_03740 gene yjfF 33802 34803 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830436.1 protein_id gnl|my_center|LOCUS_03740 34905 35384 gene locus_tag LOCUS_03750 34905 35384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03750 35654 35705 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35726 36346 gene locus_tag LOCUS_03760 35726 36346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 37412 36414 gene locus_tag LOCUS_03770 gene fbp 37412 36414 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095345.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence009 277 359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1120 413 gene locus_tag LOCUS_03780 gene endA 1120 413 CDS product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098661.1 protein_id gnl|my_center|LOCUS_03780 1726 1217 gene locus_tag LOCUS_03790 1726 1217 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860035.1 protein_id gnl|my_center|LOCUS_03790 3182 1800 gene locus_tag LOCUS_03800 gene galP 3182 1800 CDS product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113171.1 protein_id gnl|my_center|LOCUS_03800 4684 3530 gene locus_tag LOCUS_03810 gene metK 4684 3530 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098658.1 protein_id gnl|my_center|LOCUS_03810 5654 6796 gene locus_tag LOCUS_03820 5654 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03820 6711 7457 gene locus_tag LOCUS_03830 6711 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03830 7936 7715 gene locus_tag LOCUS_03840 7936 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 7847 8533 gene locus_tag LOCUS_03850 7847 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03850 9341 8583 gene locus_tag LOCUS_03860 gene loiP 9341 8583 CDS product metalloprotease LoiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701842.1 protein_id gnl|my_center|LOCUS_03860 9630 11003 gene locus_tag LOCUS_03870 9630 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 10877 10969 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11104 11472 gene locus_tag LOCUS_03880 11104 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 12172 11522 gene locus_tag LOCUS_03890 12172 11522 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956919.1 protein_id gnl|my_center|LOCUS_03890 12696 12166 gene locus_tag LOCUS_03900 12696 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 12485 12520 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14042 12684 gene locus_tag LOCUS_03910 14042 12684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 13172 13297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14454 14062 gene locus_tag LOCUS_03920 14454 14062 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218564.1 protein_id gnl|my_center|LOCUS_03920 14835 15854 gene locus_tag LOCUS_03930 gene epd 14835 15854 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369761.1 protein_id gnl|my_center|LOCUS_03930 15904 16818 gene locus_tag LOCUS_03940 15904 16818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 16237 16296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17011 18087 gene locus_tag LOCUS_03950 gene fbaA 17011 18087 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098634.1 protein_id gnl|my_center|LOCUS_03950 18287 18562 gene locus_tag LOCUS_03960 18287 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03960 18581 19261 gene locus_tag LOCUS_03970 18581 19261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03970 19394 20029 gene locus_tag LOCUS_03980 gene argO 19394 20029 CDS product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703435.1 protein_id gnl|my_center|LOCUS_03980 20100 20798 gene locus_tag LOCUS_03990 20100 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 20683 20898 gene locus_tag LOCUS_04000 20683 20898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04000 21670 20930 gene locus_tag LOCUS_04010 gene argP 21670 20930 CDS product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499727.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04010 21962 22621 gene locus_tag LOCUS_04020 gene rpiA 21962 22621 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 protein_id gnl|my_center|LOCUS_04020 22892 24130 gene locus_tag LOCUS_04030 gene serA 22892 24130 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098629.1 protein_id gnl|my_center|LOCUS_04030 24762 24238 gene locus_tag LOCUS_04040 24762 24238 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098628.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04040 25376 25047 gene locus_tag LOCUS_04050 gene zapA 25376 25047 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205298.1 protein_id gnl|my_center|LOCUS_04050 25532 26101 gene locus_tag LOCUS_04060 25532 26101 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027229.1 protein_id gnl|my_center|LOCUS_04060 26127 27098 gene locus_tag LOCUS_04070 26127 27098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04070 27047 27442 gene locus_tag LOCUS_04080 27047 27442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 27439 28614 gene locus_tag LOCUS_04090 gene ubiH 27439 28614 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111195.1 protein_id gnl|my_center|LOCUS_04090 28625 29827 gene locus_tag LOCUS_04100 gene ubiI 28625 29827 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703429.1 protein_id gnl|my_center|LOCUS_04100 30239 31336 gene locus_tag LOCUS_04110 gene gcvT 30239 31336 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068738.1 protein_id gnl|my_center|LOCUS_04110 31363 31752 gene locus_tag LOCUS_04120 gene gcvH 31363 31752 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 protein_id gnl|my_center|LOCUS_04120 31863 34169 gene locus_tag LOCUS_04130 gene gcvP 31863 34169 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195062.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04130 34147 34707 gene locus_tag LOCUS_04140 34147 34707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04140 36838 35447 gene locus_tag LOCUS_04150 gene ccp 36838 35447 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784821.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence010 208 325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 618 767 gene locus_tag LOCUS_04160 618 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04160 1578 1243 gene locus_tag LOCUS_04170 1578 1243 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366825.1 protein_id gnl|my_center|LOCUS_04170 1728 2000 gene locus_tag LOCUS_04180 1728 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 2176 1997 gene locus_tag LOCUS_04190 2176 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3176 2289 gene locus_tag LOCUS_04200 gene lpxP 3176 2289 CDS product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484431.1 protein_id gnl|my_center|LOCUS_04200 5706 3664 gene locus_tag LOCUS_04210 gene dcp 5706 3664 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096778.1 protein_id gnl|my_center|LOCUS_04210 5856 6605 gene locus_tag LOCUS_04220 gene ydfG 5856 6605 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096779.1 protein_id gnl|my_center|LOCUS_04220 6688 7377 gene locus_tag LOCUS_04230 6688 7377 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096780.1 protein_id gnl|my_center|LOCUS_04230 7492 7695 gene locus_tag LOCUS_04240 gene ydfZ 7492 7695 CDS product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096785.1 protein_id gnl|my_center|LOCUS_04240 8907 7834 gene locus_tag LOCUS_04250 8907 7834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382183.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04250 9559 9227 gene locus_tag LOCUS_04260 9559 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 10742 9441 gene locus_tag LOCUS_04270 10742 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 12391 10841 gene locus_tag LOCUS_04280 12391 10841 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096787.1 protein_id gnl|my_center|LOCUS_04280 13825 12419 gene locus_tag LOCUS_04290 gene uxaC 13825 12419 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096788.1 protein_id gnl|my_center|LOCUS_04290 15085 13871 gene locus_tag LOCUS_04300 gene rspA 15085 13871 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096791.1 protein_id gnl|my_center|LOCUS_04300 15559 15233 gene locus_tag LOCUS_04310 15559 15233 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314753.1 protein_id gnl|my_center|LOCUS_04310 15949 16506 gene locus_tag LOCUS_04320 gene speG 15949 16506 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138584.1 protein_id gnl|my_center|LOCUS_04320 17232 16522 gene locus_tag LOCUS_04330 17232 16522 CDS product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096795.1 protein_id gnl|my_center|LOCUS_04330 17342 17644 gene locus_tag LOCUS_04340 17342 17644 CDS product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096796.1 protein_id gnl|my_center|LOCUS_04340 19125 17680 gene locus_tag LOCUS_04350 gene murP 19125 17680 CDS product PTS N-acetylmuramic acid transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703855.1 protein_id gnl|my_center|LOCUS_04350 20038 19136 gene locus_tag LOCUS_04360 gene murQ 20038 19136 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369100.1 protein_id gnl|my_center|LOCUS_04360 21515 20301 gene locus_tag LOCUS_04370 21515 20301 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706746.1 protein_id gnl|my_center|LOCUS_04370 22662 21520 gene locus_tag LOCUS_04380 22662 21520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04380 23407 22739 gene locus_tag LOCUS_04390 23407 22739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04390 23911 24621 gene locus_tag LOCUS_04400 gene osmY 23911 24621 CDS product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096821.1 protein_id gnl|my_center|LOCUS_04400 24644 25546 gene locus_tag LOCUS_04410 gene osmX 24644 25546 CDS product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211196.1 protein_id gnl|my_center|LOCUS_04410 25559 26206 gene locus_tag LOCUS_04420 gene osmW 25559 26206 CDS product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808875.1 protein_id gnl|my_center|LOCUS_04420 26347 26392 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26405 27100 gene locus_tag LOCUS_04430 26405 27100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 27327 27136 gene locus_tag LOCUS_04440 27327 27136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04440 27761 27354 gene locus_tag LOCUS_04450 27761 27354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04450 29102 27885 gene locus_tag LOCUS_04460 29102 27885 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225096.1 protein_id gnl|my_center|LOCUS_04460 30129 29209 gene locus_tag LOCUS_04470 30129 29209 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705289.1 protein_id gnl|my_center|LOCUS_04470 30329 31003 gene locus_tag LOCUS_04480 30329 31003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04480 30963 31478 gene locus_tag LOCUS_04490 30963 31478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04490 31550 33037 gene locus_tag LOCUS_04500 31550 33037 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705288.1 protein_id gnl|my_center|LOCUS_04500 33328 34146 gene locus_tag LOCUS_04510 33328 34146 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096841.1 protein_id gnl|my_center|LOCUS_04510 34502 34173 gene locus_tag LOCUS_04520 gene mdtI 34502 34173 CDS product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046661.1 protein_id gnl|my_center|LOCUS_04520 34851 34489 gene locus_tag LOCUS_04530 gene mdtJ 34851 34489 CDS product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882799.1 protein_id gnl|my_center|LOCUS_04530 35837 35433 gene locus_tag LOCUS_04540 35837 35433 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114423.1 protein_id gnl|my_center|LOCUS_04540 >Feature sequence011 1280 810 gene locus_tag LOCUS_04550 gene rpsG 1280 810 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861706.1 protein_id gnl|my_center|LOCUS_04550 1684 1376 gene locus_tag LOCUS_04560 gene rpsL 1684 1376 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 protein_id gnl|my_center|LOCUS_04560 2096 1809 gene locus_tag LOCUS_04570 gene tusB 2096 1809 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903373.1 protein_id gnl|my_center|LOCUS_04570 2466 2104 gene locus_tag LOCUS_04580 gene tusC 2466 2104 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820720.1 protein_id gnl|my_center|LOCUS_04580 2837 2466 gene locus_tag LOCUS_04590 gene tusD 2837 2466 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817322.1 protein_id gnl|my_center|LOCUS_04590 3580 2852 gene locus_tag LOCUS_04600 3580 2852 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091466.1 protein_id gnl|my_center|LOCUS_04600 4632 3901 gene locus_tag LOCUS_04610 gene fkpA 4632 3901 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099036.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04610 5441 4854 gene locus_tag LOCUS_04620 gene slyD 5441 4854 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099037.1 protein_id gnl|my_center|LOCUS_04620 5730 5536 gene locus_tag LOCUS_04630 5730 5536 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099038.1 protein_id gnl|my_center|LOCUS_04630 5895 5746 gene locus_tag LOCUS_04640 5895 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04640 7551 5932 gene locus_tag LOCUS_04650 gene kefB 7551 5932 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399162.1 protein_id gnl|my_center|LOCUS_04650 8102 7551 gene locus_tag LOCUS_04660 gene kefG 8102 7551 CDS product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099040.1 protein_id gnl|my_center|LOCUS_04660 8309 10213 gene locus_tag LOCUS_04670 8309 10213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099041.1 protein_id gnl|my_center|LOCUS_04670 10241 11257 gene locus_tag LOCUS_04680 10241 11257 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099052.1 protein_id gnl|my_center|LOCUS_04680 11254 11472 gene locus_tag LOCUS_04690 11254 11472 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369405.1 protein_id gnl|my_center|LOCUS_04690 11581 12330 gene locus_tag LOCUS_04700 11581 12330 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274690.1 protein_id gnl|my_center|LOCUS_04700 12793 12389 gene locus_tag LOCUS_04710 12793 12389 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027906.1 protein_id gnl|my_center|LOCUS_04710 13097 13729 gene locus_tag LOCUS_04720 gene crp 13097 13729 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 protein_id gnl|my_center|LOCUS_04720 13777 15876 gene locus_tag LOCUS_04730 13777 15876 CDS product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099057.1 protein_id gnl|my_center|LOCUS_04730 17083 15866 gene locus_tag LOCUS_04740 gene argD 17083 15866 CDS product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963784.1 protein_id gnl|my_center|LOCUS_04740 17732 17169 gene locus_tag LOCUS_04750 gene pabA 17732 17169 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099059.1 protein_id gnl|my_center|LOCUS_04750 18365 17763 gene locus_tag LOCUS_04760 18365 17763 CDS product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280679.1 protein_id gnl|my_center|LOCUS_04760 18525 18355 gene locus_tag LOCUS_04770 18525 18355 CDS product YhfG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519136.1 protein_id gnl|my_center|LOCUS_04770 19203 18631 gene locus_tag LOCUS_04780 gene ppiA 19203 18631 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099061.1 protein_id gnl|my_center|LOCUS_04780 19480 20652 gene locus_tag LOCUS_04790 gene tsgA 19480 20652 CDS product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099062.1 protein_id gnl|my_center|LOCUS_04790 21966 20668 gene locus_tag LOCUS_04800 21966 20668 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703651.1 protein_id gnl|my_center|LOCUS_04800 22205 24751 gene locus_tag LOCUS_04810 gene nirB 22205 24751 CDS product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049259.1 protein_id gnl|my_center|LOCUS_04810 24748 25074 gene locus_tag LOCUS_04820 gene nirD 24748 25074 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369393.1 protein_id gnl|my_center|LOCUS_04820 25266 26075 gene locus_tag LOCUS_04830 gene nirC 25266 26075 CDS product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493575.1 protein_id gnl|my_center|LOCUS_04830 26087 27811 gene locus_tag LOCUS_04840 gene cysG 26087 27811 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349881.1 protein_id gnl|my_center|LOCUS_04840 28149 29486 gene locus_tag LOCUS_04850 gene frlA 28149 29486 CDS product fructoselysine/psicoselysine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535505.1 protein_id gnl|my_center|LOCUS_04850 29508 30530 gene locus_tag LOCUS_04860 gene frlB 29508 30530 CDS product fructoselysine 6-phosphate deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295163.1 protein_id gnl|my_center|LOCUS_04860 30583 31401 gene locus_tag LOCUS_04870 gene frlC 30583 31401 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847833.1 protein_id gnl|my_center|LOCUS_04870 31410 32195 gene locus_tag LOCUS_04880 gene frlD 31410 32195 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853351.1 protein_id gnl|my_center|LOCUS_04880 32296 33030 gene locus_tag LOCUS_04890 gene frlR 32296 33030 CDS product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302327.1 protein_id gnl|my_center|LOCUS_04890 34077 33073 gene locus_tag LOCUS_04900 gene trpS 34077 33073 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369391.1 protein_id gnl|my_center|LOCUS_04900 34831 34070 gene locus_tag LOCUS_04910 gene gph 34831 34070 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099068.1 protein_id gnl|my_center|LOCUS_04910 35501 34824 gene locus_tag LOCUS_04920 gene rpe 35501 34824 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503032.1 protein_id gnl|my_center|LOCUS_04920 36357 35542 gene locus_tag LOCUS_04930 gene dam 36357 35542 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742143.1 protein_id gnl|my_center|LOCUS_04930 36657 36424 gene locus_tag LOCUS_04940 36657 36424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence012 <1 1453 gene locus_tag LOCUS_04950 <1 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704378.1:DNA polymerase II 1584 2516 gene locus_tag LOCUS_04960 1584 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04960 2504 4333 gene locus_tag LOCUS_04970 2504 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04970 4480 5133 gene locus_tag LOCUS_04980 gene rluA 4480 5133 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002888348.1 protein_id gnl|my_center|LOCUS_04980 5988 5173 gene locus_tag LOCUS_04990 gene djlA 5988 5173 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200573.1 protein_id gnl|my_center|LOCUS_04990 6351 7343 gene locus_tag LOCUS_05000 6351 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05000 7504 8715 gene locus_tag LOCUS_05010 7504 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05010 8764 10050 gene locus_tag LOCUS_05020 gene surA 8764 10050 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095542.1 protein_id gnl|my_center|LOCUS_05020 10050 11045 gene locus_tag LOCUS_05030 gene pdxA 10050 11045 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095541.1 protein_id gnl|my_center|LOCUS_05030 11042 11863 gene locus_tag LOCUS_05040 gene rsmA 11042 11863 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065397.1 protein_id gnl|my_center|LOCUS_05040 11867 12244 gene locus_tag LOCUS_05050 gene apaG 11867 12244 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095539.1 protein_id gnl|my_center|LOCUS_05050 12249 13112 gene locus_tag LOCUS_05060 gene apaH 12249 13112 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257211.1 protein_id gnl|my_center|LOCUS_05060 13635 13156 gene locus_tag LOCUS_05070 gene folA 13635 13156 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368294.1 protein_id gnl|my_center|LOCUS_05070 13904 14518 gene locus_tag LOCUS_05080 13904 14518 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166992.1 protein_id gnl|my_center|LOCUS_05080 14807 15319 gene locus_tag LOCUS_05090 14807 15319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 17446 15584 gene locus_tag LOCUS_05100 gene kefC 17446 15584 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095537.1 protein_id gnl|my_center|LOCUS_05100 17858 17439 gene locus_tag LOCUS_05110 gene kefF 17858 17439 CDS product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600737.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05110 19291 18002 gene locus_tag LOCUS_05120 19291 18002 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136163.1 protein_id gnl|my_center|LOCUS_05120 19621 19334 gene locus_tag LOCUS_05130 gene fixX 19621 19334 CDS product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203747.1 protein_id gnl|my_center|LOCUS_05130 20904 19618 gene locus_tag LOCUS_05140 20904 19618 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287774.1 protein_id gnl|my_center|LOCUS_05140 21878 20961 gene locus_tag LOCUS_05150 21878 20961 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032189.1 protein_id gnl|my_center|LOCUS_05150 22663 21890 gene locus_tag LOCUS_05160 22663 21890 CDS product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692187.1 protein_id gnl|my_center|LOCUS_05160 23105 24619 gene locus_tag LOCUS_05170 gene caiT 23105 24619 CDS product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787109.1 protein_id gnl|my_center|LOCUS_05170 24660 25802 gene locus_tag LOCUS_05180 gene caiA 24660 25802 CDS product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 protein_id gnl|my_center|LOCUS_05180 25875 27095 gene locus_tag LOCUS_05190 gene caiB 25875 27095 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349928.1 protein_id gnl|my_center|LOCUS_05190 27162 28718 gene locus_tag LOCUS_05200 gene caiC 27162 28718 CDS product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355790.1 protein_id gnl|my_center|LOCUS_05200 28790 29575 gene locus_tag LOCUS_05210 gene caiD 28790 29575 CDS product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004377.1 protein_id gnl|my_center|LOCUS_05210 29598 30188 gene locus_tag LOCUS_05220 gene caiE 29598 30188 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122865.1 protein_id gnl|my_center|LOCUS_05220 30628 30233 gene locus_tag LOCUS_05230 gene caiF 30628 30233 CDS product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333324.1 protein_id gnl|my_center|LOCUS_05230 31098 30865 gene locus_tag LOCUS_05240 31098 30865 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704368.1 protein_id gnl|my_center|LOCUS_05240 31777 31211 gene locus_tag LOCUS_05250 31777 31211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 32170 31892 gene locus_tag LOCUS_05260 32170 31892 CDS product biofilm development regulator YmgB/AriR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367639.1 protein_id gnl|my_center|LOCUS_05260 32524 32207 gene locus_tag LOCUS_05270 32524 32207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 32934 32689 gene locus_tag LOCUS_05280 gene ycgZ 32934 32689 CDS product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096960.1 protein_id gnl|my_center|LOCUS_05280 33378 34526 gene locus_tag LOCUS_05290 33378 34526 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704783.1 protein_id gnl|my_center|LOCUS_05290 34976 35446 gene locus_tag LOCUS_05300 34976 35446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05300 <36594 35500 gene locus_tag LOCUS_05310 <36594 35500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095532.1:carbamoyl-phosphate synthase large subunit >Feature sequence013 <1 535 gene locus_tag LOCUS_05320 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097436.1:glutathione ABC transporter ATP-binding protein GsiA 537 2075 gene locus_tag LOCUS_05330 gene gsiB 537 2075 CDS product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097435.1 protein_id gnl|my_center|LOCUS_05330 2121 3041 gene locus_tag LOCUS_05340 gene gsiC 2121 3041 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936043.1 protein_id gnl|my_center|LOCUS_05340 3086 3955 gene locus_tag LOCUS_05350 gene gsiD 3086 3955 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704838.1 protein_id gnl|my_center|LOCUS_05350 5322 3997 gene locus_tag LOCUS_05360 gene rimO 5322 3997 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097432.1 protein_id gnl|my_center|LOCUS_05360 5517 5717 gene locus_tag LOCUS_05370 5517 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 6622 5714 gene locus_tag LOCUS_05380 6622 5714 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816320.1 protein_id gnl|my_center|LOCUS_05380 6154 6232 gene locus_tag LOCUS_t00060 6154 6232 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6910 7209 gene locus_tag LOCUS_05390 6910 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 7361 7663 gene locus_tag LOCUS_05400 7361 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05400 7675 8472 gene locus_tag LOCUS_05410 7675 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05410 8961 8473 gene locus_tag LOCUS_05420 8961 8473 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631908.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05420 9107 8958 gene locus_tag LOCUS_05430 9107 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05430 9358 10563 gene locus_tag LOCUS_05440 gene dacC 9358 10563 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831210.1 protein_id gnl|my_center|LOCUS_05440 11225 10605 gene locus_tag LOCUS_05450 gene deoR 11225 10605 CDS product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097425.1 protein_id gnl|my_center|LOCUS_05450 11263 11309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11982 11374 gene locus_tag LOCUS_05460 gene ybjG 11982 11374 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097424.1 protein_id gnl|my_center|LOCUS_05460 12265 13290 gene locus_tag LOCUS_05470 12265 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05470 13199 13489 gene locus_tag LOCUS_05480 13199 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05480 14332 13520 gene locus_tag LOCUS_05490 14332 13520 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097421.1 protein_id gnl|my_center|LOCUS_05490 15540 14347 gene locus_tag LOCUS_05500 15540 14347 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620242.1 protein_id gnl|my_center|LOCUS_05500 15629 16189 gene locus_tag LOCUS_05510 15629 16189 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097419.1 protein_id gnl|my_center|LOCUS_05510 17353 16262 gene locus_tag LOCUS_05520 17353 16262 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290950.1 protein_id gnl|my_center|LOCUS_05520 18039 17419 gene locus_tag LOCUS_05530 18039 17419 CDS product phage repressor protein CI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047327.1 protein_id gnl|my_center|LOCUS_05530 18176 18397 gene locus_tag LOCUS_05540 18176 18397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097412.1 protein_id gnl|my_center|LOCUS_05540 18430 18933 gene locus_tag LOCUS_05550 18430 18933 CDS product phage regulatory CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097411.1 protein_id gnl|my_center|LOCUS_05550 18941 19135 gene locus_tag LOCUS_05560 18941 19135 CDS product DUF2724 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643377.1 protein_id gnl|my_center|LOCUS_05560 19125 19553 gene locus_tag LOCUS_05570 19125 19553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 19550 19951 gene locus_tag LOCUS_05580 19550 19951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974860.1 protein_id gnl|my_center|LOCUS_05580 20018 20263 gene locus_tag LOCUS_05590 20018 20263 CDS product DUF2732 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551165.1 protein_id gnl|my_center|LOCUS_05590 20254 20562 gene locus_tag LOCUS_05600 20254 20562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 20546 21382 gene locus_tag LOCUS_05610 20546 21382 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279403.1 protein_id gnl|my_center|LOCUS_05610 21379 22023 gene locus_tag LOCUS_05620 21379 22023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05620 21929 22573 gene locus_tag LOCUS_05630 21929 22573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05630 22465 23376 gene locus_tag LOCUS_05640 22465 23376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05640 23495 23707 gene locus_tag LOCUS_05650 23495 23707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097403.1 protein_id gnl|my_center|LOCUS_05650 23938 23681 gene locus_tag LOCUS_05660 23938 23681 CDS product ogr/Delta-like zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602735.1 protein_id gnl|my_center|LOCUS_05660 25014 23989 gene locus_tag LOCUS_05670 25014 23989 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097401.1 protein_id gnl|my_center|LOCUS_05670 26786 25011 gene locus_tag LOCUS_05680 26786 25011 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097400.1 protein_id gnl|my_center|LOCUS_05680 26946 27755 gene locus_tag LOCUS_05690 26946 27755 CDS product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018795.1 protein_id gnl|my_center|LOCUS_05690 27807 28829 gene locus_tag LOCUS_05700 27807 28829 CDS product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003838043.1 protein_id gnl|my_center|LOCUS_05700 28833 29537 gene locus_tag LOCUS_05710 gene gpM 28833 29537 CDS product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218531.1 protein_id gnl|my_center|LOCUS_05710 29631 30083 gene locus_tag LOCUS_05720 29631 30083 CDS product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024143839.1 protein_id gnl|my_center|LOCUS_05720 30080 30559 gene locus_tag LOCUS_05730 30080 30559 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084223.1 protein_id gnl|my_center|LOCUS_05730 30552 31235 gene locus_tag LOCUS_05740 30552 31235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097394.1 protein_id gnl|my_center|LOCUS_05740 31254 32216 gene locus_tag LOCUS_05750 31254 32216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05750 32168 32359 gene locus_tag LOCUS_05760 32168 32359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05760 32362 32814 gene locus_tag LOCUS_05770 32362 32814 CDS product DUF2597 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097392.1 protein_id gnl|my_center|LOCUS_05770 32820 32987 gene locus_tag LOCUS_05780 32820 32987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05780 32981 33121 gene locus_tag LOCUS_05790 32981 33121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05790 33118 33459 gene locus_tag LOCUS_05800 33118 33459 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175561.1 protein_id gnl|my_center|LOCUS_05800 33459 33824 gene locus_tag LOCUS_05810 33459 33824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097389.1 protein_id gnl|my_center|LOCUS_05810 33769 33954 gene locus_tag LOCUS_05820 33769 33954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 33947 34213 gene locus_tag LOCUS_05830 33947 34213 CDS product putative phage tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001738732.1 protein_id gnl|my_center|LOCUS_05830 34401 35237 gene locus_tag LOCUS_05840 34401 35237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05840 35482 35631 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence014 969 580 gene locus_tag LOCUS_05850 969 580 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901082.1 protein_id gnl|my_center|LOCUS_05850 3144 1006 gene locus_tag LOCUS_05860 3144 1006 CDS product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095667.1 protein_id gnl|my_center|LOCUS_05860 4217 3258 gene locus_tag LOCUS_05870 gene accA 4217 3258 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095666.1 protein_id gnl|my_center|LOCUS_05870 5489 4230 gene locus_tag LOCUS_05880 5489 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 5515 5705 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7604 6000 gene locus_tag LOCUS_05890 7604 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05890 8232 7636 gene locus_tag LOCUS_05900 gene rnhB 8232 7636 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095664.1 protein_id gnl|my_center|LOCUS_05900 9263 8229 gene locus_tag LOCUS_05910 gene lpxB 9263 8229 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095663.1 protein_id gnl|my_center|LOCUS_05910 10167 9379 gene locus_tag LOCUS_05920 gene lpxA 10167 9379 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 protein_id gnl|my_center|LOCUS_05920 10626 10171 gene locus_tag LOCUS_05930 gene fabZ 10626 10171 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426706.1 protein_id gnl|my_center|LOCUS_05930 11766 10741 gene locus_tag LOCUS_05940 gene lpxD 11766 10741 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139279.1 protein_id gnl|my_center|LOCUS_05940 12264 11770 gene locus_tag LOCUS_05950 gene skp 12264 11770 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095660.1 protein_id gnl|my_center|LOCUS_05950 14645 12384 gene locus_tag LOCUS_05960 gene bamA 14645 12384 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 protein_id gnl|my_center|LOCUS_05960 15951 14812 gene locus_tag LOCUS_05970 gene rseP 15951 14812 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095658.1 protein_id gnl|my_center|LOCUS_05970 16965 16108 gene locus_tag LOCUS_05980 gene cdsA 16965 16108 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095657.1 protein_id gnl|my_center|LOCUS_05980 17736 16978 gene locus_tag LOCUS_05990 gene ispU 17736 16978 CDS product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028110.1 protein_id gnl|my_center|LOCUS_05990 18482 17925 gene locus_tag LOCUS_06000 18482 17925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06000 19107 18472 gene locus_tag LOCUS_06010 19107 18472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06010 19833 19234 gene locus_tag LOCUS_06020 gene frr 19833 19234 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368165.1 protein_id gnl|my_center|LOCUS_06020 20686 19961 gene locus_tag LOCUS_06030 gene pyrH 20686 19961 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856194.1 protein_id gnl|my_center|LOCUS_06030 21166 20825 gene locus_tag LOCUS_06040 21166 20825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06040 21684 21343 gene locus_tag LOCUS_06050 21684 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06050 21977 21804 gene locus_tag LOCUS_06060 21977 21804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06060 22449 21940 gene locus_tag LOCUS_06070 gene rpsB 22449 21940 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004858107.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06070 22769 23563 gene locus_tag LOCUS_06080 gene map 22769 23563 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095652.1 protein_id gnl|my_center|LOCUS_06080 23735 26203 gene locus_tag LOCUS_06090 gene glnD 23735 26203 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095651.1 protein_id gnl|my_center|LOCUS_06090 26194 26418 gene locus_tag LOCUS_06100 26194 26418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06100 26450 27274 gene locus_tag LOCUS_06110 gene dapD 26450 27274 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_06110 27383 27769 gene locus_tag LOCUS_06120 27383 27769 CDS product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272188.1 protein_id gnl|my_center|LOCUS_06120 28943 27810 gene locus_tag LOCUS_06130 gene cdaR 28943 27810 CDS product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 protein_id gnl|my_center|LOCUS_06130 29894 29073 gene locus_tag LOCUS_06140 29894 29073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06140 30454 29891 gene locus_tag LOCUS_06150 30454 29891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06150 32107 30593 gene locus_tag LOCUS_06160 gene dgt 32107 30593 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057094.1 protein_id gnl|my_center|LOCUS_06160 32200 32859 gene locus_tag LOCUS_06170 gene mtnN 32200 32859 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 protein_id gnl|my_center|LOCUS_06170 32852 33445 gene locus_tag LOCUS_06180 32852 33445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06180 33445 33633 gene locus_tag LOCUS_06190 33445 33633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06190 33643 34263 gene locus_tag LOCUS_06200 33643 34263 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 protein_id gnl|my_center|LOCUS_06200 34658 34314 gene locus_tag LOCUS_06210 gene erpA 34658 34314 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence015 564 109 gene locus_tag LOCUS_06220 564 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06220 1137 595 gene locus_tag LOCUS_06230 1137 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06230 1396 1118 gene locus_tag LOCUS_06240 1396 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06240 1530 2222 gene locus_tag LOCUS_06250 1530 2222 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642849.1 protein_id gnl|my_center|LOCUS_06250 2384 3469 gene locus_tag LOCUS_06260 gene serC 2384 3469 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882989.1 protein_id gnl|my_center|LOCUS_06260 3541 3996 gene locus_tag LOCUS_06270 3541 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06270 4008 4760 gene locus_tag LOCUS_06280 4008 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06280 4935 5621 gene locus_tag LOCUS_06290 gene cmk 4935 5621 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125016.1 protein_id gnl|my_center|LOCUS_06290 5732 7405 gene locus_tag LOCUS_06300 gene rpsA 5732 7405 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391091.1 protein_id gnl|my_center|LOCUS_06300 7478 7780 gene locus_tag LOCUS_06310 gene ihfB 7478 7780 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167332.1 protein_id gnl|my_center|LOCUS_06310 7981 9045 gene locus_tag LOCUS_06320 7981 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06320 8942 10243 gene locus_tag LOCUS_06330 8942 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06330 10280 12028 gene locus_tag LOCUS_06340 gene msbA 10280 12028 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551259.1 protein_id gnl|my_center|LOCUS_06340 12025 13002 gene locus_tag LOCUS_06350 gene lpxK 12025 13002 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704887.1 protein_id gnl|my_center|LOCUS_06350 13032 14255 gene locus_tag LOCUS_06360 13032 14255 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097301.1 protein_id gnl|my_center|LOCUS_06360 14303 14485 gene locus_tag LOCUS_06370 gene ycaR 14303 14485 CDS product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367465.1 protein_id gnl|my_center|LOCUS_06370 14482 15228 gene locus_tag LOCUS_06380 gene kdsB 14482 15228 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097299.1 protein_id gnl|my_center|LOCUS_06380 15356 16141 gene locus_tag LOCUS_06390 15356 16141 CDS product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097298.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06390 16977 16198 gene locus_tag LOCUS_06400 gene elyC 16977 16198 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899546.1 protein_id gnl|my_center|LOCUS_06400 17111 17890 gene locus_tag LOCUS_06410 gene cmoM 17111 17890 CDS product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301572.1 protein_id gnl|my_center|LOCUS_06410 17894 19216 gene locus_tag LOCUS_06420 gene mukF 17894 19216 CDS product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288827.1 protein_id gnl|my_center|LOCUS_06420 19224 19907 gene locus_tag LOCUS_06430 gene mukE 19224 19907 CDS product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097294.1 protein_id gnl|my_center|LOCUS_06430 19900 22239 gene locus_tag LOCUS_06440 19900 22239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06440 22310 22894 gene locus_tag LOCUS_06450 22310 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06450 22926 24263 gene locus_tag LOCUS_06460 22926 24263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06460 24479 25324 gene locus_tag LOCUS_06470 24479 25324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06470 25339 26289 gene locus_tag LOCUS_06480 25339 26289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06480 26414 27016 gene locus_tag LOCUS_06490 26414 27016 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295932.1 protein_id gnl|my_center|LOCUS_06490 27052 27699 gene locus_tag LOCUS_06500 gene gloC 27052 27699 CDS product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109455.1 protein_id gnl|my_center|LOCUS_06500 27917 27744 gene locus_tag LOCUS_06510 27917 27744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06510 28923 27871 gene locus_tag LOCUS_06520 gene aspC 28923 27871 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462680.1 protein_id gnl|my_center|LOCUS_06520 30220 29108 gene locus_tag LOCUS_06530 gene ompF 30220 29108 CDS product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977709.1 protein_id gnl|my_center|LOCUS_06530 32202 30802 gene locus_tag LOCUS_06540 gene asnS 32202 30802 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117883.1 protein_id gnl|my_center|LOCUS_06540 33576 32374 gene locus_tag LOCUS_06550 gene pncB 33576 32374 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301736.1 protein_id gnl|my_center|LOCUS_06550 33575 33811 gene locus_tag LOCUS_06560 33575 33811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence016 1083 136 gene locus_tag LOCUS_06570 1083 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06570 146 187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1265 1957 gene locus_tag LOCUS_06580 1265 1957 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369222.1 protein_id gnl|my_center|LOCUS_06580 2006 3025 gene locus_tag LOCUS_06590 2006 3025 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094979.1 protein_id gnl|my_center|LOCUS_06590 3134 3883 gene locus_tag LOCUS_06600 3134 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703772.1 protein_id gnl|my_center|LOCUS_06600 3887 4804 gene locus_tag LOCUS_06610 3887 4804 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094977.1 protein_id gnl|my_center|LOCUS_06610 4907 5866 gene locus_tag LOCUS_06620 4907 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06620 5751 6179 gene locus_tag LOCUS_06630 5751 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06630 6246 7223 gene locus_tag LOCUS_06640 gene ghrB 6246 7223 CDS product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369217.1 protein_id gnl|my_center|LOCUS_06640 8426 7233 gene locus_tag LOCUS_06650 8426 7233 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 protein_id gnl|my_center|LOCUS_06650 8505 9227 gene locus_tag LOCUS_06660 8505 9227 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703823.1 protein_id gnl|my_center|LOCUS_06660 10611 9241 gene locus_tag LOCUS_06670 10611 9241 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703822.1 protein_id gnl|my_center|LOCUS_06670 10982 10608 gene locus_tag LOCUS_06680 10982 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06680 11254 10979 gene locus_tag LOCUS_06690 11254 10979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06690 12180 11209 gene locus_tag LOCUS_06700 12180 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06700 13086 12376 gene locus_tag LOCUS_06710 13086 12376 CDS product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094974.1 protein_id gnl|my_center|LOCUS_06710 13653 14594 gene locus_tag LOCUS_06720 13653 14594 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 protein_id gnl|my_center|LOCUS_06720 14610 15422 gene locus_tag LOCUS_06730 14610 15422 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_06730 15432 16973 gene locus_tag LOCUS_06740 gene yejF 15432 16973 CDS product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097987.1 protein_id gnl|my_center|LOCUS_06740 17318 16977 gene locus_tag LOCUS_06750 17318 16977 CDS product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 protein_id gnl|my_center|LOCUS_06750 17868 17656 gene locus_tag LOCUS_06760 17868 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 18641 17859 gene locus_tag LOCUS_06770 18641 17859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 19387 18680 gene locus_tag LOCUS_06780 gene rsuA 19387 18680 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097990.1 protein_id gnl|my_center|LOCUS_06780 19660 21150 gene locus_tag LOCUS_06790 19660 21150 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097991.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06790 21355 21639 gene locus_tag LOCUS_06800 gene rplY 21355 21639 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 protein_id gnl|my_center|LOCUS_06800 22696 21692 gene locus_tag LOCUS_06810 gene yejK 22696 21692 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050806.1 protein_id gnl|my_center|LOCUS_06810 22831 23058 gene locus_tag LOCUS_06820 22831 23058 CDS product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135667.1 protein_id gnl|my_center|LOCUS_06820 23078 24751 gene locus_tag LOCUS_06830 gene yejM 23078 24751 CDS product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097996.1 protein_id gnl|my_center|LOCUS_06830 24656 24668 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25379 25807 gene locus_tag LOCUS_06840 25379 25807 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220683.1 protein_id gnl|my_center|LOCUS_06840 26029 26703 gene locus_tag LOCUS_06850 26029 26703 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334592.1 protein_id gnl|my_center|LOCUS_06850 27479 26706 gene locus_tag LOCUS_06860 27479 26706 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 protein_id gnl|my_center|LOCUS_06860 27775 29973 gene locus_tag LOCUS_06870 27775 29973 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097826.1 protein_id gnl|my_center|LOCUS_06870 30980 30018 gene locus_tag LOCUS_06880 30980 30018 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209407.1 protein_id gnl|my_center|LOCUS_06880 31964 31107 gene locus_tag LOCUS_06890 31964 31107 CDS product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027214.1 protein_id gnl|my_center|LOCUS_06890 32799 31954 gene locus_tag LOCUS_06900 32799 31954 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027215.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence017 <1 945 gene locus_tag LOCUS_06910 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994102.1:cellulose biosynthesis protein BcsC 947 1414 gene locus_tag LOCUS_06920 947 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1424 2419 gene locus_tag LOCUS_06930 1424 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3226 2456 gene locus_tag LOCUS_06940 3226 2456 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095418.1 protein_id gnl|my_center|LOCUS_06940 3700 3362 gene locus_tag LOCUS_06950 3700 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 3648 4505 gene locus_tag LOCUS_06960 3648 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06960 4502 4885 gene locus_tag LOCUS_06970 4502 4885 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095417.1 protein_id gnl|my_center|LOCUS_06970 5917 4892 gene locus_tag LOCUS_06980 5917 4892 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819931.1 protein_id gnl|my_center|LOCUS_06980 6093 7853 gene locus_tag LOCUS_06990 6093 7853 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_06990 7856 8284 gene locus_tag LOCUS_07000 7856 8284 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706184.1 protein_id gnl|my_center|LOCUS_07000 8295 8789 gene locus_tag LOCUS_07010 8295 8789 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706183.1 protein_id gnl|my_center|LOCUS_07010 8800 9597 gene locus_tag LOCUS_07020 8800 9597 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706182.1 protein_id gnl|my_center|LOCUS_07020 9597 10415 gene locus_tag LOCUS_07030 9597 10415 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706181.1 protein_id gnl|my_center|LOCUS_07030 11235 10453 gene locus_tag LOCUS_07040 11235 10453 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811367.1 protein_id gnl|my_center|LOCUS_07040 11788 11228 gene locus_tag LOCUS_07050 11788 11228 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706187.1 protein_id gnl|my_center|LOCUS_07050 12801 11887 gene locus_tag LOCUS_07060 gene rihC 12801 11887 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127280.1 protein_id gnl|my_center|LOCUS_07060 13034 13861 gene locus_tag LOCUS_07070 13034 13861 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967028.1 protein_id gnl|my_center|LOCUS_07070 13876 15303 gene locus_tag LOCUS_07080 gene galP 13876 15303 CDS product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314112.1 protein_id gnl|my_center|LOCUS_07080 15320 16102 gene locus_tag LOCUS_07090 15320 16102 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975372.1 protein_id gnl|my_center|LOCUS_07090 17115 16165 gene locus_tag LOCUS_07100 gene ispH 17115 16165 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368325.1 protein_id gnl|my_center|LOCUS_07100 18046 17096 gene locus_tag LOCUS_07110 18046 17096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 18564 18046 gene locus_tag LOCUS_07120 18564 18046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 20738 18450 gene locus_tag LOCUS_07130 gene ileS 20738 18450 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286823.1 protein_id gnl|my_center|LOCUS_07130 21701 20793 gene locus_tag LOCUS_07140 gene ribF 21701 20793 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704352.1 protein_id gnl|my_center|LOCUS_07140 22028 22291 gene locus_tag LOCUS_07150 gene rpsT 22028 22291 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856458.1 protein_id gnl|my_center|LOCUS_07150 22541 23662 gene locus_tag LOCUS_07160 22541 23662 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010829.1 protein_id gnl|my_center|LOCUS_07160 23659 23937 gene locus_tag LOCUS_07170 gene sgcB 23659 23937 CDS product PTS sugar transporter subunit IIB SgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976132.1 protein_id gnl|my_center|LOCUS_07170 23956 25269 gene locus_tag LOCUS_07180 gene sgcC 23956 25269 CDS product PTS sugar transporter subunit IIC SgcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460843.1 protein_id gnl|my_center|LOCUS_07180 25281 26036 gene locus_tag LOCUS_07190 gene sgcQ 25281 26036 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118614.1 protein_id gnl|my_center|LOCUS_07190 26184 26633 gene locus_tag LOCUS_07200 gene sgcA 26184 26633 CDS product SgcA family PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606406.1 protein_id gnl|my_center|LOCUS_07200 26633 27274 gene locus_tag LOCUS_07210 26633 27274 CDS product ribulose-phosphate 3 epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600614.1 protein_id gnl|my_center|LOCUS_07210 27267 28058 gene locus_tag LOCUS_07220 27267 28058 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082780.1 protein_id gnl|my_center|LOCUS_07220 28971 28186 gene locus_tag LOCUS_07230 gene nhaR 28971 28186 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368331.1 protein_id gnl|my_center|LOCUS_07230 29668 29033 gene locus_tag LOCUS_07240 29668 29033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07240 30211 29708 gene locus_tag LOCUS_07250 30211 29708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07250 31075 30452 gene locus_tag LOCUS_07260 31075 30452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07260 31488 31006 gene locus_tag LOCUS_07270 31488 31006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07270 32555 31638 gene locus_tag LOCUS_07280 32555 31638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence018 942 400 gene locus_tag LOCUS_07290 942 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 1722 1003 gene locus_tag LOCUS_07300 gene fliA 1722 1003 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087467.1 protein_id gnl|my_center|LOCUS_07300 2939 1887 gene locus_tag LOCUS_07310 2939 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07310 3367 3068 gene locus_tag LOCUS_07320 3367 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07320 3658 4626 gene locus_tag LOCUS_07330 3658 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07330 4778 5020 gene locus_tag LOCUS_07340 4778 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07340 5033 5437 gene locus_tag LOCUS_07350 gene fliS 5033 5437 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 protein_id gnl|my_center|LOCUS_07350 5443 5805 gene locus_tag LOCUS_07360 gene fliT 5443 5805 CDS product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204899.1 protein_id gnl|my_center|LOCUS_07360 5894 7381 gene locus_tag LOCUS_07370 gene amyA 5894 7381 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096005.1 protein_id gnl|my_center|LOCUS_07370 7839 7426 gene locus_tag LOCUS_07380 gene yedD 7839 7426 CDS product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096004.1 protein_id gnl|my_center|LOCUS_07380 8045 9259 gene locus_tag LOCUS_07390 gene yedE 8045 9259 CDS product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118893.1 protein_id gnl|my_center|LOCUS_07390 9256 9489 gene locus_tag LOCUS_07400 gene yedF 9256 9489 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 protein_id gnl|my_center|LOCUS_07400 9598 10602 gene locus_tag LOCUS_07410 9598 10602 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097070.1 protein_id gnl|my_center|LOCUS_07410 12016 10709 gene locus_tag LOCUS_07420 12016 10709 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094819.1 protein_id gnl|my_center|LOCUS_07420 12471 12169 gene locus_tag LOCUS_07430 12471 12169 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500136.1 protein_id gnl|my_center|LOCUS_07430 13865 12477 gene locus_tag LOCUS_07440 13865 12477 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094820.1 protein_id gnl|my_center|LOCUS_07440 15211 13883 gene locus_tag LOCUS_07450 15211 13883 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094821.1 protein_id gnl|my_center|LOCUS_07450 15539 15225 gene locus_tag LOCUS_07460 15539 15225 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158553.1 protein_id gnl|my_center|LOCUS_07460 15831 16793 gene locus_tag LOCUS_07470 15831 16793 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094823.1 protein_id gnl|my_center|LOCUS_07470 17711 18253 gene locus_tag LOCUS_07480 17711 18253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 18427 19077 gene locus_tag LOCUS_07490 18427 19077 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095625.1 protein_id gnl|my_center|LOCUS_07490 19167 21740 gene locus_tag LOCUS_07500 19167 21740 CDS product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095624.1 protein_id gnl|my_center|LOCUS_07500 21744 22367 gene locus_tag LOCUS_07510 21744 22367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 22382 22960 gene locus_tag LOCUS_07520 22382 22960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 22975 23541 gene locus_tag LOCUS_07530 22975 23541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 23557 24711 gene locus_tag LOCUS_07540 23557 24711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 24704 26953 gene locus_tag LOCUS_07550 24704 26953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 27034 28716 gene locus_tag LOCUS_07560 27034 28716 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704284.1 protein_id gnl|my_center|LOCUS_07560 30928 28844 gene locus_tag LOCUS_07570 gene flhA 30928 28844 CDS product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361307.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence019 <1 508 gene locus_tag LOCUS_07580 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000231887.1:electron transport complex subunit RsxD note possible pseudo, frameshifted 529 657 gene locus_tag LOCUS_07590 529 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07590 667 1290 gene locus_tag LOCUS_07600 gene rsxG 667 1290 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920789.1 protein_id gnl|my_center|LOCUS_07600 1290 1859 gene locus_tag LOCUS_07610 1290 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07610 1745 1975 gene locus_tag LOCUS_07620 1745 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07620 1972 2607 gene locus_tag LOCUS_07630 gene nth 1972 2607 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705230.1 protein_id gnl|my_center|LOCUS_07630 3180 4685 gene locus_tag LOCUS_07640 gene dtpA 3180 4685 CDS product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096905.1 protein_id gnl|my_center|LOCUS_07640 4831 5436 gene locus_tag LOCUS_07650 gene gstA 4831 5436 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705228.1 protein_id gnl|my_center|LOCUS_07650 6339 5479 gene locus_tag LOCUS_07660 gene pdxY 6339 5479 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366860.1 protein_id gnl|my_center|LOCUS_07660 7704 6430 gene locus_tag LOCUS_07670 gene tyrS 7704 6430 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366861.1 protein_id gnl|my_center|LOCUS_07670 8617 7961 gene locus_tag LOCUS_07680 gene pdxH 8617 7961 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282319.1 protein_id gnl|my_center|LOCUS_07680 8998 8675 gene locus_tag LOCUS_07690 gene mliC 8998 8675 CDS product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096910.1 protein_id gnl|my_center|LOCUS_07690 9535 9089 gene locus_tag LOCUS_07700 9535 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 10124 9483 gene locus_tag LOCUS_07710 10124 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 10402 10869 gene locus_tag LOCUS_07720 gene slyB 10402 10869 CDS product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597179.1 protein_id gnl|my_center|LOCUS_07720 11274 12479 gene locus_tag LOCUS_07730 11274 12479 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830281.1 protein_id gnl|my_center|LOCUS_07730 12946 12512 gene locus_tag LOCUS_07740 gene slyA 12946 12512 CDS product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445639.1 protein_id gnl|my_center|LOCUS_07740 13129 13371 gene locus_tag LOCUS_07750 13129 13371 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366868.1 protein_id gnl|my_center|LOCUS_07750 13371 14225 gene locus_tag LOCUS_07760 13371 14225 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096915.1 protein_id gnl|my_center|LOCUS_07760 14229 16253 gene locus_tag LOCUS_07770 14229 16253 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777620.1 protein_id gnl|my_center|LOCUS_07770 16764 16243 gene locus_tag LOCUS_07780 gene sodC2 16764 16243 CDS product superoxide dismutase [Cu-Zn] SodC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826818.1 protein_id gnl|my_center|LOCUS_07780 17741 16845 gene locus_tag LOCUS_07790 17741 16845 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250656.1 protein_id gnl|my_center|LOCUS_07790 18032 17793 gene locus_tag LOCUS_07800 18032 17793 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840481.1 protein_id gnl|my_center|LOCUS_07800 18176 18772 gene locus_tag LOCUS_07810 18176 18772 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041823.1 protein_id gnl|my_center|LOCUS_07810 18827 19924 gene locus_tag LOCUS_07820 18827 19924 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096922.1 protein_id gnl|my_center|LOCUS_07820 20005 20409 gene locus_tag LOCUS_07830 gene gloA 20005 20409 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096923.1 protein_id gnl|my_center|LOCUS_07830 20507 21157 gene locus_tag LOCUS_07840 gene rnt 20507 21157 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282267.1 protein_id gnl|my_center|LOCUS_07840 21543 21202 gene locus_tag LOCUS_07850 gene grxD 21543 21202 CDS product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108176.1 protein_id gnl|my_center|LOCUS_07850 21980 22705 gene locus_tag LOCUS_07860 21980 22705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 23335 23401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24523 23750 gene locus_tag LOCUS_07870 24523 23750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07870 25134 26159 gene locus_tag LOCUS_07880 gene purR 25134 26159 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096929.1 protein_id gnl|my_center|LOCUS_07880 27086 26175 gene locus_tag LOCUS_07890 gene punR 27086 26175 CDS product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269528.1 protein_id gnl|my_center|LOCUS_07890 27221 28423 gene locus_tag LOCUS_07900 gene punC 27221 28423 CDS product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182326.1 protein_id gnl|my_center|LOCUS_07900 28677 29831 gene locus_tag LOCUS_07910 gene cfa 28677 29831 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098879.1 protein_id gnl|my_center|LOCUS_07910 29856 29935 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30579 30692 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence020 649 407 gene locus_tag LOCUS_07920 649 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1384 689 gene locus_tag LOCUS_07930 gene mobC 1384 689 CDS product MobC family replication-relaxation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909124.1 protein_id gnl|my_center|LOCUS_07930 3186 1450 gene locus_tag LOCUS_07940 3186 1450 CDS product TraM recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602685.1 protein_id gnl|my_center|LOCUS_07940 3847 3446 gene locus_tag LOCUS_07950 3847 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4266 3961 gene locus_tag LOCUS_07960 4266 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168332.1 protein_id gnl|my_center|LOCUS_07960 5065 4667 gene locus_tag LOCUS_07970 5065 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 6091 5117 gene locus_tag LOCUS_07980 gene virB11 6091 5117 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125557.1 protein_id gnl|my_center|LOCUS_07980 6809 6081 gene locus_tag LOCUS_07990 6809 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7895 7338 gene locus_tag LOCUS_08000 7895 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08000 8223 7864 gene locus_tag LOCUS_08010 8223 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08010 8906 8223 gene locus_tag LOCUS_08020 8906 8223 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005327.1 protein_id gnl|my_center|LOCUS_08020 9036 8899 gene locus_tag LOCUS_08030 9036 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 10195 9128 gene locus_tag LOCUS_08040 10195 9128 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513454.1 protein_id gnl|my_center|LOCUS_08040 10434 10207 gene locus_tag LOCUS_08050 10434 10207 CDS product EexN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949385.1 protein_id gnl|my_center|LOCUS_08050 11160 10453 gene locus_tag LOCUS_08060 11160 10453 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848059.1 protein_id gnl|my_center|LOCUS_08060 13922 11178 gene locus_tag LOCUS_08070 13922 11178 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096399.1 protein_id gnl|my_center|LOCUS_08070 14226 13933 gene locus_tag LOCUS_08080 14226 13933 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600171.1 protein_id gnl|my_center|LOCUS_08080 14984 14223 gene locus_tag LOCUS_08090 14984 14223 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001446637.1 protein_id gnl|my_center|LOCUS_08090 15228 15007 gene locus_tag LOCUS_08100 15228 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 16418 15888 gene locus_tag LOCUS_08110 16418 15888 CDS product DUF2857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937857.1 protein_id gnl|my_center|LOCUS_08110 16727 16542 gene locus_tag LOCUS_08120 16727 16542 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 protein_id gnl|my_center|LOCUS_08120 19962 18694 gene locus_tag LOCUS_08130 19962 18694 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954536.1 protein_id gnl|my_center|LOCUS_08130 20198 20123 gene locus_tag LOCUS_t00070 20198 20123 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 20889 20314 gene locus_tag LOCUS_08140 20889 20314 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095254.1 protein_id gnl|my_center|LOCUS_08140 22624 20939 gene locus_tag LOCUS_08150 22624 20939 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068881.1 protein_id gnl|my_center|LOCUS_08150 22923 22600 gene locus_tag LOCUS_08160 gene cutA 22923 22600 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704145.1 protein_id gnl|my_center|LOCUS_08160 24334 23033 gene locus_tag LOCUS_08170 24334 23033 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 protein_id gnl|my_center|LOCUS_08170 25887 24451 gene locus_tag LOCUS_08180 gene aspA 25887 24451 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855923.1 protein_id gnl|my_center|LOCUS_08180 26228 26701 gene locus_tag LOCUS_08190 gene fxsA 26228 26701 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267291.1 protein_id gnl|my_center|LOCUS_08190 26839 27132 gene locus_tag LOCUS_08200 26839 27132 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 protein_id gnl|my_center|LOCUS_08200 27180 28898 gene locus_tag LOCUS_08210 gene groL 27180 28898 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729126.1 protein_id gnl|my_center|LOCUS_08210 29152 29505 gene locus_tag LOCUS_08220 29152 29505 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605289.1 protein_id gnl|my_center|LOCUS_08220 30347 29667 gene locus_tag LOCUS_08230 30347 29667 CDS product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229237.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence021 283 645 gene locus_tag LOCUS_08240 283 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08240 558 1013 gene locus_tag LOCUS_08250 558 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08250 1922 1179 gene locus_tag LOCUS_08260 gene mlrA 1922 1179 CDS product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420186.1 protein_id gnl|my_center|LOCUS_08260 4100 2070 gene locus_tag LOCUS_08270 gene metG 4100 2070 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706086.1 protein_id gnl|my_center|LOCUS_08270 4256 5335 gene locus_tag LOCUS_08280 gene apbC 4256 5335 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097927.1 protein_id gnl|my_center|LOCUS_08280 5838 5341 gene locus_tag LOCUS_08290 5838 5341 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017899343.1 protein_id gnl|my_center|LOCUS_08290 5892 6290 gene locus_tag LOCUS_08300 5892 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08300 6253 7572 gene locus_tag LOCUS_08310 gene btsS 6253 7572 CDS product two-component regulatory system sensor histidine kinase BtsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295431.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08310 7566 8285 gene locus_tag LOCUS_08320 gene btsR 7566 8285 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365746.1 protein_id gnl|my_center|LOCUS_08320 8361 8834 gene locus_tag LOCUS_08330 8361 8834 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706088.1 protein_id gnl|my_center|LOCUS_08330 8947 9897 gene locus_tag LOCUS_08340 8947 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08340 9917 10729 gene locus_tag LOCUS_08350 9917 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08350 11672 10968 gene locus_tag LOCUS_08360 11672 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08360 11907 12389 gene locus_tag LOCUS_08370 gene allA 11907 12389 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776388.1 protein_id gnl|my_center|LOCUS_08370 12514 13329 gene locus_tag LOCUS_08380 gene allR 12514 13329 CDS product HTH-type transcriptional repressor AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141275.1 protein_id gnl|my_center|LOCUS_08380 13456 15237 gene locus_tag LOCUS_08390 gene gcl 13456 15237 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096878.1 protein_id gnl|my_center|LOCUS_08390 15249 16025 gene locus_tag LOCUS_08400 gene hyi 15249 16025 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943556.1 protein_id gnl|my_center|LOCUS_08400 16107 16985 gene locus_tag LOCUS_08410 gene glxR 16107 16985 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765822.1 protein_id gnl|my_center|LOCUS_08410 17094 18563 gene locus_tag LOCUS_08420 17094 18563 CDS product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401139.1 protein_id gnl|my_center|LOCUS_08420 18636 19133 gene locus_tag LOCUS_08430 18636 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08430 19073 20002 gene locus_tag LOCUS_08440 19073 20002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08440 20280 21368 gene locus_tag LOCUS_08450 20280 21368 CDS product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298336.1 protein_id gnl|my_center|LOCUS_08450 21394 22539 gene locus_tag LOCUS_08460 gene glxK 21394 22539 CDS product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706333.1 protein_id gnl|my_center|LOCUS_08460 22912 22613 gene locus_tag LOCUS_08470 22912 22613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08470 23408 22977 gene locus_tag LOCUS_08480 23408 22977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08480 24299 23415 gene locus_tag LOCUS_08490 24299 23415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08490 24642 24382 gene locus_tag LOCUS_08500 24642 24382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08500 25708 24659 gene locus_tag LOCUS_08510 gene allD 25708 24659 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703914.1 protein_id gnl|my_center|LOCUS_08510 26023 27681 gene locus_tag LOCUS_08520 26023 27681 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580919.1 protein_id gnl|my_center|LOCUS_08520 27691 28902 gene locus_tag LOCUS_08530 27691 28902 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495330.1 protein_id gnl|my_center|LOCUS_08530 28970 29866 gene locus_tag LOCUS_08540 28970 29866 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855389.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence022 232 53 gene locus_tag LOCUS_08550 232 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 846 175 gene locus_tag LOCUS_08560 846 175 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099181.1 protein_id gnl|my_center|LOCUS_08560 1179 3074 gene locus_tag LOCUS_08570 1179 3074 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175141.1 protein_id gnl|my_center|LOCUS_08570 3145 3825 gene locus_tag LOCUS_08580 3145 3825 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968036.1 protein_id gnl|my_center|LOCUS_08580 4452 3829 gene locus_tag LOCUS_08590 4452 3829 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096819.1 protein_id gnl|my_center|LOCUS_08590 4673 5695 gene locus_tag LOCUS_08600 4673 5695 CDS product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 protein_id gnl|my_center|LOCUS_08600 5963 6979 gene locus_tag LOCUS_08610 5963 6979 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096947.1 protein_id gnl|my_center|LOCUS_08610 6972 7640 gene locus_tag LOCUS_08620 6972 7640 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096946.1 protein_id gnl|my_center|LOCUS_08620 7662 8465 gene locus_tag LOCUS_08630 7662 8465 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096945.1 protein_id gnl|my_center|LOCUS_08630 10465 8522 gene locus_tag LOCUS_08640 10465 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 12237 10696 gene locus_tag LOCUS_08650 12237 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 12505 12738 gene locus_tag LOCUS_08660 12505 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 12632 13312 gene locus_tag LOCUS_08670 12632 13312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 13309 13914 gene locus_tag LOCUS_08680 gene ttdB 13309 13914 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722957.1 protein_id gnl|my_center|LOCUS_08680 13971 14657 gene locus_tag LOCUS_08690 13971 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08690 14685 15431 gene locus_tag LOCUS_08700 14685 15431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08700 15603 15887 gene locus_tag LOCUS_08710 15603 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 16995 16018 gene locus_tag LOCUS_08720 gene hemB 16995 16018 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095798.1 protein_id gnl|my_center|LOCUS_08720 17149 17493 gene locus_tag LOCUS_08730 17149 17493 CDS product type II toxin-antitoxin system PrlF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087280.1 protein_id gnl|my_center|LOCUS_08730 17496 17978 gene locus_tag LOCUS_08740 17496 17978 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 protein_id gnl|my_center|LOCUS_08740 18419 18030 gene locus_tag LOCUS_08750 18419 18030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08750 18725 18774 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19088 19178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19586 20572 gene locus_tag LOCUS_08760 gene sbmA 19586 20572 CDS product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301663.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08760 20569 20730 gene locus_tag LOCUS_08770 20569 20730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08770 20749 21834 gene locus_tag LOCUS_08780 gene yaiW 20749 21834 CDS product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092043.1 protein_id gnl|my_center|LOCUS_08780 22154 21837 gene locus_tag LOCUS_08790 22154 21837 CDS product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763144.1 protein_id gnl|my_center|LOCUS_08790 22439 22654 gene locus_tag LOCUS_08800 22439 22654 CDS product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295334.1 protein_id gnl|my_center|LOCUS_08800 23791 22658 gene locus_tag LOCUS_08810 gene ddlA 23791 22658 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413693.1 protein_id gnl|my_center|LOCUS_08810 23887 24585 gene locus_tag LOCUS_08820 23887 24585 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095808.1 protein_id gnl|my_center|LOCUS_08820 24754 25965 gene locus_tag LOCUS_08830 24754 25965 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 protein_id gnl|my_center|LOCUS_08830 26182 26442 gene locus_tag LOCUS_08840 gene iraP 26182 26442 CDS product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095810.1 protein_id gnl|my_center|LOCUS_08840 26930 27154 gene locus_tag LOCUS_08850 26930 27154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08850 27263 28372 gene locus_tag LOCUS_08860 gene adrA 27263 28372 CDS product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484042.1 protein_id gnl|my_center|LOCUS_08860 29217 28387 gene locus_tag LOCUS_08870 gene proC 29217 28387 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704543.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence023 1477 194 gene locus_tag LOCUS_08880 gene glgC 1477 194 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099110.1 protein_id gnl|my_center|LOCUS_08880 3475 1493 gene locus_tag LOCUS_08890 gene glgX 3475 1493 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703689.1 protein_id gnl|my_center|LOCUS_08890 5658 3472 gene locus_tag LOCUS_08900 gene glgB 5658 3472 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098552.1 protein_id gnl|my_center|LOCUS_08900 7023 5917 gene locus_tag LOCUS_08910 gene asd 7023 5917 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703691.1 protein_id gnl|my_center|LOCUS_08910 7199 7792 gene locus_tag LOCUS_08920 gene yhgN 7199 7792 CDS product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 protein_id gnl|my_center|LOCUS_08920 9177 7837 gene locus_tag LOCUS_08930 gene gntU 9177 7837 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833577.1 protein_id gnl|my_center|LOCUS_08930 9707 9174 gene locus_tag LOCUS_08940 gene gntK 9707 9174 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108320.1 protein_id gnl|my_center|LOCUS_08940 10848 9853 gene locus_tag LOCUS_08950 gene gntR 10848 9853 CDS product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 protein_id gnl|my_center|LOCUS_08950 11689 10994 gene locus_tag LOCUS_08960 11689 10994 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639789.1 protein_id gnl|my_center|LOCUS_08960 13738 12116 gene locus_tag LOCUS_08970 13738 12116 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098705.1 protein_id gnl|my_center|LOCUS_08970 15672 13933 gene locus_tag LOCUS_08980 gene ggt 15672 13933 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595080.1 protein_id gnl|my_center|LOCUS_08980 15792 16271 gene locus_tag LOCUS_08990 15792 16271 CDS product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825996.1 protein_id gnl|my_center|LOCUS_08990 17008 16268 gene locus_tag LOCUS_09000 gene ugpQ 17008 16268 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073552.1 protein_id gnl|my_center|LOCUS_09000 18072 17005 gene locus_tag LOCUS_09010 18072 17005 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099124.1 protein_id gnl|my_center|LOCUS_09010 18919 18074 gene locus_tag LOCUS_09020 gene ugpE 18919 18074 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703702.1 protein_id gnl|my_center|LOCUS_09020 19803 18916 gene locus_tag LOCUS_09030 gene ugpA 19803 18916 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099126.1 protein_id gnl|my_center|LOCUS_09030 20316 19864 gene locus_tag LOCUS_09040 20316 19864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09040 21103 20234 gene locus_tag LOCUS_09050 21103 20234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09050 20371 20399 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21390 21689 gene locus_tag LOCUS_09060 21390 21689 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100678.1 protein_id gnl|my_center|LOCUS_09060 21680 22165 gene locus_tag LOCUS_09070 21680 22165 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405248.1 protein_id gnl|my_center|LOCUS_09070 22931 22218 gene locus_tag LOCUS_09080 gene livF 22931 22218 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086538103.1 protein_id gnl|my_center|LOCUS_09080 23407 22997 gene locus_tag LOCUS_09090 23407 22997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09090 23438 23514 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24847 23570 gene locus_tag LOCUS_09100 gene livM 24847 23570 CDS product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099130.1 protein_id gnl|my_center|LOCUS_09100 25770 24844 gene locus_tag LOCUS_09110 gene livH 25770 24844 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099131.1 protein_id gnl|my_center|LOCUS_09110 26945 25818 gene locus_tag LOCUS_09120 gene livK 26945 25818 CDS product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099132.1 protein_id gnl|my_center|LOCUS_09120 27349 27732 gene locus_tag LOCUS_09130 gene panM 27349 27732 CDS product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099135.1 protein_id gnl|my_center|LOCUS_09130 28852 27887 gene locus_tag LOCUS_09140 gene livJ 28852 27887 CDS product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069546.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09140 >Feature sequence024 381 1433 gene locus_tag LOCUS_09150 381 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2883 3386 gene locus_tag LOCUS_09160 2883 3386 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098953.1 protein_id gnl|my_center|LOCUS_09160 4328 3483 gene locus_tag LOCUS_09170 4328 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095380.1 protein_id gnl|my_center|LOCUS_09170 5156 4398 gene locus_tag LOCUS_09180 gene miaE 5156 4398 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218459.1 protein_id gnl|my_center|LOCUS_09180 5627 5202 gene locus_tag LOCUS_09190 gene rraB 5627 5202 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002940.1 protein_id gnl|my_center|LOCUS_09190 5792 6796 gene locus_tag LOCUS_09200 gene argF 5792 6796 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012908.1 protein_id gnl|my_center|LOCUS_09200 7291 6839 gene locus_tag LOCUS_09210 7291 6839 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368552.1 protein_id gnl|my_center|LOCUS_09210 7872 8807 gene locus_tag LOCUS_09220 gene pyrB 7872 8807 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704213.1 protein_id gnl|my_center|LOCUS_09220 8821 9132 gene locus_tag LOCUS_09230 8821 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 9276 9662 gene locus_tag LOCUS_09240 gene ridA 9276 9662 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047544.1 protein_id gnl|my_center|LOCUS_09240 10372 9758 gene locus_tag LOCUS_09250 10372 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 10862 10392 gene locus_tag LOCUS_09260 10862 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09260 11239 10877 gene locus_tag LOCUS_09270 11239 10877 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703888.1 protein_id gnl|my_center|LOCUS_09270 11576 11229 gene locus_tag LOCUS_09280 11576 11229 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094795.1 protein_id gnl|my_center|LOCUS_09280 13129 11636 gene locus_tag LOCUS_09290 13129 11636 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828527.1 protein_id gnl|my_center|LOCUS_09290 14760 13126 gene locus_tag LOCUS_09300 14760 13126 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087177.1 protein_id gnl|my_center|LOCUS_09300 14844 15698 gene locus_tag LOCUS_09310 14844 15698 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 protein_id gnl|my_center|LOCUS_09310 16443 15718 gene locus_tag LOCUS_09320 16443 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 18388 16493 gene locus_tag LOCUS_09330 18388 16493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 16498 16674 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18338 18640 gene locus_tag LOCUS_09340 18338 18640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 18762 19709 gene locus_tag LOCUS_09350 gene treR 18762 19709 CDS product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181321.1 protein_id gnl|my_center|LOCUS_09350 19839 21260 gene locus_tag LOCUS_09360 gene treB 19839 21260 CDS product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420863.1 protein_id gnl|my_center|LOCUS_09360 21300 22529 gene locus_tag LOCUS_09370 21300 22529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09370 22453 22950 gene locus_tag LOCUS_09380 22453 22950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09380 23323 25728 gene locus_tag LOCUS_09390 gene nrdD 23323 25728 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187820.1 protein_id gnl|my_center|LOCUS_09390 25649 25870 gene locus_tag LOCUS_09400 25649 25870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09400 26470 25904 gene locus_tag LOCUS_09410 26470 25904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09410 26990 26442 gene locus_tag LOCUS_09420 26990 26442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09420 27071 27120 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27753 27193 gene locus_tag LOCUS_09430 27753 27193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09430 28095 27775 gene locus_tag LOCUS_09440 28095 27775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09440 28510 28040 gene locus_tag LOCUS_09450 28510 28040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09450 <29133 28507 gene locus_tag LOCUS_09460 <29133 28507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001139189.1:DgaE family pyridoxal phosphate-dependent ammonia lyase >Feature sequence025 1025 1264 gene locus_tag LOCUS_09470 1025 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1356 2612 gene locus_tag LOCUS_09480 1356 2612 CDS product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114469.1 protein_id gnl|my_center|LOCUS_09480 3232 2660 gene locus_tag LOCUS_09490 3232 2660 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095829.1 protein_id gnl|my_center|LOCUS_09490 4011 3430 gene locus_tag LOCUS_09500 gene acpH 4011 3430 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704556.1 protein_id gnl|my_center|LOCUS_09500 4216 5283 gene locus_tag LOCUS_09510 4216 5283 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266503.1 protein_id gnl|my_center|LOCUS_09510 5401 6489 gene locus_tag LOCUS_09520 gene tgt 5401 6489 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368001.1 protein_id gnl|my_center|LOCUS_09520 6511 6843 gene locus_tag LOCUS_09530 gene yajC 6511 6843 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007630.1 protein_id gnl|my_center|LOCUS_09530 6904 8412 gene locus_tag LOCUS_09540 gene secD 6904 8412 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095833.1 protein_id gnl|my_center|LOCUS_09540 8409 8585 gene locus_tag LOCUS_09550 8409 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 8596 8970 gene locus_tag LOCUS_09560 8596 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09560 8967 9557 gene locus_tag LOCUS_09570 8967 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09570 9678 10472 gene locus_tag LOCUS_09580 9678 10472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09580 10514 11044 gene locus_tag LOCUS_09590 10514 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09590 11964 11080 gene locus_tag LOCUS_09600 11964 11080 CDS product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025756198.1 protein_id gnl|my_center|LOCUS_09600 12791 12243 gene locus_tag LOCUS_09610 12791 12243 CDS product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830864.1 protein_id gnl|my_center|LOCUS_09610 12941 13216 gene locus_tag LOCUS_09620 12941 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09620 13174 13187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13213 13344 gene locus_tag LOCUS_09630 13213 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09630 13510 14403 gene locus_tag LOCUS_09640 gene ribD 13510 14403 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095839.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09640 14495 14869 gene locus_tag LOCUS_09650 14495 14869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 14915 15334 gene locus_tag LOCUS_09660 gene nusB 14915 15334 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801120.1 protein_id gnl|my_center|LOCUS_09660 15393 16370 gene locus_tag LOCUS_09670 gene thiL 15393 16370 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742108.1 protein_id gnl|my_center|LOCUS_09670 17388 16414 gene locus_tag LOCUS_09680 gene yajO 17388 16414 CDS product 1-deoxyxylulose-5-phosphate synthase YajO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199788.1 protein_id gnl|my_center|LOCUS_09680 19326 17464 gene locus_tag LOCUS_09690 gene dxs 19326 17464 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006808.1 protein_id gnl|my_center|LOCUS_09690 20247 19348 gene locus_tag LOCUS_09700 gene ispA 20247 19348 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367988.1 protein_id gnl|my_center|LOCUS_09700 20490 20248 gene locus_tag LOCUS_09710 gene xseB 20490 20248 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367987.1 protein_id gnl|my_center|LOCUS_09710 20694 22142 gene locus_tag LOCUS_09720 gene thiI 20694 22142 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668662.1 protein_id gnl|my_center|LOCUS_09720 22955 22188 gene locus_tag LOCUS_09730 22955 22188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09730 23551 22997 gene locus_tag LOCUS_09740 23551 22997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09740 25721 23538 gene locus_tag LOCUS_09750 25721 23538 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_09750 27167 25815 gene locus_tag LOCUS_09760 27167 25815 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460991.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence026 219 689 gene locus_tag LOCUS_09770 219 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09770 784 1113 gene locus_tag LOCUS_09780 784 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09780 1363 2961 gene locus_tag LOCUS_09790 gene aceB 1363 2961 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138870.1 protein_id gnl|my_center|LOCUS_09790 2986 4308 gene locus_tag LOCUS_09800 gene aceA 2986 4308 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857854.1 protein_id gnl|my_center|LOCUS_09800 4364 5251 gene locus_tag LOCUS_09810 4364 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09810 5136 6116 gene locus_tag LOCUS_09820 5136 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09820 6972 6136 gene locus_tag LOCUS_09830 gene iclR 6972 6136 CDS product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368798.1 protein_id gnl|my_center|LOCUS_09830 7215 8315 gene locus_tag LOCUS_09840 7215 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 8312 10702 gene locus_tag LOCUS_09850 8312 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 10973 11221 gene locus_tag LOCUS_09860 gene rpsP 10973 11221 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370257.1 protein_id gnl|my_center|LOCUS_09860 11240 11788 gene locus_tag LOCUS_09870 gene rimM 11240 11788 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 protein_id gnl|my_center|LOCUS_09870 11819 12586 gene locus_tag LOCUS_09880 gene trmD 11819 12586 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 protein_id gnl|my_center|LOCUS_09880 12629 12976 gene locus_tag LOCUS_09890 gene rplS 12629 12976 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 protein_id gnl|my_center|LOCUS_09890 13108 13758 gene locus_tag LOCUS_09900 13108 13758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 14137 14562 gene locus_tag LOCUS_09910 14137 14562 CDS product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370259.1 protein_id gnl|my_center|LOCUS_09910 14616 15269 gene locus_tag LOCUS_09920 14616 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09920 15185 15640 gene locus_tag LOCUS_09930 15185 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09930 15589 15607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15615 15917 gene locus_tag LOCUS_09940 15615 15917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09940 16309 15926 gene locus_tag LOCUS_09950 16309 15926 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098347.1 protein_id gnl|my_center|LOCUS_09950 17640 16420 gene locus_tag LOCUS_09960 gene dgcN 17640 16420 CDS product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098346.1 protein_id gnl|my_center|LOCUS_09960 18055 17633 gene locus_tag LOCUS_09970 18055 17633 CDS product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098345.1 protein_id gnl|my_center|LOCUS_09970 18704 18330 gene locus_tag LOCUS_09980 18704 18330 CDS product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298694.1 protein_id gnl|my_center|LOCUS_09980 18980 20050 gene locus_tag LOCUS_09990 gene aroF 18980 20050 CDS product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 protein_id gnl|my_center|LOCUS_09990 20060 21250 gene locus_tag LOCUS_10000 gene tyrA 20060 21250 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098342.1 protein_id gnl|my_center|LOCUS_10000 22351 21191 gene locus_tag LOCUS_10010 gene pheA 22351 21191 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098340.1 protein_id gnl|my_center|LOCUS_10010 23006 22596 gene locus_tag LOCUS_10020 gene raiA 23006 22596 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502470.1 protein_id gnl|my_center|LOCUS_10020 23930 23193 gene locus_tag LOCUS_10030 gene bamD 23930 23193 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098339.1 protein_id gnl|my_center|LOCUS_10030 24067 25047 gene locus_tag LOCUS_10040 gene rluD 24067 25047 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370269.1 protein_id gnl|my_center|LOCUS_10040 25044 25775 gene locus_tag LOCUS_10050 gene yfiH 25044 25775 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098337.1 protein_id gnl|my_center|LOCUS_10050 25906 27975 gene locus_tag LOCUS_10060 gene clpB 25906 27975 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098336.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10060 >Feature sequence027 1197 799 gene locus_tag LOCUS_10070 1197 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10070 2389 1097 gene locus_tag LOCUS_10080 2389 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10080 2549 3577 gene locus_tag LOCUS_10090 gene malI 2549 3577 CDS product mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179513.1 protein_id gnl|my_center|LOCUS_10090 3821 3606 gene locus_tag LOCUS_10100 3821 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10100 5125 3752 gene locus_tag LOCUS_10110 5125 3752 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096881.1 protein_id gnl|my_center|LOCUS_10110 6411 5215 gene locus_tag LOCUS_10120 gene manA 6411 5215 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096880.1 protein_id gnl|my_center|LOCUS_10120 6615 8261 gene locus_tag LOCUS_10130 gene fumA 6615 8261 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096879.1 protein_id gnl|my_center|LOCUS_10130 8470 8515 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8892 9015 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9037 9390 gene locus_tag LOCUS_10140 9037 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 10313 9387 gene locus_tag LOCUS_10150 gene tus 10313 9387 CDS product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096877.1 protein_id gnl|my_center|LOCUS_10150 10901 10446 gene locus_tag LOCUS_10160 10901 10446 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244522.1 protein_id gnl|my_center|LOCUS_10160 11015 12352 gene locus_tag LOCUS_10170 11015 12352 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174164.1 protein_id gnl|my_center|LOCUS_10170 12276 12464 gene locus_tag LOCUS_10180 12276 12464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 12781 12458 gene locus_tag LOCUS_10190 12781 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10190 13667 12750 gene locus_tag LOCUS_10200 13667 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10200 14404 13682 gene locus_tag LOCUS_10210 gene rstA 14404 13682 CDS product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705255.1 protein_id gnl|my_center|LOCUS_10210 15202 14480 gene locus_tag LOCUS_10220 gene folM 15202 14480 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520804.1 protein_id gnl|my_center|LOCUS_10220 16626 15244 gene locus_tag LOCUS_10230 16626 15244 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096871.1 protein_id gnl|my_center|LOCUS_10230 17767 16817 gene locus_tag LOCUS_10240 gene ydgH 17767 16817 CDS product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769298.1 protein_id gnl|my_center|LOCUS_10240 18284 19813 gene locus_tag LOCUS_10250 gene pntA 18284 19813 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096869.1 protein_id gnl|my_center|LOCUS_10250 19824 20456 gene locus_tag LOCUS_10260 19824 20456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 20345 20373 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20390 20998 gene locus_tag LOCUS_10270 20390 20998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 21245 22924 gene locus_tag LOCUS_10280 21245 22924 CDS product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096407.1 protein_id gnl|my_center|LOCUS_10280 22943 23413 gene locus_tag LOCUS_10290 22943 23413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10290 23530 24231 gene locus_tag LOCUS_10300 23530 24231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10300 24254 24484 gene locus_tag LOCUS_10310 24254 24484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10310 24497 25132 gene locus_tag LOCUS_10320 24497 25132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10320 25119 25961 gene locus_tag LOCUS_10330 25119 25961 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224671.1 protein_id gnl|my_center|LOCUS_10330 25988 27040 gene locus_tag LOCUS_10340 25988 27040 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096411.1 protein_id gnl|my_center|LOCUS_10340 27059 27847 gene locus_tag LOCUS_10350 27059 27847 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420918.1 protein_id gnl|my_center|LOCUS_10350 27861 28112 gene locus_tag LOCUS_10360 27861 28112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10360 >Feature sequence028 1485 898 gene locus_tag LOCUS_10370 1485 898 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017057.1 protein_id gnl|my_center|LOCUS_10370 1688 2260 gene locus_tag LOCUS_10380 1688 2260 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955285.1 protein_id gnl|my_center|LOCUS_10380 2987 2226 gene locus_tag LOCUS_10390 2987 2226 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079547.1 protein_id gnl|my_center|LOCUS_10390 4211 3255 gene locus_tag LOCUS_10400 gene dusC 4211 3255 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706102.1 protein_id gnl|my_center|LOCUS_10400 4460 4882 gene locus_tag LOCUS_10410 4460 4882 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045719.1 protein_id gnl|my_center|LOCUS_10410 5082 5534 gene locus_tag LOCUS_10420 5082 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10420 5616 6500 gene locus_tag LOCUS_10430 gene cdd 5616 6500 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553529.1 protein_id gnl|my_center|LOCUS_10430 6619 7332 gene locus_tag LOCUS_10440 gene sanA 6619 7332 CDS product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920064.1 protein_id gnl|my_center|LOCUS_10440 7473 8588 gene locus_tag LOCUS_10450 7473 8588 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365665.1 protein_id gnl|my_center|LOCUS_10450 9644 8634 gene locus_tag LOCUS_10460 gene mglC 9644 8634 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097952.1 protein_id gnl|my_center|LOCUS_10460 11180 9660 gene locus_tag LOCUS_10470 gene mglA 11180 9660 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255020.1 protein_id gnl|my_center|LOCUS_10470 12259 11264 gene locus_tag LOCUS_10480 gene mglB 12259 11264 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 protein_id gnl|my_center|LOCUS_10480 12816 12532 gene locus_tag LOCUS_10490 12816 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10490 13564 12824 gene locus_tag LOCUS_10500 13564 12824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10500 14875 13718 gene locus_tag LOCUS_10510 gene yeiB 14875 13718 CDS product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097956.1 protein_id gnl|my_center|LOCUS_10510 15352 14891 gene locus_tag LOCUS_10520 15352 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 16650 15568 gene locus_tag LOCUS_10530 16650 15568 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097958.1 protein_id gnl|my_center|LOCUS_10530 16776 17495 gene locus_tag LOCUS_10540 gene yeiG 16776 17495 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425438.1 protein_id gnl|my_center|LOCUS_10540 18180 17878 gene locus_tag LOCUS_10550 18180 17878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 20221 18353 gene locus_tag LOCUS_10560 gene cirA 20221 18353 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488257.1 protein_id gnl|my_center|LOCUS_10560 20223 20411 gene locus_tag LOCUS_10570 20223 20411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 21909 20551 gene locus_tag LOCUS_10580 gene lysP 21909 20551 CDS product lysine-specific permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534384.1 protein_id gnl|my_center|LOCUS_10580 22631 22134 gene locus_tag LOCUS_10590 22631 22134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10590 22999 22634 gene locus_tag LOCUS_10600 22999 22634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10600 23122 24168 gene locus_tag LOCUS_10610 23122 24168 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137966.1 protein_id gnl|my_center|LOCUS_10610 24236 25093 gene locus_tag LOCUS_10620 gene nfo 24236 25093 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706116.1 protein_id gnl|my_center|LOCUS_10620 26359 25151 gene locus_tag LOCUS_10630 26359 25151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10630 26718 26356 gene locus_tag LOCUS_10640 26718 26356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10640 26371 26398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <27555 26747 gene locus_tag LOCUS_10650 <27555 26747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000091263.1:1-phosphofructokinase >Feature sequence029 <1 1255 gene locus_tag LOCUS_10660 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115524.1:esterase EstA 1604 1290 gene locus_tag LOCUS_10670 1604 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1494 1730 gene locus_tag LOCUS_10680 1494 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3128 1740 gene locus_tag LOCUS_10690 3128 1740 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168494.1 protein_id gnl|my_center|LOCUS_10690 3357 4670 gene locus_tag LOCUS_10700 3357 4670 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931585.1 protein_id gnl|my_center|LOCUS_10700 5872 4667 gene locus_tag LOCUS_10710 5872 4667 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047054668.1 protein_id gnl|my_center|LOCUS_10710 6010 6870 gene locus_tag LOCUS_10720 gene yghU 6010 6870 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 protein_id gnl|my_center|LOCUS_10720 7800 6913 gene locus_tag LOCUS_10730 gene yghX 7800 6913 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005010978.1 protein_id gnl|my_center|LOCUS_10730 8416 7898 gene locus_tag LOCUS_10740 8416 7898 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 protein_id gnl|my_center|LOCUS_10740 8982 8485 gene locus_tag LOCUS_10750 8982 8485 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098708.1 protein_id gnl|my_center|LOCUS_10750 9086 9490 gene locus_tag LOCUS_10760 9086 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936453.1 protein_id gnl|my_center|LOCUS_10760 9494 9943 gene locus_tag LOCUS_10770 9494 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098710.1 protein_id gnl|my_center|LOCUS_10770 10030 10926 gene locus_tag LOCUS_10780 gene yghA 10030 10926 CDS product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018760.1 protein_id gnl|my_center|LOCUS_10780 11407 10982 gene locus_tag LOCUS_10790 gene exbD 11407 10982 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369671.1 protein_id gnl|my_center|LOCUS_10790 12130 11414 gene locus_tag LOCUS_10800 gene exbB 12130 11414 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098712.1 protein_id gnl|my_center|LOCUS_10800 12351 12983 gene locus_tag LOCUS_10810 12351 12983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10810 12920 13534 gene locus_tag LOCUS_10820 12920 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10820 13657 14310 gene locus_tag LOCUS_10830 gene yghB 13657 14310 CDS product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098714.1 protein_id gnl|my_center|LOCUS_10830 15238 14342 gene locus_tag LOCUS_10840 15238 14342 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703501.1 protein_id gnl|my_center|LOCUS_10840 15426 16589 gene locus_tag LOCUS_10850 gene yqhD 15426 16589 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 protein_id gnl|my_center|LOCUS_10850 16692 17519 gene locus_tag LOCUS_10860 gene dkgA 16692 17519 CDS product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098717.1 protein_id gnl|my_center|LOCUS_10860 18146 17676 gene locus_tag LOCUS_10870 18146 17676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 20363 18189 gene locus_tag LOCUS_10880 20363 18189 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420579.1 protein_id gnl|my_center|LOCUS_10880 21900 20479 gene locus_tag LOCUS_10890 gene ftsP 21900 20479 CDS product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098721.1 protein_id gnl|my_center|LOCUS_10890 22695 21958 gene locus_tag LOCUS_10900 gene plsC 22695 21958 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098722.1 protein_id gnl|my_center|LOCUS_10900 24563 22920 gene locus_tag LOCUS_10910 24563 22920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10910 25185 24586 gene locus_tag LOCUS_10920 25185 24586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10920 25436 26017 gene locus_tag LOCUS_10930 25436 26017 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098727.1 protein_id gnl|my_center|LOCUS_10930 26107 26421 gene locus_tag LOCUS_10940 26107 26421 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098728.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence030 524 847 gene locus_tag LOCUS_10950 524 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096003.1 protein_id gnl|my_center|LOCUS_10950 1584 1045 gene locus_tag LOCUS_10960 1584 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10960 1555 1713 gene locus_tag LOCUS_10970 1555 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2411 1962 gene locus_tag LOCUS_10980 2411 1962 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097204.1 protein_id gnl|my_center|LOCUS_10980 2569 3807 gene locus_tag LOCUS_10990 gene agp 2569 3807 CDS product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132910.1 protein_id gnl|my_center|LOCUS_10990 4069 3842 gene locus_tag LOCUS_11000 4069 3842 CDS product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499832.1 protein_id gnl|my_center|LOCUS_11000 4684 4088 gene locus_tag LOCUS_11010 gene wrbA 4684 4088 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151437.1 protein_id gnl|my_center|LOCUS_11010 5077 5259 gene locus_tag LOCUS_11020 5077 5259 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097201.1 protein_id gnl|my_center|LOCUS_11020 5415 6332 gene locus_tag LOCUS_11030 5415 6332 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097200.1 protein_id gnl|my_center|LOCUS_11030 6340 6975 gene locus_tag LOCUS_11040 gene rutR 6340 6975 CDS product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367241.1 protein_id gnl|my_center|LOCUS_11040 7355 6972 gene locus_tag LOCUS_11050 7355 6972 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821059.1 protein_id gnl|my_center|LOCUS_11050 8440 7427 gene locus_tag LOCUS_11060 8440 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11060 11325 8344 gene locus_tag LOCUS_11070 11325 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11070 8457 8468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11750 13258 gene locus_tag LOCUS_11080 gene putP 11750 13258 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018468.1 protein_id gnl|my_center|LOCUS_11080 13813 14601 gene locus_tag LOCUS_11090 gene phoH 13813 14601 CDS product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097183.1 protein_id gnl|my_center|LOCUS_11090 15180 14656 gene locus_tag LOCUS_11100 15180 14656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11100 14855 14894 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15917 15120 gene locus_tag LOCUS_11110 15917 15120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11110 16781 16293 gene locus_tag LOCUS_11120 16781 16293 CDS product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001752509.1 protein_id gnl|my_center|LOCUS_11120 17488 18477 gene locus_tag LOCUS_11130 gene araF 17488 18477 CDS product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027935.1 protein_id gnl|my_center|LOCUS_11130 18535 20049 gene locus_tag LOCUS_11140 gene araG 18535 20049 CDS product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096045.1 protein_id gnl|my_center|LOCUS_11140 20063 21043 gene locus_tag LOCUS_11150 gene araH 20063 21043 CDS product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096046.1 protein_id gnl|my_center|LOCUS_11150 21283 21579 gene locus_tag LOCUS_11160 21283 21579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11160 21554 22051 gene locus_tag LOCUS_11170 21554 22051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11170 22026 23450 gene locus_tag LOCUS_11180 gene otsA 22026 23450 CDS product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089042.1 protein_id gnl|my_center|LOCUS_11180 23921 23502 gene locus_tag LOCUS_11190 gene uspC 23921 23502 CDS product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122412.1 protein_id gnl|my_center|LOCUS_11190 24724 25074 gene locus_tag LOCUS_11200 gene flhD 24724 25074 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096050.1 protein_id gnl|my_center|LOCUS_11200 25077 25655 gene locus_tag LOCUS_11210 gene flhC 25077 25655 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096051.1 protein_id gnl|my_center|LOCUS_11210 26113 26230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence031 <1 523 gene locus_tag LOCUS_11220 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001119449.1:OapA family protein 1433 495 gene locus_tag LOCUS_11230 1433 495 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095309.1 protein_id gnl|my_center|LOCUS_11230 2045 1596 gene locus_tag LOCUS_11240 gene rplI 2045 1596 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196062.1 protein_id gnl|my_center|LOCUS_11240 2314 2087 gene locus_tag LOCUS_11250 gene rpsR 2314 2087 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 protein_id gnl|my_center|LOCUS_11250 2633 2319 gene locus_tag LOCUS_11260 gene priB 2633 2319 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315977.1 protein_id gnl|my_center|LOCUS_11260 3034 2639 gene locus_tag LOCUS_11270 gene rpsF 3034 2639 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216673.1 protein_id gnl|my_center|LOCUS_11270 3388 3621 gene locus_tag LOCUS_11280 3388 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 4481 3729 gene locus_tag LOCUS_11290 gene yjfP 4481 3729 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560304.1 protein_id gnl|my_center|LOCUS_11290 4694 5008 gene locus_tag LOCUS_11300 gene bsmA 4694 5008 CDS product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586831.1 protein_id gnl|my_center|LOCUS_11300 5161 5436 gene locus_tag LOCUS_11310 gene yjfN 5161 5436 CDS product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139152684.1 protein_id gnl|my_center|LOCUS_11310 5582 7474 gene locus_tag LOCUS_11320 5582 7474 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095297.1 protein_id gnl|my_center|LOCUS_11320 9157 7523 gene locus_tag LOCUS_11330 9157 7523 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095296.1 protein_id gnl|my_center|LOCUS_11330 9744 9316 gene locus_tag LOCUS_11340 9744 9316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943487.1 protein_id gnl|my_center|LOCUS_11340 10146 9784 gene locus_tag LOCUS_11350 10146 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11350 10940 10146 gene locus_tag LOCUS_11360 10940 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11360 11946 11548 gene locus_tag LOCUS_11370 11946 11548 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547734.1 protein_id gnl|my_center|LOCUS_11370 12643 11951 gene locus_tag LOCUS_11380 12643 11951 CDS product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012534.1 protein_id gnl|my_center|LOCUS_11380 13693 12650 gene locus_tag LOCUS_11390 13693 12650 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769107.1 protein_id gnl|my_center|LOCUS_11390 14442 13693 gene locus_tag LOCUS_11400 14442 13693 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511955.1 protein_id gnl|my_center|LOCUS_11400 14824 14429 gene locus_tag LOCUS_11410 14824 14429 CDS product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220121.1 protein_id gnl|my_center|LOCUS_11410 15685 14954 gene locus_tag LOCUS_11420 gene rlmB 15685 14954 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704174.1 protein_id gnl|my_center|LOCUS_11420 18213 15769 gene locus_tag LOCUS_11430 gene rnr 18213 15769 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095293.1 protein_id gnl|my_center|LOCUS_11430 18749 18324 gene locus_tag LOCUS_11440 gene nsrR 18749 18324 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 protein_id gnl|my_center|LOCUS_11440 19198 18902 gene locus_tag LOCUS_11450 19198 18902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 20306 19137 gene locus_tag LOCUS_11460 20306 19137 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006178975.1 protein_id gnl|my_center|LOCUS_11460 19202 19233 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20606 20409 gene locus_tag LOCUS_11470 20606 20409 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095291.1 protein_id gnl|my_center|LOCUS_11470 21673 20669 gene locus_tag LOCUS_11480 gene hflC 21673 20669 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 protein_id gnl|my_center|LOCUS_11480 22926 21676 gene locus_tag LOCUS_11490 gene hflK 22926 21676 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312504.1 protein_id gnl|my_center|LOCUS_11490 23991 23119 gene locus_tag LOCUS_11500 23991 23119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11500 24397 23969 gene locus_tag LOCUS_11510 24397 23969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11510 24780 24472 gene locus_tag LOCUS_11520 gene hfq 24780 24472 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095287.1 protein_id gnl|my_center|LOCUS_11520 25831 24881 gene locus_tag LOCUS_11530 gene miaA 25831 24881 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280341.1 protein_id gnl|my_center|LOCUS_11530 26382 25828 gene locus_tag LOCUS_11540 26382 25828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence032 <1 1367 gene locus_tag LOCUS_11550 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105494.1:ATP-dependent RNA helicase HrpA 1771 2619 gene locus_tag LOCUS_11560 gene focA 1771 2619 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097310.1 protein_id gnl|my_center|LOCUS_11560 2671 4560 gene locus_tag LOCUS_11570 gene pflB 2671 4560 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097311.1 protein_id gnl|my_center|LOCUS_11570 4452 4473 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4503 4775 gene locus_tag LOCUS_11580 4503 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4974 5714 gene locus_tag LOCUS_11590 gene pflA 4974 5714 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097312.1 protein_id gnl|my_center|LOCUS_11590 6467 5766 gene locus_tag LOCUS_11600 6467 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11600 6858 6490 gene locus_tag LOCUS_11610 6858 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11610 7006 6833 gene locus_tag LOCUS_11620 7006 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 7211 7834 gene locus_tag LOCUS_11630 gene ycaC 7211 7834 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165876.1 protein_id gnl|my_center|LOCUS_11630 8457 7882 gene locus_tag LOCUS_11640 8457 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 8977 8399 gene locus_tag LOCUS_11650 8977 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 9525 9067 gene locus_tag LOCUS_11660 9525 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11660 10417 9509 gene locus_tag LOCUS_11670 10417 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11670 11037 10426 gene locus_tag LOCUS_11680 gene lolA 11037 10426 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295343.1 protein_id gnl|my_center|LOCUS_11680 11697 11185 gene locus_tag LOCUS_11690 11697 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11690 11930 11721 gene locus_tag LOCUS_11700 11930 11721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11700 11978 12112 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12377 12501 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12672 12875 gene locus_tag LOCUS_11710 12672 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 13486 12776 gene locus_tag LOCUS_11720 13486 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11720 14048 13398 gene locus_tag LOCUS_11730 14048 13398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11730 14688 13996 gene locus_tag LOCUS_11740 14688 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11740 15303 14809 gene locus_tag LOCUS_11750 gene lrp 15303 14809 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 protein_id gnl|my_center|LOCUS_11750 15869 16858 gene locus_tag LOCUS_11760 gene trxB 15869 16858 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097321.1 protein_id gnl|my_center|LOCUS_11760 16960 18726 gene locus_tag LOCUS_11770 gene cydD 16960 18726 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044527.1 protein_id gnl|my_center|LOCUS_11770 18727 20460 gene locus_tag LOCUS_11780 gene cydC 18727 20460 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704874.1 protein_id gnl|my_center|LOCUS_11780 20492 21199 gene locus_tag LOCUS_11790 gene aat 20492 21199 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704873.1 protein_id gnl|my_center|LOCUS_11790 21464 21682 gene locus_tag LOCUS_11800 gene infA 21464 21682 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_11800 24047 21774 gene locus_tag LOCUS_11810 gene clpA 24047 21774 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934041.1 protein_id gnl|my_center|LOCUS_11810 24396 24076 gene locus_tag LOCUS_11820 gene clpS 24396 24076 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174393.1 protein_id gnl|my_center|LOCUS_11820 24890 24690 gene locus_tag LOCUS_11830 24890 24690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 26147 25008 gene locus_tag LOCUS_11840 26147 25008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence033 603 163 gene locus_tag LOCUS_11850 603 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11850 914 600 gene locus_tag LOCUS_11860 914 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 1404 1039 gene locus_tag LOCUS_11870 1404 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11870 2939 1539 gene locus_tag LOCUS_11880 2939 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11880 3516 2896 gene locus_tag LOCUS_11890 3516 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11890 4081 4653 gene locus_tag LOCUS_11900 4081 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 5964 4711 gene locus_tag LOCUS_11910 5964 4711 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094960.1 protein_id gnl|my_center|LOCUS_11910 6123 5986 gene locus_tag LOCUS_11920 6123 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11920 7168 6092 gene locus_tag LOCUS_11930 gene xylH 7168 6092 CDS product xylose ABC transporter permease XylH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045989.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11930 8687 7146 gene locus_tag LOCUS_11940 8687 7146 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094962.1 protein_id gnl|my_center|LOCUS_11940 9748 8756 gene locus_tag LOCUS_11950 gene xylF 9748 8756 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094963.1 protein_id gnl|my_center|LOCUS_11950 10130 11458 gene locus_tag LOCUS_11960 gene xylA 10130 11458 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830210.1 protein_id gnl|my_center|LOCUS_11960 11502 12437 gene locus_tag LOCUS_11970 11502 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11970 12364 12948 gene locus_tag LOCUS_11980 12364 12948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11980 13056 13223 gene locus_tag LOCUS_11990 13056 13223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11990 13211 13549 gene locus_tag LOCUS_12000 13211 13549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12000 13546 14463 gene locus_tag LOCUS_12010 13546 14463 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094967.1 protein_id gnl|my_center|LOCUS_12010 15451 14456 gene locus_tag LOCUS_12020 gene wecH 15451 14456 CDS product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182664.1 protein_id gnl|my_center|LOCUS_12020 15653 15934 gene locus_tag LOCUS_12030 15653 15934 CDS product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094969.1 protein_id gnl|my_center|LOCUS_12030 16097 16234 gene locus_tag LOCUS_12040 16097 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12040 16397 16990 gene locus_tag LOCUS_12050 16397 16990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12050 17000 19069 gene locus_tag LOCUS_12060 gene glyS 17000 19069 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291774.1 protein_id gnl|my_center|LOCUS_12060 19834 19992 gene locus_tag LOCUS_12070 gene hokE 19834 19992 CDS product type I toxin-antitoxin system toxin HokE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956455.1 protein_id gnl|my_center|LOCUS_12070 20430 20140 gene locus_tag LOCUS_12080 20430 20140 CDS product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455798.1 protein_id gnl|my_center|LOCUS_12080 24276 20704 gene locus_tag LOCUS_12090 gene uca 24276 20704 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 protein_id gnl|my_center|LOCUS_12090 24986 24351 gene locus_tag LOCUS_12100 24986 24351 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_12100 25694 25053 gene locus_tag LOCUS_12110 25694 25053 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence034 276 58 gene locus_tag LOCUS_12120 276 58 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758664.1 protein_id gnl|my_center|LOCUS_12120 675 448 gene locus_tag LOCUS_12130 675 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12130 1132 599 gene locus_tag LOCUS_12140 1132 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12140 1814 2344 gene locus_tag LOCUS_12150 gene rppH 1814 2344 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564481.1 protein_id gnl|my_center|LOCUS_12150 2356 3108 gene locus_tag LOCUS_12160 2356 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2930 2968 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2991 4496 gene locus_tag LOCUS_12170 2991 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 4638 5522 gene locus_tag LOCUS_12180 gene lgt 4638 5522 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204645.1 protein_id gnl|my_center|LOCUS_12180 5529 6323 gene locus_tag LOCUS_12190 gene thyA 5529 6323 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098550.1 protein_id gnl|my_center|LOCUS_12190 6535 6975 gene locus_tag LOCUS_12200 6535 6975 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 protein_id gnl|my_center|LOCUS_12200 7102 7527 gene locus_tag LOCUS_12210 7102 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12210 7557 7940 gene locus_tag LOCUS_12220 7557 7940 CDS product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703325.1 protein_id gnl|my_center|LOCUS_12220 8267 9799 gene locus_tag LOCUS_12230 8267 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12230 9682 11589 gene locus_tag LOCUS_12240 9682 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12240 11739 12506 gene locus_tag LOCUS_12250 11739 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12250 12424 14619 gene locus_tag LOCUS_12260 gene ptrA 12424 14619 CDS product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138262.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12260 14616 18158 gene locus_tag LOCUS_12270 gene recB 14616 18158 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322794.1 protein_id gnl|my_center|LOCUS_12270 18307 19971 gene locus_tag LOCUS_12280 gene recD 18307 19971 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 protein_id gnl|my_center|LOCUS_12280 18348 18447 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21214 19973 gene locus_tag LOCUS_12290 gene argA 21214 19973 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098542.1 protein_id gnl|my_center|LOCUS_12290 21706 22758 gene locus_tag LOCUS_12300 gene amiC 21706 22758 CDS product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011916.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12300 22920 22844 gene locus_tag LOCUS_t00080 22920 22844 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23031 22955 gene locus_tag LOCUS_t00090 23031 22955 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23275 24336 gene locus_tag LOCUS_12310 gene mltA 23275 24336 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678646.1 protein_id gnl|my_center|LOCUS_12310 24386 25192 gene locus_tag LOCUS_12320 gene tcdA 24386 25192 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117716.1 protein_id gnl|my_center|LOCUS_12320 25639 25196 gene locus_tag LOCUS_12330 gene csdE 25639 25196 CDS product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184268.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence035 568 1311 gene locus_tag LOCUS_12340 gene ygaZ 568 1311 CDS product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445651.1 protein_id gnl|my_center|LOCUS_12340 1301 1636 gene locus_tag LOCUS_12350 gene ygaH 1301 1636 CDS product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119763.1 protein_id gnl|my_center|LOCUS_12350 1726 2256 gene locus_tag LOCUS_12360 gene mprA 1726 2256 CDS product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378431.1 protein_id gnl|my_center|LOCUS_12360 2394 3209 gene locus_tag LOCUS_12370 2394 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12370 3143 3556 gene locus_tag LOCUS_12380 3143 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12380 3571 5157 gene locus_tag LOCUS_12390 gene emrB 3571 5157 CDS product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296316.1 protein_id gnl|my_center|LOCUS_12390 5681 5166 gene locus_tag LOCUS_12400 gene luxS 5681 5166 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098432.1 protein_id gnl|my_center|LOCUS_12400 7364 5835 gene locus_tag LOCUS_12410 gene gshA 7364 5835 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098433.1 protein_id gnl|my_center|LOCUS_12410 7853 7425 gene locus_tag LOCUS_12420 7853 7425 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152081995.1 protein_id gnl|my_center|LOCUS_12420 8416 7850 gene locus_tag LOCUS_12430 gene yqaB 8416 7850 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703238.1 protein_id gnl|my_center|LOCUS_12430 8619 8543 gene locus_tag LOCUS_t00100 8619 8543 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8715 8623 gene locus_tag LOCUS_t00110 8715 8623 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9195 9010 gene locus_tag LOCUS_12440 gene csrA 9195 9010 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 protein_id gnl|my_center|LOCUS_12440 12192 9562 gene locus_tag LOCUS_12450 gene alaS 12192 9562 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098436.1 protein_id gnl|my_center|LOCUS_12450 12834 12331 gene locus_tag LOCUS_12460 gene recX 12834 12331 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140508.1 protein_id gnl|my_center|LOCUS_12460 13950 12886 gene locus_tag LOCUS_12470 gene recA 13950 12886 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963150.1 protein_id gnl|my_center|LOCUS_12470 14582 14040 gene locus_tag LOCUS_12480 gene pncC 14582 14040 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098439.1 protein_id gnl|my_center|LOCUS_12480 15733 14645 gene locus_tag LOCUS_12490 gene mltB 15733 14645 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005051417.1 protein_id gnl|my_center|LOCUS_12490 15986 16522 gene locus_tag LOCUS_12500 gene cueP 15986 16522 CDS product copper-binding periplasmic metallochaperone CueP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047148.1 protein_id gnl|my_center|LOCUS_12500 16800 17153 gene locus_tag LOCUS_12510 16800 17153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12510 17101 19395 gene locus_tag LOCUS_12520 gene mutS 17101 19395 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098485.1 protein_id gnl|my_center|LOCUS_12520 19676 19440 gene locus_tag LOCUS_12530 19676 19440 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562982.1 protein_id gnl|my_center|LOCUS_12530 21116 19692 gene locus_tag LOCUS_12540 21116 19692 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863205.1 protein_id gnl|my_center|LOCUS_12540 21690 21106 gene locus_tag LOCUS_12550 21690 21106 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098488.1 protein_id gnl|my_center|LOCUS_12550 21875 22279 gene locus_tag LOCUS_12560 21875 22279 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098489.1 protein_id gnl|my_center|LOCUS_12560 23347 22355 gene locus_tag LOCUS_12570 gene rpoS 23347 22355 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 protein_id gnl|my_center|LOCUS_12570 24590 23463 gene locus_tag LOCUS_12580 gene nlpD 24590 23463 CDS product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620533.1 protein_id gnl|my_center|LOCUS_12580 25341 24715 gene locus_tag LOCUS_12590 25341 24715 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098496.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence036 844 560 gene locus_tag LOCUS_12600 844 560 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705707.1 protein_id gnl|my_center|LOCUS_12600 1211 834 gene locus_tag LOCUS_12610 1211 834 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294876.1 protein_id gnl|my_center|LOCUS_12610 1415 1843 gene locus_tag LOCUS_12620 1415 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3197 2361 gene locus_tag LOCUS_12630 3197 2361 CDS product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705710.1 protein_id gnl|my_center|LOCUS_12630 4054 3197 gene locus_tag LOCUS_12640 4054 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 5019 4054 gene locus_tag LOCUS_12650 5019 4054 CDS product primase-helicase zinc-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260358.1 protein_id gnl|my_center|LOCUS_12650 6680 5016 gene locus_tag LOCUS_12660 6680 5016 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913116.1 protein_id gnl|my_center|LOCUS_12660 7505 7218 gene locus_tag LOCUS_12670 7505 7218 CDS product YdaS family helix-turn-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887453.1 protein_id gnl|my_center|LOCUS_12670 7648 8337 gene locus_tag LOCUS_12680 7648 8337 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048781225.1 protein_id gnl|my_center|LOCUS_12680 8487 8810 gene locus_tag LOCUS_12690 8487 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 8794 8985 gene locus_tag LOCUS_12700 8794 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 8987 9442 gene locus_tag LOCUS_12710 8987 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 9612 9836 gene locus_tag LOCUS_12720 9612 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 9820 10179 gene locus_tag LOCUS_12730 9820 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 10176 10412 gene locus_tag LOCUS_12740 10176 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 10409 10627 gene locus_tag LOCUS_12750 10409 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 10624 11028 gene locus_tag LOCUS_12760 10624 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 11176 11619 gene locus_tag LOCUS_12770 11176 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097280.1 protein_id gnl|my_center|LOCUS_12770 11631 12374 gene locus_tag LOCUS_12780 11631 12374 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099210.1 protein_id gnl|my_center|LOCUS_12780 12377 12748 gene locus_tag LOCUS_12790 12377 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047371030.1 protein_id gnl|my_center|LOCUS_12790 12732 12977 gene locus_tag LOCUS_12800 12732 12977 CDS product excisionase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097283.1 protein_id gnl|my_center|LOCUS_12800 13033 14346 gene locus_tag LOCUS_12810 13033 14346 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362003.1 protein_id gnl|my_center|LOCUS_12810 14373 14843 gene locus_tag LOCUS_12820 14373 14843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12820 14803 15120 gene locus_tag LOCUS_12830 14803 15120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12830 15190 15585 gene locus_tag LOCUS_12840 15190 15585 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096077.1 protein_id gnl|my_center|LOCUS_12840 15625 16371 gene locus_tag LOCUS_12850 gene cmoA 15625 16371 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019598.1 protein_id gnl|my_center|LOCUS_12850 16368 17318 gene locus_tag LOCUS_12860 gene cmoB 16368 17318 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096075.1 protein_id gnl|my_center|LOCUS_12860 16402 16492 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18372 17353 gene locus_tag LOCUS_12870 18372 17353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12870 21063 18445 gene locus_tag LOCUS_12880 21063 18445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 22615 21875 gene locus_tag LOCUS_12890 gene cutC 22615 21875 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419924.1 protein_id gnl|my_center|LOCUS_12890 23348 22785 gene locus_tag LOCUS_12900 23348 22785 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096073.1 protein_id gnl|my_center|LOCUS_12900 23542 25272 gene locus_tag LOCUS_12910 gene argS 23542 25272 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705961.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence037 2173 131 gene locus_tag LOCUS_12920 gene prlC 2173 131 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099196.1 protein_id gnl|my_center|LOCUS_12920 2351 3193 gene locus_tag LOCUS_12930 gene rlmJ 2351 3193 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602562.1 protein_id gnl|my_center|LOCUS_12930 3265 4617 gene locus_tag LOCUS_12940 gene gorA 3265 4617 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703747.1 protein_id gnl|my_center|LOCUS_12940 5569 4814 gene locus_tag LOCUS_12950 5569 4814 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094946.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12950 5888 7285 gene locus_tag LOCUS_12960 5888 7285 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204802.1 protein_id gnl|my_center|LOCUS_12960 7304 9265 gene locus_tag LOCUS_12970 7304 9265 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 protein_id gnl|my_center|LOCUS_12970 10334 9345 gene locus_tag LOCUS_12980 10334 9345 CDS product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049034212.1 protein_id gnl|my_center|LOCUS_12980 10964 10584 gene locus_tag LOCUS_12990 10964 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12990 12136 11336 gene locus_tag LOCUS_13000 12136 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13000 12491 12123 gene locus_tag LOCUS_13010 12491 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13010 13554 12637 gene locus_tag LOCUS_13020 13554 12637 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488351.1 protein_id gnl|my_center|LOCUS_13020 14137 13625 gene locus_tag LOCUS_13030 14137 13625 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109977.1 protein_id gnl|my_center|LOCUS_13030 14657 15934 gene locus_tag LOCUS_13040 14657 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 15958 17289 gene locus_tag LOCUS_13050 15958 17289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 18059 17286 gene locus_tag LOCUS_13060 18059 17286 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 protein_id gnl|my_center|LOCUS_13060 18158 18379 gene locus_tag LOCUS_13070 18158 18379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 19402 18497 gene locus_tag LOCUS_13080 19402 18497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 18631 18652 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21013 19418 gene locus_tag LOCUS_13090 21013 19418 CDS product STY4199 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099200.1 protein_id gnl|my_center|LOCUS_13090 21193 21735 gene locus_tag LOCUS_13100 21193 21735 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703751.1 protein_id gnl|my_center|LOCUS_13100 22519 21761 gene locus_tag LOCUS_13110 22519 21761 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_13110 22638 23537 gene locus_tag LOCUS_13120 22638 23537 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369250.1 protein_id gnl|my_center|LOCUS_13120 23591 24625 gene locus_tag LOCUS_13130 gene yhjD 23591 24625 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099206.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence038 352 397 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 413 886 gene locus_tag LOCUS_13140 413 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13140 949 1437 gene locus_tag LOCUS_13150 949 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 1450 2298 gene locus_tag LOCUS_13160 1450 2298 CDS product DUF2950 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757452.1 protein_id gnl|my_center|LOCUS_13160 2627 2343 gene locus_tag LOCUS_13170 2627 2343 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765363.1 protein_id gnl|my_center|LOCUS_13170 4231 2828 gene locus_tag LOCUS_13180 gene lpdA 4231 2828 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519338.1 protein_id gnl|my_center|LOCUS_13180 5721 4441 gene locus_tag LOCUS_13190 5721 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 8399 5736 gene locus_tag LOCUS_13200 gene aceE 8399 5736 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095597.1 protein_id gnl|my_center|LOCUS_13200 9342 8578 gene locus_tag LOCUS_13210 gene pdhR 9342 8578 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368223.1 protein_id gnl|my_center|LOCUS_13210 9879 11192 gene locus_tag LOCUS_13220 gene aroP 9879 11192 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602166.1 protein_id gnl|my_center|LOCUS_13220 12112 11258 gene locus_tag LOCUS_13230 gene ampE 12112 11258 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095591.1 protein_id gnl|my_center|LOCUS_13230 12672 12109 gene locus_tag LOCUS_13240 gene ampD 12672 12109 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923703.1 protein_id gnl|my_center|LOCUS_13240 12757 13650 gene locus_tag LOCUS_13250 gene nadC 12757 13650 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704410.1 protein_id gnl|my_center|LOCUS_13250 14421 14068 gene locus_tag LOCUS_13260 14421 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 14308 15036 gene locus_tag LOCUS_13270 14308 15036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 14934 15452 gene locus_tag LOCUS_13280 14934 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 15445 16647 gene locus_tag LOCUS_13290 gene hofC 15445 16647 CDS product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114107.1 protein_id gnl|my_center|LOCUS_13290 17748 16705 gene locus_tag LOCUS_13300 17748 16705 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217357.1 protein_id gnl|my_center|LOCUS_13300 17977 18597 gene locus_tag LOCUS_13310 gene coaE 17977 18597 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269520.1 protein_id gnl|my_center|LOCUS_13310 18597 19340 gene locus_tag LOCUS_13320 gene zapD 18597 19340 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095583.1 protein_id gnl|my_center|LOCUS_13320 19350 19544 gene locus_tag LOCUS_13330 gene yacG 19350 19544 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 protein_id gnl|my_center|LOCUS_13330 20008 19607 gene locus_tag LOCUS_13340 gene mutT 20008 19607 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736063.1 protein_id gnl|my_center|LOCUS_13340 20737 20021 gene locus_tag LOCUS_13350 20737 20021 CDS product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984827.1 protein_id gnl|my_center|LOCUS_13350 21118 20792 gene locus_tag LOCUS_13360 21118 20792 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107565.1 protein_id gnl|my_center|LOCUS_13360 21885 21118 gene locus_tag LOCUS_13370 gene trmB 21885 21118 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098672.1 protein_id gnl|my_center|LOCUS_13370 21988 23073 gene locus_tag LOCUS_13380 gene mutY 21988 23073 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703459.1 protein_id gnl|my_center|LOCUS_13380 23076 23351 gene locus_tag LOCUS_13390 23076 23351 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098674.1 protein_id gnl|my_center|LOCUS_13390 23407 24486 gene locus_tag LOCUS_13400 gene mltC 23407 24486 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098675.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence039 <1 996 gene locus_tag LOCUS_13410 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050717203.1:DUF5107 domain-containing protein note possible pseudo, frameshifted 882 1598 gene locus_tag LOCUS_13420 882 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13420 1659 3098 gene locus_tag LOCUS_13430 1659 3098 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_13430 3098 3943 gene locus_tag LOCUS_13440 3098 3943 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528174.1 protein_id gnl|my_center|LOCUS_13440 4444 4106 gene locus_tag LOCUS_13450 4444 4106 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015492.1 protein_id gnl|my_center|LOCUS_13450 4816 4457 gene locus_tag LOCUS_13460 gene yeaR 4816 4457 CDS product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248993.1 protein_id gnl|my_center|LOCUS_13460 5456 4998 gene locus_tag LOCUS_13470 gene fucU 5456 4998 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 protein_id gnl|my_center|LOCUS_13470 5701 5459 gene locus_tag LOCUS_13480 5701 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13480 6513 5689 gene locus_tag LOCUS_13490 6513 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13490 6782 6537 gene locus_tag LOCUS_13500 6782 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13500 8600 6831 gene locus_tag LOCUS_13510 gene fucI 8600 6831 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724159.1 protein_id gnl|my_center|LOCUS_13510 9129 10469 gene locus_tag LOCUS_13520 gene gguA 9129 10469 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_13520 10473 11456 gene locus_tag LOCUS_13530 10473 11456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_13530 11522 12511 gene locus_tag LOCUS_13540 11522 12511 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067432.1 protein_id gnl|my_center|LOCUS_13540 12581 13567 gene locus_tag LOCUS_13550 12581 13567 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 protein_id gnl|my_center|LOCUS_13550 13674 14321 gene locus_tag LOCUS_13560 gene fucA 13674 14321 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440828.1 protein_id gnl|my_center|LOCUS_13560 14362 15237 gene locus_tag LOCUS_13570 14362 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13570 15197 15514 gene locus_tag LOCUS_13580 15197 15514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13580 16836 15556 gene locus_tag LOCUS_13590 16836 15556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13590 17724 16870 gene locus_tag LOCUS_13600 17724 16870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13600 18304 17753 gene locus_tag LOCUS_13610 gene hydN 18304 17753 CDS product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078791.1 protein_id gnl|my_center|LOCUS_13610 19362 18730 gene locus_tag LOCUS_13620 19362 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 19840 20112 gene locus_tag LOCUS_13630 19840 20112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 20061 21821 gene locus_tag LOCUS_13640 gene flhA 20061 21821 CDS product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816738.1 protein_id gnl|my_center|LOCUS_13640 22155 23150 gene locus_tag LOCUS_13650 gene dctP 22155 23150 CDS product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 protein_id gnl|my_center|LOCUS_13650 23415 24041 gene locus_tag LOCUS_13660 gene dctQ 23415 24041 CDS product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105527.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence040 95 985 gene locus_tag LOCUS_13670 95 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2955 1195 gene locus_tag LOCUS_13680 2955 1195 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156477.1 protein_id gnl|my_center|LOCUS_13680 3138 3593 gene locus_tag LOCUS_13690 gene matP 3138 3593 CDS product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877161.1 protein_id gnl|my_center|LOCUS_13690 4385 3684 gene locus_tag LOCUS_13700 4385 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13700 4749 4438 gene locus_tag LOCUS_13710 4749 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13710 5611 5102 gene locus_tag LOCUS_13720 gene sulA 5611 5102 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288723.1 protein_id gnl|my_center|LOCUS_13720 5829 6119 gene locus_tag LOCUS_13730 5829 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13730 6177 6443 gene locus_tag LOCUS_13740 6177 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13740 8579 6429 gene locus_tag LOCUS_13750 gene yccS 8579 6429 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097254.1 protein_id gnl|my_center|LOCUS_13750 9025 8579 gene locus_tag LOCUS_13760 9025 8579 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261236.1 protein_id gnl|my_center|LOCUS_13760 9150 10016 gene locus_tag LOCUS_13770 9150 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13770 9940 11157 gene locus_tag LOCUS_13780 9940 11157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13780 11616 11158 gene locus_tag LOCUS_13790 gene mgsA 11616 11158 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424181.1 protein_id gnl|my_center|LOCUS_13790 11977 11708 gene locus_tag LOCUS_13800 11977 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13800 12357 11965 gene locus_tag LOCUS_13810 12357 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13810 12533 12946 gene locus_tag LOCUS_13820 12533 12946 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301418.1 protein_id gnl|my_center|LOCUS_13820 13294 12977 gene locus_tag LOCUS_13830 gene hspQ 13294 12977 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097248.1 protein_id gnl|my_center|LOCUS_13830 14547 13357 gene locus_tag LOCUS_13840 gene rlmI 14547 13357 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 protein_id gnl|my_center|LOCUS_13840 14638 14919 gene locus_tag LOCUS_13850 gene yccX 14638 14919 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097246.1 protein_id gnl|my_center|LOCUS_13850 15245 14916 gene locus_tag LOCUS_13860 gene tusE 15245 14916 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097245.1 protein_id gnl|my_center|LOCUS_13860 16014 15349 gene locus_tag LOCUS_13870 gene yccA 16014 15349 CDS product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374046.1 protein_id gnl|my_center|LOCUS_13870 16308 16395 gene locus_tag LOCUS_t00120 16308 16395 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18662 16509 gene locus_tag LOCUS_13880 gene fdhF 18662 16509 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705180.1 protein_id gnl|my_center|LOCUS_13880 19250 18705 gene locus_tag LOCUS_13890 gene hydN 19250 18705 CDS product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078791.1 protein_id gnl|my_center|LOCUS_13890 19853 19398 gene locus_tag LOCUS_13900 gene hycI 19853 19398 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132962.1 protein_id gnl|my_center|LOCUS_13900 20256 19846 gene locus_tag LOCUS_13910 20256 19846 CDS product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003725.1 protein_id gnl|my_center|LOCUS_13910 21020 20256 gene locus_tag LOCUS_13920 gene hycG 21020 20256 CDS product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067392.1 protein_id gnl|my_center|LOCUS_13920 21558 21034 gene locus_tag LOCUS_13930 gene hycF 21558 21034 CDS product formate hydrogenlyase subunit HycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493767.1 protein_id gnl|my_center|LOCUS_13930 23198 21666 gene locus_tag LOCUS_13940 gene hycE 23198 21666 CDS product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370028.1 protein_id gnl|my_center|LOCUS_13940 21670 21704 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24112 23210 gene locus_tag LOCUS_13950 24112 23210 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098466.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence041 1480 1692 gene locus_tag LOCUS_13960 gene rpmE 1480 1692 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368925.1 protein_id gnl|my_center|LOCUS_13960 2064 1747 gene locus_tag LOCUS_13970 gene metJ 2064 1747 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862042.1 protein_id gnl|my_center|LOCUS_13970 2355 3515 gene locus_tag LOCUS_13980 gene metB 2355 3515 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099309.1 protein_id gnl|my_center|LOCUS_13980 3518 5950 gene locus_tag LOCUS_13990 gene metL 3518 5950 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110811.1 protein_id gnl|my_center|LOCUS_13990 6177 7067 gene locus_tag LOCUS_14000 gene metF 6177 7067 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007509.1 protein_id gnl|my_center|LOCUS_14000 9966 7300 gene locus_tag LOCUS_14010 gene ppc 9966 7300 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368915.1 protein_id gnl|my_center|LOCUS_14010 11380 10220 gene locus_tag LOCUS_14020 gene argE 11380 10220 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298964.1 protein_id gnl|my_center|LOCUS_14020 11557 12561 gene locus_tag LOCUS_14030 gene argC 11557 12561 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935365.1 protein_id gnl|my_center|LOCUS_14030 12572 13345 gene locus_tag LOCUS_14040 gene argB 12572 13345 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686923.1 protein_id gnl|my_center|LOCUS_14040 13372 14589 gene locus_tag LOCUS_14050 13372 14589 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465152.1 protein_id gnl|my_center|LOCUS_14050 14686 16059 gene locus_tag LOCUS_14060 gene argH 14686 16059 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368911.1 protein_id gnl|my_center|LOCUS_14060 16307 17224 gene locus_tag LOCUS_14070 gene oxyR 16307 17224 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025919.1 protein_id gnl|my_center|LOCUS_14070 18607 17207 gene locus_tag LOCUS_14080 gene sthA 18607 17207 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120789.1 protein_id gnl|my_center|LOCUS_14080 18803 19336 gene locus_tag LOCUS_14090 18803 19336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14090 19415 19774 gene locus_tag LOCUS_14100 19415 19774 CDS product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813838.1 protein_id gnl|my_center|LOCUS_14100 20935 19826 gene locus_tag LOCUS_14110 gene trmA 20935 19826 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187001.1 protein_id gnl|my_center|LOCUS_14110 21296 22669 gene locus_tag LOCUS_14120 21296 22669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14120 22683 23132 gene locus_tag LOCUS_14130 22683 23132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14130 23077 23928 gene locus_tag LOCUS_14140 gene murI 23077 23928 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201804.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence042 1270 2199 gene locus_tag LOCUS_14150 1270 2199 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299745.1 protein_id gnl|my_center|LOCUS_14150 2312 4648 gene locus_tag LOCUS_14160 gene arcB 2312 4648 CDS product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809818.1 protein_id gnl|my_center|LOCUS_14160 4877 5530 gene locus_tag LOCUS_14170 gene elbB 4877 5530 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703608.1 protein_id gnl|my_center|LOCUS_14170 5527 6255 gene locus_tag LOCUS_14180 gene mtgA 5527 6255 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047087.1 protein_id gnl|my_center|LOCUS_14180 6531 6259 gene locus_tag LOCUS_14190 gene npr 6531 6259 CDS product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918431.1 protein_id gnl|my_center|LOCUS_14190 7382 6528 gene locus_tag LOCUS_14200 gene rapZ 7382 6528 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098945.1 protein_id gnl|my_center|LOCUS_14200 7922 7443 gene locus_tag LOCUS_14210 gene ptsN 7922 7443 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609332.1 protein_id gnl|my_center|LOCUS_14210 8290 8003 gene locus_tag LOCUS_14220 gene hpf 8290 8003 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176588.1 protein_id gnl|my_center|LOCUS_14220 9746 8313 gene locus_tag LOCUS_14230 gene rpoN 9746 8313 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098942.1 protein_id gnl|my_center|LOCUS_14230 10639 9914 gene locus_tag LOCUS_14240 gene lptB 10639 9914 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206203.1 protein_id gnl|my_center|LOCUS_14240 11197 10646 gene locus_tag LOCUS_14250 gene lptA 11197 10646 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 protein_id gnl|my_center|LOCUS_14250 12245 11166 gene locus_tag LOCUS_14260 12245 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 13249 12263 gene locus_tag LOCUS_14270 gene kdsD 13249 12263 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098937.1 protein_id gnl|my_center|LOCUS_14270 13919 13263 gene locus_tag LOCUS_14280 13919 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14280 14458 15273 gene locus_tag LOCUS_14290 gene mlaF 14458 15273 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438248.1 protein_id gnl|my_center|LOCUS_14290 15281 16063 gene locus_tag LOCUS_14300 gene mlaE 15281 16063 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925786.1 protein_id gnl|my_center|LOCUS_14300 16067 16618 gene locus_tag LOCUS_14310 gene mlaD 16067 16618 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193591.1 protein_id gnl|my_center|LOCUS_14310 16634 17263 gene locus_tag LOCUS_14320 gene mlaC 16634 17263 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098933.1 protein_id gnl|my_center|LOCUS_14320 17263 17565 gene locus_tag LOCUS_14330 gene mlaB 17263 17565 CDS product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 protein_id gnl|my_center|LOCUS_14330 17693 17947 gene locus_tag LOCUS_14340 gene ibaG 17693 17947 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900133.1 protein_id gnl|my_center|LOCUS_14340 17999 19198 gene locus_tag LOCUS_14350 gene murA 17999 19198 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098931.1 protein_id gnl|my_center|LOCUS_14350 19562 19299 gene locus_tag LOCUS_14360 gene sfsB 19562 19299 CDS product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444167.1 protein_id gnl|my_center|LOCUS_14360 20739 19768 gene locus_tag LOCUS_14370 gene ispB 20739 19768 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098929.1 protein_id gnl|my_center|LOCUS_14370 20999 21310 gene locus_tag LOCUS_14380 gene rplU 20999 21310 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025032.1 protein_id gnl|my_center|LOCUS_14380 21329 21586 gene locus_tag LOCUS_14390 gene rpmA 21329 21586 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 protein_id gnl|my_center|LOCUS_14390 21675 22640 gene locus_tag LOCUS_14400 21675 22640 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369509.1 protein_id gnl|my_center|LOCUS_14400 22657 23544 gene locus_tag LOCUS_14410 22657 23544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14410 23629 23874 gene locus_tag LOCUS_14420 23629 23874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14420 >Feature sequence043 <1 738 gene locus_tag LOCUS_14430 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099207.1:MFS transporter 2256 784 gene locus_tag LOCUS_14440 gene dtpB 2256 784 CDS product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098284.1 protein_id gnl|my_center|LOCUS_14440 2932 2495 gene locus_tag LOCUS_14450 gene uspA 2932 2495 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145166.1 protein_id gnl|my_center|LOCUS_14450 3641 3444 gene locus_tag LOCUS_14460 3641 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5252 3756 gene locus_tag LOCUS_14470 gene pitA 5252 3756 CDS product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902764.1 protein_id gnl|my_center|LOCUS_14470 5480 6670 gene locus_tag LOCUS_14480 5480 6670 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420964.1 protein_id gnl|my_center|LOCUS_14480 7528 6887 gene locus_tag LOCUS_14490 gene fdnI 7528 6887 CDS product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045648.1 protein_id gnl|my_center|LOCUS_14490 7940 7521 gene locus_tag LOCUS_14500 7940 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 10422 7945 gene locus_tag LOCUS_14510 gene fdnG 10422 7945 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154231912.1 protein_id gnl|my_center|LOCUS_14510 7986 8127 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11058 10471 gene locus_tag LOCUS_14520 11058 10471 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906463.1 protein_id gnl|my_center|LOCUS_14520 12003 12899 gene locus_tag LOCUS_14530 12003 12899 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815364.1 protein_id gnl|my_center|LOCUS_14530 13032 14252 gene locus_tag LOCUS_14540 13032 14252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 14266 14841 gene locus_tag LOCUS_14550 14266 14841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 14834 15250 gene locus_tag LOCUS_14560 14834 15250 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942200.1 protein_id gnl|my_center|LOCUS_14560 15244 16008 gene locus_tag LOCUS_14570 15244 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 16843 18057 gene locus_tag LOCUS_14580 16843 18057 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096959.1 protein_id gnl|my_center|LOCUS_14580 19933 18101 gene locus_tag LOCUS_14590 19933 18101 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036278.1 protein_id gnl|my_center|LOCUS_14590 20332 19985 gene locus_tag LOCUS_14600 20332 19985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14600 20841 20425 gene locus_tag LOCUS_14610 20841 20425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14610 21341 22087 gene locus_tag LOCUS_14620 21341 22087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 22516 22082 gene locus_tag LOCUS_14630 22516 22082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 23013 23450 gene locus_tag LOCUS_14640 23013 23450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence044 <1 689 gene locus_tag LOCUS_14650 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095096.1:sugar ABC transporter ATP-binding protein 682 1467 gene locus_tag LOCUS_14660 682 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1603 2544 gene locus_tag LOCUS_14670 1603 2544 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237475.1 protein_id gnl|my_center|LOCUS_14670 2625 3308 gene locus_tag LOCUS_14680 2625 3308 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830337.1 protein_id gnl|my_center|LOCUS_14680 3324 4184 gene locus_tag LOCUS_14690 3324 4184 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 protein_id gnl|my_center|LOCUS_14690 4194 5204 gene locus_tag LOCUS_14700 4194 5204 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209518.1 protein_id gnl|my_center|LOCUS_14700 5870 6406 gene locus_tag LOCUS_14710 5870 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 6526 7206 gene locus_tag LOCUS_14720 6526 7206 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 protein_id gnl|my_center|LOCUS_14720 7575 7871 gene locus_tag LOCUS_14730 7575 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14730 7960 9687 gene locus_tag LOCUS_14740 7960 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14740 9687 10664 gene locus_tag LOCUS_14750 9687 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 10770 11303 gene locus_tag LOCUS_14760 10770 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 12136 11405 gene locus_tag LOCUS_14770 12136 11405 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095088.1 protein_id gnl|my_center|LOCUS_14770 13411 12308 gene locus_tag LOCUS_14780 13411 12308 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 protein_id gnl|my_center|LOCUS_14780 13746 15077 gene locus_tag LOCUS_14790 13746 15077 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094951.1 protein_id gnl|my_center|LOCUS_14790 15074 16753 gene locus_tag LOCUS_14800 15074 16753 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966867.1 protein_id gnl|my_center|LOCUS_14800 16805 17710 gene locus_tag LOCUS_14810 gene yagE 16805 17710 CDS product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136613.1 protein_id gnl|my_center|LOCUS_14810 18506 17751 gene locus_tag LOCUS_14820 18506 17751 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894191.1 protein_id gnl|my_center|LOCUS_14820 19923 18646 gene locus_tag LOCUS_14830 gene gltP 19923 18646 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368716.1 protein_id gnl|my_center|LOCUS_14830 20348 21922 gene locus_tag LOCUS_14840 gene acs 20348 21922 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083869.1 protein_id gnl|my_center|LOCUS_14840 21919 22401 gene locus_tag LOCUS_14850 21919 22401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14850 22334 22606 gene locus_tag LOCUS_14860 22334 22606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14860 22746 23060 gene locus_tag LOCUS_14870 22746 23060 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999620.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence045 714 2207 gene locus_tag LOCUS_14880 gene ravA 714 2207 CDS product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940993.1 protein_id gnl|my_center|LOCUS_14880 2204 3655 gene locus_tag LOCUS_14890 gene viaA 2204 3655 CDS product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956591.1 protein_id gnl|my_center|LOCUS_14890 4651 3659 gene locus_tag LOCUS_14900 gene asnA 4651 3659 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099401.1 protein_id gnl|my_center|LOCUS_14900 4804 5166 gene locus_tag LOCUS_14910 gene asnC 4804 5166 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14910 5402 5842 gene locus_tag LOCUS_14920 gene mioC 5402 5842 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099402.1 protein_id gnl|my_center|LOCUS_14920 6221 7405 gene locus_tag LOCUS_14930 6221 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 7320 7916 gene locus_tag LOCUS_14940 7320 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 7354 7374 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7943 8593 gene locus_tag LOCUS_14950 gene rsmG 7943 8593 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099403.1 protein_id gnl|my_center|LOCUS_14950 9191 9574 gene locus_tag LOCUS_14960 gene atpI 9191 9574 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145371.1 protein_id gnl|my_center|LOCUS_14960 9583 10401 gene locus_tag LOCUS_14970 gene atpB 9583 10401 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135632.1 protein_id gnl|my_center|LOCUS_14970 10450 10689 gene locus_tag LOCUS_14980 gene atpE 10450 10689 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 protein_id gnl|my_center|LOCUS_14980 10759 11229 gene locus_tag LOCUS_14990 gene atpF 10759 11229 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393038.1 protein_id gnl|my_center|LOCUS_14990 11244 11777 gene locus_tag LOCUS_15000 gene atpH 11244 11777 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288957.1 protein_id gnl|my_center|LOCUS_15000 11790 13331 gene locus_tag LOCUS_15010 gene atpA 11790 13331 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369006.1 protein_id gnl|my_center|LOCUS_15010 13382 14245 gene locus_tag LOCUS_15020 gene atpG 13382 14245 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896501.1 protein_id gnl|my_center|LOCUS_15020 14272 15654 gene locus_tag LOCUS_15030 gene atpD 14272 15654 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862362.1 protein_id gnl|my_center|LOCUS_15030 15675 16094 gene locus_tag LOCUS_15040 15675 16094 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251971.1 protein_id gnl|my_center|LOCUS_15040 16527 17825 gene locus_tag LOCUS_15050 gene glmU 16527 17825 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933729.1 protein_id gnl|my_center|LOCUS_15050 18078 19907 gene locus_tag LOCUS_15060 gene glmS 18078 19907 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334099.1 protein_id gnl|my_center|LOCUS_15060 20217 21257 gene locus_tag LOCUS_15070 gene pstS 20217 21257 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099410.1 protein_id gnl|my_center|LOCUS_15070 21372 22331 gene locus_tag LOCUS_15080 gene pstC 21372 22331 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741630.1 protein_id gnl|my_center|LOCUS_15080 22331 23065 gene locus_tag LOCUS_15090 gene pstA 22331 23065 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251992.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15090 23052 23192 gene locus_tag LOCUS_15100 23052 23192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15100 >Feature sequence046 1370 45 gene locus_tag LOCUS_15110 gene srmB 1370 45 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219193.1 protein_id gnl|my_center|LOCUS_15110 1579 2235 gene locus_tag LOCUS_15120 1579 2235 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098325.1 protein_id gnl|my_center|LOCUS_15120 3806 2220 gene locus_tag LOCUS_15130 gene nadB 3806 2220 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094491.1 protein_id gnl|my_center|LOCUS_15130 4269 4844 gene locus_tag LOCUS_15140 gene rpoE 4269 4844 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176728.1 protein_id gnl|my_center|LOCUS_15140 4876 5523 gene locus_tag LOCUS_15150 gene rseA 4876 5523 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168379.1 protein_id gnl|my_center|LOCUS_15150 5613 6479 gene locus_tag LOCUS_15160 gene rseB 5613 6479 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 protein_id gnl|my_center|LOCUS_15160 6476 6955 gene locus_tag LOCUS_15170 gene rseC 6476 6955 CDS product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703183.1 protein_id gnl|my_center|LOCUS_15170 7591 9126 gene locus_tag LOCUS_15180 7591 9126 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189772.1 protein_id gnl|my_center|LOCUS_15180 9355 11154 gene locus_tag LOCUS_15190 gene lepA 9355 11154 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098320.1 protein_id gnl|my_center|LOCUS_15190 11169 12143 gene locus_tag LOCUS_15200 gene lepB 11169 12143 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098319.1 protein_id gnl|my_center|LOCUS_15200 12498 13112 gene locus_tag LOCUS_15210 gene rnc 12498 13112 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004151992.1 protein_id gnl|my_center|LOCUS_15210 13109 14014 gene locus_tag LOCUS_15220 gene era 13109 14014 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102231.1 protein_id gnl|my_center|LOCUS_15220 14166 14717 gene locus_tag LOCUS_15230 14166 14717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15230 15044 14793 gene locus_tag LOCUS_15240 15044 14793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 15122 15508 gene locus_tag LOCUS_15250 15122 15508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15250 15508 15888 gene locus_tag LOCUS_15260 gene acpS 15508 15888 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986043.1 protein_id gnl|my_center|LOCUS_15260 16145 15885 gene locus_tag LOCUS_15270 16145 15885 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370294.1 protein_id gnl|my_center|LOCUS_15270 16865 16416 gene locus_tag LOCUS_15280 16865 16416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 17524 17138 gene locus_tag LOCUS_15290 17524 17138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15290 18032 17451 gene locus_tag LOCUS_15300 18032 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15300 18228 18863 gene locus_tag LOCUS_15310 gene yfhb 18228 18863 CDS product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190655.1 protein_id gnl|my_center|LOCUS_15310 18946 19446 gene locus_tag LOCUS_15320 gene tadA 18946 19446 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098309.1 protein_id gnl|my_center|LOCUS_15320 20890 19340 gene locus_tag LOCUS_15330 gene mltF 20890 19340 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098308.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence047 369 719 gene locus_tag LOCUS_15340 369 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1291 1434 gene locus_tag LOCUS_15350 1291 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2153 1545 gene locus_tag LOCUS_15360 2153 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039861821.1 protein_id gnl|my_center|LOCUS_15360 2173 2382 gene locus_tag LOCUS_15370 2173 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 2510 2797 gene locus_tag LOCUS_15380 2510 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2802 3092 gene locus_tag LOCUS_15390 2802 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 3207 3641 gene locus_tag LOCUS_15400 3207 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204956.1 protein_id gnl|my_center|LOCUS_15400 3655 5187 gene locus_tag LOCUS_15410 3655 5187 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936861.1 protein_id gnl|my_center|LOCUS_15410 5190 6467 gene locus_tag LOCUS_15420 5190 6467 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072869.1 protein_id gnl|my_center|LOCUS_15420 6473 7153 gene locus_tag LOCUS_15430 6473 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 7165 8328 gene locus_tag LOCUS_15440 7165 8328 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 protein_id gnl|my_center|LOCUS_15440 8365 8610 gene locus_tag LOCUS_15450 8365 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 8558 8890 gene locus_tag LOCUS_15460 8558 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 8951 9151 gene locus_tag LOCUS_15470 8951 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 9154 9462 gene locus_tag LOCUS_15480 9154 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 9455 9940 gene locus_tag LOCUS_15490 9455 9940 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072862.1 protein_id gnl|my_center|LOCUS_15490 9937 10302 gene locus_tag LOCUS_15500 9937 10302 CDS product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072861.1 protein_id gnl|my_center|LOCUS_15500 10351 10842 gene locus_tag LOCUS_15510 10351 10842 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113190.1 protein_id gnl|my_center|LOCUS_15510 10842 11051 gene locus_tag LOCUS_15520 10842 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 11014 11268 gene locus_tag LOCUS_15530 11014 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 11328 11498 gene locus_tag LOCUS_15540 11328 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 11571 11798 gene locus_tag LOCUS_15550 11571 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 11863 13776 gene locus_tag LOCUS_15560 11863 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15560 13786 14289 gene locus_tag LOCUS_15570 13786 14289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15570 14289 14627 gene locus_tag LOCUS_15580 14289 14627 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072856.1 protein_id gnl|my_center|LOCUS_15580 14624 15379 gene locus_tag LOCUS_15590 14624 15379 CDS product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055651.1 protein_id gnl|my_center|LOCUS_15590 15381 16091 gene locus_tag LOCUS_15600 15381 16091 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096343.1 protein_id gnl|my_center|LOCUS_15600 16122 16457 gene locus_tag LOCUS_15610 16122 16457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 16420 17070 gene locus_tag LOCUS_15620 16420 17070 CDS product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419708.1 protein_id gnl|my_center|LOCUS_15620 16446 16452 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17108 17365 gene locus_tag LOCUS_15630 17108 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 17606 17379 gene locus_tag LOCUS_15640 17606 17379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 17772 21254 gene locus_tag LOCUS_15650 17772 21254 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096345.1 protein_id gnl|my_center|LOCUS_15650 21254 22210 gene locus_tag LOCUS_15660 21254 22210 CDS product DUF6453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096346.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence048 775 500 gene locus_tag LOCUS_15670 775 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15670 1898 786 gene locus_tag LOCUS_15680 gene mrdB 1898 786 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131719.1 protein_id gnl|my_center|LOCUS_15680 3796 1898 gene locus_tag LOCUS_15690 gene mrdA 3796 1898 CDS product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776191.1 protein_id gnl|my_center|LOCUS_15690 4290 3823 gene locus_tag LOCUS_15700 gene rlmH 4290 3823 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776107.1 protein_id gnl|my_center|LOCUS_15700 4611 4294 gene locus_tag LOCUS_15710 gene rsfS 4611 4294 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161664.1 protein_id gnl|my_center|LOCUS_15710 5453 4851 gene locus_tag LOCUS_15720 5453 4851 CDS product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351014.1 protein_id gnl|my_center|LOCUS_15720 5546 6631 gene locus_tag LOCUS_15730 gene cobD 5546 6631 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_15730 7208 6603 gene locus_tag LOCUS_15740 gene nadD 7208 6603 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989126.1 protein_id gnl|my_center|LOCUS_15740 7902 7201 gene locus_tag LOCUS_15750 7902 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 8788 8192 gene locus_tag LOCUS_15760 gene lptE 8788 8192 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704738.1 protein_id gnl|my_center|LOCUS_15760 11385 8803 gene locus_tag LOCUS_15770 gene leuS 11385 8803 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704739.1 protein_id gnl|my_center|LOCUS_15770 11614 12096 gene locus_tag LOCUS_15780 11614 12096 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831082.1 protein_id gnl|my_center|LOCUS_15780 12441 12148 gene locus_tag LOCUS_15790 12441 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 12749 12360 gene locus_tag LOCUS_15800 12749 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 13408 12749 gene locus_tag LOCUS_15810 gene gltK 13408 12749 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097580.1 protein_id gnl|my_center|LOCUS_15810 14112 13501 gene locus_tag LOCUS_15820 gene gltJ 14112 13501 CDS product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020930.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15820 13505 13513 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15232 14312 gene locus_tag LOCUS_15830 15232 14312 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588823.1 protein_id gnl|my_center|LOCUS_15830 17125 15587 gene locus_tag LOCUS_15840 gene lnt 17125 15587 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367717.1 protein_id gnl|my_center|LOCUS_15840 18008 17130 gene locus_tag LOCUS_15850 gene corC 18008 17130 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704743.1 protein_id gnl|my_center|LOCUS_15850 18572 18105 gene locus_tag LOCUS_15860 gene ybeY 18572 18105 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858677.1 protein_id gnl|my_center|LOCUS_15860 19630 18569 gene locus_tag LOCUS_15870 19630 18569 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018040.1 protein_id gnl|my_center|LOCUS_15870 20483 19833 gene locus_tag LOCUS_15880 20483 19833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 20511 20586 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence049 717 172 gene locus_tag LOCUS_15890 gene hemG 717 172 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853982.1 protein_id gnl|my_center|LOCUS_15890 2181 730 gene locus_tag LOCUS_15900 gene trkH 2181 730 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099227.1 protein_id gnl|my_center|LOCUS_15900 2739 2221 gene locus_tag LOCUS_15910 2739 2221 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099228.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15910 4143 2812 gene locus_tag LOCUS_15920 gene pepQ 4143 2812 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444561.1 protein_id gnl|my_center|LOCUS_15920 4335 6524 gene locus_tag LOCUS_15930 gene fadB 4335 6524 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965943.1 protein_id gnl|my_center|LOCUS_15930 6535 7698 gene locus_tag LOCUS_15940 gene fadA 6535 7698 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099231.1 protein_id gnl|my_center|LOCUS_15940 8511 7810 gene locus_tag LOCUS_15950 gene fre 8511 7810 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209828.1 protein_id gnl|my_center|LOCUS_15950 10041 8557 gene locus_tag LOCUS_15960 gene ubiD 10041 8557 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496900.1 protein_id gnl|my_center|LOCUS_15960 10224 10712 gene locus_tag LOCUS_15970 gene rfaH 10224 10712 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099234.1 protein_id gnl|my_center|LOCUS_15970 11234 10713 gene locus_tag LOCUS_15980 11234 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15980 12311 11544 gene locus_tag LOCUS_15990 gene tatC 12311 11544 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257554.1 protein_id gnl|my_center|LOCUS_15990 12847 12314 gene locus_tag LOCUS_16000 gene tatB 12847 12314 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459594.1 protein_id gnl|my_center|LOCUS_16000 13102 12851 gene locus_tag LOCUS_16010 gene tatA 13102 12851 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368844.1 protein_id gnl|my_center|LOCUS_16010 14805 13288 gene locus_tag LOCUS_16020 gene ubiB 14805 13288 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099239.1 protein_id gnl|my_center|LOCUS_16020 13759 13766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15302 14802 gene locus_tag LOCUS_16030 gene ubiJ 15302 14802 CDS product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099240.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16030 16184 15429 gene locus_tag LOCUS_16040 gene ubiE 16184 15429 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099241.1 protein_id gnl|my_center|LOCUS_16040 17699 16263 gene locus_tag LOCUS_16050 gene rmuC 17699 16263 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099242.1 protein_id gnl|my_center|LOCUS_16050 18637 17876 gene locus_tag LOCUS_16060 gene udp 18637 17876 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181652.1 protein_id gnl|my_center|LOCUS_16060 18880 19701 gene locus_tag LOCUS_16070 18880 19701 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099243.1 protein_id gnl|my_center|LOCUS_16070 <21741 19755 gene locus_tag LOCUS_16080 <21741 19755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099244.1:5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase 21054 21131 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence050 1001 426 gene locus_tag LOCUS_16090 1001 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16090 1666 947 gene locus_tag LOCUS_16100 1666 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16100 1547 1783 gene locus_tag LOCUS_16110 1547 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1863 2576 gene locus_tag LOCUS_16120 1863 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16120 2573 3148 gene locus_tag LOCUS_16130 2573 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16130 4218 3223 gene locus_tag LOCUS_16140 gene pgl 4218 3223 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097511.1 protein_id gnl|my_center|LOCUS_16140 4373 5191 gene locus_tag LOCUS_16150 4373 5191 CDS product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097512.1 protein_id gnl|my_center|LOCUS_16150 6250 5192 gene locus_tag LOCUS_16160 gene modC 6250 5192 CDS product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097513.1 protein_id gnl|my_center|LOCUS_16160 6942 6253 gene locus_tag LOCUS_16170 gene modB 6942 6253 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097514.1 protein_id gnl|my_center|LOCUS_16170 7727 6942 gene locus_tag LOCUS_16180 gene modA 7727 6942 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101994.1 protein_id gnl|my_center|LOCUS_16180 7995 7846 gene locus_tag LOCUS_16190 7995 7846 CDS product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097516.1 protein_id gnl|my_center|LOCUS_16190 8121 8906 gene locus_tag LOCUS_16200 gene modE 8121 8906 CDS product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097517.1 protein_id gnl|my_center|LOCUS_16200 8938 9981 gene locus_tag LOCUS_16210 8938 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 9831 9884 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9927 10220 gene locus_tag LOCUS_16220 9927 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 10425 11441 gene locus_tag LOCUS_16230 gene galE 10425 11441 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622345.1 protein_id gnl|my_center|LOCUS_16230 11451 12506 gene locus_tag LOCUS_16240 gene galT 11451 12506 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191517.1 protein_id gnl|my_center|LOCUS_16240 12509 12751 gene locus_tag LOCUS_16250 12509 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16250 12736 13599 gene locus_tag LOCUS_16260 gene galK 12736 13599 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097521.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16260 13593 14633 gene locus_tag LOCUS_16270 gene galM 13593 14633 CDS product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097522.1 protein_id gnl|my_center|LOCUS_16270 14835 15587 gene locus_tag LOCUS_16280 gene gpmA 14835 15587 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367652.1 protein_id gnl|my_center|LOCUS_16280 16714 15662 gene locus_tag LOCUS_16290 gene aroG 16714 15662 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109233.1 protein_id gnl|my_center|LOCUS_16290 17039 17503 gene locus_tag LOCUS_16300 17039 17503 CDS product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784342.1 protein_id gnl|my_center|LOCUS_16300 17739 18491 gene locus_tag LOCUS_16310 gene zitB 17739 18491 CDS product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16310 19207 18488 gene locus_tag LOCUS_16320 gene pnuC 19207 18488 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345410.1 protein_id gnl|my_center|LOCUS_16320 20299 19253 gene locus_tag LOCUS_16330 gene nadA 20299 19253 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097527.1 protein_id gnl|my_center|LOCUS_16330 20646 21206 gene locus_tag LOCUS_16340 20646 21206 CDS product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 protein_id gnl|my_center|LOCUS_16340 21494 21419 gene locus_tag LOCUS_t00130 21494 21419 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 21708 21633 gene locus_tag LOCUS_t00140 21708 21633 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence051 <1 548 gene locus_tag LOCUS_16350 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001326970.1:acid-sensing system histidine kinase EvgS 457 501 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1026 1535 gene locus_tag LOCUS_16360 1026 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1661 2182 gene locus_tag LOCUS_16370 1661 2182 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419182.1 protein_id gnl|my_center|LOCUS_16370 2229 2903 gene locus_tag LOCUS_16380 2229 2903 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 protein_id gnl|my_center|LOCUS_16380 2918 5188 gene locus_tag LOCUS_16390 gene lpfC 2918 5188 CDS product outer membrane usher protein LpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558680.1 protein_id gnl|my_center|LOCUS_16390 5202 6227 gene locus_tag LOCUS_16400 5202 6227 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096966.1 protein_id gnl|my_center|LOCUS_16400 7858 6296 gene locus_tag LOCUS_16410 7858 6296 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 protein_id gnl|my_center|LOCUS_16410 8311 9327 gene locus_tag LOCUS_16420 8311 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16420 9285 9779 gene locus_tag LOCUS_16430 9285 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16430 9772 9906 gene locus_tag LOCUS_16440 9772 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 9925 11571 gene locus_tag LOCUS_16450 9925 11571 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_16450 11702 12481 gene locus_tag LOCUS_16460 11702 12481 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 protein_id gnl|my_center|LOCUS_16460 12484 13533 gene locus_tag LOCUS_16470 12484 13533 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 protein_id gnl|my_center|LOCUS_16470 13550 14521 gene locus_tag LOCUS_16480 13550 14521 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040673.1 protein_id gnl|my_center|LOCUS_16480 14576 15034 gene locus_tag LOCUS_16490 14576 15034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 15053 16561 gene locus_tag LOCUS_16500 15053 16561 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 protein_id gnl|my_center|LOCUS_16500 16625 17656 gene locus_tag LOCUS_16510 gene cra 16625 17656 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104372.1 protein_id gnl|my_center|LOCUS_16510 18154 18720 gene locus_tag LOCUS_16520 18154 18720 CDS product long polar fimbria major subunit LpfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756356.1 protein_id gnl|my_center|LOCUS_16520 18853 19443 gene locus_tag LOCUS_16530 18853 19443 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 protein_id gnl|my_center|LOCUS_16530 19449 19949 gene locus_tag LOCUS_16540 19449 19949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence052 1616 396 gene locus_tag LOCUS_16550 1616 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16550 2761 1676 gene locus_tag LOCUS_16560 2761 1676 CDS product DUF4297 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210712.1 protein_id gnl|my_center|LOCUS_16560 3534 3833 gene locus_tag LOCUS_16570 3534 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3836 4456 gene locus_tag LOCUS_16580 3836 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 4821 4642 gene locus_tag LOCUS_16590 4821 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 5643 4831 gene locus_tag LOCUS_16600 5643 4831 CDS product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483178.1 protein_id gnl|my_center|LOCUS_16600 6147 5665 gene locus_tag LOCUS_16610 6147 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185130035.1 protein_id gnl|my_center|LOCUS_16610 7161 6223 gene locus_tag LOCUS_16620 7161 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 7295 7531 gene locus_tag LOCUS_16630 7295 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 8046 8261 gene locus_tag LOCUS_16640 8046 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 8191 9411 gene locus_tag LOCUS_16650 8191 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 10053 9751 gene locus_tag LOCUS_16660 10053 9751 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 protein_id gnl|my_center|LOCUS_16660 10561 11190 gene locus_tag LOCUS_16670 10561 11190 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056849.1 protein_id gnl|my_center|LOCUS_16670 13041 11257 gene locus_tag LOCUS_16680 13041 11257 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301901.1 protein_id gnl|my_center|LOCUS_16680 12950 13792 gene locus_tag LOCUS_16690 gene lafU 12950 13792 CDS product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207574.1 protein_id gnl|my_center|LOCUS_16690 14530 13793 gene locus_tag LOCUS_16700 14530 13793 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089099.1 protein_id gnl|my_center|LOCUS_16700 15337 14576 gene locus_tag LOCUS_16710 15337 14576 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065249.1 protein_id gnl|my_center|LOCUS_16710 15519 15352 gene locus_tag LOCUS_16720 15519 15352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16720 16071 15577 gene locus_tag LOCUS_16730 16071 15577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16730 17277 16132 gene locus_tag LOCUS_16740 17277 16132 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410140.1 protein_id gnl|my_center|LOCUS_16740 16179 16183 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17862 17323 gene locus_tag LOCUS_16750 17862 17323 CDS product 2,4'-dihydroxyacetophenone dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066672.1 protein_id gnl|my_center|LOCUS_16750 18180 19088 gene locus_tag LOCUS_16760 gene yagE 18180 19088 CDS product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095373.1 protein_id gnl|my_center|LOCUS_16760 20515 19085 gene locus_tag LOCUS_16770 20515 19085 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098403.1 protein_id gnl|my_center|LOCUS_16770 <21480 20535 gene locus_tag LOCUS_16780 <21480 20535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098404.1:carbamate kinase family protein >Feature sequence053 391 125 gene locus_tag LOCUS_16790 391 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16790 964 422 gene locus_tag LOCUS_16800 964 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16800 1321 1160 gene locus_tag LOCUS_16810 1321 1160 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 protein_id gnl|my_center|LOCUS_16810 2075 1452 gene locus_tag LOCUS_16820 gene osmY 2075 1452 CDS product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095484.1 protein_id gnl|my_center|LOCUS_16820 3922 2492 gene locus_tag LOCUS_16830 gene prfC 3922 2492 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095483.1 protein_id gnl|my_center|LOCUS_16830 4696 4019 gene locus_tag LOCUS_16840 gene yjjG 4696 4019 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368388.1 protein_id gnl|my_center|LOCUS_16840 5164 4721 gene locus_tag LOCUS_16850 gene rimI 5164 4721 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095481.1 protein_id gnl|my_center|LOCUS_16850 5546 5133 gene locus_tag LOCUS_16860 5546 5133 CDS product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095480.1 protein_id gnl|my_center|LOCUS_16860 5673 6704 gene locus_tag LOCUS_16870 gene rsmC 5673 6704 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272330.1 protein_id gnl|my_center|LOCUS_16870 6977 7008 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7298 7062 gene locus_tag LOCUS_16880 7298 7062 CDS product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360092.1 protein_id gnl|my_center|LOCUS_16880 7841 7641 gene locus_tag LOCUS_16890 7841 7641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 7791 8621 gene locus_tag LOCUS_16900 7791 8621 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211217.1 protein_id gnl|my_center|LOCUS_16900 8702 9490 gene locus_tag LOCUS_16910 gene fhuF 8702 9490 CDS product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331566.1 protein_id gnl|my_center|LOCUS_16910 10842 9499 gene locus_tag LOCUS_16920 10842 9499 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095475.1 protein_id gnl|my_center|LOCUS_16920 11155 11613 gene locus_tag LOCUS_16930 11155 11613 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368396.1 protein_id gnl|my_center|LOCUS_16930 12306 11659 gene locus_tag LOCUS_16940 gene bglJ 12306 11659 CDS product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095473.1 protein_id gnl|my_center|LOCUS_16940 12986 12282 gene locus_tag LOCUS_16950 12986 12282 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688833.1 protein_id gnl|my_center|LOCUS_16950 13817 14578 gene locus_tag LOCUS_16960 13817 14578 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882175.1 protein_id gnl|my_center|LOCUS_16960 14689 15042 gene locus_tag LOCUS_16970 14689 15042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16970 15168 15713 gene locus_tag LOCUS_16980 gene dnaT 15168 15713 CDS product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098818.1 protein_id gnl|my_center|LOCUS_16980 15716 16435 gene locus_tag LOCUS_16990 gene dnaC 15716 16435 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799923.1 protein_id gnl|my_center|LOCUS_16990 16569 17072 gene locus_tag LOCUS_17000 16569 17072 CDS product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704311.1 protein_id gnl|my_center|LOCUS_17000 17314 19605 gene locus_tag LOCUS_17010 gene opgB 17314 19605 CDS product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704310.1 protein_id gnl|my_center|LOCUS_17010 19642 20865 gene locus_tag LOCUS_17020 gene dsdA 19642 20865 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426433.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence054 108 1061 gene locus_tag LOCUS_17030 gene metR 108 1061 CDS product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573621.1 protein_id gnl|my_center|LOCUS_17030 1881 949 gene locus_tag LOCUS_17040 1881 949 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703990.1 protein_id gnl|my_center|LOCUS_17040 2777 1971 gene locus_tag LOCUS_17050 gene yigL 2777 1971 CDS product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285349.1 protein_id gnl|my_center|LOCUS_17050 3817 2825 gene locus_tag LOCUS_17060 gene pldB 3817 2825 CDS product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099248.1 protein_id gnl|my_center|LOCUS_17060 3964 4584 gene locus_tag LOCUS_17070 gene rhtB 3964 4584 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099249.1 protein_id gnl|my_center|LOCUS_17070 5226 4585 gene locus_tag LOCUS_17080 gene rhtC 5226 4585 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703986.1 protein_id gnl|my_center|LOCUS_17080 7096 5267 gene locus_tag LOCUS_17090 gene recQ 7096 5267 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420793.1 protein_id gnl|my_center|LOCUS_17090 8033 7164 gene locus_tag LOCUS_17100 gene pldA 8033 7164 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259700.1 protein_id gnl|my_center|LOCUS_17100 8204 8674 gene locus_tag LOCUS_17110 gene yigI 8204 8674 CDS product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004097567.1 protein_id gnl|my_center|LOCUS_17110 8725 9486 gene locus_tag LOCUS_17120 gene rarD 8725 9486 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339085.1 protein_id gnl|my_center|LOCUS_17120 9486 9782 gene locus_tag LOCUS_17130 9486 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 10281 10661 gene locus_tag LOCUS_17140 10281 10661 CDS product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356594.1 protein_id gnl|my_center|LOCUS_17140 11659 10709 gene locus_tag LOCUS_17150 gene corA 11659 10709 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947159.1 protein_id gnl|my_center|LOCUS_17150 13291 12014 gene locus_tag LOCUS_17160 13291 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17160 14169 13372 gene locus_tag LOCUS_17170 14169 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17170 14947 14231 gene locus_tag LOCUS_17180 gene yigB 14947 14231 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213567.1 protein_id gnl|my_center|LOCUS_17180 15852 14947 gene locus_tag LOCUS_17190 gene xerC 15852 14947 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703983.1 protein_id gnl|my_center|LOCUS_17190 17036 15849 gene locus_tag LOCUS_17200 17036 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 17423 17220 gene locus_tag LOCUS_17210 17423 17220 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703981.1 protein_id gnl|my_center|LOCUS_17210 17595 17915 gene locus_tag LOCUS_17220 gene cyaY 17595 17915 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368867.1 protein_id gnl|my_center|LOCUS_17220 19859 17916 gene locus_tag LOCUS_17230 gene cyaA 19859 17916 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17230 20463 19909 gene locus_tag LOCUS_17240 20463 19909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17240 >Feature sequence055 1028 630 gene locus_tag LOCUS_17250 1028 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1183 1368 gene locus_tag LOCUS_17260 1183 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2307 1432 gene locus_tag LOCUS_17270 2307 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 3541 3020 gene locus_tag LOCUS_17280 gene fldB 3541 3020 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369793.1 protein_id gnl|my_center|LOCUS_17280 4877 3621 gene locus_tag LOCUS_17290 4877 3621 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033613.1 protein_id gnl|my_center|LOCUS_17290 5442 5092 gene locus_tag LOCUS_17300 5442 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17300 6833 5454 gene locus_tag LOCUS_17310 6833 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17310 8714 7176 gene locus_tag LOCUS_17320 8714 7176 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226977.1 protein_id gnl|my_center|LOCUS_17320 9504 8728 gene locus_tag LOCUS_17330 9504 8728 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283536.1 protein_id gnl|my_center|LOCUS_17330 10359 9514 gene locus_tag LOCUS_17340 10359 9514 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205220.1 protein_id gnl|my_center|LOCUS_17340 11158 10373 gene locus_tag LOCUS_17350 11158 10373 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843394.1 protein_id gnl|my_center|LOCUS_17350 11392 12015 gene locus_tag LOCUS_17360 11392 12015 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298021.1 protein_id gnl|my_center|LOCUS_17360 13012 12275 gene locus_tag LOCUS_17370 13012 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 13834 13397 gene locus_tag LOCUS_17380 13834 13397 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044768.1 protein_id gnl|my_center|LOCUS_17380 14133 13831 gene locus_tag LOCUS_17390 gene vapB 14133 13831 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261287.1 protein_id gnl|my_center|LOCUS_17390 14415 14705 gene locus_tag LOCUS_17400 14415 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111771.1 protein_id gnl|my_center|LOCUS_17400 14695 15594 gene locus_tag LOCUS_17410 14695 15594 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963206.1 protein_id gnl|my_center|LOCUS_17410 17470 15644 gene locus_tag LOCUS_17420 17470 15644 CDS product P-loop NTPase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698737.1 protein_id gnl|my_center|LOCUS_17420 18059 17865 gene locus_tag LOCUS_17430 18059 17865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17430 18885 18013 gene locus_tag LOCUS_17440 18885 18013 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130100443.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17440 19307 19723 gene locus_tag LOCUS_17450 19307 19723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 19826 20605 gene locus_tag LOCUS_17460 19826 20605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence056 705 229 gene locus_tag LOCUS_17470 705 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17470 265 270 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 871 1545 gene locus_tag LOCUS_17480 gene radC 871 1545 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380129.1 protein_id gnl|my_center|LOCUS_17480 1762 1998 gene locus_tag LOCUS_17490 gene rpmB 1762 1998 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436699.1 protein_id gnl|my_center|LOCUS_17490 2019 2186 gene locus_tag LOCUS_17500 gene rpmG 2019 2186 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208990.1 protein_id gnl|my_center|LOCUS_17500 2259 3068 gene locus_tag LOCUS_17510 gene mutM 2259 3068 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114533.1 protein_id gnl|my_center|LOCUS_17510 3564 3076 gene locus_tag LOCUS_17520 gene coaD 3564 3076 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094895.1 protein_id gnl|my_center|LOCUS_17520 4337 3561 gene locus_tag LOCUS_17530 4337 3561 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094896.1 protein_id gnl|my_center|LOCUS_17530 5443 4337 gene locus_tag LOCUS_17540 gene waaA 5443 4337 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369159.1 protein_id gnl|my_center|LOCUS_17540 7382 5754 gene locus_tag LOCUS_17550 7382 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 8368 7397 gene locus_tag LOCUS_17560 8368 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 9360 8377 gene locus_tag LOCUS_17570 9360 8377 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094898.1 protein_id gnl|my_center|LOCUS_17570 10772 9519 gene locus_tag LOCUS_17580 10772 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 11103 12197 gene locus_tag LOCUS_17590 11103 12197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 13306 12194 gene locus_tag LOCUS_17600 13306 12194 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 protein_id gnl|my_center|LOCUS_17600 13707 13303 gene locus_tag LOCUS_17610 13707 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 14392 13673 gene locus_tag LOCUS_17620 14392 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17620 15383 14385 gene locus_tag LOCUS_17630 gene rfaC 15383 14385 CDS product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703798.1 protein_id gnl|my_center|LOCUS_17630 16432 15386 gene locus_tag LOCUS_17640 gene rfaF 16432 15386 CDS product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699210.1 protein_id gnl|my_center|LOCUS_17640 17365 16442 gene locus_tag LOCUS_17650 gene rfaD 17365 16442 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094908.1 protein_id gnl|my_center|LOCUS_17650 17595 18794 gene locus_tag LOCUS_17660 gene kbl 17595 18794 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094909.1 protein_id gnl|my_center|LOCUS_17660 18804 19832 gene locus_tag LOCUS_17670 gene tdh 18804 19832 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369171.1 protein_id gnl|my_center|LOCUS_17670 20074 20772 gene locus_tag LOCUS_17680 20074 20772 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152082698.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence057 <1 1203 gene locus_tag LOCUS_17690 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099109.1:glycogen synthase GlgA 1223 2812 gene locus_tag LOCUS_17700 1223 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17700 2787 3623 gene locus_tag LOCUS_17710 2787 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17710 4449 3667 gene locus_tag LOCUS_17720 4449 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 4495 4540 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5157 5486 gene locus_tag LOCUS_17730 gene glpE 5157 5486 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833569.1 protein_id gnl|my_center|LOCUS_17730 5533 6363 gene locus_tag LOCUS_17740 gene glpG 5533 6363 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099104.1 protein_id gnl|my_center|LOCUS_17740 6388 7146 gene locus_tag LOCUS_17750 6388 7146 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099103.1 protein_id gnl|my_center|LOCUS_17750 9877 7172 gene locus_tag LOCUS_17760 gene malT 9877 7172 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420753.1 protein_id gnl|my_center|LOCUS_17760 10371 12755 gene locus_tag LOCUS_17770 gene malP 10371 12755 CDS product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082255.1 protein_id gnl|my_center|LOCUS_17770 12765 14873 gene locus_tag LOCUS_17780 gene malQ 12765 14873 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444319.1 protein_id gnl|my_center|LOCUS_17780 15513 14938 gene locus_tag LOCUS_17790 gene nfuA 15513 14938 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099096.1 protein_id gnl|my_center|LOCUS_17790 16036 15572 gene locus_tag LOCUS_17800 16036 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 16290 17075 gene locus_tag LOCUS_17810 gene bioH 16290 17075 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703680.1 protein_id gnl|my_center|LOCUS_17810 17190 17459 gene locus_tag LOCUS_17820 17190 17459 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369359.1 protein_id gnl|my_center|LOCUS_17820 17754 17518 gene locus_tag LOCUS_17830 gene feoC 17754 17518 CDS product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703679.1 protein_id gnl|my_center|LOCUS_17830 20082 17764 gene locus_tag LOCUS_17840 gene feoB 20082 17764 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099092.1 protein_id gnl|my_center|LOCUS_17840 20328 20104 gene locus_tag LOCUS_17850 gene feoA 20328 20104 CDS product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436417.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence058 287 2221 gene locus_tag LOCUS_17860 gene sltY 287 2221 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409451.1 protein_id gnl|my_center|LOCUS_17860 2262 2612 gene locus_tag LOCUS_17870 gene trpR 2262 2612 CDS product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068679.1 protein_id gnl|my_center|LOCUS_17870 3016 2603 gene locus_tag LOCUS_17880 gene yjjX 3016 2603 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341279.1 protein_id gnl|my_center|LOCUS_17880 3165 3812 gene locus_tag LOCUS_17890 gene gpmB 3165 3812 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942359.1 protein_id gnl|my_center|LOCUS_17890 4657 3713 gene locus_tag LOCUS_17900 gene robA 4657 3713 CDS product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704329.1 protein_id gnl|my_center|LOCUS_17900 4848 5330 gene locus_tag LOCUS_17910 gene creA 4848 5330 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368367.1 protein_id gnl|my_center|LOCUS_17910 5343 6032 gene locus_tag LOCUS_17920 gene creB 5343 6032 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188664.1 protein_id gnl|my_center|LOCUS_17920 6032 7459 gene locus_tag LOCUS_17930 gene creC 6032 7459 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704331.1 protein_id gnl|my_center|LOCUS_17930 7537 8292 gene locus_tag LOCUS_17940 7537 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17940 8383 8901 gene locus_tag LOCUS_17950 8383 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17950 9669 8953 gene locus_tag LOCUS_17960 gene arcA 9669 8953 CDS product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 protein_id gnl|my_center|LOCUS_17960 10304 10990 gene locus_tag LOCUS_17970 10304 10990 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095507.1 protein_id gnl|my_center|LOCUS_17970 11346 11834 gene locus_tag LOCUS_17980 11346 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17980 11821 13746 gene locus_tag LOCUS_17990 gene thrA 11821 13746 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264731.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17990 13748 14482 gene locus_tag LOCUS_18000 13748 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 14601 15569 gene locus_tag LOCUS_18010 14601 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18010 15533 15886 gene locus_tag LOCUS_18020 15533 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18020 16713 15940 gene locus_tag LOCUS_18030 gene yaaA 16713 15940 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095513.1 protein_id gnl|my_center|LOCUS_18030 18225 16792 gene locus_tag LOCUS_18040 18225 16792 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095514.1 protein_id gnl|my_center|LOCUS_18040 18501 19376 gene locus_tag LOCUS_18050 gene tal 18501 19376 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095515.1 protein_id gnl|my_center|LOCUS_18050 19510 20103 gene locus_tag LOCUS_18060 gene mog 19510 20103 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166957.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence059 509 375 gene locus_tag LOCUS_18070 509 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18070 1437 502 gene locus_tag LOCUS_18080 gene macA 1437 502 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097327.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18080 1591 2550 gene locus_tag LOCUS_18090 1591 2550 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097328.1 protein_id gnl|my_center|LOCUS_18090 4205 2547 gene locus_tag LOCUS_18100 4205 2547 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704871.1 protein_id gnl|my_center|LOCUS_18100 4588 5283 gene locus_tag LOCUS_18110 gene aqpZ 4588 5283 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704870.1 protein_id gnl|my_center|LOCUS_18110 5407 5910 gene locus_tag LOCUS_18120 5407 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18120 5951 6283 gene locus_tag LOCUS_18130 5951 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18130 6357 6683 gene locus_tag LOCUS_18140 6357 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18140 6661 8001 gene locus_tag LOCUS_18150 gene hcp 6661 8001 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097332.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18150 8011 8979 gene locus_tag LOCUS_18160 gene hcr 8011 8979 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178665.1 protein_id gnl|my_center|LOCUS_18160 9443 9015 gene locus_tag LOCUS_18170 9443 9015 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704866.1 protein_id gnl|my_center|LOCUS_18170 9589 10905 gene locus_tag LOCUS_18180 gene poxB 9589 10905 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704865.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18180 10875 11276 gene locus_tag LOCUS_18190 10875 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18190 11315 12265 gene locus_tag LOCUS_18200 gene ltaE 11315 12265 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566403.1 protein_id gnl|my_center|LOCUS_18200 12278 12964 gene locus_tag LOCUS_18210 12278 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18210 12997 13713 gene locus_tag LOCUS_18220 12997 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18220 13801 14811 gene locus_tag LOCUS_18230 13801 14811 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367508.1 protein_id gnl|my_center|LOCUS_18230 15638 14808 gene locus_tag LOCUS_18240 15638 14808 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367510.1 protein_id gnl|my_center|LOCUS_18240 15922 15635 gene locus_tag LOCUS_18250 15922 15635 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160725.1 protein_id gnl|my_center|LOCUS_18250 16091 16627 gene locus_tag LOCUS_18260 16091 16627 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097359.1 protein_id gnl|my_center|LOCUS_18260 16843 17571 gene locus_tag LOCUS_18270 gene artP 16843 17571 CDS product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097360.1 protein_id gnl|my_center|LOCUS_18270 17592 18323 gene locus_tag LOCUS_18280 gene artJ 17592 18323 CDS product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756586.1 protein_id gnl|my_center|LOCUS_18280 18331 19047 gene locus_tag LOCUS_18290 gene artQ 18331 19047 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367517.1 protein_id gnl|my_center|LOCUS_18290 19047 19868 gene locus_tag LOCUS_18300 gene artM 19047 19868 CDS product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097363.1 protein_id gnl|my_center|LOCUS_18300 19893 20627 gene locus_tag LOCUS_18310 gene artJ 19893 20627 CDS product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367519.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence060 63 818 gene locus_tag LOCUS_18320 gene yihT 63 818 CDS product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046464.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18320 908 2149 gene locus_tag LOCUS_18330 gene yihS 908 2149 CDS product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099370.1 protein_id gnl|my_center|LOCUS_18330 2178 3014 gene locus_tag LOCUS_18340 2178 3014 CDS product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052848.1 protein_id gnl|my_center|LOCUS_18340 3042 5078 gene locus_tag LOCUS_18350 3042 5078 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099371.1 protein_id gnl|my_center|LOCUS_18350 5125 6012 gene locus_tag LOCUS_18360 5125 6012 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345437.1 protein_id gnl|my_center|LOCUS_18360 6042 7418 gene locus_tag LOCUS_18370 6042 7418 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099372.1 protein_id gnl|my_center|LOCUS_18370 7442 8866 gene locus_tag LOCUS_18380 7442 8866 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420847.1 protein_id gnl|my_center|LOCUS_18380 8946 9632 gene locus_tag LOCUS_18390 gene ompL 8946 9632 CDS product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099374.1 protein_id gnl|my_center|LOCUS_18390 11504 9681 gene locus_tag LOCUS_18400 gene typA 11504 9681 CDS product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099375.1 protein_id gnl|my_center|LOCUS_18400 11873 13195 gene locus_tag LOCUS_18410 gene glnA 11873 13195 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099376.1 protein_id gnl|my_center|LOCUS_18410 12850 12857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13339 14388 gene locus_tag LOCUS_18420 gene glnL 13339 14388 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501857.1 protein_id gnl|my_center|LOCUS_18420 14406 14834 gene locus_tag LOCUS_18430 14406 14834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 14788 15723 gene locus_tag LOCUS_18440 14788 15723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 17367 15994 gene locus_tag LOCUS_18450 gene hemN 17367 15994 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116087.1 protein_id gnl|my_center|LOCUS_18450 18060 17554 gene locus_tag LOCUS_18460 gene yihI 18060 17554 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099380.1 protein_id gnl|my_center|LOCUS_18460 18723 19142 gene locus_tag LOCUS_18470 18723 19142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 <20647 19445 gene locus_tag LOCUS_18480 <20647 19445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099383.1:DNA polymerase I >Feature sequence061 <1 728 gene locus_tag LOCUS_18490 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000934214.1:alpha,alpha-trehalase 2710 746 gene locus_tag LOCUS_18500 gene rlhA 2710 746 CDS product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301045.1 protein_id gnl|my_center|LOCUS_18500 3475 2945 gene locus_tag LOCUS_18510 3475 2945 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096643.1 protein_id gnl|my_center|LOCUS_18510 3576 4691 gene locus_tag LOCUS_18520 3576 4691 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096644.1 protein_id gnl|my_center|LOCUS_18520 5315 4746 gene locus_tag LOCUS_18530 5315 4746 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261013.1 protein_id gnl|my_center|LOCUS_18530 6240 5647 gene locus_tag LOCUS_18540 gene tehB 6240 5647 CDS product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218282.1 protein_id gnl|my_center|LOCUS_18540 7064 6237 gene locus_tag LOCUS_18550 gene tehA 7064 6237 CDS product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096651.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18550 7252 7073 gene locus_tag LOCUS_18560 7252 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18560 7377 8357 gene locus_tag LOCUS_18570 gene ydcK 7377 8357 CDS product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096652.1 protein_id gnl|my_center|LOCUS_18570 8930 8370 gene locus_tag LOCUS_18580 gene rimL 8930 8370 CDS product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140873.1 protein_id gnl|my_center|LOCUS_18580 9726 9010 gene locus_tag LOCUS_18590 9726 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18590 9961 9707 gene locus_tag LOCUS_18600 9961 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18600 10643 9990 gene locus_tag LOCUS_18610 10643 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18610 12004 11258 gene locus_tag LOCUS_18620 12004 11258 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096655.1 protein_id gnl|my_center|LOCUS_18620 12607 12191 gene locus_tag LOCUS_18630 12607 12191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18630 13109 12582 gene locus_tag LOCUS_18640 13109 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 13232 13567 gene locus_tag LOCUS_18650 13232 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18650 13705 14079 gene locus_tag LOCUS_18660 13705 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18660 15462 14119 gene locus_tag LOCUS_18670 15462 14119 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013762.1 protein_id gnl|my_center|LOCUS_18670 15745 16668 gene locus_tag LOCUS_18680 15745 16668 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096674.1 protein_id gnl|my_center|LOCUS_18680 16760 17815 gene locus_tag LOCUS_18690 16760 17815 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184894.1 protein_id gnl|my_center|LOCUS_18690 18788 17868 gene locus_tag LOCUS_18700 18788 17868 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930756.1 protein_id gnl|my_center|LOCUS_18700 18885 18691 gene locus_tag LOCUS_18710 18885 18691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 20220 18892 gene locus_tag LOCUS_18720 20220 18892 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061782.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence062 <1 508 gene locus_tag LOCUS_18730 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704038.1:chorismate lyase 508 1377 gene locus_tag LOCUS_18740 gene ubiA 508 1377 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455249.1 protein_id gnl|my_center|LOCUS_18740 3840 1411 gene locus_tag LOCUS_18750 gene plsB 3840 1411 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017354.1 protein_id gnl|my_center|LOCUS_18750 3973 4341 gene locus_tag LOCUS_18760 3973 4341 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368764.1 protein_id gnl|my_center|LOCUS_18760 4450 5058 gene locus_tag LOCUS_18770 gene lexA 4450 5058 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095053.1 protein_id gnl|my_center|LOCUS_18770 5145 6479 gene locus_tag LOCUS_18780 gene dinF 5145 6479 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128149.1 protein_id gnl|my_center|LOCUS_18780 6703 6912 gene locus_tag LOCUS_18790 6703 6912 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981150.1 protein_id gnl|my_center|LOCUS_18790 7505 6984 gene locus_tag LOCUS_18800 gene zur 7505 6984 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416263.1 protein_id gnl|my_center|LOCUS_18800 7814 9067 gene locus_tag LOCUS_18810 7814 9067 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 protein_id gnl|my_center|LOCUS_18810 9218 10159 gene locus_tag LOCUS_18820 gene dusA 9218 10159 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602639.1 protein_id gnl|my_center|LOCUS_18820 10282 10539 gene locus_tag LOCUS_18830 gene pspG 10282 10539 CDS product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095061.1 protein_id gnl|my_center|LOCUS_18830 11052 10717 gene locus_tag LOCUS_18840 11052 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18840 11303 10998 gene locus_tag LOCUS_18850 11303 10998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18850 11646 11272 gene locus_tag LOCUS_18860 11646 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18860 11786 13192 gene locus_tag LOCUS_18870 gene dnaB 11786 13192 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918353.1 protein_id gnl|my_center|LOCUS_18870 13347 14426 gene locus_tag LOCUS_18880 gene alr 13347 14426 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 protein_id gnl|my_center|LOCUS_18880 14540 15742 gene locus_tag LOCUS_18890 gene tyrB 14540 15742 CDS product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486998.1 protein_id gnl|my_center|LOCUS_18890 15912 16625 gene locus_tag LOCUS_18900 gene aphA 15912 16625 CDS product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704046.1 protein_id gnl|my_center|LOCUS_18900 16883 17236 gene locus_tag LOCUS_18910 16883 17236 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095068.1 protein_id gnl|my_center|LOCUS_18910 17815 17237 gene locus_tag LOCUS_18920 17815 17237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 19988 17823 gene locus_tag LOCUS_18930 gene uvrA 19988 17823 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357740.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence063 846 34 gene locus_tag LOCUS_18940 846 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2023 935 gene locus_tag LOCUS_18950 gene aroB 2023 935 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439846.1 protein_id gnl|my_center|LOCUS_18950 2601 2080 gene locus_tag LOCUS_18960 gene aroK 2601 2080 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861630.1 protein_id gnl|my_center|LOCUS_18960 4130 2901 gene locus_tag LOCUS_18970 gene hofQ 4130 2901 CDS product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832818.1 protein_id gnl|my_center|LOCUS_18970 4479 4087 gene locus_tag LOCUS_18980 4479 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 4879 4469 gene locus_tag LOCUS_18990 4879 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 5436 4942 gene locus_tag LOCUS_19000 5436 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 6275 5487 gene locus_tag LOCUS_19010 6275 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874746.1 protein_id gnl|my_center|LOCUS_19010 6466 8946 gene locus_tag LOCUS_19020 gene mrcA 6466 8946 CDS product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301905.1 protein_id gnl|my_center|LOCUS_19020 9558 8998 gene locus_tag LOCUS_19030 gene nudE 9558 8998 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519362.1 protein_id gnl|my_center|LOCUS_19030 9878 12016 gene locus_tag LOCUS_19040 9878 12016 CDS product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099081.1 protein_id gnl|my_center|LOCUS_19040 12079 12792 gene locus_tag LOCUS_19050 gene yrfG 12079 12792 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520508.1 protein_id gnl|my_center|LOCUS_19050 12770 13171 gene locus_tag LOCUS_19060 gene hslR 12770 13171 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660483.1 protein_id gnl|my_center|LOCUS_19060 13196 14074 gene locus_tag LOCUS_19070 gene hslO 13196 14074 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001753131.1 protein_id gnl|my_center|LOCUS_19070 14431 16056 gene locus_tag LOCUS_19080 gene pckA 14431 16056 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265689.1 protein_id gnl|my_center|LOCUS_19080 17483 16131 gene locus_tag LOCUS_19090 gene envZ 17483 16131 CDS product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882169.1 protein_id gnl|my_center|LOCUS_19090 17725 17480 gene locus_tag LOCUS_19100 17725 17480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19100 18195 17692 gene locus_tag LOCUS_19110 18195 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19110 18743 19927 gene locus_tag LOCUS_19120 gene uxuA 18743 19927 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815487.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence064 <1 533 gene locus_tag LOCUS_19130 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098977.1:p-hydroxybenzoic acid efflux pump subunit AaeB note possible pseudo, frameshifted 523 1887 gene locus_tag LOCUS_19140 523 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19140 1989 2858 gene locus_tag LOCUS_19150 1989 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19150 2836 3432 gene locus_tag LOCUS_19160 2836 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19160 3498 3776 gene locus_tag LOCUS_19170 3498 3776 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029013.1 protein_id gnl|my_center|LOCUS_19170 4097 3831 gene locus_tag LOCUS_19180 gene yhcN-B 4097 3831 CDS product DUF1471 family stress response protein YhcN-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369472.1 protein_id gnl|my_center|LOCUS_19180 4454 4191 gene locus_tag LOCUS_19190 gene yhcN 4454 4191 CDS product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695690.1 protein_id gnl|my_center|LOCUS_19190 5273 4803 gene locus_tag LOCUS_19200 gene argR 5273 4803 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369474.1 protein_id gnl|my_center|LOCUS_19200 5696 6634 gene locus_tag LOCUS_19210 gene mdh 5696 6634 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307415.1 protein_id gnl|my_center|LOCUS_19210 7755 6691 gene locus_tag LOCUS_19220 gene degS 7755 6691 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497726.1 protein_id gnl|my_center|LOCUS_19220 9220 7802 gene locus_tag LOCUS_19230 gene degQ 9220 7802 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716695.1 protein_id gnl|my_center|LOCUS_19230 9796 9398 gene locus_tag LOCUS_19240 gene zapG 9796 9398 CDS product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481183.1 protein_id gnl|my_center|LOCUS_19240 9979 11052 gene locus_tag LOCUS_19250 gene zapE 9979 11052 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098968.1 protein_id gnl|my_center|LOCUS_19250 11296 11724 gene locus_tag LOCUS_19260 gene rplM 11296 11724 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 protein_id gnl|my_center|LOCUS_19260 11740 12132 gene locus_tag LOCUS_19270 gene rpsI 11740 12132 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 protein_id gnl|my_center|LOCUS_19270 12446 13087 gene locus_tag LOCUS_19280 gene sspA 12446 13087 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257300.1 protein_id gnl|my_center|LOCUS_19280 13093 13584 gene locus_tag LOCUS_19290 gene sspB 13093 13584 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366127.1 protein_id gnl|my_center|LOCUS_19290 14189 13638 gene locus_tag LOCUS_19300 gene yjgA 14189 13638 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501414.1 protein_id gnl|my_center|LOCUS_19300 14296 15648 gene locus_tag LOCUS_19310 gene pmbA 14296 15648 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852994.1 protein_id gnl|my_center|LOCUS_19310 15705 16091 gene locus_tag LOCUS_19320 gene cybC 15705 16091 CDS product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232231.1 protein_id gnl|my_center|LOCUS_19320 16400 16738 gene locus_tag LOCUS_19330 16400 16738 CDS product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027887.1 protein_id gnl|my_center|LOCUS_19330 16749 17111 gene locus_tag LOCUS_19340 16749 17111 CDS product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006179053.1 protein_id gnl|my_center|LOCUS_19340 17114 17413 gene locus_tag LOCUS_19350 17114 17413 CDS product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810338.1 protein_id gnl|my_center|LOCUS_19350 17437 18213 gene locus_tag LOCUS_19360 17437 18213 CDS product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478578.1 protein_id gnl|my_center|LOCUS_19360 18225 18869 gene locus_tag LOCUS_19370 18225 18869 CDS product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368573.1 protein_id gnl|my_center|LOCUS_19370 18914 20047 gene locus_tag LOCUS_19380 18914 20047 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459938.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence065 1310 2497 gene locus_tag LOCUS_19390 gene ygeW 1310 2497 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303128.1 protein_id gnl|my_center|LOCUS_19390 2565 3761 gene locus_tag LOCUS_19400 gene dpaL 2565 3761 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705214.1 protein_id gnl|my_center|LOCUS_19400 3833 5050 gene locus_tag LOCUS_19410 3833 5050 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705213.1 protein_id gnl|my_center|LOCUS_19410 5101 6486 gene locus_tag LOCUS_19420 gene hyuA 5101 6486 CDS product D-phenylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264435.1 protein_id gnl|my_center|LOCUS_19420 6540 7472 gene locus_tag LOCUS_19430 gene arcC 6540 7472 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037995.1 protein_id gnl|my_center|LOCUS_19430 9169 7526 gene locus_tag LOCUS_19440 gene yqeB 9169 7526 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020384.1 protein_id gnl|my_center|LOCUS_19440 9812 9195 gene locus_tag LOCUS_19450 gene yqeC 9812 9195 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835685.1 protein_id gnl|my_center|LOCUS_19450 10079 10567 gene locus_tag LOCUS_19460 10079 10567 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705210.1 protein_id gnl|my_center|LOCUS_19460 10891 12831 gene locus_tag LOCUS_19470 10891 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19470 12920 13978 gene locus_tag LOCUS_19480 12920 13978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19480 13981 15309 gene locus_tag LOCUS_19490 gene ssnA 13981 15309 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906289.1 protein_id gnl|my_center|LOCUS_19490 15357 16052 gene locus_tag LOCUS_19500 gene ygfM 15357 16052 CDS product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572441.1 protein_id gnl|my_center|LOCUS_19500 16049 18919 gene locus_tag LOCUS_19510 16049 18919 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583615.1 protein_id gnl|my_center|LOCUS_19510 18871 19053 gene locus_tag LOCUS_19520 18871 19053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 19054 19563 gene locus_tag LOCUS_19530 19054 19563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence066 1014 502 gene locus_tag LOCUS_19540 1014 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19540 1769 2920 gene locus_tag LOCUS_19550 1769 2920 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200769.1 protein_id gnl|my_center|LOCUS_19550 3185 2982 gene locus_tag LOCUS_19560 3185 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19560 4110 3154 gene locus_tag LOCUS_19570 4110 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19570 5098 4385 gene locus_tag LOCUS_19580 5098 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19580 5559 5041 gene locus_tag LOCUS_19590 5559 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19590 5931 6869 gene locus_tag LOCUS_19600 5931 6869 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 protein_id gnl|my_center|LOCUS_19600 7174 8439 gene locus_tag LOCUS_19610 gene gatZ 7174 8439 CDS product tagatose-bisphosphate aldolase subunit GatZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853833.1 protein_id gnl|my_center|LOCUS_19610 8450 9499 gene locus_tag LOCUS_19620 gene gatD 8450 9499 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844177.1 protein_id gnl|my_center|LOCUS_19620 9503 10372 gene locus_tag LOCUS_19630 9503 10372 CDS product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469985.1 protein_id gnl|my_center|LOCUS_19630 10411 10836 gene locus_tag LOCUS_19640 gene fucU 10411 10836 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 protein_id gnl|my_center|LOCUS_19640 10868 12391 gene locus_tag LOCUS_19650 gene gguA 10868 12391 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992366.1 protein_id gnl|my_center|LOCUS_19650 12392 12895 gene locus_tag LOCUS_19660 12392 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19660 12945 13448 gene locus_tag LOCUS_19670 12945 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19670 13495 14451 gene locus_tag LOCUS_19680 13495 14451 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311043.1 protein_id gnl|my_center|LOCUS_19680 14528 15547 gene locus_tag LOCUS_19690 14528 15547 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_19690 15584 17071 gene locus_tag LOCUS_19700 gene xylB 15584 17071 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762617.1 protein_id gnl|my_center|LOCUS_19700 17205 17885 gene locus_tag LOCUS_19710 17205 17885 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19710 18117 17962 gene locus_tag LOCUS_19720 18117 17962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 18146 18181 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18678 18781 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19828 19409 gene locus_tag LOCUS_19730 19828 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence067 <1 502 gene locus_tag LOCUS_19740 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000838944.1:RpoE-regulated lipoprotein 603 758 gene locus_tag LOCUS_19750 603 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19750 764 1498 gene locus_tag LOCUS_19760 764 1498 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098206.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19760 2323 1553 gene locus_tag LOCUS_19770 2323 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19770 2805 2317 gene locus_tag LOCUS_19780 2805 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19780 3308 2922 gene locus_tag LOCUS_19790 3308 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4589 3312 gene locus_tag LOCUS_19800 gene frc 4589 3312 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726706.1 protein_id gnl|my_center|LOCUS_19800 5365 4604 gene locus_tag LOCUS_19810 5365 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19810 6357 5356 gene locus_tag LOCUS_19820 6357 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19820 7677 6397 gene locus_tag LOCUS_19830 7677 6397 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902070.1 protein_id gnl|my_center|LOCUS_19830 7941 8840 gene locus_tag LOCUS_19840 7941 8840 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193481.1 protein_id gnl|my_center|LOCUS_19840 9086 9688 gene locus_tag LOCUS_19850 9086 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19850 9682 10062 gene locus_tag LOCUS_19860 9682 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19860 10062 10895 gene locus_tag LOCUS_19870 gene cysT 10062 10895 CDS product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458408.1 protein_id gnl|my_center|LOCUS_19870 10895 11128 gene locus_tag LOCUS_19880 10895 11128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19880 11100 11309 gene locus_tag LOCUS_19890 11100 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19890 11323 11772 gene locus_tag LOCUS_19900 11323 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19900 11762 12514 gene locus_tag LOCUS_19910 11762 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19910 12462 13697 gene locus_tag LOCUS_19920 12462 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 12831 12839 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13751 14401 gene locus_tag LOCUS_19930 13751 14401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19930 14343 14573 gene locus_tag LOCUS_19940 14343 14573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19940 15130 14627 gene locus_tag LOCUS_19950 gene crr 15130 14627 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522253.1 protein_id gnl|my_center|LOCUS_19950 16901 15174 gene locus_tag LOCUS_19960 gene ptsI 16901 15174 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098199.1 protein_id gnl|my_center|LOCUS_19960 17202 16945 gene locus_tag LOCUS_19970 gene ptsH 17202 16945 CDS product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 protein_id gnl|my_center|LOCUS_19970 18554 17583 gene locus_tag LOCUS_19980 gene cysK 18554 17583 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878168.1 protein_id gnl|my_center|LOCUS_19980 19478 18717 gene locus_tag LOCUS_19990 gene cysZ 19478 18717 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255008.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence068 <1 562 gene locus_tag LOCUS_20000 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097163.1:glucans biosynthesis glucosyltransferase MdoH note possible pseudo, frameshifted 478 1017 gene locus_tag LOCUS_20010 478 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20010 1090 1317 gene locus_tag LOCUS_20020 1090 1317 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097162.1 protein_id gnl|my_center|LOCUS_20020 1693 1319 gene locus_tag LOCUS_20030 1693 1319 CDS product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180050.1 protein_id gnl|my_center|LOCUS_20030 2752 1832 gene locus_tag LOCUS_20040 2752 1832 CDS product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367212.1 protein_id gnl|my_center|LOCUS_20040 3015 4016 gene locus_tag LOCUS_20050 3015 4016 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097157.1 protein_id gnl|my_center|LOCUS_20050 4628 4053 gene locus_tag LOCUS_20060 4628 4053 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097156.1 protein_id gnl|my_center|LOCUS_20060 5158 4649 gene locus_tag LOCUS_20070 5158 4649 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419093.1 protein_id gnl|my_center|LOCUS_20070 5560 5435 gene locus_tag LOCUS_20080 5560 5435 CDS product YceO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367210.1 protein_id gnl|my_center|LOCUS_20080 6732 5638 gene locus_tag LOCUS_20090 gene solA 6732 5638 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419095.1 protein_id gnl|my_center|LOCUS_20090 7215 6961 gene locus_tag LOCUS_20100 gene bssS 7215 6961 CDS product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414441.1 protein_id gnl|my_center|LOCUS_20100 7828 7583 gene locus_tag LOCUS_20110 gene dinI 7828 7583 CDS product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097151.1 protein_id gnl|my_center|LOCUS_20110 8437 7910 gene locus_tag LOCUS_20120 8437 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20120 8691 8449 gene locus_tag LOCUS_20130 8691 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20130 8911 8663 gene locus_tag LOCUS_20140 8911 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20140 9598 9038 gene locus_tag LOCUS_20150 9598 9038 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097149.1 protein_id gnl|my_center|LOCUS_20150 10353 9706 gene locus_tag LOCUS_20160 gene grxB 10353 9706 CDS product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 protein_id gnl|my_center|LOCUS_20160 11623 10415 gene locus_tag LOCUS_20170 gene mdtH 11623 10415 CDS product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092170.1 protein_id gnl|my_center|LOCUS_20170 11932 12582 gene locus_tag LOCUS_20180 gene rimJ 11932 12582 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468186.1 protein_id gnl|my_center|LOCUS_20180 12488 13093 gene locus_tag LOCUS_20190 12488 13093 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877137.1 protein_id gnl|my_center|LOCUS_20190 13113 13556 gene locus_tag LOCUS_20200 13113 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20200 13549 14043 gene locus_tag LOCUS_20210 13549 14043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20210 14152 15687 gene locus_tag LOCUS_20220 gene murJ 14152 15687 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050683.1 protein_id gnl|my_center|LOCUS_20220 16157 15735 gene locus_tag LOCUS_20230 gene flgN 16157 15735 CDS product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197547.1 protein_id gnl|my_center|LOCUS_20230 16458 16162 gene locus_tag LOCUS_20240 gene flgM 16458 16162 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020880.1 protein_id gnl|my_center|LOCUS_20240 16842 16645 gene locus_tag LOCUS_20250 16842 16645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20250 17221 16760 gene locus_tag LOCUS_20260 17221 16760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20260 17375 17791 gene locus_tag LOCUS_20270 gene flgB 17375 17791 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 protein_id gnl|my_center|LOCUS_20270 17794 17979 gene locus_tag LOCUS_20280 17794 17979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20280 17943 18197 gene locus_tag LOCUS_20290 17943 18197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20290 18208 18894 gene locus_tag LOCUS_20300 gene flgD 18208 18894 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020450.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence069 731 1504 gene locus_tag LOCUS_20310 gene pdeH 731 1504 CDS product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099209.1 protein_id gnl|my_center|LOCUS_20310 1608 3623 gene locus_tag LOCUS_20320 1608 3623 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 protein_id gnl|my_center|LOCUS_20320 4062 3664 gene locus_tag LOCUS_20330 4062 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20330 5125 4121 gene locus_tag LOCUS_20340 5125 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20340 6609 5323 gene locus_tag LOCUS_20350 6609 5323 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099213.1 protein_id gnl|my_center|LOCUS_20350 8550 6712 gene locus_tag LOCUS_20360 gene hmsP 8550 6712 CDS product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014344205.1 protein_id gnl|my_center|LOCUS_20360 9666 12101 gene locus_tag LOCUS_20370 gene pgaA 9666 12101 CDS product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063447004.1 protein_id gnl|my_center|LOCUS_20370 12111 14129 gene locus_tag LOCUS_20380 gene pgaB 12111 14129 CDS product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368678.1 protein_id gnl|my_center|LOCUS_20380 14122 15450 gene locus_tag LOCUS_20390 gene pgaC 14122 15450 CDS product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368679.1 protein_id gnl|my_center|LOCUS_20390 15450 15953 gene locus_tag LOCUS_20400 gene pgaD 15450 15953 CDS product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212041.1 protein_id gnl|my_center|LOCUS_20400 16289 16696 gene locus_tag LOCUS_20410 gene vapC 16289 16696 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_20410 17319 16789 gene locus_tag LOCUS_20420 17319 16789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201267.1 protein_id gnl|my_center|LOCUS_20420 17453 17644 gene locus_tag LOCUS_20430 17453 17644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 18731 17697 gene locus_tag LOCUS_20440 18731 17697 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694624.1 protein_id gnl|my_center|LOCUS_20440 19042 18731 gene locus_tag LOCUS_20450 19042 18731 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005672747.1 protein_id gnl|my_center|LOCUS_20450 19350 19027 gene locus_tag LOCUS_20460 19350 19027 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661200.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence070 2 415 gene locus_tag LOCUS_20470 2 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20470 584 1240 gene locus_tag LOCUS_20480 584 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20480 1237 2550 gene locus_tag LOCUS_20490 gene potE 1237 2550 CDS product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097559.1 protein_id gnl|my_center|LOCUS_20490 4234 2651 gene locus_tag LOCUS_20500 gene pgm 4234 2651 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297249.1 protein_id gnl|my_center|LOCUS_20500 4804 4259 gene locus_tag LOCUS_20510 gene seqA 4804 4259 CDS product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848387.1 protein_id gnl|my_center|LOCUS_20510 4987 5754 gene locus_tag LOCUS_20520 gene ybfF 4987 5754 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773301.1 protein_id gnl|my_center|LOCUS_20520 5897 6178 gene locus_tag LOCUS_20530 gene ybfE 5897 6178 CDS product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300829.1 protein_id gnl|my_center|LOCUS_20530 6328 6858 gene locus_tag LOCUS_20540 gene fldA 6328 6858 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 protein_id gnl|my_center|LOCUS_20540 7152 7592 gene locus_tag LOCUS_20550 gene fur 7152 7592 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428651.1 protein_id gnl|my_center|LOCUS_20550 7898 8512 gene locus_tag LOCUS_20560 7898 8512 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703599.1 protein_id gnl|my_center|LOCUS_20560 9836 8619 gene locus_tag LOCUS_20570 9836 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20570 10273 9731 gene locus_tag LOCUS_20580 10273 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20580 10644 10450 gene locus_tag LOCUS_20590 10644 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20590 12493 10652 gene locus_tag LOCUS_20600 gene nagE 12493 10652 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816827.1 protein_id gnl|my_center|LOCUS_20600 12818 13465 gene locus_tag LOCUS_20610 12818 13465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20610 13368 13616 gene locus_tag LOCUS_20620 13368 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20620 13640 14788 gene locus_tag LOCUS_20630 gene nagA 13640 14788 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367708.1 protein_id gnl|my_center|LOCUS_20630 14797 16023 gene locus_tag LOCUS_20640 14797 16023 CDS product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097570.1 protein_id gnl|my_center|LOCUS_20640 16085 16837 gene locus_tag LOCUS_20650 gene nagD 16085 16837 CDS product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153143.1 protein_id gnl|my_center|LOCUS_20650 17123 18787 gene locus_tag LOCUS_20660 gene asnB 17123 18787 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704746.1 protein_id gnl|my_center|LOCUS_20660 19037 19113 gene locus_tag LOCUS_t00150 19037 19113 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19121 19205 gene locus_tag LOCUS_t00160 19121 19205 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence071 1287 430 gene locus_tag LOCUS_20670 gene pdxY 1287 430 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630043.1 protein_id gnl|my_center|LOCUS_20670 2561 1299 gene locus_tag LOCUS_20680 gene mtr 2561 1299 CDS product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815557.1 protein_id gnl|my_center|LOCUS_20680 4043 2673 gene locus_tag LOCUS_20690 4043 2673 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015962.1 protein_id gnl|my_center|LOCUS_20690 4900 5559 gene locus_tag LOCUS_20700 4900 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 6488 6587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7095 7289 gene locus_tag LOCUS_20710 7095 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 7301 7702 gene locus_tag LOCUS_20720 7301 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 8109 8870 gene locus_tag LOCUS_20730 gene kduD 8109 8870 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603502.1 protein_id gnl|my_center|LOCUS_20730 9297 8974 gene locus_tag LOCUS_20740 9297 8974 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_20740 9458 10156 gene locus_tag LOCUS_20750 9458 10156 CDS product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098567.1 protein_id gnl|my_center|LOCUS_20750 11069 10143 gene locus_tag LOCUS_20760 11069 10143 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703333.1 protein_id gnl|my_center|LOCUS_20760 11195 12457 gene locus_tag LOCUS_20770 gene lysA 11195 12457 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369915.1 protein_id gnl|my_center|LOCUS_20770 12488 12937 gene locus_tag LOCUS_20780 12488 12937 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098560.1 protein_id gnl|my_center|LOCUS_20780 13941 12934 gene locus_tag LOCUS_20790 gene galR 13941 12934 CDS product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098559.1 protein_id gnl|my_center|LOCUS_20790 13823 14152 gene locus_tag LOCUS_20800 13823 14152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 14570 16726 gene locus_tag LOCUS_20810 gene aas 14570 16726 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098558.1 protein_id gnl|my_center|LOCUS_20810 16719 17912 gene locus_tag LOCUS_20820 gene lplT 16719 17912 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004684.1 protein_id gnl|my_center|LOCUS_20820 18983 17943 gene locus_tag LOCUS_20830 18983 17943 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369921.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence072 357 1184 gene locus_tag LOCUS_20840 gene nhoA 357 1184 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096510.1 protein_id gnl|my_center|LOCUS_20840 1285 2094 gene locus_tag LOCUS_20850 gene ybiV 1285 2094 CDS product sugar-phosphatase YbiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083006.1 protein_id gnl|my_center|LOCUS_20850 2448 2095 gene locus_tag LOCUS_20860 2448 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3079 2468 gene locus_tag LOCUS_20870 3079 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 3396 5789 gene locus_tag LOCUS_20880 3396 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 5843 6166 gene locus_tag LOCUS_20890 5843 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 6163 7329 gene locus_tag LOCUS_20900 6163 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 7598 7891 gene locus_tag LOCUS_20910 7598 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 8679 7924 gene locus_tag LOCUS_20920 8679 7924 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930359.1 protein_id gnl|my_center|LOCUS_20920 8941 10176 gene locus_tag LOCUS_20930 gene umuC 8941 10176 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096856.1 protein_id gnl|my_center|LOCUS_20930 10869 10288 gene locus_tag LOCUS_20940 10869 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 11373 10876 gene locus_tag LOCUS_20950 11373 10876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 13189 11366 gene locus_tag LOCUS_20960 13189 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 13257 15146 gene locus_tag LOCUS_20970 13257 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 15321 15806 gene locus_tag LOCUS_20980 15321 15806 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705072.1 protein_id gnl|my_center|LOCUS_20980 15842 16381 gene locus_tag LOCUS_20990 15842 16381 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367123.1 protein_id gnl|my_center|LOCUS_20990 16427 16948 gene locus_tag LOCUS_21000 16427 16948 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038010816.1 protein_id gnl|my_center|LOCUS_21000 18094 17021 gene locus_tag LOCUS_21010 gene pmrB 18094 17021 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704800.1 protein_id gnl|my_center|LOCUS_21010 18771 18091 gene locus_tag LOCUS_21020 gene pmrA 18771 18091 CDS product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697895.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence073 1 1164 gene locus_tag LOCUS_21030 1 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21030 1189 1482 gene locus_tag LOCUS_21040 1189 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21040 2008 2093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3272 2118 gene locus_tag LOCUS_21050 gene purT 3272 2118 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366002.1 protein_id gnl|my_center|LOCUS_21050 3400 3720 gene locus_tag LOCUS_21060 3400 3720 CDS product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705951.1 protein_id gnl|my_center|LOCUS_21060 3826 4167 gene locus_tag LOCUS_21070 gene yebF 3826 4167 CDS product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042123.1 protein_id gnl|my_center|LOCUS_21070 4283 4939 gene locus_tag LOCUS_21080 4283 4939 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024751.1 protein_id gnl|my_center|LOCUS_21080 5022 7082 gene locus_tag LOCUS_21090 gene ptrB 5022 7082 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936997.1 protein_id gnl|my_center|LOCUS_21090 7747 7079 gene locus_tag LOCUS_21100 gene exoX 7747 7079 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366006.1 protein_id gnl|my_center|LOCUS_21100 8496 7771 gene locus_tag LOCUS_21110 8496 7771 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100250.1 protein_id gnl|my_center|LOCUS_21110 8842 8612 gene locus_tag LOCUS_21120 8842 8612 CDS product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096102.1 protein_id gnl|my_center|LOCUS_21120 8984 9367 gene locus_tag LOCUS_21130 gene yobA 8984 9367 CDS product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168393.1 protein_id gnl|my_center|LOCUS_21130 9550 10221 gene locus_tag LOCUS_21140 gene copD 9550 10221 CDS product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096104.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21140 10247 10585 gene locus_tag LOCUS_21150 10247 10585 CDS product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096105.1 protein_id gnl|my_center|LOCUS_21150 11353 11661 gene locus_tag LOCUS_21160 11353 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21160 11618 11974 gene locus_tag LOCUS_21170 11618 11974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21170 12166 11975 gene locus_tag LOCUS_21180 12166 11975 CDS product DUF1482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457838.1 protein_id gnl|my_center|LOCUS_21180 12513 12274 gene locus_tag LOCUS_21190 12513 12274 CDS product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978523.1 protein_id gnl|my_center|LOCUS_21190 14064 12628 gene locus_tag LOCUS_21200 gene rsmF 14064 12628 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057022.1 protein_id gnl|my_center|LOCUS_21200 16631 14142 gene locus_tag LOCUS_21210 gene yebT 16631 14142 CDS product lipid-binding membrane homeostasis protein YebT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306757.1 protein_id gnl|my_center|LOCUS_21210 18027 16744 gene locus_tag LOCUS_21220 gene yebS 18027 16744 CDS product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419906.1 protein_id gnl|my_center|LOCUS_21220 18155 18652 gene locus_tag LOCUS_21230 18155 18652 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096117.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence074 369 1598 gene locus_tag LOCUS_21240 369 1598 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706112.1 protein_id gnl|my_center|LOCUS_21240 1611 2036 gene locus_tag LOCUS_21250 gene arsC 1611 2036 CDS product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065786.1 protein_id gnl|my_center|LOCUS_21250 2409 2681 gene locus_tag LOCUS_21260 2409 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21260 2882 3523 gene locus_tag LOCUS_21270 2882 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21270 4120 4548 gene locus_tag LOCUS_21280 gene umuD 4120 4548 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109071.1 protein_id gnl|my_center|LOCUS_21280 4548 5819 gene locus_tag LOCUS_21290 4548 5819 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457555.1 protein_id gnl|my_center|LOCUS_21290 6251 6529 gene locus_tag LOCUS_21300 6251 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21300 6699 6959 gene locus_tag LOCUS_21310 6699 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21310 7518 8672 gene locus_tag LOCUS_21320 7518 8672 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211752.1 protein_id gnl|my_center|LOCUS_21320 8669 9640 gene locus_tag LOCUS_21330 8669 9640 CDS product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215070.1 protein_id gnl|my_center|LOCUS_21330 10145 10825 gene locus_tag LOCUS_21340 10145 10825 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086135.1 protein_id gnl|my_center|LOCUS_21340 10822 11046 gene locus_tag LOCUS_21350 10822 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211748.1 protein_id gnl|my_center|LOCUS_21350 11098 11523 gene locus_tag LOCUS_21360 11098 11523 CDS product DUF1380 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087145.1 protein_id gnl|my_center|LOCUS_21360 11933 12433 gene locus_tag LOCUS_21370 11933 12433 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211746.1 protein_id gnl|my_center|LOCUS_21370 12473 12676 gene locus_tag LOCUS_21380 12473 12676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072050670.1 protein_id gnl|my_center|LOCUS_21380 12865 13122 gene locus_tag LOCUS_21390 12865 13122 CDS product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097727.1 protein_id gnl|my_center|LOCUS_21390 13768 14313 gene locus_tag LOCUS_21400 gene ssb1 13768 14313 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860284.1 protein_id gnl|my_center|LOCUS_21400 14373 14603 gene locus_tag LOCUS_21410 14373 14603 CDS product DUF905 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194654.1 protein_id gnl|my_center|LOCUS_21410 14674 16680 gene locus_tag LOCUS_21420 14674 16680 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211744.1 protein_id gnl|my_center|LOCUS_21420 16726 17157 gene locus_tag LOCUS_21430 gene psiB 16726 17157 CDS product conjugation system SOS inhibitor PsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845908.1 protein_id gnl|my_center|LOCUS_21430 17154 17885 gene locus_tag LOCUS_21440 17154 17885 CDS product plasmid SOS inhibition protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087158.1 protein_id gnl|my_center|LOCUS_21440 17882 18208 gene locus_tag LOCUS_21450 17882 18208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 18455 18670 gene locus_tag LOCUS_21460 18455 18670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence075 1086 151 gene locus_tag LOCUS_21470 1086 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21470 177 227 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2413 1454 gene locus_tag LOCUS_21480 gene nrdF 2413 1454 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703235.1 protein_id gnl|my_center|LOCUS_21480 4562 2418 gene locus_tag LOCUS_21490 gene nrdE 4562 2418 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098421.1 protein_id gnl|my_center|LOCUS_21490 4945 4550 gene locus_tag LOCUS_21500 gene nrdI 4945 4550 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080944.1 protein_id gnl|my_center|LOCUS_21500 5187 4942 gene locus_tag LOCUS_21510 gene nrdH 5187 4942 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223227.1 protein_id gnl|my_center|LOCUS_21510 5777 5448 gene locus_tag LOCUS_21520 5777 5448 CDS product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519557.1 protein_id gnl|my_center|LOCUS_21520 5944 6288 gene locus_tag LOCUS_21530 5944 6288 CDS product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098417.1 protein_id gnl|my_center|LOCUS_21530 6760 6308 gene locus_tag LOCUS_21540 gene alaE 6760 6308 CDS product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098416.1 protein_id gnl|my_center|LOCUS_21540 7359 7661 gene locus_tag LOCUS_21550 7359 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 8197 9243 gene locus_tag LOCUS_21560 gene ansB 8197 9243 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394189.1 protein_id gnl|my_center|LOCUS_21560 9547 9744 gene locus_tag LOCUS_21570 gene cspG 9547 9744 CDS product cold shock protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163087.1 protein_id gnl|my_center|LOCUS_21570 9894 10328 gene locus_tag LOCUS_21580 9894 10328 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094870.1 protein_id gnl|my_center|LOCUS_21580 10720 11805 gene locus_tag LOCUS_21590 10720 11805 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704680.1 protein_id gnl|my_center|LOCUS_21590 11855 13066 gene locus_tag LOCUS_21600 11855 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21600 13134 13979 gene locus_tag LOCUS_21610 13134 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21610 14078 16045 gene locus_tag LOCUS_21620 14078 16045 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_21620 16206 16823 gene locus_tag LOCUS_21630 gene evgA 16206 16823 CDS product acid-sensing system DNA-binding response regulator EvgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991370.1 protein_id gnl|my_center|LOCUS_21630 16827 17588 gene locus_tag LOCUS_21640 16827 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21640 18342 18439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence076 524 39 gene locus_tag LOCUS_21650 524 39 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097046.1 protein_id gnl|my_center|LOCUS_21650 289 299 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 700 2550 gene locus_tag LOCUS_21660 gene sppA 700 2550 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097047.1 protein_id gnl|my_center|LOCUS_21660 2621 2788 gene locus_tag LOCUS_21670 2621 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21670 2766 3482 gene locus_tag LOCUS_21680 2766 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21680 3632 4291 gene locus_tag LOCUS_21690 gene pncA 3632 4291 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097049.1 protein_id gnl|my_center|LOCUS_21690 4597 4319 gene locus_tag LOCUS_21700 4597 4319 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097051.1 protein_id gnl|my_center|LOCUS_21700 4950 4639 gene locus_tag LOCUS_21710 gene msrB 4950 4639 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705785.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21710 5392 6471 gene locus_tag LOCUS_21720 gene gapA 5392 6471 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097053.1 protein_id gnl|my_center|LOCUS_21720 6547 7431 gene locus_tag LOCUS_21730 6547 7431 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366147.1 protein_id gnl|my_center|LOCUS_21730 8333 7473 gene locus_tag LOCUS_21740 gene yeaE 8333 7473 CDS product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186343.1 protein_id gnl|my_center|LOCUS_21740 9446 8346 gene locus_tag LOCUS_21750 9446 8346 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882373.1 protein_id gnl|my_center|LOCUS_21750 9637 10791 gene locus_tag LOCUS_21760 9637 10791 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_21760 10623 10629 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10892 11962 gene locus_tag LOCUS_21770 10892 11962 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_21770 11972 12988 gene locus_tag LOCUS_21780 11972 12988 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095327.1 protein_id gnl|my_center|LOCUS_21780 13038 13508 gene locus_tag LOCUS_21790 13038 13508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21790 13541 14512 gene locus_tag LOCUS_21800 13541 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21800 14522 15583 gene locus_tag LOCUS_21810 14522 15583 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095405.1 protein_id gnl|my_center|LOCUS_21810 16362 15616 gene locus_tag LOCUS_21820 16362 15616 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705786.1 protein_id gnl|my_center|LOCUS_21820 16789 17475 gene locus_tag LOCUS_21830 16789 17475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence077 157 200 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 231 1364 gene locus_tag LOCUS_21840 gene lolE 231 1364 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097096.1 protein_id gnl|my_center|LOCUS_21840 1380 2291 gene locus_tag LOCUS_21850 gene nagK 1380 2291 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291270.1 protein_id gnl|my_center|LOCUS_21850 2415 3125 gene locus_tag LOCUS_21860 gene cobB 2415 3125 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097094.1 protein_id gnl|my_center|LOCUS_21860 3708 3163 gene locus_tag LOCUS_21870 3708 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21870 4210 3656 gene locus_tag LOCUS_21880 4210 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21880 5025 4231 gene locus_tag LOCUS_21890 gene potC 5025 4231 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097091.1 protein_id gnl|my_center|LOCUS_21890 5845 5099 gene locus_tag LOCUS_21900 gene potB 5845 5099 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705059.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21900 7094 5829 gene locus_tag LOCUS_21910 gene potA 7094 5829 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705060.1 protein_id gnl|my_center|LOCUS_21910 7275 8498 gene locus_tag LOCUS_21920 gene pepT 7275 8498 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359463.1 protein_id gnl|my_center|LOCUS_21920 9635 8670 gene locus_tag LOCUS_21930 9635 8670 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097085.1 protein_id gnl|my_center|LOCUS_21930 10317 9700 gene locus_tag LOCUS_21940 10317 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21940 11060 10335 gene locus_tag LOCUS_21950 11060 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21950 10353 10389 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11731 11057 gene locus_tag LOCUS_21960 gene phoP 11731 11057 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367146.1 protein_id gnl|my_center|LOCUS_21960 12740 11817 gene locus_tag LOCUS_21970 12740 11817 CDS product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901609.1 protein_id gnl|my_center|LOCUS_21970 14213 12843 gene locus_tag LOCUS_21980 gene purB 14213 12843 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419121.1 protein_id gnl|my_center|LOCUS_21980 14677 14231 gene locus_tag LOCUS_21990 14677 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21990 14832 14674 gene locus_tag LOCUS_22000 14832 14674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22000 15154 14894 gene locus_tag LOCUS_22010 15154 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22010 15998 15168 gene locus_tag LOCUS_22020 15998 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22020 15178 15183 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16511 16053 gene locus_tag LOCUS_22030 gene nudJ 16511 16053 CDS product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476089.1 protein_id gnl|my_center|LOCUS_22030 17174 16521 gene locus_tag LOCUS_22040 gene rluE 17174 16521 CDS product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097078.1 protein_id gnl|my_center|LOCUS_22040 17291 17566 gene locus_tag LOCUS_22050 17291 17566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22050 >Feature sequence078 331 492 gene locus_tag LOCUS_22060 331 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22060 447 1286 gene locus_tag LOCUS_22070 gene oppF 447 1286 CDS product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096274.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22070 1397 2329 gene locus_tag LOCUS_22080 1397 2329 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045367413.1 protein_id gnl|my_center|LOCUS_22080 2582 2253 gene locus_tag LOCUS_22090 2582 2253 CDS product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425070.1 protein_id gnl|my_center|LOCUS_22090 2856 2617 gene locus_tag LOCUS_22100 2856 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22100 4070 2835 gene locus_tag LOCUS_22110 gene cls 4070 2835 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22110 4740 4444 gene locus_tag LOCUS_22120 4740 4444 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967595.1 protein_id gnl|my_center|LOCUS_22120 5050 5616 gene locus_tag LOCUS_22130 5050 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22130 6063 5662 gene locus_tag LOCUS_22140 gene yciA 6063 5662 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096281.1 protein_id gnl|my_center|LOCUS_22140 6599 6060 gene locus_tag LOCUS_22150 6599 6060 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808682.1 protein_id gnl|my_center|LOCUS_22150 7407 6697 gene locus_tag LOCUS_22160 7407 6697 CDS product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096283.1 protein_id gnl|my_center|LOCUS_22160 7745 7434 gene locus_tag LOCUS_22170 7745 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 8529 8693 gene locus_tag LOCUS_22180 8529 8693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22180 9162 8755 gene locus_tag LOCUS_22190 9162 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22190 9550 9086 gene locus_tag LOCUS_22200 9550 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22200 10743 9550 gene locus_tag LOCUS_22210 gene trpB 10743 9550 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209521.1 protein_id gnl|my_center|LOCUS_22210 11155 10754 gene locus_tag LOCUS_22220 11155 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22220 12083 11061 gene locus_tag LOCUS_22230 12083 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22230 13682 12087 gene locus_tag LOCUS_22240 gene trpD 13682 12087 CDS product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763524.1 protein_id gnl|my_center|LOCUS_22240 15244 13682 gene locus_tag LOCUS_22250 15244 13682 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883574.1 protein_id gnl|my_center|LOCUS_22250 15497 15760 gene locus_tag LOCUS_22260 15497 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22260 15654 16400 gene locus_tag LOCUS_22270 gene rnm 15654 16400 CDS product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705744.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22270 16397 17017 gene locus_tag LOCUS_22280 16397 17017 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096362.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence079 978 1370 gene locus_tag LOCUS_22290 978 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1367 1573 gene locus_tag LOCUS_22300 1367 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 1693 1974 gene locus_tag LOCUS_22310 1693 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 3630 2257 gene locus_tag LOCUS_22320 3630 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3949 4566 gene locus_tag LOCUS_22330 3949 4566 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703812.1 protein_id gnl|my_center|LOCUS_22330 4874 6841 gene locus_tag LOCUS_22340 4874 6841 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269419.1 protein_id gnl|my_center|LOCUS_22340 7295 7606 gene locus_tag LOCUS_22350 7295 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 8444 7569 gene locus_tag LOCUS_22360 8444 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22360 8698 9093 gene locus_tag LOCUS_22370 8698 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22370 8999 9328 gene locus_tag LOCUS_22380 8999 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22380 9383 9658 gene locus_tag LOCUS_22390 gene rpoZ 9383 9658 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 protein_id gnl|my_center|LOCUS_22390 9678 10343 gene locus_tag LOCUS_22400 9678 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22400 10352 10615 gene locus_tag LOCUS_22410 10352 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22410 10612 11022 gene locus_tag LOCUS_22420 10612 11022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22420 11073 11807 gene locus_tag LOCUS_22430 11073 11807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22430 11812 12534 gene locus_tag LOCUS_22440 gene trmH 11812 12534 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068431.1 protein_id gnl|my_center|LOCUS_22440 12535 12810 gene locus_tag LOCUS_22450 12535 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22450 12813 13097 gene locus_tag LOCUS_22460 12813 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22460 13097 13666 gene locus_tag LOCUS_22470 13097 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22470 13566 14582 gene locus_tag LOCUS_22480 13566 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22480 14743 16134 gene locus_tag LOCUS_22490 14743 16134 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094877.1 protein_id gnl|my_center|LOCUS_22490 16254 17402 gene locus_tag LOCUS_22500 16254 17402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22500 >Feature sequence080 1488 862 gene locus_tag LOCUS_22510 gene upp 1488 862 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860560.1 protein_id gnl|my_center|LOCUS_22510 1712 2749 gene locus_tag LOCUS_22520 gene purM 1712 2749 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098241.1 protein_id gnl|my_center|LOCUS_22520 2749 3390 gene locus_tag LOCUS_22530 gene purN 2749 3390 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098242.1 protein_id gnl|my_center|LOCUS_22530 3614 5641 gene locus_tag LOCUS_22540 gene ppk1 3614 5641 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098243.1 protein_id gnl|my_center|LOCUS_22540 5645 7192 gene locus_tag LOCUS_22550 gene ppx 5645 7192 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832869.1 protein_id gnl|my_center|LOCUS_22550 9300 7189 gene locus_tag LOCUS_22560 9300 7189 CDS product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773655.1 protein_id gnl|my_center|LOCUS_22560 9779 9970 gene locus_tag LOCUS_22570 9779 9970 CDS product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528036.1 protein_id gnl|my_center|LOCUS_22570 11766 10267 gene locus_tag LOCUS_22580 gene guaA 11766 10267 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138293.1 protein_id gnl|my_center|LOCUS_22580 12269 11889 gene locus_tag LOCUS_22590 12269 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22590 13383 12310 gene locus_tag LOCUS_22600 13383 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22600 13529 14830 gene locus_tag LOCUS_22610 gene xseA 13529 14830 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098266.1 protein_id gnl|my_center|LOCUS_22610 15050 14835 gene locus_tag LOCUS_22620 15050 14835 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098270.1 protein_id gnl|my_center|LOCUS_22620 16567 15095 gene locus_tag LOCUS_22630 gene der 16567 15095 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882245.1 protein_id gnl|my_center|LOCUS_22630 <17483 16689 gene locus_tag LOCUS_22640 <17483 16689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001177037.1:outer membrane protein assembly factor BamB >Feature sequence081 300 1283 gene locus_tag LOCUS_22650 gene dcyD 300 1283 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128215.1 protein_id gnl|my_center|LOCUS_22650 1304 1972 gene locus_tag LOCUS_22660 gene tcyL 1304 1972 CDS product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096022.1 protein_id gnl|my_center|LOCUS_22660 1969 2721 gene locus_tag LOCUS_22670 gene yecC 1969 2721 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273000.1 protein_id gnl|my_center|LOCUS_22670 3089 3664 gene locus_tag LOCUS_22680 gene sdiA 3089 3664 CDS product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078446.1 protein_id gnl|my_center|LOCUS_22680 3954 3730 gene locus_tag LOCUS_22690 3954 3730 CDS product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365908.1 protein_id gnl|my_center|LOCUS_22690 4441 5097 gene locus_tag LOCUS_22700 gene uvrY 4441 5097 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611323.1 protein_id gnl|my_center|LOCUS_22700 5103 6137 gene locus_tag LOCUS_22710 5103 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22710 6023 6904 gene locus_tag LOCUS_22720 6023 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22720 6962 7177 gene locus_tag LOCUS_22730 6962 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22730 7104 7511 gene locus_tag LOCUS_22740 7104 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22740 7663 7738 gene locus_tag LOCUS_t00170 7663 7738 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7792 7865 gene locus_tag LOCUS_t00180 7792 7865 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7876 7962 gene locus_tag LOCUS_t00190 7876 7962 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9046 8138 gene locus_tag LOCUS_22750 9046 8138 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058303659.1 protein_id gnl|my_center|LOCUS_22750 10677 9337 gene locus_tag LOCUS_22760 10677 9337 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 protein_id gnl|my_center|LOCUS_22760 12417 10903 gene locus_tag LOCUS_22770 gene abfA 12417 10903 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_22770 13760 12438 gene locus_tag LOCUS_22780 13760 12438 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224212.1 protein_id gnl|my_center|LOCUS_22780 14214 15143 gene locus_tag LOCUS_22790 14214 15143 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 protein_id gnl|my_center|LOCUS_22790 15580 15173 gene locus_tag LOCUS_22800 15580 15173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22800 15924 15523 gene locus_tag LOCUS_22810 15924 15523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22810 16821 15934 gene locus_tag LOCUS_22820 16821 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 <17372 16824 gene locus_tag LOCUS_22830 <17372 16824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093232.1:ethanolamine ammonia-lyase subunit EutB >Feature sequence082 <1 510 gene locus_tag LOCUS_22840 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705659.1:L-Ala-D/L-Glu epimerase 953 501 gene locus_tag LOCUS_22850 953 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22850 1173 976 gene locus_tag LOCUS_22860 1173 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22860 1378 2997 gene locus_tag LOCUS_22870 1378 2997 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096426.1 protein_id gnl|my_center|LOCUS_22870 3124 3771 gene locus_tag LOCUS_22880 gene zinT 3124 3771 CDS product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007767.1 protein_id gnl|my_center|LOCUS_22880 4169 3822 gene locus_tag LOCUS_22890 4169 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366895.1 protein_id gnl|my_center|LOCUS_22890 4786 4184 gene locus_tag LOCUS_22900 4786 4184 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098828.1 protein_id gnl|my_center|LOCUS_22900 4830 4964 gene locus_tag LOCUS_22910 4830 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 5099 5365 gene locus_tag LOCUS_22920 5099 5365 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_22920 6507 5362 gene locus_tag LOCUS_22930 6507 5362 CDS product membrane-associated sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819461.1 protein_id gnl|my_center|LOCUS_22930 6690 7673 gene locus_tag LOCUS_22940 gene zntB 6690 7673 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387372.1 protein_id gnl|my_center|LOCUS_22940 7949 8080 gene locus_tag LOCUS_22950 7949 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 9047 8112 gene locus_tag LOCUS_22960 gene ttcA 9047 8112 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157412.1 protein_id gnl|my_center|LOCUS_22960 9239 9565 gene locus_tag LOCUS_22970 9239 9565 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_22970 9737 9934 gene locus_tag LOCUS_22980 9737 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 10202 10312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10733 10800 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11009 11208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11720 11758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14200 12059 gene locus_tag LOCUS_22990 14200 12059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 12092 12190 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14464 14730 gene locus_tag LOCUS_23000 14464 14730 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200680.1 protein_id gnl|my_center|LOCUS_23000 15149 14727 gene locus_tag LOCUS_23010 gene hslJ 15149 14727 CDS product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296048.1 protein_id gnl|my_center|LOCUS_23010 16229 15240 gene locus_tag LOCUS_23020 16229 15240 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096773.1 protein_id gnl|my_center|LOCUS_23020 16442 16615 gene locus_tag LOCUS_23030 16442 16615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23030 >Feature sequence083 229 669 gene locus_tag LOCUS_23040 229 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23040 265 301 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 666 2075 gene locus_tag LOCUS_23050 666 2075 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136930.1 protein_id gnl|my_center|LOCUS_23050 2062 2640 gene locus_tag LOCUS_23060 2062 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097384.1 protein_id gnl|my_center|LOCUS_23060 2650 4104 gene locus_tag LOCUS_23070 2650 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 4181 4495 gene locus_tag LOCUS_23080 4181 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 4470 4811 gene locus_tag LOCUS_23090 4470 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 4814 5335 gene locus_tag LOCUS_23100 4814 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 5325 6047 gene locus_tag LOCUS_23110 5325 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267960.1 protein_id gnl|my_center|LOCUS_23110 6019 6588 gene locus_tag LOCUS_23120 6019 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200801.1 protein_id gnl|my_center|LOCUS_23120 6575 8275 gene locus_tag LOCUS_23130 6575 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977539.1 protein_id gnl|my_center|LOCUS_23130 9034 8861 gene locus_tag LOCUS_23140 9034 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 10983 9349 gene locus_tag LOCUS_23150 10983 9349 CDS product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097376.1 protein_id gnl|my_center|LOCUS_23150 11370 11636 gene locus_tag LOCUS_23160 11370 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 11944 11678 gene locus_tag LOCUS_23170 11944 11678 CDS product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495513.1 protein_id gnl|my_center|LOCUS_23170 12141 12431 gene locus_tag LOCUS_23180 12141 12431 CDS product YbjC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259133.1 protein_id gnl|my_center|LOCUS_23180 12415 13137 gene locus_tag LOCUS_23190 gene nfsA 12415 13137 CDS product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189165.1 protein_id gnl|my_center|LOCUS_23190 13215 14117 gene locus_tag LOCUS_23200 gene rimK 13215 14117 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684361.1 protein_id gnl|my_center|LOCUS_23200 14252 14731 gene locus_tag LOCUS_23210 14252 14731 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367528.1 protein_id gnl|my_center|LOCUS_23210 15043 16215 gene locus_tag LOCUS_23220 gene potF 15043 16215 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126098.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence084 864 106 gene locus_tag LOCUS_23230 864 106 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099005.1 protein_id gnl|my_center|LOCUS_23230 1976 873 gene locus_tag LOCUS_23240 1976 873 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351330.1 protein_id gnl|my_center|LOCUS_23240 3168 1987 gene locus_tag LOCUS_23250 3168 1987 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019643.1 protein_id gnl|my_center|LOCUS_23250 4267 3242 gene locus_tag LOCUS_23260 4267 3242 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 protein_id gnl|my_center|LOCUS_23260 4973 4752 gene locus_tag LOCUS_23270 4973 4752 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825639.1 protein_id gnl|my_center|LOCUS_23270 5502 5284 gene locus_tag LOCUS_23280 5502 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23280 8305 5543 gene locus_tag LOCUS_23290 8305 5543 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099000.1 protein_id gnl|my_center|LOCUS_23290 9326 8298 gene locus_tag LOCUS_23300 gene acrE 9326 8298 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160348.1 protein_id gnl|my_center|LOCUS_23300 9873 10523 gene locus_tag LOCUS_23310 gene envR 9873 10523 CDS product acrEF/envCD operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446923.1 protein_id gnl|my_center|LOCUS_23310 10889 10593 gene locus_tag LOCUS_23320 gene fis 10889 10593 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 protein_id gnl|my_center|LOCUS_23320 11907 10993 gene locus_tag LOCUS_23330 gene dusB 11907 10993 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369451.1 protein_id gnl|my_center|LOCUS_23330 13043 12303 gene locus_tag LOCUS_23340 13043 12303 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_23340 14072 13191 gene locus_tag LOCUS_23350 gene prmA 14072 13191 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703628.1 protein_id gnl|my_center|LOCUS_23350 15190 14084 gene locus_tag LOCUS_23360 15190 14084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23360 15533 15087 gene locus_tag LOCUS_23370 15533 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23370 15765 15523 gene locus_tag LOCUS_23380 15765 15523 CDS product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098993.1 protein_id gnl|my_center|LOCUS_23380 16522 15866 gene locus_tag LOCUS_23390 16522 15866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 16534 16555 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence085 903 61 gene locus_tag LOCUS_23400 gene epmB 903 61 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940500.1 protein_id gnl|my_center|LOCUS_23400 1131 1697 gene locus_tag LOCUS_23410 gene efp 1131 1697 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855940.1 protein_id gnl|my_center|LOCUS_23410 1752 1889 gene locus_tag LOCUS_23420 1752 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 1992 2138 gene locus_tag LOCUS_23430 gene ecnB 1992 2138 CDS product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239598.1 protein_id gnl|my_center|LOCUS_23430 2643 2176 gene locus_tag LOCUS_23440 2643 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 3037 3354 gene locus_tag LOCUS_23450 gene sugE 3037 3354 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118469.1 protein_id gnl|my_center|LOCUS_23450 3881 3351 gene locus_tag LOCUS_23460 3881 3351 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095269.1 protein_id gnl|my_center|LOCUS_23460 5166 3949 gene locus_tag LOCUS_23470 5166 3949 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029244.1 protein_id gnl|my_center|LOCUS_23470 5337 6878 gene locus_tag LOCUS_23480 gene ptsG 5337 6878 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838205.1 protein_id gnl|my_center|LOCUS_23480 6908 9523 gene locus_tag LOCUS_23490 6908 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 9567 10391 gene locus_tag LOCUS_23500 9567 10391 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261394.1 protein_id gnl|my_center|LOCUS_23500 9790 9799 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10375 10767 gene locus_tag LOCUS_23510 10375 10767 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094795.1 protein_id gnl|my_center|LOCUS_23510 10767 11039 gene locus_tag LOCUS_23520 10767 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 11443 11084 gene locus_tag LOCUS_23530 gene frdD 11443 11084 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609650.1 protein_id gnl|my_center|LOCUS_23530 11848 11453 gene locus_tag LOCUS_23540 gene frdC 11848 11453 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208749.1 protein_id gnl|my_center|LOCUS_23540 12593 11859 gene locus_tag LOCUS_23550 gene frdB 12593 11859 CDS product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704156.1 protein_id gnl|my_center|LOCUS_23550 14382 12586 gene locus_tag LOCUS_23560 gene frdA 14382 12586 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095275.1 protein_id gnl|my_center|LOCUS_23560 14702 15679 gene locus_tag LOCUS_23570 gene epmA 14702 15679 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 protein_id gnl|my_center|LOCUS_23570 16607 15720 gene locus_tag LOCUS_23580 16607 15720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23580 >Feature sequence086 715 368 gene locus_tag LOCUS_23590 715 368 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096342.1 protein_id gnl|my_center|LOCUS_23590 1693 719 gene locus_tag LOCUS_23600 1693 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23600 3335 1827 gene locus_tag LOCUS_23610 3335 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23610 3621 3316 gene locus_tag LOCUS_23620 3621 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 4037 3630 gene locus_tag LOCUS_23630 4037 3630 CDS product phage minor tail protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299690.1 protein_id gnl|my_center|LOCUS_23630 4809 4072 gene locus_tag LOCUS_23640 4809 4072 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096338.1 protein_id gnl|my_center|LOCUS_23640 5215 4817 gene locus_tag LOCUS_23650 gene gpU 5215 4817 CDS product phage tail terminator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096337.1 protein_id gnl|my_center|LOCUS_23650 5233 5382 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttctccacgcacgtggaggtgtttc 5942 5385 gene locus_tag LOCUS_23660 5942 5385 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096336.1 protein_id gnl|my_center|LOCUS_23660 6227 5952 gene locus_tag LOCUS_23670 6227 5952 CDS product DNA breaking-rejoining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220710484.1 protein_id gnl|my_center|LOCUS_23670 6543 6220 gene locus_tag LOCUS_23680 6543 6220 CDS product DUF2190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097065.1 protein_id gnl|my_center|LOCUS_23680 8604 6625 gene locus_tag LOCUS_23690 8604 6625 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081097245.1 protein_id gnl|my_center|LOCUS_23690 10078 8573 gene locus_tag LOCUS_23700 10078 8573 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096321.1 protein_id gnl|my_center|LOCUS_23700 10299 10075 gene locus_tag LOCUS_23710 10299 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309515.1 protein_id gnl|my_center|LOCUS_23710 12398 10296 gene locus_tag LOCUS_23720 12398 10296 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096319.1 protein_id gnl|my_center|LOCUS_23720 12898 12398 gene locus_tag LOCUS_23730 12898 12398 CDS product DUF1441 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020884621.1 protein_id gnl|my_center|LOCUS_23730 13472 13128 gene locus_tag LOCUS_23740 13472 13128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 14596 13598 gene locus_tag LOCUS_23750 14596 13598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 15627 15487 gene locus_tag LOCUS_23760 15627 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 15952 15602 gene locus_tag LOCUS_23770 15952 15602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 16455 15949 gene locus_tag LOCUS_23780 16455 15949 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403797.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence087 1402 2391 gene locus_tag LOCUS_23790 gene mgrA 1402 2391 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_23790 2536 2862 gene locus_tag LOCUS_23800 2536 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 3050 4609 gene locus_tag LOCUS_23810 gene malX 3050 4609 CDS product maltose/glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387436.1 protein_id gnl|my_center|LOCUS_23810 4670 5977 gene locus_tag LOCUS_23820 4670 5977 CDS product adenylosuccinate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034850905.1 protein_id gnl|my_center|LOCUS_23820 5967 7178 gene locus_tag LOCUS_23830 gene nagA 5967 7178 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582637.1 protein_id gnl|my_center|LOCUS_23830 8667 7171 gene locus_tag LOCUS_23840 8667 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 9999 8761 gene locus_tag LOCUS_23850 9999 8761 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186369.1 protein_id gnl|my_center|LOCUS_23850 10351 11550 gene locus_tag LOCUS_23860 gene nupC 10351 11550 CDS product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878156.1 protein_id gnl|my_center|LOCUS_23860 11764 11600 gene locus_tag LOCUS_23870 11764 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 13157 11808 gene locus_tag LOCUS_23880 13157 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23880 13470 13165 gene locus_tag LOCUS_23890 13470 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23890 13768 13861 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14101 14463 gene locus_tag LOCUS_23900 14101 14463 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472034.1 protein_id gnl|my_center|LOCUS_23900 14467 14853 gene locus_tag LOCUS_23910 14467 14853 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472021.1 protein_id gnl|my_center|LOCUS_23910 15983 14904 gene locus_tag LOCUS_23920 gene gltX 15983 14904 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695623.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23920 16319 16044 gene locus_tag LOCUS_23930 16319 16044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23930 >Feature sequence088 1118 531 gene locus_tag LOCUS_23940 1118 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23940 2331 1240 gene locus_tag LOCUS_23950 gene lacI 2331 1240 CDS product DNA-binding transcriptional repressor LacI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851507.1 protein_id gnl|my_center|LOCUS_23950 2766 2554 gene locus_tag LOCUS_23960 2766 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3164 2799 gene locus_tag LOCUS_23970 3164 2799 CDS product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878136.1 protein_id gnl|my_center|LOCUS_23970 3417 3196 gene locus_tag LOCUS_23980 3417 3196 CDS product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703392.1 protein_id gnl|my_center|LOCUS_23980 3899 3426 gene locus_tag LOCUS_23990 gene radC 3899 3426 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703840.1 protein_id gnl|my_center|LOCUS_23990 4785 3967 gene locus_tag LOCUS_24000 4785 3967 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007869723.1 protein_id gnl|my_center|LOCUS_24000 5490 4885 gene locus_tag LOCUS_24010 5490 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878130.1 protein_id gnl|my_center|LOCUS_24010 6743 5850 gene locus_tag LOCUS_24020 6743 5850 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878129.1 protein_id gnl|my_center|LOCUS_24020 7554 7862 gene locus_tag LOCUS_24030 7554 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 9934 8303 gene locus_tag LOCUS_24040 9934 8303 CDS product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481742.1 protein_id gnl|my_center|LOCUS_24040 10434 10036 gene locus_tag LOCUS_24050 10434 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 10896 11732 gene locus_tag LOCUS_24060 10896 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 13167 13889 gene locus_tag LOCUS_24070 13167 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 13890 14522 gene locus_tag LOCUS_24080 13890 14522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 15098 15649 gene locus_tag LOCUS_24090 15098 15649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 15976 16003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16025 16324 gene locus_tag LOCUS_24100 16025 16324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 >Feature sequence089 2 277 gene locus_tag LOCUS_24110 gene rplR 2 277 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006817270.1 protein_id gnl|my_center|LOCUS_24110 292 765 gene locus_tag LOCUS_24120 gene rpsE 292 765 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 protein_id gnl|my_center|LOCUS_24120 850 912 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 932 1204 gene locus_tag LOCUS_24130 932 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 1212 2543 gene locus_tag LOCUS_24140 gene secY 1212 2543 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 protein_id gnl|my_center|LOCUS_24140 2774 2601 gene locus_tag LOCUS_24150 2774 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2837 3193 gene locus_tag LOCUS_24160 gene rpsM 2837 3193 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099021.1 protein_id gnl|my_center|LOCUS_24160 3210 3599 gene locus_tag LOCUS_24170 gene rpsK 3210 3599 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388621.1 protein_id gnl|my_center|LOCUS_24170 3631 4251 gene locus_tag LOCUS_24180 gene rpsD 3631 4251 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 protein_id gnl|my_center|LOCUS_24180 4277 4858 gene locus_tag LOCUS_24190 4277 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24190 4767 5207 gene locus_tag LOCUS_24200 4767 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24200 5248 5634 gene locus_tag LOCUS_24210 gene rplQ 5248 5634 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216372.1 protein_id gnl|my_center|LOCUS_24210 5735 6106 gene locus_tag LOCUS_24220 5735 6106 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266531.1 protein_id gnl|my_center|LOCUS_24220 6106 6525 gene locus_tag LOCUS_24230 gene zntR 6106 6525 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369432.1 protein_id gnl|my_center|LOCUS_24230 6577 6792 gene locus_tag LOCUS_24240 gene arfA 6577 6792 CDS product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092695.1 protein_id gnl|my_center|LOCUS_24240 7206 6793 gene locus_tag LOCUS_24250 gene mscL 7206 6793 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022450.1 protein_id gnl|my_center|LOCUS_24250 8723 7347 gene locus_tag LOCUS_24260 gene trkA 8723 7347 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369435.1 protein_id gnl|my_center|LOCUS_24260 10051 8759 gene locus_tag LOCUS_24270 gene rsmB 10051 8759 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744595.1 protein_id gnl|my_center|LOCUS_24270 11023 10112 gene locus_tag LOCUS_24280 gene fmt 11023 10112 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004453.1 protein_id gnl|my_center|LOCUS_24280 11458 11048 gene locus_tag LOCUS_24290 gene def 11458 11048 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114992.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24290 11690 12811 gene locus_tag LOCUS_24300 gene dprA 11690 12811 CDS product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228544.1 protein_id gnl|my_center|LOCUS_24300 12783 13256 gene locus_tag LOCUS_24310 gene smg 12783 13256 CDS product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369440.1 protein_id gnl|my_center|LOCUS_24310 13282 13833 gene locus_tag LOCUS_24320 13282 13833 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099010.1 protein_id gnl|my_center|LOCUS_24320 13826 14398 gene locus_tag LOCUS_24330 gene tsaC 13826 14398 CDS product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420961.1 protein_id gnl|my_center|LOCUS_24330 14403 15221 gene locus_tag LOCUS_24340 gene aroE 14403 15221 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451211.1 protein_id gnl|my_center|LOCUS_24340 15218 15475 gene locus_tag LOCUS_24350 15218 15475 CDS product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070563.1 protein_id gnl|my_center|LOCUS_24350 16005 15451 gene locus_tag LOCUS_24360 16005 15451 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099006.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence090 <1 526 gene locus_tag LOCUS_24370 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000377800.1:phosphate signaling complex protein PhoU 1188 523 gene locus_tag LOCUS_24380 gene yieH 1188 523 CDS product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703909.1 protein_id gnl|my_center|LOCUS_24380 1368 2705 gene locus_tag LOCUS_24390 gene adeP 1368 2705 CDS product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301685.1 protein_id gnl|my_center|LOCUS_24390 3306 2740 gene locus_tag LOCUS_24400 3306 2740 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369022.1 protein_id gnl|my_center|LOCUS_24400 4081 3299 gene locus_tag LOCUS_24410 4081 3299 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190678.1 protein_id gnl|my_center|LOCUS_24410 5206 4313 gene locus_tag LOCUS_24420 5206 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24420 5568 5368 gene locus_tag LOCUS_24430 5568 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24430 7089 5674 gene locus_tag LOCUS_24440 gene tnaA 7089 5674 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295247.1 protein_id gnl|my_center|LOCUS_24440 7371 7574 gene locus_tag LOCUS_24450 7371 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 8392 7676 gene locus_tag LOCUS_24460 8392 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24460 8966 8397 gene locus_tag LOCUS_24470 8966 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 8429 8444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9392 9060 gene locus_tag LOCUS_24480 9392 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24480 10597 9386 gene locus_tag LOCUS_24490 gene yidC 10597 9386 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378272.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24490 11147 10821 gene locus_tag LOCUS_24500 gene rnpA 11147 10821 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703902.1 protein_id gnl|my_center|LOCUS_24500 12011 13321 gene locus_tag LOCUS_24510 gene dnaA 12011 13321 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014068246.1 protein_id gnl|my_center|LOCUS_24510 13326 14426 gene locus_tag LOCUS_24520 gene dnaN 13326 14426 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369032.1 protein_id gnl|my_center|LOCUS_24520 14426 15499 gene locus_tag LOCUS_24530 gene recF 14426 15499 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094779.1 protein_id gnl|my_center|LOCUS_24530 15528 15998 gene locus_tag LOCUS_24540 15528 15998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24540 >Feature sequence091 728 2227 gene locus_tag LOCUS_24550 gene ushA 728 2227 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095904.1 protein_id gnl|my_center|LOCUS_24550 2753 2274 gene locus_tag LOCUS_24560 gene ybaK 2753 2274 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428207.1 protein_id gnl|my_center|LOCUS_24560 3633 2836 gene locus_tag LOCUS_24570 3633 2836 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367896.1 protein_id gnl|my_center|LOCUS_24570 6148 3719 gene locus_tag LOCUS_24580 gene copA 6148 3719 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816861.1 protein_id gnl|my_center|LOCUS_24580 4415 4518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6380 6601 gene locus_tag LOCUS_24590 6380 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 7149 9182 gene locus_tag LOCUS_24600 7149 9182 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933627.1 protein_id gnl|my_center|LOCUS_24600 9183 10694 gene locus_tag LOCUS_24610 gene casA 9183 10694 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933628.1 protein_id gnl|my_center|LOCUS_24610 10691 11206 gene locus_tag LOCUS_24620 gene casB 10691 11206 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933629.1 protein_id gnl|my_center|LOCUS_24620 11203 11838 gene locus_tag LOCUS_24630 gene cas6e 11203 11838 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933630.1 protein_id gnl|my_center|LOCUS_24630 11854 12900 gene locus_tag LOCUS_24640 gene cas7e 11854 12900 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933631.1 protein_id gnl|my_center|LOCUS_24640 12904 13605 gene locus_tag LOCUS_24650 gene cas5e 12904 13605 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933632.1 protein_id gnl|my_center|LOCUS_24650 13637 14134 gene locus_tag LOCUS_24660 13637 14134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24660 14258 14503 gene locus_tag LOCUS_24670 14258 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24670 14500 14790 gene locus_tag LOCUS_24680 gene cas2e 14500 14790 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933634.1 protein_id gnl|my_center|LOCUS_24680 14810 >16118 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttctccacgtacgtggaggtgtttc >Feature sequence092 1184 909 gene locus_tag LOCUS_24690 1184 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1924 1196 gene locus_tag LOCUS_24700 1924 1196 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848059.1 protein_id gnl|my_center|LOCUS_24700 2435 1947 gene locus_tag LOCUS_24710 2435 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24710 2664 2419 gene locus_tag LOCUS_24720 2664 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24720 3989 2607 gene locus_tag LOCUS_24730 3989 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24730 4642 4172 gene locus_tag LOCUS_24740 4642 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24740 4932 4654 gene locus_tag LOCUS_24750 4932 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 5244 5342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5595 5696 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5949 5954 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6467 6258 gene locus_tag LOCUS_24760 6467 6258 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112403.1 protein_id gnl|my_center|LOCUS_24760 6651 6457 gene locus_tag LOCUS_24770 6651 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 9788 9114 gene locus_tag LOCUS_24780 9788 9114 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338540.1 protein_id gnl|my_center|LOCUS_24780 10199 11371 gene locus_tag LOCUS_24790 gene vceC 10199 11371 CDS product multidrug efflux MFS transporter outer membrane subunit VceC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798631.1 protein_id gnl|my_center|LOCUS_24790 11371 12570 gene locus_tag LOCUS_24800 11371 12570 CDS product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 protein_id gnl|my_center|LOCUS_24800 12574 14106 gene locus_tag LOCUS_24810 12574 14106 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193982.1 protein_id gnl|my_center|LOCUS_24810 14212 15117 gene locus_tag LOCUS_24820 gene cyoA 14212 15117 CDS product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239434.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence093 1374 118 gene locus_tag LOCUS_24830 1374 118 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209313.1 protein_id gnl|my_center|LOCUS_24830 2807 1608 gene locus_tag LOCUS_24840 2807 1608 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851503.1 protein_id gnl|my_center|LOCUS_24840 3057 2983 gene locus_tag LOCUS_t00200 3057 2983 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4090 3131 gene locus_tag LOCUS_24850 4090 3131 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098160.1 protein_id gnl|my_center|LOCUS_24850 4290 4820 gene locus_tag LOCUS_24860 gene ccmA 4290 4820 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370110.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24860 4891 5550 gene locus_tag LOCUS_24870 gene ccmB 4891 5550 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971732.1 protein_id gnl|my_center|LOCUS_24870 5597 6307 gene locus_tag LOCUS_24880 5597 6307 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006798169.1 protein_id gnl|my_center|LOCUS_24880 6304 6522 gene locus_tag LOCUS_24890 gene ccmD 6304 6522 CDS product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006798167.1 protein_id gnl|my_center|LOCUS_24890 6519 6998 gene locus_tag LOCUS_24900 gene ccmE 6519 6998 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158631.1 protein_id gnl|my_center|LOCUS_24900 6995 8944 gene locus_tag LOCUS_24910 6995 8944 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158627.1 protein_id gnl|my_center|LOCUS_24910 8944 9090 gene locus_tag LOCUS_24920 8944 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24920 9227 9487 gene locus_tag LOCUS_24930 9227 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24930 9484 9942 gene locus_tag LOCUS_24940 9484 9942 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703210.1 protein_id gnl|my_center|LOCUS_24940 9939 11141 gene locus_tag LOCUS_24950 gene ccmI 9939 11141 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815901.1 protein_id gnl|my_center|LOCUS_24950 11171 11923 gene locus_tag LOCUS_24960 gene mlaA 11171 11923 CDS product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776787.1 protein_id gnl|my_center|LOCUS_24960 13360 11993 gene locus_tag LOCUS_24970 gene fadL 13360 11993 CDS product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420287.1 protein_id gnl|my_center|LOCUS_24970 13730 14014 gene locus_tag LOCUS_24980 13730 14014 CDS product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030904.1 protein_id gnl|my_center|LOCUS_24980 14181 15491 gene locus_tag LOCUS_24990 gene fadI 14181 15491 CDS product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420286.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence094 411 773 gene locus_tag LOCUS_25000 411 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25000 835 1338 gene locus_tag LOCUS_25010 835 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25010 1343 3253 gene locus_tag LOCUS_25020 gene paoC 1343 3253 CDS product aldehyde oxidoreductase molybdenum-binding subunit PaoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667043.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25020 3207 3518 gene locus_tag LOCUS_25030 3207 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25030 3727 4407 gene locus_tag LOCUS_25040 3727 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25040 5346 4747 gene locus_tag LOCUS_25050 5346 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 5464 6891 gene locus_tag LOCUS_25060 5464 6891 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159678901.1 protein_id gnl|my_center|LOCUS_25060 8237 7017 gene locus_tag LOCUS_25070 8237 7017 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032715566.1 protein_id gnl|my_center|LOCUS_25070 8615 9601 gene locus_tag LOCUS_25080 8615 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 9605 10612 gene locus_tag LOCUS_25090 9605 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 10745 11407 gene locus_tag LOCUS_25100 10745 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 12179 11571 gene locus_tag LOCUS_25110 12179 11571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 13035 12172 gene locus_tag LOCUS_25120 13035 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 13345 13010 gene locus_tag LOCUS_25130 13345 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 13360 14496 gene locus_tag LOCUS_25140 13360 14496 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705543.1 protein_id gnl|my_center|LOCUS_25140 15041 15227 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence095 504 232 gene locus_tag LOCUS_25150 504 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25150 4366 569 gene locus_tag LOCUS_25160 gene yhdP 4366 569 CDS product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253574.1 protein_id gnl|my_center|LOCUS_25160 5887 4418 gene locus_tag LOCUS_25170 gene rng 5887 4418 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 protein_id gnl|my_center|LOCUS_25170 6339 5896 gene locus_tag LOCUS_25180 6339 5896 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25180 6852 6436 gene locus_tag LOCUS_25190 gene mreD 6852 6436 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098985.1 protein_id gnl|my_center|LOCUS_25190 7907 6852 gene locus_tag LOCUS_25200 gene mreC 7907 6852 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098986.1 protein_id gnl|my_center|LOCUS_25200 9020 7977 gene locus_tag LOCUS_25210 gene mreB 9020 7977 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 protein_id gnl|my_center|LOCUS_25210 11270 9330 gene locus_tag LOCUS_25220 gene csrD 11270 9330 CDS product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098987.1 protein_id gnl|my_center|LOCUS_25220 11492 12466 gene locus_tag LOCUS_25230 11492 12466 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148479.1 protein_id gnl|my_center|LOCUS_25230 12577 13131 gene locus_tag LOCUS_25240 12577 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 13093 13126 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13136 13501 gene locus_tag LOCUS_25250 13136 13501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 13502 14101 gene locus_tag LOCUS_25260 gene msrQ 13502 14101 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703627.1 protein_id gnl|my_center|LOCUS_25260 14336 14788 gene locus_tag LOCUS_25270 gene aroQ 14336 14788 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098991.1 protein_id gnl|my_center|LOCUS_25270 14810 15286 gene locus_tag LOCUS_25280 gene accB 14810 15286 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354626.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence096 739 155 gene locus_tag LOCUS_25290 739 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25290 2086 764 gene locus_tag LOCUS_25300 2086 764 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580275.1 protein_id gnl|my_center|LOCUS_25300 2739 2083 gene locus_tag LOCUS_25310 gene atoA 2739 2083 CDS product acetate CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339055.1 protein_id gnl|my_center|LOCUS_25310 3398 2742 gene locus_tag LOCUS_25320 gene atoD 3398 2742 CDS product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 protein_id gnl|my_center|LOCUS_25320 4979 3606 gene locus_tag LOCUS_25330 gene atoC 4979 3606 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 protein_id gnl|my_center|LOCUS_25330 6748 4976 gene locus_tag LOCUS_25340 gene atoS 6748 4976 CDS product two-component system sensor histidine kinase AtoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559125.1 protein_id gnl|my_center|LOCUS_25340 6994 9843 gene locus_tag LOCUS_25350 gene rcsC 6994 9843 CDS product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098008.1 protein_id gnl|my_center|LOCUS_25350 10527 9877 gene locus_tag LOCUS_25360 gene rcsB 10527 9877 CDS product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061910.1 protein_id gnl|my_center|LOCUS_25360 11128 10544 gene locus_tag LOCUS_25370 11128 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25370 13194 11116 gene locus_tag LOCUS_25380 gene rcsD 13194 11116 CDS product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619743.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25380 14021 15139 gene locus_tag LOCUS_25390 14021 15139 CDS product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865526.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence097 267 1214 gene locus_tag LOCUS_25400 gene gshB 267 1214 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593260.1 protein_id gnl|my_center|LOCUS_25400 1351 1914 gene locus_tag LOCUS_25410 1351 1914 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369734.1 protein_id gnl|my_center|LOCUS_25410 1914 2330 gene locus_tag LOCUS_25420 gene ruvX 1914 2330 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811925.1 protein_id gnl|my_center|LOCUS_25420 3318 2341 gene locus_tag LOCUS_25430 3318 2341 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001683272.1 protein_id gnl|my_center|LOCUS_25430 3426 4049 gene locus_tag LOCUS_25440 3426 4049 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098666.1 protein_id gnl|my_center|LOCUS_25440 4065 4631 gene locus_tag LOCUS_25450 4065 4631 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369729.1 protein_id gnl|my_center|LOCUS_25450 4628 4915 gene locus_tag LOCUS_25460 gene yggU 4628 4915 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369728.1 protein_id gnl|my_center|LOCUS_25460 4931 5524 gene locus_tag LOCUS_25470 4931 5524 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 protein_id gnl|my_center|LOCUS_25470 5517 6653 gene locus_tag LOCUS_25480 gene hemW 5517 6653 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098670.1 protein_id gnl|my_center|LOCUS_25480 7648 6725 gene locus_tag LOCUS_25490 7648 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25490 8403 7648 gene locus_tag LOCUS_25500 8403 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 7707 7722 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8410 8576 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9610 9176 gene locus_tag LOCUS_25510 gene secM 9610 9176 CDS product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704404.1 protein_id gnl|my_center|LOCUS_25510 10842 9925 gene locus_tag LOCUS_25520 gene lpxC 10842 9925 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095578.1 protein_id gnl|my_center|LOCUS_25520 12080 10944 gene locus_tag LOCUS_25530 gene ftsZ 12080 10944 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004857884.1 protein_id gnl|my_center|LOCUS_25530 12710 12141 gene locus_tag LOCUS_25540 12710 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25540 13380 12673 gene locus_tag LOCUS_25550 13380 12673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25550 14105 13377 gene locus_tag LOCUS_25560 gene ftsQ 14105 13377 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095577.1 protein_id gnl|my_center|LOCUS_25560 14766 14194 gene locus_tag LOCUS_25570 14766 14194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25570 15112 14735 gene locus_tag LOCUS_25580 15112 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25580 >Feature sequence098 1869 1279 gene locus_tag LOCUS_25590 1869 1279 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097014.1 protein_id gnl|my_center|LOCUS_25590 2304 1978 gene locus_tag LOCUS_25600 2304 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2370 2425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3346 2678 gene locus_tag LOCUS_25610 gene hxpB 3346 2678 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097012.1 protein_id gnl|my_center|LOCUS_25610 3607 4038 gene locus_tag LOCUS_25620 3607 4038 CDS product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097011.1 protein_id gnl|my_center|LOCUS_25620 4928 4068 gene locus_tag LOCUS_25630 4928 4068 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097010.1 protein_id gnl|my_center|LOCUS_25630 5325 5032 gene locus_tag LOCUS_25640 gene ghoS 5325 5032 CDS product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146149.1 protein_id gnl|my_center|LOCUS_25640 5561 5403 gene locus_tag LOCUS_25650 5561 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 5591 5751 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5905 6228 gene locus_tag LOCUS_25660 5905 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 6768 7409 gene locus_tag LOCUS_25670 6768 7409 CDS product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097007.1 protein_id gnl|my_center|LOCUS_25670 7906 9117 gene locus_tag LOCUS_25680 7906 9117 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198300234.1 protein_id gnl|my_center|LOCUS_25680 9311 9072 gene locus_tag LOCUS_25690 9311 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 9703 9356 gene locus_tag LOCUS_25700 9703 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 11103 9994 gene locus_tag LOCUS_25710 11103 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 13816 11114 gene locus_tag LOCUS_25720 13816 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 14327 13953 gene locus_tag LOCUS_25730 14327 13953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 14518 14336 gene locus_tag LOCUS_25740 14518 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence099 <1 796 gene locus_tag LOCUS_25750 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000822139.1:dTDP-glucose 4,6-dehydratase 814 1695 gene locus_tag LOCUS_25760 gene rfbA 814 1695 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676077.1 protein_id gnl|my_center|LOCUS_25760 2056 2352 gene locus_tag LOCUS_25770 2056 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25770 2357 3487 gene locus_tag LOCUS_25780 gene rffA 2357 3487 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 protein_id gnl|my_center|LOCUS_25780 3489 4739 gene locus_tag LOCUS_25790 gene wzxE 3489 4739 CDS product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050302.1 protein_id gnl|my_center|LOCUS_25790 4736 5812 gene locus_tag LOCUS_25800 4736 5812 CDS product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099271.1 protein_id gnl|my_center|LOCUS_25800 5809 7167 gene locus_tag LOCUS_25810 gene wzyE 5809 7167 CDS product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055119.1 protein_id gnl|my_center|LOCUS_25810 7176 7979 gene locus_tag LOCUS_25820 gene wecG 7176 7979 CDS product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064038.1 protein_id gnl|my_center|LOCUS_25820 8107 9492 gene locus_tag LOCUS_25830 8107 9492 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774741.1 protein_id gnl|my_center|LOCUS_25830 9616 9812 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11600 10506 gene locus_tag LOCUS_25840 gene hemY 11600 10506 CDS product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099267.1 protein_id gnl|my_center|LOCUS_25840 12787 11600 gene locus_tag LOCUS_25850 gene hemX 12787 11600 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139074.1 protein_id gnl|my_center|LOCUS_25850 13546 12809 gene locus_tag LOCUS_25860 gene hemD 13546 12809 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703978.1 protein_id gnl|my_center|LOCUS_25860 14481 13543 gene locus_tag LOCUS_25870 gene hemC 14481 13543 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001338644.1 protein_id gnl|my_center|LOCUS_25870 >Feature sequence100 1167 2294 gene locus_tag LOCUS_25880 1167 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25880 2470 2518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2535 3023 gene locus_tag LOCUS_25890 2535 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25890 3941 3033 gene locus_tag LOCUS_25900 gene yvcK 3941 3033 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097495.1 protein_id gnl|my_center|LOCUS_25900 4280 5269 gene locus_tag LOCUS_25910 gene moaA 4280 5269 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704804.1 protein_id gnl|my_center|LOCUS_25910 5291 5803 gene locus_tag LOCUS_25920 gene moaB 5291 5803 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084629.1 protein_id gnl|my_center|LOCUS_25920 5806 6285 gene locus_tag LOCUS_25930 gene moaC 5806 6285 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080893.1 protein_id gnl|my_center|LOCUS_25930 6285 6530 gene locus_tag LOCUS_25940 gene moaD 6285 6530 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598612.1 protein_id gnl|my_center|LOCUS_25940 6532 6984 gene locus_tag LOCUS_25950 gene moaE 6532 6984 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852296.1 protein_id gnl|my_center|LOCUS_25950 7047 7757 gene locus_tag LOCUS_25960 7047 7757 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428846.1 protein_id gnl|my_center|LOCUS_25960 8765 7731 gene locus_tag LOCUS_25970 8765 7731 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129824.1 protein_id gnl|my_center|LOCUS_25970 10007 8775 gene locus_tag LOCUS_25980 gene clsB 10007 8775 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650337.1 protein_id gnl|my_center|LOCUS_25980 10429 10004 gene locus_tag LOCUS_25990 10429 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25990 10760 10365 gene locus_tag LOCUS_26000 10760 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26000 10891 11307 gene locus_tag LOCUS_26010 10891 11307 CDS product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704808.1 protein_id gnl|my_center|LOCUS_26010 12375 11269 gene locus_tag LOCUS_26020 12375 11269 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469031.1 protein_id gnl|my_center|LOCUS_26020 13345 12386 gene locus_tag LOCUS_26030 13345 12386 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045765.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26030 13485 13351 gene locus_tag LOCUS_26040 13485 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26040 14585 13482 gene locus_tag LOCUS_26050 14585 13482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26050 14598 14630 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence101 472 149 gene locus_tag LOCUS_26060 472 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 2818 527 gene locus_tag LOCUS_26070 gene pflB 2818 527 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098876.1 protein_id gnl|my_center|LOCUS_26070 4068 2860 gene locus_tag LOCUS_26080 gene tdcD 4068 2860 CDS product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661584.1 protein_id gnl|my_center|LOCUS_26080 5457 4123 gene locus_tag LOCUS_26090 gene tdcC 5457 4123 CDS product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107720.1 protein_id gnl|my_center|LOCUS_26090 6474 5482 gene locus_tag LOCUS_26100 gene tdcB 6474 5482 CDS product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815409.1 protein_id gnl|my_center|LOCUS_26100 7005 8210 gene locus_tag LOCUS_26110 7005 8210 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154617.1 protein_id gnl|my_center|LOCUS_26110 8962 8291 gene locus_tag LOCUS_26120 8962 8291 CDS product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968968.1 protein_id gnl|my_center|LOCUS_26120 9197 9661 gene locus_tag LOCUS_26130 gene marR 9197 9661 CDS product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799375.1 protein_id gnl|my_center|LOCUS_26130 9679 10053 gene locus_tag LOCUS_26140 gene marA 9679 10053 CDS product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502237.1 protein_id gnl|my_center|LOCUS_26140 10095 10298 gene locus_tag LOCUS_26150 gene marB 10095 10298 CDS product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096628.1 protein_id gnl|my_center|LOCUS_26150 11084 10266 gene locus_tag LOCUS_26160 gene eamA 11084 10266 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096629.1 protein_id gnl|my_center|LOCUS_26160 11284 12042 gene locus_tag LOCUS_26170 11284 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 11912 11925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11981 12343 gene locus_tag LOCUS_26180 11981 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 12429 12638 gene locus_tag LOCUS_26190 12429 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 13077 12673 gene locus_tag LOCUS_26200 13077 12673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 13091 13128 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14072 13272 gene locus_tag LOCUS_26210 gene urtD 14072 13272 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096633.1 protein_id gnl|my_center|LOCUS_26210 14662 14069 gene locus_tag LOCUS_26220 14662 14069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 14669 14733 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence102 1338 829 gene locus_tag LOCUS_26230 1338 829 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099148.1 protein_id gnl|my_center|LOCUS_26230 2358 1381 gene locus_tag LOCUS_26240 2358 1381 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 protein_id gnl|my_center|LOCUS_26240 2813 2526 gene locus_tag LOCUS_26250 2813 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 2955 3620 gene locus_tag LOCUS_26260 2955 3620 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099151.1 protein_id gnl|my_center|LOCUS_26260 3692 4249 gene locus_tag LOCUS_26270 3692 4249 CDS product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099152.1 protein_id gnl|my_center|LOCUS_26270 4613 4311 gene locus_tag LOCUS_26280 4613 4311 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931180.1 protein_id gnl|my_center|LOCUS_26280 5937 4624 gene locus_tag LOCUS_26290 5937 4624 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733949.1 protein_id gnl|my_center|LOCUS_26290 7367 5949 gene locus_tag LOCUS_26300 7367 5949 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989440.1 protein_id gnl|my_center|LOCUS_26300 7699 7367 gene locus_tag LOCUS_26310 7699 7367 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261351.1 protein_id gnl|my_center|LOCUS_26310 7899 8810 gene locus_tag LOCUS_26320 7899 8810 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047372561.1 protein_id gnl|my_center|LOCUS_26320 8830 9804 gene locus_tag LOCUS_26330 8830 9804 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189263.1 protein_id gnl|my_center|LOCUS_26330 11072 9834 gene locus_tag LOCUS_26340 11072 9834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 protein_id gnl|my_center|LOCUS_26340 11161 12231 gene locus_tag LOCUS_26350 11161 12231 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297848.1 protein_id gnl|my_center|LOCUS_26350 12739 13128 gene locus_tag LOCUS_26360 12739 13128 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 protein_id gnl|my_center|LOCUS_26360 13197 14267 gene locus_tag LOCUS_26370 13197 14267 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 protein_id gnl|my_center|LOCUS_26370 14483 14636 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14658 14852 gene locus_tag LOCUS_26380 14658 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 >Feature sequence103 <1 1120 gene locus_tag LOCUS_26390 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003861487.1:NADH-quinone oxidoreductase subunit NuoF 1206 2660 gene locus_tag LOCUS_26400 1206 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26400 2667 3941 gene locus_tag LOCUS_26410 2667 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26410 3938 4915 gene locus_tag LOCUS_26420 gene nuoH 3938 4915 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365589.1 protein_id gnl|my_center|LOCUS_26420 4930 5472 gene locus_tag LOCUS_26430 gene nuoI 4930 5472 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861491.1 protein_id gnl|my_center|LOCUS_26430 5694 5733 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5871 6173 gene locus_tag LOCUS_26440 gene nuoK 5871 6173 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 protein_id gnl|my_center|LOCUS_26440 6170 6454 gene locus_tag LOCUS_26450 6170 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 6381 7892 gene locus_tag LOCUS_26460 gene nuoL 6381 7892 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832758.1 protein_id gnl|my_center|LOCUS_26460 8113 8266 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8277 8627 gene locus_tag LOCUS_26470 8277 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 8509 9156 gene locus_tag LOCUS_26480 8509 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 9163 10464 gene locus_tag LOCUS_26490 gene nuoN 9163 10464 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098101.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26490 10412 10582 gene locus_tag LOCUS_26500 10412 10582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26500 10715 12268 gene locus_tag LOCUS_26510 10715 12268 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244800.1 protein_id gnl|my_center|LOCUS_26510 12537 12304 gene locus_tag LOCUS_26520 12537 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 12995 12537 gene locus_tag LOCUS_26530 12995 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 12607 12648 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13061 13510 gene locus_tag LOCUS_26540 13061 13510 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574091.1 protein_id gnl|my_center|LOCUS_26540 13577 13888 gene locus_tag LOCUS_26550 gene elaB 13577 13888 CDS product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028061.1 protein_id gnl|my_center|LOCUS_26550 13932 14624 gene locus_tag LOCUS_26560 13932 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 14548 14570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence104 <1 1417 gene locus_tag LOCUS_26570 <1 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703899.1:DNA topoisomerase (ATP-hydrolyzing) subunit B note possible pseudo, frameshifted 1414 1596 gene locus_tag LOCUS_26580 1414 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26580 1744 2523 gene locus_tag LOCUS_26590 gene yidA 1744 2523 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985571.1 protein_id gnl|my_center|LOCUS_26590 2721 3431 gene locus_tag LOCUS_26600 gene dgoR 2721 3431 CDS product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369039.1 protein_id gnl|my_center|LOCUS_26600 3513 4661 gene locus_tag LOCUS_26610 gene dgoD 3513 4661 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094786.1 protein_id gnl|my_center|LOCUS_26610 4795 5070 gene locus_tag LOCUS_26620 4795 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 4994 5971 gene locus_tag LOCUS_26630 4994 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26630 6004 7263 gene locus_tag LOCUS_26640 6004 7263 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809957.1 protein_id gnl|my_center|LOCUS_26640 7580 7254 gene locus_tag LOCUS_26650 7580 7254 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369045.1 protein_id gnl|my_center|LOCUS_26650 7878 8291 gene locus_tag LOCUS_26660 gene ibpA 7878 8291 CDS product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 protein_id gnl|my_center|LOCUS_26660 8399 8827 gene locus_tag LOCUS_26670 gene ibpB 8399 8827 CDS product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094790.1 protein_id gnl|my_center|LOCUS_26670 8982 9305 gene locus_tag LOCUS_26680 8982 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26680 9290 10669 gene locus_tag LOCUS_26690 9290 10669 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279784.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26690 10786 11133 gene locus_tag LOCUS_26700 10786 11133 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703889.1 protein_id gnl|my_center|LOCUS_26700 11126 11464 gene locus_tag LOCUS_26710 11126 11464 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113457.1 protein_id gnl|my_center|LOCUS_26710 12072 11461 gene locus_tag LOCUS_26720 12072 11461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26720 12622 12017 gene locus_tag LOCUS_26730 12622 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26730 13414 12791 gene locus_tag LOCUS_26740 13414 12791 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705174.1 protein_id gnl|my_center|LOCUS_26740 14627 14683 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence105 627 1337 gene locus_tag LOCUS_26750 gene folP 627 1337 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764731.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26750 1330 2667 gene locus_tag LOCUS_26760 gene glmM 1330 2667 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071169.1 protein_id gnl|my_center|LOCUS_26760 3601 2702 gene locus_tag LOCUS_26770 3601 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26770 4170 3607 gene locus_tag LOCUS_26780 4170 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26780 5314 4181 gene locus_tag LOCUS_26790 gene iadA 5314 4181 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128783587.1 protein_id gnl|my_center|LOCUS_26790 5482 6384 gene locus_tag LOCUS_26800 5482 6384 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262090.1 protein_id gnl|my_center|LOCUS_26800 6546 6878 gene locus_tag LOCUS_26810 gene secG 6546 6878 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295556.1 protein_id gnl|my_center|LOCUS_26810 6923 7009 gene locus_tag LOCUS_t00210 6923 7009 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7069 7145 gene locus_tag LOCUS_t00220 7069 7145 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7328 7810 gene locus_tag LOCUS_26820 gene rimP 7328 7810 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524507.1 protein_id gnl|my_center|LOCUS_26820 7837 9324 gene locus_tag LOCUS_26830 gene nusA 7837 9324 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369524.1 protein_id gnl|my_center|LOCUS_26830 9349 12063 gene locus_tag LOCUS_26840 gene infB 9349 12063 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098916.1 protein_id gnl|my_center|LOCUS_26840 12131 12532 gene locus_tag LOCUS_26850 gene rbfA 12131 12532 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 protein_id gnl|my_center|LOCUS_26850 12532 13476 gene locus_tag LOCUS_26860 gene truB 12532 13476 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098915.1 protein_id gnl|my_center|LOCUS_26860 13562 13885 gene locus_tag LOCUS_26870 gene rpsO 13562 13885 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 protein_id gnl|my_center|LOCUS_26870 14131 14460 gene locus_tag LOCUS_26880 14131 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26880 >Feature sequence106 871 653 gene locus_tag LOCUS_26890 871 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 934 996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1539 1129 gene locus_tag LOCUS_26900 1539 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 3412 1526 gene locus_tag LOCUS_26910 3412 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 1548 1618 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4402 3650 gene locus_tag LOCUS_26920 4402 3650 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862621.1 protein_id gnl|my_center|LOCUS_26920 5156 4416 gene locus_tag LOCUS_26930 5156 4416 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_26930 6478 5168 gene locus_tag LOCUS_26940 6478 5168 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990033.1 protein_id gnl|my_center|LOCUS_26940 6761 6483 gene locus_tag LOCUS_26950 6761 6483 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723637.1 protein_id gnl|my_center|LOCUS_26950 7143 6790 gene locus_tag LOCUS_26960 7143 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 7871 7140 gene locus_tag LOCUS_26970 7871 7140 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990032.1 protein_id gnl|my_center|LOCUS_26970 8851 7880 gene locus_tag LOCUS_26980 8851 7880 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723635.1 protein_id gnl|my_center|LOCUS_26980 10547 9117 gene locus_tag LOCUS_26990 10547 9117 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815892.1 protein_id gnl|my_center|LOCUS_26990 11805 10696 gene locus_tag LOCUS_27000 11805 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27000 12176 13189 gene locus_tag LOCUS_27010 12176 13189 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815890.1 protein_id gnl|my_center|LOCUS_27010 14093 13224 gene locus_tag LOCUS_27020 14093 13224 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096380.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence107 558 803 gene locus_tag LOCUS_27030 gene ydcY 558 803 CDS product DUF2526 family protein YdcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018633.1 protein_id gnl|my_center|LOCUS_27030 1249 800 gene locus_tag LOCUS_27040 1249 800 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096484.1 protein_id gnl|my_center|LOCUS_27040 1764 1246 gene locus_tag LOCUS_27050 gene mddA 1764 1246 CDS product L-methionine sulfoximine/L-methionine sulfone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310799.1 protein_id gnl|my_center|LOCUS_27050 2003 1830 gene locus_tag LOCUS_27060 2003 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1921 2388 gene locus_tag LOCUS_27070 1921 2388 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366420.1 protein_id gnl|my_center|LOCUS_27070 2536 3204 gene locus_tag LOCUS_27080 2536 3204 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096488.1 protein_id gnl|my_center|LOCUS_27080 5566 3566 gene locus_tag LOCUS_27090 gene pqqU 5566 3566 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446029.1 protein_id gnl|my_center|LOCUS_27090 5917 6975 gene locus_tag LOCUS_27100 5917 6975 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550626.1 protein_id gnl|my_center|LOCUS_27100 8123 6990 gene locus_tag LOCUS_27110 8123 6990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531199.1 protein_id gnl|my_center|LOCUS_27110 9344 8244 gene locus_tag LOCUS_27120 9344 8244 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456065.1 protein_id gnl|my_center|LOCUS_27120 10521 9475 gene locus_tag LOCUS_27130 10521 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 12155 10662 gene locus_tag LOCUS_27140 gene ansP 12155 10662 CDS product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684770.1 protein_id gnl|my_center|LOCUS_27140 12417 13034 gene locus_tag LOCUS_27150 12417 13034 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096501.1 protein_id gnl|my_center|LOCUS_27150 13077 13301 gene locus_tag LOCUS_27160 gene pptA 13077 13301 CDS product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096502.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence108 1851 1090 gene locus_tag LOCUS_27170 1851 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27170 2932 1853 gene locus_tag LOCUS_27180 2932 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27180 4380 2929 gene locus_tag LOCUS_27190 gene selA 4380 2929 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206268.1 protein_id gnl|my_center|LOCUS_27190 4998 4390 gene locus_tag LOCUS_27200 4998 4390 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766681.1 protein_id gnl|my_center|LOCUS_27200 5348 5097 gene locus_tag LOCUS_27210 5348 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27210 6163 5345 gene locus_tag LOCUS_27220 6163 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27220 6501 6166 gene locus_tag LOCUS_27230 6501 6166 CDS product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478200.1 protein_id gnl|my_center|LOCUS_27230 7140 9044 gene locus_tag LOCUS_27240 7140 9044 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094933.1 protein_id gnl|my_center|LOCUS_27240 9150 10100 gene locus_tag LOCUS_27250 gene mtlD 9150 10100 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645424.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27250 10087 10281 gene locus_tag LOCUS_27260 10087 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27260 10341 10868 gene locus_tag LOCUS_27270 gene mtlR 10341 10868 CDS product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094931.1 protein_id gnl|my_center|LOCUS_27270 10925 11287 gene locus_tag LOCUS_27280 10925 11287 CDS product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665687.1 protein_id gnl|my_center|LOCUS_27280 11626 13281 gene locus_tag LOCUS_27290 gene lldP 11626 13281 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055299.1 protein_id gnl|my_center|LOCUS_27290 13278 14060 gene locus_tag LOCUS_27300 gene lldR 13278 14060 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369184.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence109 110 886 gene locus_tag LOCUS_27310 110 886 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095486.1 protein_id gnl|my_center|LOCUS_27310 1378 881 gene locus_tag LOCUS_27320 1378 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27320 1679 1431 gene locus_tag LOCUS_27330 1679 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27330 3249 1699 gene locus_tag LOCUS_27340 3249 1699 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 protein_id gnl|my_center|LOCUS_27340 3515 4294 gene locus_tag LOCUS_27350 gene deoC 3515 4294 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031624265.1 protein_id gnl|my_center|LOCUS_27350 4351 5673 gene locus_tag LOCUS_27360 gene deoA 4351 5673 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477838.1 protein_id gnl|my_center|LOCUS_27360 5773 6996 gene locus_tag LOCUS_27370 gene deoB 5773 6996 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095491.1 protein_id gnl|my_center|LOCUS_27370 7050 7769 gene locus_tag LOCUS_27380 gene deoD 7050 7769 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887789.1 protein_id gnl|my_center|LOCUS_27380 7997 9037 gene locus_tag LOCUS_27390 gene kch 7997 9037 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807739.1 protein_id gnl|my_center|LOCUS_27390 8880 8906 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9241 9065 gene locus_tag LOCUS_27400 9241 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27400 10058 9228 gene locus_tag LOCUS_27410 gene lplA 10058 9228 CDS product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209755.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27410 10724 10083 gene locus_tag LOCUS_27420 10724 10083 CDS product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124615.1 protein_id gnl|my_center|LOCUS_27420 10830 11801 gene locus_tag LOCUS_27430 gene serB 10830 11801 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095495.1 protein_id gnl|my_center|LOCUS_27430 11814 12470 gene locus_tag LOCUS_27440 11814 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 12430 12461 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12482 13048 gene locus_tag LOCUS_27450 12482 13048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence110 196 375 gene locus_tag LOCUS_27460 196 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27460 412 987 gene locus_tag LOCUS_27470 gene yeaY 412 987 CDS product Slp family lipoprotein YeaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290576.1 protein_id gnl|my_center|LOCUS_27470 1192 2877 gene locus_tag LOCUS_27480 gene fadD 1192 2877 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705923.1 protein_id gnl|my_center|LOCUS_27480 2946 4067 gene locus_tag LOCUS_27490 gene rnd 2946 4067 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162182289.1 protein_id gnl|my_center|LOCUS_27490 4438 4172 gene locus_tag LOCUS_27500 gene minE 4438 4172 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185665.1 protein_id gnl|my_center|LOCUS_27500 5254 4442 gene locus_tag LOCUS_27510 gene minD 5254 4442 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101055.1 protein_id gnl|my_center|LOCUS_27510 5971 5279 gene locus_tag LOCUS_27520 gene minC 5971 5279 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366055.1 protein_id gnl|my_center|LOCUS_27520 6098 6373 gene locus_tag LOCUS_27530 6098 6373 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295992.1 protein_id gnl|my_center|LOCUS_27530 6449 7522 gene locus_tag LOCUS_27540 6449 7522 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298239.1 protein_id gnl|my_center|LOCUS_27540 7551 8210 gene locus_tag LOCUS_27550 7551 8210 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366057.1 protein_id gnl|my_center|LOCUS_27550 8302 8559 gene locus_tag LOCUS_27560 8302 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27560 8898 9134 gene locus_tag LOCUS_27570 8898 9134 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296778.1 protein_id gnl|my_center|LOCUS_27570 9295 9468 gene locus_tag LOCUS_27580 9295 9468 CDS product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096478.1 protein_id gnl|my_center|LOCUS_27580 10064 9525 gene locus_tag LOCUS_27590 gene dsbB 10064 9525 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028084.1 protein_id gnl|my_center|LOCUS_27590 10460 10221 gene locus_tag LOCUS_27600 10460 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 11500 10385 gene locus_tag LOCUS_27610 11500 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 11717 12436 gene locus_tag LOCUS_27620 gene fadR 11717 12436 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234823.1 protein_id gnl|my_center|LOCUS_27620 13193 12681 gene locus_tag LOCUS_27630 13193 12681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 13585 13355 gene locus_tag LOCUS_27640 13585 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27640 >Feature sequence111 763 494 gene locus_tag LOCUS_27650 763 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27650 1487 828 gene locus_tag LOCUS_27660 1487 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27660 842 875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2581 1484 gene locus_tag LOCUS_27670 2581 1484 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501583.1 protein_id gnl|my_center|LOCUS_27670 4396 2591 gene locus_tag LOCUS_27680 4396 2591 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561746.1 protein_id gnl|my_center|LOCUS_27680 4880 4599 gene locus_tag LOCUS_27690 4880 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27690 4915 5063 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6671 6102 gene locus_tag LOCUS_27700 gene mepS 6671 6102 CDS product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241015.1 protein_id gnl|my_center|LOCUS_27700 6773 6964 gene locus_tag LOCUS_27710 6773 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 7800 7087 gene locus_tag LOCUS_27720 7800 7087 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136374357.1 protein_id gnl|my_center|LOCUS_27720 8824 7847 gene locus_tag LOCUS_27730 8824 7847 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097980.1 protein_id gnl|my_center|LOCUS_27730 10411 8945 gene locus_tag LOCUS_27740 10411 8945 CDS product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706121.1 protein_id gnl|my_center|LOCUS_27740 11232 10660 gene locus_tag LOCUS_27750 gene yeiP 11232 10660 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136827.1 protein_id gnl|my_center|LOCUS_27750 11388 11642 gene locus_tag LOCUS_27760 11388 11642 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365691.1 protein_id gnl|my_center|LOCUS_27760 12820 11639 gene locus_tag LOCUS_27770 gene setB 12820 11639 CDS product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097970.1 protein_id gnl|my_center|LOCUS_27770 13171 13776 gene locus_tag LOCUS_27780 13171 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27780 >Feature sequence112 1592 75 gene locus_tag LOCUS_27790 gene lysS 1592 75 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003071.1 protein_id gnl|my_center|LOCUS_27790 2261 1602 gene locus_tag LOCUS_27800 2261 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27800 2442 2230 gene locus_tag LOCUS_27810 2442 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27810 4465 2801 gene locus_tag LOCUS_27820 gene recJ 4465 2801 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813190.1 protein_id gnl|my_center|LOCUS_27820 5194 4517 gene locus_tag LOCUS_27830 gene dsbC 5194 4517 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745614.1 protein_id gnl|my_center|LOCUS_27830 6182 5220 gene locus_tag LOCUS_27840 gene xerD 6182 5220 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434302.1 protein_id gnl|my_center|LOCUS_27840 6221 6742 gene locus_tag LOCUS_27850 gene fldB 6221 6742 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369793.1 protein_id gnl|my_center|LOCUS_27850 7166 6747 gene locus_tag LOCUS_27860 7166 6747 CDS product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369792.1 protein_id gnl|my_center|LOCUS_27860 7413 7147 gene locus_tag LOCUS_27870 gene sdhE 7413 7147 CDS product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 protein_id gnl|my_center|LOCUS_27870 7654 8667 gene locus_tag LOCUS_27880 gene ygfZ 7654 8667 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886049.1 protein_id gnl|my_center|LOCUS_27880 9361 8702 gene locus_tag LOCUS_27890 9361 8702 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863433.1 protein_id gnl|my_center|LOCUS_27890 9802 9491 gene locus_tag LOCUS_27900 gene yqfB 9802 9491 CDS product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182957.1 protein_id gnl|my_center|LOCUS_27900 9916 10653 gene locus_tag LOCUS_27910 9916 10653 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098618.1 protein_id gnl|my_center|LOCUS_27910 10777 12213 gene locus_tag LOCUS_27920 10777 12213 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098619.1 protein_id gnl|my_center|LOCUS_27920 12297 13286 gene locus_tag LOCUS_27930 12297 13286 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027737.1 protein_id gnl|my_center|LOCUS_27930 13428 13718 gene locus_tag LOCUS_27940 gene rpsF 13428 13718 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002942403.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence113 3300 2104 gene locus_tag LOCUS_27950 gene ackA 3300 2104 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095689.1 protein_id gnl|my_center|LOCUS_27950 3709 4086 gene locus_tag LOCUS_27960 gene yfbV 3709 4086 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098114.1 protein_id gnl|my_center|LOCUS_27960 4159 4653 gene locus_tag LOCUS_27970 4159 4653 CDS product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426135.1 protein_id gnl|my_center|LOCUS_27970 4666 5091 gene locus_tag LOCUS_27980 4666 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 5342 7186 gene locus_tag LOCUS_27990 5342 7186 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098111.1 protein_id gnl|my_center|LOCUS_27990 7774 7175 gene locus_tag LOCUS_28000 gene yfbR 7774 7175 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706162.1 protein_id gnl|my_center|LOCUS_28000 9067 7853 gene locus_tag LOCUS_28010 gene alaA 9067 7853 CDS product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098109.1 protein_id gnl|my_center|LOCUS_28010 10186 10971 gene locus_tag LOCUS_28020 gene lrhA 10186 10971 CDS product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881734.1 protein_id gnl|my_center|LOCUS_28020 11585 12031 gene locus_tag LOCUS_28030 gene nuoA 11585 12031 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913181.1 protein_id gnl|my_center|LOCUS_28030 12061 12131 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12638 13477 gene locus_tag LOCUS_28040 12638 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28040 >Feature sequence114 505 65 gene locus_tag LOCUS_28050 505 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 960 427 gene locus_tag LOCUS_28060 960 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28060 2550 1141 gene locus_tag LOCUS_28070 2550 1141 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973343.1 protein_id gnl|my_center|LOCUS_28070 4112 2754 gene locus_tag LOCUS_28080 gene gudP 4112 2754 CDS product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098524.1 protein_id gnl|my_center|LOCUS_28080 4405 4184 gene locus_tag LOCUS_28090 4405 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 4929 4369 gene locus_tag LOCUS_28100 4929 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 5710 4922 gene locus_tag LOCUS_28110 5710 4922 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28110 7147 5843 gene locus_tag LOCUS_28120 7147 5843 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895440.1 protein_id gnl|my_center|LOCUS_28120 8909 7197 gene locus_tag LOCUS_28130 8909 7197 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726981.1 protein_id gnl|my_center|LOCUS_28130 9187 9900 gene locus_tag LOCUS_28140 9187 9900 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 protein_id gnl|my_center|LOCUS_28140 10824 9943 gene locus_tag LOCUS_28150 gene gap 10824 9943 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096168.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28150 10960 10781 gene locus_tag LOCUS_28160 10960 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28160 12023 11103 gene locus_tag LOCUS_28170 12023 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28170 12608 13039 gene locus_tag LOCUS_28180 12608 13039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 13050 13352 gene locus_tag LOCUS_28190 13050 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence115 1381 119 gene locus_tag LOCUS_28200 gene wecC 1381 119 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006621.1 protein_id gnl|my_center|LOCUS_28200 2508 1378 gene locus_tag LOCUS_28210 gene wecB 2508 1378 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866686.1 protein_id gnl|my_center|LOCUS_28210 3613 2564 gene locus_tag LOCUS_28220 gene wzzE 3613 2564 CDS product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193415.1 protein_id gnl|my_center|LOCUS_28220 4727 3624 gene locus_tag LOCUS_28230 gene wecA 4727 3624 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050971.1 protein_id gnl|my_center|LOCUS_28230 6187 4976 gene locus_tag LOCUS_28240 gene rho 6187 4976 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883293.1 protein_id gnl|my_center|LOCUS_28240 6869 6540 gene locus_tag LOCUS_28250 gene trxA 6869 6540 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 protein_id gnl|my_center|LOCUS_28250 6988 7896 gene locus_tag LOCUS_28260 6988 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28260 7944 8231 gene locus_tag LOCUS_28270 7944 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28270 8237 9694 gene locus_tag LOCUS_28280 gene gppA 8237 9694 CDS product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099280.1 protein_id gnl|my_center|LOCUS_28280 11736 9760 gene locus_tag LOCUS_28290 gene rep 11736 9760 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099281.1 protein_id gnl|my_center|LOCUS_28290 11858 12139 gene locus_tag LOCUS_28300 gene ppiC 11858 12139 CDS product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368892.1 protein_id gnl|my_center|LOCUS_28300 12187 12468 gene locus_tag LOCUS_28310 gene ppiC 12187 12468 CDS product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096806.1 protein_id gnl|my_center|LOCUS_28310 13337 12516 gene locus_tag LOCUS_28320 13337 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28320 >Feature sequence116 924 445 gene locus_tag LOCUS_28330 gene gmm 924 445 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393539.1 protein_id gnl|my_center|LOCUS_28330 1892 927 gene locus_tag LOCUS_28340 1892 927 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 protein_id gnl|my_center|LOCUS_28340 3016 1895 gene locus_tag LOCUS_28350 gene gmd 3016 1895 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863514.1 protein_id gnl|my_center|LOCUS_28350 3608 3051 gene locus_tag LOCUS_28360 gene wcaF 3608 3051 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_28360 4471 3719 gene locus_tag LOCUS_28370 gene wcaE 4471 3719 CDS product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097876.1 protein_id gnl|my_center|LOCUS_28370 5703 4474 gene locus_tag LOCUS_28380 gene wcaD 5703 4474 CDS product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097877.1 protein_id gnl|my_center|LOCUS_28380 6160 5678 gene locus_tag LOCUS_28390 6160 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28390 6151 6579 gene locus_tag LOCUS_28400 6151 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 6847 6704 gene locus_tag LOCUS_28410 6847 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28410 7308 6844 gene locus_tag LOCUS_28420 gene wcaB 7308 6844 CDS product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097879.1 protein_id gnl|my_center|LOCUS_28420 8066 7308 gene locus_tag LOCUS_28430 gene wcaA 8066 7308 CDS product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097880.1 protein_id gnl|my_center|LOCUS_28430 7611 7680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10293 8134 gene locus_tag LOCUS_28440 gene wzc 10293 8134 CDS product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137223.1 protein_id gnl|my_center|LOCUS_28440 11783 10296 gene locus_tag LOCUS_28450 11783 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 >Feature sequence117 1170 1397 gene locus_tag LOCUS_28460 1170 1397 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750393.1 protein_id gnl|my_center|LOCUS_28460 1755 2672 gene locus_tag LOCUS_28470 gene gcvA 1755 2672 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 protein_id gnl|my_center|LOCUS_28470 2734 3114 gene locus_tag LOCUS_28480 2734 3114 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862756.1 protein_id gnl|my_center|LOCUS_28480 3101 4306 gene locus_tag LOCUS_28490 gene rlmM 3101 4306 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098534.1 protein_id gnl|my_center|LOCUS_28490 4181 4244 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4450 4701 gene locus_tag LOCUS_28500 4450 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 6300 4933 gene locus_tag LOCUS_28510 gene sdaA 6300 4933 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 protein_id gnl|my_center|LOCUS_28510 6266 6430 gene locus_tag LOCUS_28520 6266 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 7021 6512 gene locus_tag LOCUS_28530 7021 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 8215 7031 gene locus_tag LOCUS_28540 gene pabB 8215 7031 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855029.1 protein_id gnl|my_center|LOCUS_28540 8312 8491 gene locus_tag LOCUS_28550 8312 8491 CDS product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500497.1 protein_id gnl|my_center|LOCUS_28550 8989 8561 gene locus_tag LOCUS_28560 8989 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 9266 10996 gene locus_tag LOCUS_28570 9266 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 11398 11054 gene locus_tag LOCUS_28580 11398 11054 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096138.1 protein_id gnl|my_center|LOCUS_28580 11411 13024 gene locus_tag LOCUS_28590 11411 13024 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096139.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28590 11435 11469 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12952 13203 gene locus_tag LOCUS_28600 12952 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28600 >Feature sequence118 203 796 gene locus_tag LOCUS_28610 203 796 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112218.1 protein_id gnl|my_center|LOCUS_28610 1156 1301 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2097 2170 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2178 3047 gene locus_tag LOCUS_28620 2178 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28620 3167 3703 gene locus_tag LOCUS_28630 gene cybB 3167 3703 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306523.1 protein_id gnl|my_center|LOCUS_28630 4146 5294 gene locus_tag LOCUS_28640 4146 5294 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815933.1 protein_id gnl|my_center|LOCUS_28640 5350 5646 gene locus_tag LOCUS_28650 5350 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 7289 5838 gene locus_tag LOCUS_28660 gene uxaB 7289 5838 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854618.1 protein_id gnl|my_center|LOCUS_28660 8514 7471 gene locus_tag LOCUS_28670 8514 7471 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096607.1 protein_id gnl|my_center|LOCUS_28670 9359 8652 gene locus_tag LOCUS_28680 9359 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28680 10096 9251 gene locus_tag LOCUS_28690 10096 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28690 11064 10195 gene locus_tag LOCUS_28700 gene glsB 11064 10195 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257423.1 protein_id gnl|my_center|LOCUS_28700 12680 11091 gene locus_tag LOCUS_28710 12680 11091 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096611.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence119 19 609 gene locus_tag LOCUS_28720 19 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 1570 596 gene locus_tag LOCUS_28730 gene uvsE 1570 596 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605880.1 protein_id gnl|my_center|LOCUS_28730 3118 1682 gene locus_tag LOCUS_28740 3118 1682 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095421.1 protein_id gnl|my_center|LOCUS_28740 3294 3455 gene locus_tag LOCUS_28750 3294 3455 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095422.1 protein_id gnl|my_center|LOCUS_28750 3604 4773 gene locus_tag LOCUS_28760 3604 4773 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098822.1 protein_id gnl|my_center|LOCUS_28760 4953 4878 gene locus_tag LOCUS_t00230 4953 4878 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6008 5109 gene locus_tag LOCUS_28770 6008 5109 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210024.1 protein_id gnl|my_center|LOCUS_28770 7135 6005 gene locus_tag LOCUS_28780 7135 6005 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210025.1 protein_id gnl|my_center|LOCUS_28780 8567 7185 gene locus_tag LOCUS_28790 8567 7185 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 protein_id gnl|my_center|LOCUS_28790 9184 8684 gene locus_tag LOCUS_28800 gene rbsD 9184 8684 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210027.1 protein_id gnl|my_center|LOCUS_28800 10125 9214 gene locus_tag LOCUS_28810 10125 9214 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210028.1 protein_id gnl|my_center|LOCUS_28810 10899 10198 gene locus_tag LOCUS_28820 gene deoC 10899 10198 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210030.1 protein_id gnl|my_center|LOCUS_28820 11131 12018 gene locus_tag LOCUS_28830 11131 12018 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210026.1 protein_id gnl|my_center|LOCUS_28830 <13138 12035 gene locus_tag LOCUS_28840 <13138 12035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095746.1:glutamate-5-semialdehyde dehydrogenase >Feature sequence120 1444 293 gene locus_tag LOCUS_28850 1444 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28850 420 439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1991 2968 gene locus_tag LOCUS_28860 gene rluC 1991 2968 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705035.1 protein_id gnl|my_center|LOCUS_28860 3579 3031 gene locus_tag LOCUS_28870 3579 3031 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028074.1 protein_id gnl|my_center|LOCUS_28870 3720 4241 gene locus_tag LOCUS_28880 gene yceD 3720 4241 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174481.1 protein_id gnl|my_center|LOCUS_28880 4292 4465 gene locus_tag LOCUS_28890 gene rpmF 4292 4465 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290727.1 protein_id gnl|my_center|LOCUS_28890 4539 5636 gene locus_tag LOCUS_28900 gene plsX 4539 5636 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197585.1 protein_id gnl|my_center|LOCUS_28900 5643 6425 gene locus_tag LOCUS_28910 gene fabH 5643 6425 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288132.1 protein_id gnl|my_center|LOCUS_28910 6503 6964 gene locus_tag LOCUS_28920 6503 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28920 7028 7372 gene locus_tag LOCUS_28930 7028 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28930 7386 8120 gene locus_tag LOCUS_28940 gene fabG 7386 8120 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008535.1 protein_id gnl|my_center|LOCUS_28940 8396 8542 gene locus_tag LOCUS_28950 8396 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 8651 9892 gene locus_tag LOCUS_28960 gene fabF 8651 9892 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705037.1 protein_id gnl|my_center|LOCUS_28960 9998 10804 gene locus_tag LOCUS_28970 gene pabC 9998 10804 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705038.1 protein_id gnl|my_center|LOCUS_28970 10818 11843 gene locus_tag LOCUS_28980 gene yceG 10818 11843 CDS product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097117.1 protein_id gnl|my_center|LOCUS_28980 11821 12456 gene locus_tag LOCUS_28990 gene tmk 11821 12456 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256997.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence121 532 164 gene locus_tag LOCUS_29000 532 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29000 171 175 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 720 1436 gene locus_tag LOCUS_29010 720 1436 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097539.1 protein_id gnl|my_center|LOCUS_29010 2391 1525 gene locus_tag LOCUS_29020 gene sucD 2391 1525 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501094.1 protein_id gnl|my_center|LOCUS_29020 3557 2391 gene locus_tag LOCUS_29030 gene sucC 3557 2391 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367670.1 protein_id gnl|my_center|LOCUS_29030 4902 3667 gene locus_tag LOCUS_29040 gene odhB 4902 3667 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099820.1 protein_id gnl|my_center|LOCUS_29040 7628 4917 gene locus_tag LOCUS_29050 gene sucA 7628 4917 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622290.1 protein_id gnl|my_center|LOCUS_29050 5541 5549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8566 7850 gene locus_tag LOCUS_29060 gene sdhB 8566 7850 CDS product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501090.1 protein_id gnl|my_center|LOCUS_29060 9284 8583 gene locus_tag LOCUS_29070 9284 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29070 9298 9315 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10140 9397 gene locus_tag LOCUS_29080 10140 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29080 10544 10197 gene locus_tag LOCUS_29090 gene sdhD 10544 10197 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501088.1 protein_id gnl|my_center|LOCUS_29090 10942 10538 gene locus_tag LOCUS_29100 gene sdhC 10942 10538 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684965.1 protein_id gnl|my_center|LOCUS_29100 11582 12868 gene locus_tag LOCUS_29110 gene gltA 11582 12868 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785834.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence122 302 369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 567 1367 gene locus_tag LOCUS_29120 gene manY 567 1367 CDS product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859914.1 protein_id gnl|my_center|LOCUS_29120 1371 2240 gene locus_tag LOCUS_29130 1371 2240 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175979.1 protein_id gnl|my_center|LOCUS_29130 2304 2762 gene locus_tag LOCUS_29140 2304 2762 CDS product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096131.1 protein_id gnl|my_center|LOCUS_29140 3146 3709 gene locus_tag LOCUS_29150 gene mntP 3146 3709 CDS product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518359.1 protein_id gnl|my_center|LOCUS_29150 4518 3706 gene locus_tag LOCUS_29160 gene rlmA 4518 3706 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_29160 4863 4654 gene locus_tag LOCUS_29170 gene cspE 4863 4654 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 protein_id gnl|my_center|LOCUS_29170 5941 5654 gene locus_tag LOCUS_29180 5941 5654 CDS product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000660.1 protein_id gnl|my_center|LOCUS_29180 6163 6014 gene locus_tag LOCUS_29190 6163 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 6314 6550 gene locus_tag LOCUS_29200 6314 6550 CDS product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705933.1 protein_id gnl|my_center|LOCUS_29200 7372 6581 gene locus_tag LOCUS_29210 gene kdgR 7372 6581 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262203.1 protein_id gnl|my_center|LOCUS_29210 7569 7772 gene locus_tag LOCUS_29220 7569 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 7806 9536 gene locus_tag LOCUS_29230 7806 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 10153 10689 gene locus_tag LOCUS_29240 10153 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 10779 11063 gene locus_tag LOCUS_29250 10779 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 11082 11270 gene locus_tag LOCUS_29260 11082 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 11267 11707 gene locus_tag LOCUS_29270 11267 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 12261 12872 gene locus_tag LOCUS_29280 12261 12872 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103083.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence123 301 26 gene locus_tag LOCUS_29290 301 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1240 485 gene locus_tag LOCUS_29300 1240 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582232.1 protein_id gnl|my_center|LOCUS_29300 1725 1237 gene locus_tag LOCUS_29310 1725 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 2252 1716 gene locus_tag LOCUS_29320 gene yfdR 2252 1716 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001603282.1 protein_id gnl|my_center|LOCUS_29320 3274 2345 gene locus_tag LOCUS_29330 gene rdgC 3274 2345 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368016.1 protein_id gnl|my_center|LOCUS_29330 3614 3865 gene locus_tag LOCUS_29340 3614 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 4472 4263 gene locus_tag LOCUS_29350 4472 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29350 4896 4462 gene locus_tag LOCUS_29360 4896 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29360 5014 5238 gene locus_tag LOCUS_29370 5014 5238 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067727.1 protein_id gnl|my_center|LOCUS_29370 5267 5818 gene locus_tag LOCUS_29380 gene ymfL 5267 5818 CDS product protein YmfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515848.1 protein_id gnl|my_center|LOCUS_29380 5994 6113 gene locus_tag LOCUS_29390 5994 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 6166 7038 gene locus_tag LOCUS_29400 6166 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 7035 7478 gene locus_tag LOCUS_29410 7035 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 7478 8671 gene locus_tag LOCUS_29420 7478 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 8665 8985 gene locus_tag LOCUS_29430 8665 8985 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210143.1 protein_id gnl|my_center|LOCUS_29430 8982 9380 gene locus_tag LOCUS_29440 8982 9380 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767110.1 protein_id gnl|my_center|LOCUS_29440 9708 10259 gene locus_tag LOCUS_29450 9708 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29450 10288 11256 gene locus_tag LOCUS_29460 10288 11256 CDS product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360050.1 protein_id gnl|my_center|LOCUS_29460 11274 12104 gene locus_tag LOCUS_29470 11274 12104 CDS product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705710.1 protein_id gnl|my_center|LOCUS_29470 >Feature sequence124 447 1115 gene locus_tag LOCUS_29480 447 1115 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096700.1 protein_id gnl|my_center|LOCUS_29480 1474 2946 gene locus_tag LOCUS_29490 gene proP 1474 2946 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919708.1 protein_id gnl|my_center|LOCUS_29490 3037 3567 gene locus_tag LOCUS_29500 gene cybB 3037 3567 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096695.1 protein_id gnl|my_center|LOCUS_29500 3666 4016 gene locus_tag LOCUS_29510 gene yeaR 3666 4016 CDS product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248993.1 protein_id gnl|my_center|LOCUS_29510 4027 4209 gene locus_tag LOCUS_29520 4027 4209 CDS product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513737.1 protein_id gnl|my_center|LOCUS_29520 4341 4553 gene locus_tag LOCUS_29530 4341 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 5726 5571 gene locus_tag LOCUS_29540 5726 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 5888 6484 gene locus_tag LOCUS_29550 5888 6484 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104860.1 protein_id gnl|my_center|LOCUS_29550 6665 7246 gene locus_tag LOCUS_29560 6665 7246 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039271.1 protein_id gnl|my_center|LOCUS_29560 7752 7387 gene locus_tag LOCUS_29570 7752 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 7960 8235 gene locus_tag LOCUS_29580 7960 8235 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 protein_id gnl|my_center|LOCUS_29580 8268 9218 gene locus_tag LOCUS_29590 8268 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 10140 9259 gene locus_tag LOCUS_29600 gene htpX 10140 9259 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984498.1 protein_id gnl|my_center|LOCUS_29600 <12679 10332 gene locus_tag LOCUS_29610 <12679 10332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096119.1:carboxy terminal-processing peptidase 12231 12282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence125 <1 511 gene locus_tag LOCUS_29620 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000887629.1:alkyl hydroperoxide reductase subunit F 1006 578 gene locus_tag LOCUS_29630 gene uspG 1006 578 CDS product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097606.1 protein_id gnl|my_center|LOCUS_29630 1264 2502 gene locus_tag LOCUS_29640 1264 2502 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646173.1 protein_id gnl|my_center|LOCUS_29640 2960 3493 gene locus_tag LOCUS_29650 2960 3493 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163272.1 protein_id gnl|my_center|LOCUS_29650 3562 3945 gene locus_tag LOCUS_29660 3562 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 4166 5494 gene locus_tag LOCUS_29670 4166 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29670 5442 6044 gene locus_tag LOCUS_29680 5442 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29680 6037 6669 gene locus_tag LOCUS_29690 6037 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29690 6688 7437 gene locus_tag LOCUS_29700 6688 7437 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018304.1 protein_id gnl|my_center|LOCUS_29700 7461 8033 gene locus_tag LOCUS_29710 7461 8033 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095779.1 protein_id gnl|my_center|LOCUS_29710 8062 8421 gene locus_tag LOCUS_29720 8062 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 8538 8945 gene locus_tag LOCUS_29730 8538 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 8989 9402 gene locus_tag LOCUS_29740 8989 9402 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208091882.1 protein_id gnl|my_center|LOCUS_29740 9411 9938 gene locus_tag LOCUS_29750 9411 9938 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725949.1 protein_id gnl|my_center|LOCUS_29750 10142 11677 gene locus_tag LOCUS_29760 gene waaL-xs 10142 11677 CDS product O-antigen ligase-like protein WaaL-xs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815615.1 protein_id gnl|my_center|LOCUS_29760 12120 11710 gene locus_tag LOCUS_29770 gene rnk 12120 11710 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097604.1 protein_id gnl|my_center|LOCUS_29770 >Feature sequence126 151 279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 501 1445 gene locus_tag LOCUS_29780 501 1445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251315.1 protein_id gnl|my_center|LOCUS_29780 1435 2241 gene locus_tag LOCUS_29790 1435 2241 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096476.1 protein_id gnl|my_center|LOCUS_29790 2266 3690 gene locus_tag LOCUS_29800 gene patD 2266 3690 CDS product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096477.1 protein_id gnl|my_center|LOCUS_29800 4411 4596 gene locus_tag LOCUS_29810 4411 4596 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071524879.1 protein_id gnl|my_center|LOCUS_29810 5441 4680 gene locus_tag LOCUS_29820 5441 4680 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096615.1 protein_id gnl|my_center|LOCUS_29820 5973 5443 gene locus_tag LOCUS_29830 5973 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29830 6429 5986 gene locus_tag LOCUS_29840 6429 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29840 7684 6422 gene locus_tag LOCUS_29850 7684 6422 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410744.1 protein_id gnl|my_center|LOCUS_29850 7864 8829 gene locus_tag LOCUS_29860 7864 8829 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096618.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29860 8951 9835 gene locus_tag LOCUS_29870 8951 9835 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096619.1 protein_id gnl|my_center|LOCUS_29870 9912 10985 gene locus_tag LOCUS_29880 9912 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29880 10973 11314 gene locus_tag LOCUS_29890 10973 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29890 11316 11867 gene locus_tag LOCUS_29900 11316 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29900 11882 12409 gene locus_tag LOCUS_29910 11882 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29910 >Feature sequence127 1016 354 gene locus_tag LOCUS_29920 1016 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 1294 1355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2425 1376 gene locus_tag LOCUS_29930 2425 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 2837 2472 gene locus_tag LOCUS_29940 2837 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 3080 2916 gene locus_tag LOCUS_29950 3080 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29950 3499 3029 gene locus_tag LOCUS_29960 3499 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29960 3855 3502 gene locus_tag LOCUS_29970 3855 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211716.1 protein_id gnl|my_center|LOCUS_29970 3994 3857 gene locus_tag LOCUS_29980 3994 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 4338 3997 gene locus_tag LOCUS_29990 4338 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29990 5750 4341 gene locus_tag LOCUS_30000 5750 4341 CDS product P22 phage major capsid protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705696.1 protein_id gnl|my_center|LOCUS_30000 6558 5767 gene locus_tag LOCUS_30010 6558 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705697.1 protein_id gnl|my_center|LOCUS_30010 7129 6644 gene locus_tag LOCUS_30020 7129 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30020 7739 7194 gene locus_tag LOCUS_30030 7739 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30030 8388 7741 gene locus_tag LOCUS_30040 8388 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 9062 8391 gene locus_tag LOCUS_30050 9062 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 10638 9067 gene locus_tag LOCUS_30060 10638 9067 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816477.1 protein_id gnl|my_center|LOCUS_30060 11123 10635 gene locus_tag LOCUS_30070 11123 10635 CDS product DUF2280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211724.1 protein_id gnl|my_center|LOCUS_30070 11781 11155 gene locus_tag LOCUS_30080 11781 11155 CDS product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095975.1 protein_id gnl|my_center|LOCUS_30080 12227 12087 gene locus_tag LOCUS_30090 12227 12087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 >Feature sequence128 251 445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 470 877 gene locus_tag LOCUS_30100 470 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1004 1234 gene locus_tag LOCUS_30110 1004 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 1721 2407 gene locus_tag LOCUS_30120 1721 2407 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_30120 2408 3487 gene locus_tag LOCUS_30130 2408 3487 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 protein_id gnl|my_center|LOCUS_30130 3508 3759 gene locus_tag LOCUS_30140 3508 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 3798 4598 gene locus_tag LOCUS_30150 3798 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30150 4636 5097 gene locus_tag LOCUS_30160 4636 5097 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033059696.1 protein_id gnl|my_center|LOCUS_30160 5169 6014 gene locus_tag LOCUS_30170 5169 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30170 6004 6411 gene locus_tag LOCUS_30180 6004 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30180 7227 6481 gene locus_tag LOCUS_30190 7227 6481 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_30190 7396 8151 gene locus_tag LOCUS_30200 7396 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30200 8148 8507 gene locus_tag LOCUS_30210 8148 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30210 8830 9597 gene locus_tag LOCUS_30220 8830 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30220 9607 11262 gene locus_tag LOCUS_30230 9607 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30230 11276 11902 gene locus_tag LOCUS_30240 gene dmsB 11276 11902 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 protein_id gnl|my_center|LOCUS_30240 >Feature sequence129 886 293 gene locus_tag LOCUS_30250 886 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30250 1368 931 gene locus_tag LOCUS_30260 gene dtd 1368 931 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099363.1 protein_id gnl|my_center|LOCUS_30260 2237 1365 gene locus_tag LOCUS_30270 2237 1365 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 protein_id gnl|my_center|LOCUS_30270 2830 2231 gene locus_tag LOCUS_30280 gene yihX 2830 2231 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099365.1 protein_id gnl|my_center|LOCUS_30280 3758 2961 gene locus_tag LOCUS_30290 3758 2961 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_30290 4530 3883 gene locus_tag LOCUS_30300 gene eda 4530 3883 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775173.1 protein_id gnl|my_center|LOCUS_30300 5884 4577 gene locus_tag LOCUS_30310 5884 4577 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728426.1 protein_id gnl|my_center|LOCUS_30310 6916 5927 gene locus_tag LOCUS_30320 6916 5927 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495856.1 protein_id gnl|my_center|LOCUS_30320 7952 6936 gene locus_tag LOCUS_30330 7952 6936 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267365.1 protein_id gnl|my_center|LOCUS_30330 9150 7996 gene locus_tag LOCUS_30340 9150 7996 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435962.1 protein_id gnl|my_center|LOCUS_30340 10206 9379 gene locus_tag LOCUS_30350 10206 9379 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099366.1 protein_id gnl|my_center|LOCUS_30350 11116 10220 gene locus_tag LOCUS_30360 11116 10220 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420843.1 protein_id gnl|my_center|LOCUS_30360 >Feature sequence130 1538 2383 gene locus_tag LOCUS_30370 gene leuO 1538 2383 CDS product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095563.1 protein_id gnl|my_center|LOCUS_30370 2776 4503 gene locus_tag LOCUS_30380 gene ilvI 2776 4503 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425609.1 protein_id gnl|my_center|LOCUS_30380 4506 4997 gene locus_tag LOCUS_30390 gene ilvN 4506 4997 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252744.1 protein_id gnl|my_center|LOCUS_30390 5174 6136 gene locus_tag LOCUS_30400 gene cra 5174 6136 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762401.1 protein_id gnl|my_center|LOCUS_30400 6386 6258 gene locus_tag LOCUS_30410 6386 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 6737 7195 gene locus_tag LOCUS_30420 gene mraZ 6737 7195 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488291.1 protein_id gnl|my_center|LOCUS_30420 7199 8140 gene locus_tag LOCUS_30430 gene rsmH 7199 8140 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970463.1 protein_id gnl|my_center|LOCUS_30430 8137 8502 gene locus_tag LOCUS_30440 gene ftsL 8137 8502 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501989.1 protein_id gnl|my_center|LOCUS_30440 8627 8842 gene locus_tag LOCUS_30450 8627 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30450 8976 10211 gene locus_tag LOCUS_30460 8976 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30460 10437 10261 gene locus_tag LOCUS_30470 10437 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 10387 11313 gene locus_tag LOCUS_30480 10387 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30480 11297 11665 gene locus_tag LOCUS_30490 11297 11665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30490 >Feature sequence131 214 310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 842 2053 gene locus_tag LOCUS_30500 842 2053 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705033.1 protein_id gnl|my_center|LOCUS_30500 2240 3484 gene locus_tag LOCUS_30510 2240 3484 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283067.1 protein_id gnl|my_center|LOCUS_30510 3469 4119 gene locus_tag LOCUS_30520 3469 4119 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502952.1 protein_id gnl|my_center|LOCUS_30520 4339 4211 gene locus_tag LOCUS_30530 4339 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30530 5183 4326 gene locus_tag LOCUS_30540 gene flgL 5183 4326 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212782.1 protein_id gnl|my_center|LOCUS_30540 6842 5199 gene locus_tag LOCUS_30550 gene flgK 6842 5199 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096524.1 protein_id gnl|my_center|LOCUS_30550 7866 6919 gene locus_tag LOCUS_30560 gene flgJ 7866 6919 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578683.1 protein_id gnl|my_center|LOCUS_30560 8217 7876 gene locus_tag LOCUS_30570 8217 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30570 8969 8214 gene locus_tag LOCUS_30580 8969 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30580 9679 8981 gene locus_tag LOCUS_30590 gene flgH 9679 8981 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857987.1 protein_id gnl|my_center|LOCUS_30590 10517 9735 gene locus_tag LOCUS_30600 gene flgG 10517 9735 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 protein_id gnl|my_center|LOCUS_30600 11285 10530 gene locus_tag LOCUS_30610 11285 10530 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349284.1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence132 <1 917 gene locus_tag LOCUS_30620 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000214156.1:fatty acid oxidation complex subunit alpha FadJ note possible pseudo, frameshifted 935 1450 gene locus_tag LOCUS_30630 935 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30630 1642 2136 gene locus_tag LOCUS_30640 gene sixA 1642 2136 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365538.1 protein_id gnl|my_center|LOCUS_30640 2723 2172 gene locus_tag LOCUS_30650 gene smrB 2723 2172 CDS product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730817.1 protein_id gnl|my_center|LOCUS_30650 2887 3819 gene locus_tag LOCUS_30660 gene prmB 2887 3819 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098152.1 protein_id gnl|my_center|LOCUS_30660 3963 4958 gene locus_tag LOCUS_30670 gene aroC 3963 4958 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297933.1 protein_id gnl|my_center|LOCUS_30670 4964 5788 gene locus_tag LOCUS_30680 gene mepA 4964 5788 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043820.1 protein_id gnl|my_center|LOCUS_30680 5799 6596 gene locus_tag LOCUS_30690 5799 6596 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098149.1 protein_id gnl|my_center|LOCUS_30690 6596 7144 gene locus_tag LOCUS_30700 6596 7144 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365544.1 protein_id gnl|my_center|LOCUS_30700 7199 7477 gene locus_tag LOCUS_30710 7199 7477 CDS product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559749.1 protein_id gnl|my_center|LOCUS_30710 7828 9933 gene locus_tag LOCUS_30720 gene cstA 7828 9933 CDS product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043160.1 protein_id gnl|my_center|LOCUS_30720 10014 10211 gene locus_tag LOCUS_30730 10014 10211 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460431.1 protein_id gnl|my_center|LOCUS_30730 10221 11333 gene locus_tag LOCUS_30740 gene yjiA 10221 11333 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770183.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence133 <1 758 gene locus_tag LOCUS_30750 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000973130.1:acyl-CoA dehydrogenase FadE 893 1699 gene locus_tag LOCUS_30760 893 1699 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111965864.1 protein_id gnl|my_center|LOCUS_30760 2094 1696 gene locus_tag LOCUS_30770 2094 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 2133 2193 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2832 2593 gene locus_tag LOCUS_30780 2832 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3905 3174 gene locus_tag LOCUS_30790 gene dnaQ 3905 3174 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670675.1 protein_id gnl|my_center|LOCUS_30790 3958 4434 gene locus_tag LOCUS_30800 gene rnhA 3958 4434 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095689.1 protein_id gnl|my_center|LOCUS_30800 4774 4427 gene locus_tag LOCUS_30810 4774 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30810 5147 4806 gene locus_tag LOCUS_30820 5147 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30820 5181 5936 gene locus_tag LOCUS_30830 gene gloB 5181 5936 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052736.1 protein_id gnl|my_center|LOCUS_30830 6155 7339 gene locus_tag LOCUS_30840 gene mltD 6155 7339 CDS product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644706.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30840 8174 7413 gene locus_tag LOCUS_30850 8174 7413 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368130.1 protein_id gnl|my_center|LOCUS_30850 9053 8244 gene locus_tag LOCUS_30860 9053 8244 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230964.1 protein_id gnl|my_center|LOCUS_30860 9300 10205 gene locus_tag LOCUS_30870 gene yafC 9300 10205 CDS product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648572.1 protein_id gnl|my_center|LOCUS_30870 10342 10266 gene locus_tag LOCUS_t00240 10342 10266 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10511 10401 gene locus_tag LOCUS_r00010 10511 10401 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 10927 10965 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence134 <1 2254 gene locus_tag LOCUS_30880 <1 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097901.1:multidrug efflux RND transporter permease subunit MdtC 319 359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2258 3664 gene locus_tag LOCUS_30890 2258 3664 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706067.1 protein_id gnl|my_center|LOCUS_30890 3664 4635 gene locus_tag LOCUS_30900 3664 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 4635 4976 gene locus_tag LOCUS_30910 4635 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 4973 5695 gene locus_tag LOCUS_30920 gene baeR 4973 5695 CDS product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137875.1 protein_id gnl|my_center|LOCUS_30920 5832 7097 gene locus_tag LOCUS_30930 gene yegQ 5832 7097 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476011.1 protein_id gnl|my_center|LOCUS_30930 6303 6319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7351 8253 gene locus_tag LOCUS_30940 gene yegS 7351 8253 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273393.1 protein_id gnl|my_center|LOCUS_30940 8723 8250 gene locus_tag LOCUS_30950 8723 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 9201 8710 gene locus_tag LOCUS_30960 9201 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 9149 9154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9441 9214 gene locus_tag LOCUS_30970 9441 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 10200 9496 gene locus_tag LOCUS_30980 10200 9496 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298844.1 protein_id gnl|my_center|LOCUS_30980 <11400 10172 gene locus_tag LOCUS_30990 <11400 10172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_175628126.1:fimbrial usher protein StbD >Feature sequence135 420 890 gene locus_tag LOCUS_31000 gene nanQ 420 890 CDS product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605256.1 protein_id gnl|my_center|LOCUS_31000 962 1837 gene locus_tag LOCUS_31010 962 1837 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433673.1 protein_id gnl|my_center|LOCUS_31010 3321 1834 gene locus_tag LOCUS_31020 gene nanT 3321 1834 CDS product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108473.1 protein_id gnl|my_center|LOCUS_31020 4285 3383 gene locus_tag LOCUS_31030 gene nanA 4285 3383 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029662.1 protein_id gnl|my_center|LOCUS_31030 5198 4407 gene locus_tag LOCUS_31040 gene nanR 5198 4407 CDS product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382926.1 protein_id gnl|my_center|LOCUS_31040 5548 5754 gene locus_tag LOCUS_31050 5548 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 5908 6810 gene locus_tag LOCUS_31060 5908 6810 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094818.1 protein_id gnl|my_center|LOCUS_31060 7684 6854 gene locus_tag LOCUS_31070 7684 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31070 8594 7659 gene locus_tag LOCUS_31080 8594 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31080 8851 8528 gene locus_tag LOCUS_31090 8851 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31090 9231 8902 gene locus_tag LOCUS_31100 9231 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 9278 9346 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10856 9396 gene locus_tag LOCUS_31110 10856 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31110 10914 11109 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence136 405 121 gene locus_tag LOCUS_31120 405 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31120 1271 399 gene locus_tag LOCUS_31130 1271 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31130 1861 1334 gene locus_tag LOCUS_31140 1861 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31140 2220 1858 gene locus_tag LOCUS_31150 2220 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31150 2776 2255 gene locus_tag LOCUS_31160 2776 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31160 4336 3008 gene locus_tag LOCUS_31170 gene garP 4336 3008 CDS product galactarate/glucarate/glycerate transporter GarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979025.1 protein_id gnl|my_center|LOCUS_31170 4734 6305 gene locus_tag LOCUS_31180 gene garD 4734 6305 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273719.1 protein_id gnl|my_center|LOCUS_31180 6660 7130 gene locus_tag LOCUS_31190 gene gatA 6660 7130 CDS product PTS galactitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080443.1 protein_id gnl|my_center|LOCUS_31190 7145 7429 gene locus_tag LOCUS_31200 gene gatB 7145 7429 CDS product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824293.1 protein_id gnl|my_center|LOCUS_31200 7435 8781 gene locus_tag LOCUS_31210 7435 8781 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490608.1 protein_id gnl|my_center|LOCUS_31210 9002 9775 gene locus_tag LOCUS_31220 9002 9775 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 protein_id gnl|my_center|LOCUS_31220 10796 9786 gene locus_tag LOCUS_31230 10796 9786 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_31230 10982 10800 gene locus_tag LOCUS_31240 10982 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31240 >Feature sequence137 <1 1154 gene locus_tag LOCUS_31250 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000249157.1:penicillin-binding protein activator LpoA note possible pseudo, frameshifted 239 350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1159 1866 gene locus_tag LOCUS_31260 1159 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31260 1824 2213 gene locus_tag LOCUS_31270 1824 2213 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098898.1 protein_id gnl|my_center|LOCUS_31270 2243 2818 gene locus_tag LOCUS_31280 gene diaA 2243 2818 CDS product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861754.1 protein_id gnl|my_center|LOCUS_31280 2828 3403 gene locus_tag LOCUS_31290 gene dolP 2828 3403 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643280.1 protein_id gnl|my_center|LOCUS_31290 4087 3440 gene locus_tag LOCUS_31300 4087 3440 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298741.1 protein_id gnl|my_center|LOCUS_31300 4205 4723 gene locus_tag LOCUS_31310 gene yhbO 4205 4723 CDS product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037599.1 protein_id gnl|my_center|LOCUS_31310 5149 4727 gene locus_tag LOCUS_31320 5149 4727 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369539.1 protein_id gnl|my_center|LOCUS_31320 5989 5486 gene locus_tag LOCUS_31330 5989 5486 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908562.1 protein_id gnl|my_center|LOCUS_31330 6507 5983 gene locus_tag LOCUS_31340 6507 5983 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098906.1 protein_id gnl|my_center|LOCUS_31340 6735 7730 gene locus_tag LOCUS_31350 6735 7730 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098907.1 protein_id gnl|my_center|LOCUS_31350 7741 8619 gene locus_tag LOCUS_31360 7741 8619 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301318.1 protein_id gnl|my_center|LOCUS_31360 8747 9751 gene locus_tag LOCUS_31370 8747 9751 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130415.1 protein_id gnl|my_center|LOCUS_31370 11027 9783 gene locus_tag LOCUS_31380 gene mtr 11027 9783 CDS product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224334.1 protein_id gnl|my_center|LOCUS_31380 >Feature sequence138 <1 646 gene locus_tag LOCUS_31390 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000165637.1:virulence-associated effector SrfC 728 812 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1636 938 gene locus_tag LOCUS_31400 1636 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31400 2697 1633 gene locus_tag LOCUS_31410 2697 1633 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_31410 3476 2694 gene locus_tag LOCUS_31420 3476 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31420 3736 3473 gene locus_tag LOCUS_31430 3736 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31430 4972 3788 gene locus_tag LOCUS_31440 4972 3788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_31440 5140 5724 gene locus_tag LOCUS_31450 5140 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31450 5744 6094 gene locus_tag LOCUS_31460 5744 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31460 6522 6124 gene locus_tag LOCUS_31470 6522 6124 CDS product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776348.1 protein_id gnl|my_center|LOCUS_31470 6753 7256 gene locus_tag LOCUS_31480 6753 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 7270 7713 gene locus_tag LOCUS_31490 7270 7713 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096670.1 protein_id gnl|my_center|LOCUS_31490 7729 8226 gene locus_tag LOCUS_31500 7729 8226 CDS product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024810.1 protein_id gnl|my_center|LOCUS_31500 9178 8294 gene locus_tag LOCUS_31510 9178 8294 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112660.1 protein_id gnl|my_center|LOCUS_31510 9367 11172 gene locus_tag LOCUS_31520 9367 11172 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105049.1 protein_id gnl|my_center|LOCUS_31520 >Feature sequence139 132 311 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1210 1650 gene locus_tag LOCUS_31530 1210 1650 CDS product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094815.1 protein_id gnl|my_center|LOCUS_31530 3023 1692 gene locus_tag LOCUS_31540 3023 1692 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791486.1 protein_id gnl|my_center|LOCUS_31540 3930 3085 gene locus_tag LOCUS_31550 3930 3085 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966764.1 protein_id gnl|my_center|LOCUS_31550 4212 3994 gene locus_tag LOCUS_31560 4212 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31560 4968 4306 gene locus_tag LOCUS_31570 4968 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31570 5884 5168 gene locus_tag LOCUS_31580 5884 5168 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572570.1 protein_id gnl|my_center|LOCUS_31580 5998 7188 gene locus_tag LOCUS_31590 gene mdtM 5998 7188 CDS product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136983.1 protein_id gnl|my_center|LOCUS_31590 7258 7452 gene locus_tag LOCUS_31600 7258 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096722.1 protein_id gnl|my_center|LOCUS_31600 7454 8059 gene locus_tag LOCUS_31610 7454 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096723.1 protein_id gnl|my_center|LOCUS_31610 8521 8087 gene locus_tag LOCUS_31620 gene uspF 8521 8087 CDS product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096287.1 protein_id gnl|my_center|LOCUS_31620 9139 8705 gene locus_tag LOCUS_31630 9139 8705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 9234 9452 gene locus_tag LOCUS_31640 9234 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence140 388 582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 932 1009 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2665 1100 gene locus_tag LOCUS_31650 gene mdoG 2665 1100 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367217.1 protein_id gnl|my_center|LOCUS_31650 2907 4067 gene locus_tag LOCUS_31660 gene mdoC 2907 4067 CDS product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097165.1 protein_id gnl|my_center|LOCUS_31660 5564 4068 gene locus_tag LOCUS_31670 5564 4068 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976323.1 protein_id gnl|my_center|LOCUS_31670 6030 5488 gene locus_tag LOCUS_31680 gene ymdB 6030 5488 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857405.1 protein_id gnl|my_center|LOCUS_31680 6399 6088 gene locus_tag LOCUS_31690 6399 6088 CDS product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097167.1 protein_id gnl|my_center|LOCUS_31690 6908 6579 gene locus_tag LOCUS_31700 gene csgC 6908 6579 CDS product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097168.1 protein_id gnl|my_center|LOCUS_31700 7454 6963 gene locus_tag LOCUS_31710 7454 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 7949 7494 gene locus_tag LOCUS_31720 gene csgB 7949 7494 CDS product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791653.1 protein_id gnl|my_center|LOCUS_31720 8722 9372 gene locus_tag LOCUS_31730 gene csgD 8722 9372 CDS product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097171.1 protein_id gnl|my_center|LOCUS_31730 9376 9654 gene locus_tag LOCUS_31740 9376 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31740 9791 10207 gene locus_tag LOCUS_31750 gene csgF 9791 10207 CDS product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264088.1 protein_id gnl|my_center|LOCUS_31750 10231 11064 gene locus_tag LOCUS_31760 gene csgG 10231 11064 CDS product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097174.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence141 258 497 gene locus_tag LOCUS_31770 258 497 CDS product DUF905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007869725.1 protein_id gnl|my_center|LOCUS_31770 601 1059 gene locus_tag LOCUS_31780 601 1059 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098170.1 protein_id gnl|my_center|LOCUS_31780 1075 1551 gene locus_tag LOCUS_31790 1075 1551 CDS product RadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098171.1 protein_id gnl|my_center|LOCUS_31790 1560 1787 gene locus_tag LOCUS_31800 1560 1787 CDS product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098172.1 protein_id gnl|my_center|LOCUS_31800 1801 2118 gene locus_tag LOCUS_31810 1801 2118 CDS product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007869729.1 protein_id gnl|my_center|LOCUS_31810 2139 2465 gene locus_tag LOCUS_31820 gene ykfI 2139 2465 CDS product type IV toxin-antitoxin system toxin YkfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854672.1 protein_id gnl|my_center|LOCUS_31820 2781 3023 gene locus_tag LOCUS_31830 2781 3023 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_31830 3007 3255 gene locus_tag LOCUS_31840 3007 3255 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517660.1 protein_id gnl|my_center|LOCUS_31840 4949 3711 gene locus_tag LOCUS_31850 gene alaC 4949 3711 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785931.1 protein_id gnl|my_center|LOCUS_31850 5765 5877 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5882 6418 gene locus_tag LOCUS_31860 5882 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 6428 7630 gene locus_tag LOCUS_31870 6428 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31870 7024 7110 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7641 7910 gene locus_tag LOCUS_31880 7641 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31880 7920 8651 gene locus_tag LOCUS_31890 7920 8651 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098180.1 protein_id gnl|my_center|LOCUS_31890 9596 8676 gene locus_tag LOCUS_31900 gene glk 9596 8676 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098181.1 protein_id gnl|my_center|LOCUS_31900 9801 10067 gene locus_tag LOCUS_31910 9801 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31910 10079 10732 gene locus_tag LOCUS_31920 10079 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31920 10705 10953 gene locus_tag LOCUS_31930 10705 10953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31930 >Feature sequence142 141 674 gene locus_tag LOCUS_31940 141 674 CDS product toxin YdaT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705719.1 protein_id gnl|my_center|LOCUS_31940 687 941 gene locus_tag LOCUS_31950 687 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 1056 1919 gene locus_tag LOCUS_31960 1056 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 1916 2662 gene locus_tag LOCUS_31970 1916 2662 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096299.1 protein_id gnl|my_center|LOCUS_31970 2670 3269 gene locus_tag LOCUS_31980 2670 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 3266 3679 gene locus_tag LOCUS_31990 3266 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 3679 3810 gene locus_tag LOCUS_32000 3679 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 5030 4014 gene locus_tag LOCUS_32010 5030 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 6199 5495 gene locus_tag LOCUS_32020 6199 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 6635 6865 gene locus_tag LOCUS_32030 6635 6865 CDS product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217670.1 protein_id gnl|my_center|LOCUS_32030 6970 7161 gene locus_tag LOCUS_32040 6970 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 7219 7821 gene locus_tag LOCUS_32050 7219 7821 CDS product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929790.1 protein_id gnl|my_center|LOCUS_32050 7824 8429 gene locus_tag LOCUS_32060 7824 8429 CDS product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096560.1 protein_id gnl|my_center|LOCUS_32060 8655 9452 gene locus_tag LOCUS_32070 8655 9452 CDS product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047634.1 protein_id gnl|my_center|LOCUS_32070 10142 10402 gene locus_tag LOCUS_32080 10142 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 >Feature sequence143 2388 1102 gene locus_tag LOCUS_32090 gene sdaC 2388 1102 CDS product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450470.1 protein_id gnl|my_center|LOCUS_32090 4218 2854 gene locus_tag LOCUS_32100 gene ppnN 4218 2854 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 protein_id gnl|my_center|LOCUS_32100 5178 4333 gene locus_tag LOCUS_32110 gene queF 5178 4333 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100463.1 protein_id gnl|my_center|LOCUS_32110 5246 5794 gene locus_tag LOCUS_32120 gene syd 5246 5794 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343990.1 protein_id gnl|my_center|LOCUS_32120 6427 6756 gene locus_tag LOCUS_32130 6427 6756 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098527.1 protein_id gnl|my_center|LOCUS_32130 6753 7538 gene locus_tag LOCUS_32140 gene truC 6753 7538 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703313.1 protein_id gnl|my_center|LOCUS_32140 7557 8006 gene locus_tag LOCUS_32150 7557 8006 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807735.1 protein_id gnl|my_center|LOCUS_32150 8478 9836 gene locus_tag LOCUS_32160 gene gudP 8478 9836 CDS product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097082.1 protein_id gnl|my_center|LOCUS_32160 9833 10777 gene locus_tag LOCUS_32170 9833 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32170 >Feature sequence144 3042 1768 gene locus_tag LOCUS_32180 gene clpX 3042 1768 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095858.1 protein_id gnl|my_center|LOCUS_32180 3798 3175 gene locus_tag LOCUS_32190 gene clpP 3798 3175 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095857.1 protein_id gnl|my_center|LOCUS_32190 5412 4114 gene locus_tag LOCUS_32200 gene tig 5412 4114 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367952.1 protein_id gnl|my_center|LOCUS_32200 6078 5761 gene locus_tag LOCUS_32210 gene bolA 6078 5761 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095855.1 protein_id gnl|my_center|LOCUS_32210 6380 7009 gene locus_tag LOCUS_32220 6380 7009 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095854.1 protein_id gnl|my_center|LOCUS_32220 7051 8484 gene locus_tag LOCUS_32230 gene ampG 7051 8484 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095853.1 protein_id gnl|my_center|LOCUS_32230 8853 8647 gene locus_tag LOCUS_32240 8853 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 8976 9914 gene locus_tag LOCUS_32250 gene cyoA 8976 9914 CDS product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095851.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence145 1154 573 gene locus_tag LOCUS_32260 1154 573 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964735.1 protein_id gnl|my_center|LOCUS_32260 1296 1655 gene locus_tag LOCUS_32270 1296 1655 CDS product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420764.1 protein_id gnl|my_center|LOCUS_32270 1939 1673 gene locus_tag LOCUS_32280 1939 1673 CDS product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369314.1 protein_id gnl|my_center|LOCUS_32280 2525 1929 gene locus_tag LOCUS_32290 gene rsmD 2525 1929 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703709.1 protein_id gnl|my_center|LOCUS_32290 2719 3795 gene locus_tag LOCUS_32300 2719 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32300 3758 4120 gene locus_tag LOCUS_32310 3758 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32310 4123 4791 gene locus_tag LOCUS_32320 gene ftsE 4123 4791 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099140.1 protein_id gnl|my_center|LOCUS_32320 4769 5305 gene locus_tag LOCUS_32330 4769 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32330 5238 5807 gene locus_tag LOCUS_32340 5238 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32340 6062 6919 gene locus_tag LOCUS_32350 gene rpoH 6062 6919 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500093.1 protein_id gnl|my_center|LOCUS_32350 8173 7370 gene locus_tag LOCUS_32360 8173 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 9773 8298 gene locus_tag LOCUS_32370 9773 8298 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence146 236 778 gene locus_tag LOCUS_32380 236 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32380 2833 824 gene locus_tag LOCUS_32390 gene maeB 2833 824 CDS product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098212.1 protein_id gnl|my_center|LOCUS_32390 3405 4355 gene locus_tag LOCUS_32400 gene tal 3405 4355 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098213.1 protein_id gnl|my_center|LOCUS_32400 4411 6405 gene locus_tag LOCUS_32410 gene tkt 4411 6405 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087308.1 protein_id gnl|my_center|LOCUS_32410 7480 6437 gene locus_tag LOCUS_32420 7480 6437 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270542.1 protein_id gnl|my_center|LOCUS_32420 8190 7561 gene locus_tag LOCUS_32430 gene nudK 8190 7561 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138361092.1 protein_id gnl|my_center|LOCUS_32430 8607 8278 gene locus_tag LOCUS_32440 8607 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32440 8881 8573 gene locus_tag LOCUS_32450 8881 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32450 9360 8890 gene locus_tag LOCUS_32460 gene napB 9360 8890 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835182.1 protein_id gnl|my_center|LOCUS_32460 <10637 9336 gene locus_tag LOCUS_32470 <10637 9336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000013506.1:quinol dehydrogenase ferredoxin subunit NapH 10298 10313 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence147 2347 1481 gene locus_tag LOCUS_32480 2347 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32480 2783 2319 gene locus_tag LOCUS_32490 2783 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32490 2839 3036 gene locus_tag LOCUS_32500 2839 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32500 3065 5572 gene locus_tag LOCUS_32510 gene barA 3065 5572 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 protein_id gnl|my_center|LOCUS_32510 5851 5624 gene locus_tag LOCUS_32520 5851 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32520 6334 5855 gene locus_tag LOCUS_32530 6334 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32530 7052 6336 gene locus_tag LOCUS_32540 7052 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 7464 7033 gene locus_tag LOCUS_32550 gene agaF 7464 7033 CDS product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948809.1 protein_id gnl|my_center|LOCUS_32550 8297 7464 gene locus_tag LOCUS_32560 gene agaE 8297 7464 CDS product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369553.1 protein_id gnl|my_center|LOCUS_32560 9078 8311 gene locus_tag LOCUS_32570 gene agaW 9078 8311 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387359.1 protein_id gnl|my_center|LOCUS_32570 9551 9075 gene locus_tag LOCUS_32580 gene agaV 9551 9075 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098888.1 protein_id gnl|my_center|LOCUS_32580 <10613 9982 gene locus_tag LOCUS_32590 <10613 9982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098521.1:glycerate kinase >Feature sequence148 319 1338 gene locus_tag LOCUS_32600 gene virB11 319 1338 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125557.1 protein_id gnl|my_center|LOCUS_32600 1495 1701 gene locus_tag LOCUS_32610 1495 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 2310 4169 gene locus_tag LOCUS_32620 2310 4169 CDS product TraM recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602685.1 protein_id gnl|my_center|LOCUS_32620 4179 4925 gene locus_tag LOCUS_32630 gene mobC 4179 4925 CDS product MobC family replication-relaxation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909124.1 protein_id gnl|my_center|LOCUS_32630 6066 5119 gene locus_tag LOCUS_32640 6066 5119 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155898.1 protein_id gnl|my_center|LOCUS_32640 6611 8536 gene locus_tag LOCUS_32650 6611 8536 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047326435.1 protein_id gnl|my_center|LOCUS_32650 8533 10200 gene locus_tag LOCUS_32660 8533 10200 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775114.1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence149 690 1502 gene locus_tag LOCUS_32670 690 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32670 1462 1788 gene locus_tag LOCUS_32680 1462 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32680 1824 3260 gene locus_tag LOCUS_32690 1824 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32690 3707 3309 gene locus_tag LOCUS_32700 3707 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045361668.1 protein_id gnl|my_center|LOCUS_32700 3881 4243 gene locus_tag LOCUS_32710 gene yacL 3881 4243 CDS product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095603.1 protein_id gnl|my_center|LOCUS_32710 4725 5723 gene locus_tag LOCUS_32720 4725 5723 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784004.1 protein_id gnl|my_center|LOCUS_32720 5770 6291 gene locus_tag LOCUS_32730 5770 6291 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 protein_id gnl|my_center|LOCUS_32730 6291 7592 gene locus_tag LOCUS_32740 6291 7592 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 protein_id gnl|my_center|LOCUS_32740 8455 7661 gene locus_tag LOCUS_32750 gene speD 8455 7661 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095609.1 protein_id gnl|my_center|LOCUS_32750 9215 8499 gene locus_tag LOCUS_32760 gene speE 9215 8499 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829972.1 protein_id gnl|my_center|LOCUS_32760 8530 8538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9714 9367 gene locus_tag LOCUS_32770 9714 9367 CDS product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704423.1 protein_id gnl|my_center|LOCUS_32770 >Feature sequence150 368 676 gene locus_tag LOCUS_32780 368 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32780 673 858 gene locus_tag LOCUS_32790 673 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 779 3724 gene locus_tag LOCUS_32800 779 3724 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817193.1 protein_id gnl|my_center|LOCUS_32800 3865 4305 gene locus_tag LOCUS_32810 gene pagP 3865 4305 CDS product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103088.1 protein_id gnl|my_center|LOCUS_32810 4173 4187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4508 4717 gene locus_tag LOCUS_32820 gene cspE 4508 4717 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439184.1 protein_id gnl|my_center|LOCUS_32820 5306 4923 gene locus_tag LOCUS_32830 gene crcB 5306 4923 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939753.1 protein_id gnl|my_center|LOCUS_32830 5412 6200 gene locus_tag LOCUS_32840 5412 6200 CDS product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704731.1 protein_id gnl|my_center|LOCUS_32840 6327 6530 gene locus_tag LOCUS_32850 gene tatE 6327 6530 CDS product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097596.1 protein_id gnl|my_center|LOCUS_32850 7571 6618 gene locus_tag LOCUS_32860 gene lipA 7571 6618 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097595.1 protein_id gnl|my_center|LOCUS_32860 8201 7770 gene locus_tag LOCUS_32870 8201 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32870 8409 8140 gene locus_tag LOCUS_32880 8409 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32880 8770 8507 gene locus_tag LOCUS_32890 gene ybeD 8770 8507 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858718.1 protein_id gnl|my_center|LOCUS_32890 9978 8875 gene locus_tag LOCUS_32900 gene dacA 9978 8875 CDS product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092082.1 protein_id gnl|my_center|LOCUS_32900 10083 10087 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10360 10226 gene locus_tag LOCUS_32910 10360 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 >Feature sequence151 635 144 gene locus_tag LOCUS_32920 635 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32920 193 235 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1270 632 gene locus_tag LOCUS_32930 1270 632 CDS product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295278.1 protein_id gnl|my_center|LOCUS_32930 1577 1332 gene locus_tag LOCUS_32940 1577 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 3589 1940 gene locus_tag LOCUS_32950 gene pgi 3589 1940 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789986.1 protein_id gnl|my_center|LOCUS_32950 3928 4119 gene locus_tag LOCUS_32960 3928 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32960 4085 5107 gene locus_tag LOCUS_32970 4085 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32970 4983 5055 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5059 5205 gene locus_tag LOCUS_32980 5059 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 5396 6343 gene locus_tag LOCUS_32990 gene panS 5396 6343 CDS product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 protein_id gnl|my_center|LOCUS_32990 6456 6728 gene locus_tag LOCUS_33000 6456 6728 CDS product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207628.1 protein_id gnl|my_center|LOCUS_33000 7605 6730 gene locus_tag LOCUS_33010 gene rluF 7605 6730 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095030.1 protein_id gnl|my_center|LOCUS_33010 8021 7704 gene locus_tag LOCUS_33020 8021 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 8281 8021 gene locus_tag LOCUS_33030 8281 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 10065 8467 gene locus_tag LOCUS_33040 10065 8467 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956822.1 protein_id gnl|my_center|LOCUS_33040 >Feature sequence152 335 688 gene locus_tag LOCUS_33050 335 688 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_33050 685 981 gene locus_tag LOCUS_33060 685 981 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212552.1 protein_id gnl|my_center|LOCUS_33060 1564 1004 gene locus_tag LOCUS_33070 1564 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33070 2288 1599 gene locus_tag LOCUS_33080 2288 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33080 2420 3259 gene locus_tag LOCUS_33090 gene alkA 2420 3259 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288348.1 protein_id gnl|my_center|LOCUS_33090 6549 3241 gene locus_tag LOCUS_33100 6549 3241 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420943.1 protein_id gnl|my_center|LOCUS_33100 6889 7530 gene locus_tag LOCUS_33110 gene udk 6889 7530 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500855.1 protein_id gnl|my_center|LOCUS_33110 7620 8201 gene locus_tag LOCUS_33120 gene dcd 7620 8201 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234783.1 protein_id gnl|my_center|LOCUS_33120 8225 9967 gene locus_tag LOCUS_33130 gene asmA 8225 9967 CDS product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252360.1 protein_id gnl|my_center|LOCUS_33130 >Feature sequence153 2249 342 gene locus_tag LOCUS_33140 2249 342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097265.1 protein_id gnl|my_center|LOCUS_33140 2780 2256 gene locus_tag LOCUS_33150 2780 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 2823 2957 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3308 3544 gene locus_tag LOCUS_33160 3308 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 4237 3656 gene locus_tag LOCUS_33170 4237 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33170 4350 5459 gene locus_tag LOCUS_33180 4350 5459 CDS product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224084.1 protein_id gnl|my_center|LOCUS_33180 6001 5456 gene locus_tag LOCUS_33190 gene zapC 6001 5456 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097268.1 protein_id gnl|my_center|LOCUS_33190 7171 6161 gene locus_tag LOCUS_33200 gene pyrD 7171 6161 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305914.1 protein_id gnl|my_center|LOCUS_33200 7407 7982 gene locus_tag LOCUS_33210 gene ssuE 7407 7982 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263931.1 protein_id gnl|my_center|LOCUS_33210 8307 8020 gene locus_tag LOCUS_33220 8307 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33220 <10187 8304 gene locus_tag LOCUS_33230 <10187 8304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704896.1:aminopeptidase N note possible pseudo, frameshifted >Feature sequence154 279 1067 gene locus_tag LOCUS_33240 279 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33240 1024 1869 gene locus_tag LOCUS_33250 1024 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33250 1880 3172 gene locus_tag LOCUS_33260 gene purD 1880 3172 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866776.1 protein_id gnl|my_center|LOCUS_33260 3908 3207 gene locus_tag LOCUS_33270 3908 3207 CDS product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083923.1 protein_id gnl|my_center|LOCUS_33270 4187 3915 gene locus_tag LOCUS_33280 gene hupA 4187 3915 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044509.1 protein_id gnl|my_center|LOCUS_33280 4964 4374 gene locus_tag LOCUS_33290 4964 4374 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704016.1 protein_id gnl|my_center|LOCUS_33290 5680 5009 gene locus_tag LOCUS_33300 gene nfi 5680 5009 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362359.1 protein_id gnl|my_center|LOCUS_33300 6759 5695 gene locus_tag LOCUS_33310 gene hemE 6759 5695 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137652.1 protein_id gnl|my_center|LOCUS_33310 7490 6795 gene locus_tag LOCUS_33320 gene nudC 7490 6795 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373941.1 protein_id gnl|my_center|LOCUS_33320 7672 8190 gene locus_tag LOCUS_33330 7672 8190 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095013.1 protein_id gnl|my_center|LOCUS_33330 >Feature sequence155 1253 390 gene locus_tag LOCUS_33340 1253 390 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267498.1 protein_id gnl|my_center|LOCUS_33340 2110 1397 gene locus_tag LOCUS_33350 2110 1397 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501631.1 protein_id gnl|my_center|LOCUS_33350 2513 2226 gene locus_tag LOCUS_33360 2513 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33360 3205 2468 gene locus_tag LOCUS_33370 3205 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33370 4100 3222 gene locus_tag LOCUS_33380 gene dapA 4100 3222 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494019.1 protein_id gnl|my_center|LOCUS_33380 4246 4818 gene locus_tag LOCUS_33390 4246 4818 CDS product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176187.1 protein_id gnl|my_center|LOCUS_33390 4818 5288 gene locus_tag LOCUS_33400 gene bcp 4818 5288 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 protein_id gnl|my_center|LOCUS_33400 6406 5339 gene locus_tag LOCUS_33410 6406 5339 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098230.1 protein_id gnl|my_center|LOCUS_33410 6624 7391 gene locus_tag LOCUS_33420 6624 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 7325 7346 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7348 7962 gene locus_tag LOCUS_33430 7348 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 7974 8330 gene locus_tag LOCUS_33440 gene arsC 7974 8330 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365459.1 protein_id gnl|my_center|LOCUS_33440 9040 8363 gene locus_tag LOCUS_33450 9040 8363 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 protein_id gnl|my_center|LOCUS_33450 <9933 9162 gene locus_tag LOCUS_33460 <9933 9162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098238.1:uracil permease >Feature sequence156 <1 788 gene locus_tag LOCUS_33470 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000081804.1:phage tail tape measure protein 805 2313 gene locus_tag LOCUS_33480 805 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 2419 2802 gene locus_tag LOCUS_33490 2419 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 3260 3439 gene locus_tag LOCUS_33500 3260 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119356.1 protein_id gnl|my_center|LOCUS_33500 3701 3940 gene locus_tag LOCUS_33510 3701 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33510 4015 4365 gene locus_tag LOCUS_33520 4015 4365 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096342.1 protein_id gnl|my_center|LOCUS_33520 4365 5135 gene locus_tag LOCUS_33530 4365 5135 CDS product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211709.1 protein_id gnl|my_center|LOCUS_33530 5148 5879 gene locus_tag LOCUS_33540 5148 5879 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096343.1 protein_id gnl|my_center|LOCUS_33540 5867 6460 gene locus_tag LOCUS_33550 5867 6460 CDS product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113183.1 protein_id gnl|my_center|LOCUS_33550 6543 7157 gene locus_tag LOCUS_33560 6543 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 7222 8739 gene locus_tag LOCUS_33570 7222 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33570 >Feature sequence157 <1 1431 gene locus_tag LOCUS_33580 <1 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099398.1:low affinity potassium transporter Kup 1600 3507 gene locus_tag LOCUS_33590 gene rbsA 1600 3507 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099396.1 protein_id gnl|my_center|LOCUS_33590 3510 4475 gene locus_tag LOCUS_33600 gene rbsC 3510 4475 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368991.1 protein_id gnl|my_center|LOCUS_33600 4502 5389 gene locus_tag LOCUS_33610 gene rbsB 4502 5389 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368990.1 protein_id gnl|my_center|LOCUS_33610 5444 6373 gene locus_tag LOCUS_33620 gene rbsK 5444 6373 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420966.1 protein_id gnl|my_center|LOCUS_33620 6377 7369 gene locus_tag LOCUS_33630 gene rbsR 6377 7369 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224487.1 protein_id gnl|my_center|LOCUS_33630 8739 7372 gene locus_tag LOCUS_33640 gene mdtD 8739 7372 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 protein_id gnl|my_center|LOCUS_33640 9475 8780 gene locus_tag LOCUS_33650 9475 8780 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131144.1 protein_id gnl|my_center|LOCUS_33650 >Feature sequence158 586 260 gene locus_tag LOCUS_33660 586 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33660 277 286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1146 583 gene locus_tag LOCUS_33670 gene tag 1146 583 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438940.1 protein_id gnl|my_center|LOCUS_33670 1326 2039 gene locus_tag LOCUS_33680 1326 2039 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620076.1 protein_id gnl|my_center|LOCUS_33680 2214 2630 gene locus_tag LOCUS_33690 2214 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33690 2516 3373 gene locus_tag LOCUS_33700 2516 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33700 3555 5213 gene locus_tag LOCUS_33710 gene eptB 3555 5213 CDS product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269197.1 protein_id gnl|my_center|LOCUS_33710 5303 5379 gene locus_tag LOCUS_t00250 5303 5379 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5410 5415 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5705 7201 gene locus_tag LOCUS_33720 5705 7201 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 protein_id gnl|my_center|LOCUS_33720 7182 7667 gene locus_tag LOCUS_33730 7182 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 9204 7648 gene locus_tag LOCUS_33740 9204 7648 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038812.1 protein_id gnl|my_center|LOCUS_33740 9694 9269 gene locus_tag LOCUS_33750 9694 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence159 157 288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 352 672 gene locus_tag LOCUS_33760 352 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 662 1348 gene locus_tag LOCUS_33770 662 1348 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704525.1 protein_id gnl|my_center|LOCUS_33770 2157 1375 gene locus_tag LOCUS_33780 gene map 2157 1375 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209416.1 protein_id gnl|my_center|LOCUS_33780 2402 2154 gene locus_tag LOCUS_33790 2402 2154 CDS product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079039.1 protein_id gnl|my_center|LOCUS_33790 2748 2966 gene locus_tag LOCUS_33800 2748 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 3188 3667 gene locus_tag LOCUS_33810 3188 3667 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_33810 4235 3705 gene locus_tag LOCUS_33820 4235 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963497.1 protein_id gnl|my_center|LOCUS_33820 4744 5709 gene locus_tag LOCUS_33830 4744 5709 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705307.1 protein_id gnl|my_center|LOCUS_33830 6062 8416 gene locus_tag LOCUS_33840 6062 8416 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096775.1 protein_id gnl|my_center|LOCUS_33840 8771 8472 gene locus_tag LOCUS_33850 8771 8472 CDS product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703845.1 protein_id gnl|my_center|LOCUS_33850 8915 9112 gene locus_tag LOCUS_33860 8915 9112 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703844.1 protein_id gnl|my_center|LOCUS_33860 9346 9173 gene locus_tag LOCUS_33870 9346 9173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 >Feature sequence160 229 486 gene locus_tag LOCUS_33880 229 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33880 271 292 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 563 895 gene locus_tag LOCUS_33890 563 895 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 protein_id gnl|my_center|LOCUS_33890 895 1404 gene locus_tag LOCUS_33900 895 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33900 1277 1295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1322 1510 gene locus_tag LOCUS_33910 1322 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33910 1621 3507 gene locus_tag LOCUS_33920 gene htpG 1621 3507 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682145.1 protein_id gnl|my_center|LOCUS_33920 3680 4339 gene locus_tag LOCUS_33930 gene adk 3680 4339 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809841.1 protein_id gnl|my_center|LOCUS_33930 4470 5432 gene locus_tag LOCUS_33940 gene hemH 4470 5432 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250088.1 protein_id gnl|my_center|LOCUS_33940 5495 6646 gene locus_tag LOCUS_33950 gene gsk 5495 6646 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671594.1 protein_id gnl|my_center|LOCUS_33950 6610 6783 gene locus_tag LOCUS_33960 6610 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33960 8533 6857 gene locus_tag LOCUS_33970 gene ybaL 8533 6857 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095902.1 protein_id gnl|my_center|LOCUS_33970 <9424 8801 gene locus_tag LOCUS_33980 <9424 8801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095903.1:MFS transporter 8953 8999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence161 212 370 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1498 395 gene locus_tag LOCUS_33990 gene nrfF 1498 395 CDS product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706301.1 protein_id gnl|my_center|LOCUS_33990 2585 1491 gene locus_tag LOCUS_34000 2585 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34000 2619 2649 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3286 2684 gene locus_tag LOCUS_34010 3286 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 4249 3299 gene locus_tag LOCUS_34020 gene nrfD 4249 3299 CDS product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199631.1 protein_id gnl|my_center|LOCUS_34020 4413 4246 gene locus_tag LOCUS_34030 4413 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34030 4919 4386 gene locus_tag LOCUS_34040 gene nrfC 4919 4386 CDS product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278023.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34040 5482 4916 gene locus_tag LOCUS_34050 gene nrfB 5482 4916 CDS product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115063.1 protein_id gnl|my_center|LOCUS_34050 6973 5528 gene locus_tag LOCUS_34060 gene nrfA 6973 5528 CDS product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101783.1 protein_id gnl|my_center|LOCUS_34060 7638 8468 gene locus_tag LOCUS_34070 7638 8468 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182015315.1 protein_id gnl|my_center|LOCUS_34070 8470 9288 gene locus_tag LOCUS_34080 8470 9288 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704527.1 protein_id gnl|my_center|LOCUS_34080 >Feature sequence162 186 245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2981 291 gene locus_tag LOCUS_34090 2981 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34090 5244 2962 gene locus_tag LOCUS_34100 5244 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34100 5465 6310 gene locus_tag LOCUS_34110 gene sseA 5465 6310 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205251.1 protein_id gnl|my_center|LOCUS_34110 7119 6340 gene locus_tag LOCUS_34120 gene sseB 7119 6340 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098290.1 protein_id gnl|my_center|LOCUS_34120 8413 7352 gene locus_tag LOCUS_34130 gene pepB 8413 7352 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098291.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34130 8676 8476 gene locus_tag LOCUS_34140 gene iscX 8676 8476 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860650.1 protein_id gnl|my_center|LOCUS_34140 9025 8690 gene locus_tag LOCUS_34150 gene fdx 9025 8690 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124471.1 protein_id gnl|my_center|LOCUS_34150 9142 9318 gene locus_tag LOCUS_34160 9142 9318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 >Feature sequence163 585 109 gene locus_tag LOCUS_34170 585 109 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460251.1 protein_id gnl|my_center|LOCUS_34170 2921 588 gene locus_tag LOCUS_34180 2921 588 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460252.1 protein_id gnl|my_center|LOCUS_34180 3092 3784 gene locus_tag LOCUS_34190 3092 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 3882 5543 gene locus_tag LOCUS_34200 3882 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 5551 6252 gene locus_tag LOCUS_34210 5551 6252 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083022.1 protein_id gnl|my_center|LOCUS_34210 6262 7887 gene locus_tag LOCUS_34220 6262 7887 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34220 7859 8170 gene locus_tag LOCUS_34230 7859 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34230 8216 8557 gene locus_tag LOCUS_34240 8216 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence164 687 2390 gene locus_tag LOCUS_34250 gene narQ 687 2390 CDS product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309642.1 protein_id gnl|my_center|LOCUS_34250 2426 3070 gene locus_tag LOCUS_34260 gene narP 2426 3070 CDS product nitrate/nitrite response regulator protein NarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115500.1 protein_id gnl|my_center|LOCUS_34260 3222 4604 gene locus_tag LOCUS_34270 3222 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 4598 6073 gene locus_tag LOCUS_34280 4598 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 6756 7112 gene locus_tag LOCUS_34290 6756 7112 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258247.1 protein_id gnl|my_center|LOCUS_34290 7117 8244 gene locus_tag LOCUS_34300 gene dapE 7117 8244 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098221.1 protein_id gnl|my_center|LOCUS_34300 8268 8459 gene locus_tag LOCUS_34310 8268 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 8949 8500 gene locus_tag LOCUS_34320 8949 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34320 9163 8975 gene locus_tag LOCUS_34330 9163 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34330 >Feature sequence165 1133 117 gene locus_tag LOCUS_34340 1133 117 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209587.1 protein_id gnl|my_center|LOCUS_34340 1539 1445 gene locus_tag LOCUS_t00260 1539 1445 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1831 2979 gene locus_tag LOCUS_34350 1831 2979 CDS product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703825.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34350 2957 3211 gene locus_tag LOCUS_34360 2957 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34360 3215 5368 gene locus_tag LOCUS_34370 3215 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 3634 3713 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6317 5403 gene locus_tag LOCUS_34380 6317 5403 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387201.1 protein_id gnl|my_center|LOCUS_34380 7639 6710 gene locus_tag LOCUS_34390 gene fdhE 7639 6710 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368963.1 protein_id gnl|my_center|LOCUS_34390 8230 7649 gene locus_tag LOCUS_34400 gene fdoI 8230 7649 CDS product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368962.1 protein_id gnl|my_center|LOCUS_34400 8586 8227 gene locus_tag LOCUS_34410 8586 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 8658 8843 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence166 734 252 gene locus_tag LOCUS_34420 gene xdhC 734 252 CDS product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016606.1 protein_id gnl|my_center|LOCUS_34420 1138 731 gene locus_tag LOCUS_34430 1138 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34430 1433 1290 gene locus_tag LOCUS_34440 1433 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 2121 1576 gene locus_tag LOCUS_34450 2121 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34450 3783 2155 gene locus_tag LOCUS_34460 3783 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34460 4230 4811 gene locus_tag LOCUS_34470 gene actS 4230 4811 CDS product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369803.1 protein_id gnl|my_center|LOCUS_34470 4891 4964 gene locus_tag LOCUS_t00270 4891 4964 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6055 6621 gene locus_tag LOCUS_34480 6055 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 6560 6581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6657 8639 gene locus_tag LOCUS_34490 6657 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 8713 9099 gene locus_tag LOCUS_34500 8713 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 9053 9232 gene locus_tag LOCUS_34510 9053 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 >Feature sequence167 2075 414 gene locus_tag LOCUS_34520 2075 414 CDS product DUF927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305743.1 protein_id gnl|my_center|LOCUS_34520 2686 2072 gene locus_tag LOCUS_34530 2686 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34530 2949 2743 gene locus_tag LOCUS_34540 2949 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 3496 3017 gene locus_tag LOCUS_34550 3496 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 3651 3475 gene locus_tag LOCUS_34560 3651 3475 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480576.1 protein_id gnl|my_center|LOCUS_34560 4340 3726 gene locus_tag LOCUS_34570 4340 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 5787 4543 gene locus_tag LOCUS_34580 5787 4543 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525821.1 protein_id gnl|my_center|LOCUS_34580 6826 5963 gene locus_tag LOCUS_34590 6826 5963 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621352.1 protein_id gnl|my_center|LOCUS_34590 6950 7666 gene locus_tag LOCUS_34600 gene rph 6950 7666 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369149.1 protein_id gnl|my_center|LOCUS_34600 7747 8388 gene locus_tag LOCUS_34610 gene pyrE 7747 8388 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094889.1 protein_id gnl|my_center|LOCUS_34610 <9236 8420 gene locus_tag LOCUS_34620 <9236 8420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001311223.1:nucleoid occlusion factor SlmA >Feature sequence168 47 898 gene locus_tag LOCUS_34630 gene panC 47 898 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368199.1 protein_id gnl|my_center|LOCUS_34630 1019 1387 gene locus_tag LOCUS_34640 gene panD 1019 1387 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856284.1 protein_id gnl|my_center|LOCUS_34640 2662 1415 gene locus_tag LOCUS_34650 2662 1415 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420882.1 protein_id gnl|my_center|LOCUS_34650 3170 2739 gene locus_tag LOCUS_34660 3170 2739 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095618.1 protein_id gnl|my_center|LOCUS_34660 4027 3293 gene locus_tag LOCUS_34670 4027 3293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368203.1 protein_id gnl|my_center|LOCUS_34670 4767 4024 gene locus_tag LOCUS_34680 4767 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 4480 4501 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4875 5537 gene locus_tag LOCUS_34690 gene can 4875 5537 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651599.1 protein_id gnl|my_center|LOCUS_34690 6112 5564 gene locus_tag LOCUS_34700 gene hpt 6112 5564 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 protein_id gnl|my_center|LOCUS_34700 6379 8598 gene locus_tag LOCUS_34710 6379 8598 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704425.1 protein_id gnl|my_center|LOCUS_34710 8766 8826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence169 261 1733 gene locus_tag LOCUS_34720 gene citT 261 1733 CDS product citrate/succinate antiporter CitT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050328.1 protein_id gnl|my_center|LOCUS_34720 1888 2862 gene locus_tag LOCUS_34730 1888 2862 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 protein_id gnl|my_center|LOCUS_34730 2933 4375 gene locus_tag LOCUS_34740 gene norV 2933 4375 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025997.1 protein_id gnl|my_center|LOCUS_34740 4372 5505 gene locus_tag LOCUS_34750 gene norW 4372 5505 CDS product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064713.1 protein_id gnl|my_center|LOCUS_34750 5650 5790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6082 6294 gene locus_tag LOCUS_34760 6082 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 6501 6941 gene locus_tag LOCUS_34770 gene nikR 6501 6941 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083525.1 protein_id gnl|my_center|LOCUS_34770 7221 7835 gene locus_tag LOCUS_34780 7221 7835 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816728.1 protein_id gnl|my_center|LOCUS_34780 8246 8252 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence170 1976 873 gene locus_tag LOCUS_34790 1976 873 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 protein_id gnl|my_center|LOCUS_34790 3119 2175 gene locus_tag LOCUS_34800 3119 2175 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367784.1 protein_id gnl|my_center|LOCUS_34800 3327 4268 gene locus_tag LOCUS_34810 3327 4268 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209434.1 protein_id gnl|my_center|LOCUS_34810 4281 4874 gene locus_tag LOCUS_34820 4281 4874 CDS product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167399.1 protein_id gnl|my_center|LOCUS_34820 4874 6388 gene locus_tag LOCUS_34830 4874 6388 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167401.1 protein_id gnl|my_center|LOCUS_34830 6390 7490 gene locus_tag LOCUS_34840 6390 7490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209437.1 protein_id gnl|my_center|LOCUS_34840 7578 8408 gene locus_tag LOCUS_34850 7578 8408 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209438.1 protein_id gnl|my_center|LOCUS_34850 >Feature sequence171 389 733 gene locus_tag LOCUS_34860 389 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096037.1 protein_id gnl|my_center|LOCUS_34860 1045 767 gene locus_tag LOCUS_34870 1045 767 CDS product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719058.1 protein_id gnl|my_center|LOCUS_34870 1615 3012 gene locus_tag LOCUS_34880 1615 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3301 4905 gene locus_tag LOCUS_34890 3301 4905 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418469.1 protein_id gnl|my_center|LOCUS_34890 5219 4827 gene locus_tag LOCUS_34900 gene soxS 5219 4827 CDS product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095071.1 protein_id gnl|my_center|LOCUS_34900 5303 5767 gene locus_tag LOCUS_34910 gene soxR 5303 5767 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412424.1 protein_id gnl|my_center|LOCUS_34910 6034 6702 gene locus_tag LOCUS_34920 6034 6702 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958574.1 protein_id gnl|my_center|LOCUS_34920 7032 8378 gene locus_tag LOCUS_34930 gene ghxP 7032 8378 CDS product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095074.1 protein_id gnl|my_center|LOCUS_34930 >Feature sequence172 176 940 gene locus_tag LOCUS_34940 176 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 1393 1133 gene locus_tag LOCUS_34950 1393 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34950 1973 1374 gene locus_tag LOCUS_34960 1973 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34960 2350 3345 gene locus_tag LOCUS_34970 gene kdgT 2350 3345 CDS product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704632.1 protein_id gnl|my_center|LOCUS_34970 4288 3413 gene locus_tag LOCUS_34980 4288 3413 CDS product diguanylate cyclase regulator RdcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882903.1 protein_id gnl|my_center|LOCUS_34980 5415 4285 gene locus_tag LOCUS_34990 5415 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34990 5902 5357 gene locus_tag LOCUS_35000 5902 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35000 6602 5874 gene locus_tag LOCUS_35010 6602 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35010 7184 7519 gene locus_tag LOCUS_35020 7184 7519 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095115.1 protein_id gnl|my_center|LOCUS_35020 >Feature sequence173 <1 605 gene locus_tag LOCUS_35030 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096690.1:HlyD family type I secretion periplasmic adaptor subunit 1124 642 gene locus_tag LOCUS_35040 gene smpB 1124 642 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 protein_id gnl|my_center|LOCUS_35040 1276 1713 gene locus_tag LOCUS_35050 1276 1713 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242603.1 protein_id gnl|my_center|LOCUS_35050 1703 1993 gene locus_tag LOCUS_35060 1703 1993 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117834.1 protein_id gnl|my_center|LOCUS_35060 2414 2070 gene locus_tag LOCUS_35070 gene bamE 2414 2070 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863121.1 protein_id gnl|my_center|LOCUS_35070 4296 2635 gene locus_tag LOCUS_35080 gene recN 4296 2635 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098357.1 protein_id gnl|my_center|LOCUS_35080 5207 4329 gene locus_tag LOCUS_35090 gene nadK 5207 4329 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059176.1 protein_id gnl|my_center|LOCUS_35090 5328 5918 gene locus_tag LOCUS_35100 gene grpE 5328 5918 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370253.1 protein_id gnl|my_center|LOCUS_35100 7204 5963 gene locus_tag LOCUS_35110 7204 5963 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028086.1 protein_id gnl|my_center|LOCUS_35110 8065 7310 gene locus_tag LOCUS_35120 8065 7310 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537507.1 protein_id gnl|my_center|LOCUS_35120 >Feature sequence174 1289 186 gene locus_tag LOCUS_35130 gene proB 1289 186 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095745.1 protein_id gnl|my_center|LOCUS_35130 1582 2574 gene locus_tag LOCUS_35140 gene phoE 1582 2574 CDS product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749863.1 protein_id gnl|my_center|LOCUS_35140 3046 2645 gene locus_tag LOCUS_35150 gene crl 3046 2645 CDS product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174677.1 protein_id gnl|my_center|LOCUS_35150 4345 3104 gene locus_tag LOCUS_35160 gene frsA 4345 3104 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189532.1 protein_id gnl|my_center|LOCUS_35160 4917 4459 gene locus_tag LOCUS_35170 gene gpt 4917 4459 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 protein_id gnl|my_center|LOCUS_35170 5175 5672 gene locus_tag LOCUS_35180 5175 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35180 5708 6634 gene locus_tag LOCUS_35190 5708 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35190 7182 6670 gene locus_tag LOCUS_35200 7182 6670 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 protein_id gnl|my_center|LOCUS_35200 8262 7207 gene locus_tag LOCUS_35210 gene dinB 8262 7207 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 protein_id gnl|my_center|LOCUS_35210 8925 8362 gene locus_tag LOCUS_35220 8925 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 >Feature sequence175 459 289 gene locus_tag LOCUS_35230 459 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35230 1415 531 gene locus_tag LOCUS_35240 gene yddG 1415 531 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705524.1 protein_id gnl|my_center|LOCUS_35240 2310 1483 gene locus_tag LOCUS_35250 gene nadE 2310 1483 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705762.1 protein_id gnl|my_center|LOCUS_35250 2555 2902 gene locus_tag LOCUS_35260 gene osmE 2555 2902 CDS product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039301.1 protein_id gnl|my_center|LOCUS_35260 3647 2985 gene locus_tag LOCUS_35270 3647 2985 CDS product DUF2931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387039.1 protein_id gnl|my_center|LOCUS_35270 5629 3644 gene locus_tag LOCUS_35280 5629 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 8073 5824 gene locus_tag LOCUS_35290 gene katE 8073 5824 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019093.1 protein_id gnl|my_center|LOCUS_35290 8241 8480 gene locus_tag LOCUS_35300 gene cedA 8241 8480 CDS product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241561.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence176 107 442 gene locus_tag LOCUS_35310 107 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35310 871 551 gene locus_tag LOCUS_35320 871 551 CDS product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685902.1 protein_id gnl|my_center|LOCUS_35320 1592 912 gene locus_tag LOCUS_35330 1592 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35330 2275 1547 gene locus_tag LOCUS_35340 2275 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35340 3562 2387 gene locus_tag LOCUS_35350 3562 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35350 5051 3504 gene locus_tag LOCUS_35360 5051 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35360 5785 5084 gene locus_tag LOCUS_35370 gene tapT 5785 5084 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098331.1 protein_id gnl|my_center|LOCUS_35370 6284 5865 gene locus_tag LOCUS_35380 gene trxC 6284 5865 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098330.1 protein_id gnl|my_center|LOCUS_35380 6489 7547 gene locus_tag LOCUS_35390 6489 7547 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098329.1 protein_id gnl|my_center|LOCUS_35390 8224 7586 gene locus_tag LOCUS_35400 gene ung 8224 7586 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262723.1 protein_id gnl|my_center|LOCUS_35400 >Feature sequence177 675 19 gene locus_tag LOCUS_35410 675 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 1121 714 gene locus_tag LOCUS_35420 1121 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 1398 1413 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1949 1683 gene locus_tag LOCUS_35430 1949 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 2679 3548 gene locus_tag LOCUS_35440 2679 3548 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301664.1 protein_id gnl|my_center|LOCUS_35440 4112 4411 gene locus_tag LOCUS_35450 4112 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 5968 4448 gene locus_tag LOCUS_35460 5968 4448 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703226.1 protein_id gnl|my_center|LOCUS_35460 6365 6216 gene locus_tag LOCUS_35470 6365 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 6327 6872 gene locus_tag LOCUS_35480 6327 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35480 6862 7932 gene locus_tag LOCUS_35490 6862 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35490 8338 7949 gene locus_tag LOCUS_35500 8338 7949 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096638.1 protein_id gnl|my_center|LOCUS_35500 >Feature sequence178 36 111 gene locus_tag LOCUS_t00280 36 111 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1038 127 gene locus_tag LOCUS_35510 1038 127 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446236.1 protein_id gnl|my_center|LOCUS_35510 2345 1089 gene locus_tag LOCUS_35520 gene xapB 2345 1089 CDS product xanthosine/proton symporter XapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020402.1 protein_id gnl|my_center|LOCUS_35520 2994 2401 gene locus_tag LOCUS_35530 2994 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35530 3395 3718 gene locus_tag LOCUS_35540 3395 3718 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098192.1 protein_id gnl|my_center|LOCUS_35540 4650 3709 gene locus_tag LOCUS_35550 4650 3709 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098193.1 protein_id gnl|my_center|LOCUS_35550 4737 4979 gene locus_tag LOCUS_35560 4737 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35560 4900 5700 gene locus_tag LOCUS_35570 4900 5700 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765569.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35570 5924 5703 gene locus_tag LOCUS_35580 5924 5703 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861328.1 protein_id gnl|my_center|LOCUS_35580 7944 5917 gene locus_tag LOCUS_35590 gene ligA 7944 5917 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098195.1 protein_id gnl|my_center|LOCUS_35590 8262 8014 gene locus_tag LOCUS_35600 8262 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 8308 8409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence179 <1 564 gene locus_tag LOCUS_35610 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_120727113.1:multidrug efflux MATE transporter EmmdR note possible pseudo, frameshifted 545 1312 gene locus_tag LOCUS_35620 545 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35620 2105 1275 gene locus_tag LOCUS_35630 2105 1275 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703270.1 protein_id gnl|my_center|LOCUS_35630 2958 2098 gene locus_tag LOCUS_35640 gene sitC 2958 2098 CDS product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370015.1 protein_id gnl|my_center|LOCUS_35640 3755 2955 gene locus_tag LOCUS_35650 3755 2955 CDS product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385381.1 protein_id gnl|my_center|LOCUS_35650 4666 3752 gene locus_tag LOCUS_35660 gene sitA 4666 3752 CDS product iron/manganese ABC transporter substrate-binding protein SitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949004.1 protein_id gnl|my_center|LOCUS_35660 5449 5534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5802 6278 gene locus_tag LOCUS_35670 5802 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160202.1 protein_id gnl|my_center|LOCUS_35670 6492 6749 gene locus_tag LOCUS_35680 6492 6749 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288812.1 protein_id gnl|my_center|LOCUS_35680 6750 7082 gene locus_tag LOCUS_35690 6750 7082 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373724.1 protein_id gnl|my_center|LOCUS_35690 8146 8526 gene locus_tag LOCUS_35700 8146 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence180 2695 1796 gene locus_tag LOCUS_35710 2695 1796 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097441.1 protein_id gnl|my_center|LOCUS_35710 2833 3498 gene locus_tag LOCUS_35720 gene fsa 2833 3498 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420897.1 protein_id gnl|my_center|LOCUS_35720 3659 3531 gene locus_tag LOCUS_35730 3659 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 4387 3842 gene locus_tag LOCUS_35740 gene orn 4387 3842 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704162.1 protein_id gnl|my_center|LOCUS_35740 4498 5550 gene locus_tag LOCUS_35750 gene rsgA 4498 5550 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 protein_id gnl|my_center|LOCUS_35750 5651 6622 gene locus_tag LOCUS_35760 gene asd 5651 6622 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095278.1 protein_id gnl|my_center|LOCUS_35760 >Feature sequence181 1047 64 gene locus_tag LOCUS_35770 gene thiB 1047 64 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915326.1 protein_id gnl|my_center|LOCUS_35770 1580 1215 gene locus_tag LOCUS_35780 1580 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35780 2862 1549 gene locus_tag LOCUS_35790 gene sgrR 2862 1549 CDS product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139028.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35790 3165 4517 gene locus_tag LOCUS_35800 3165 4517 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095558.1 protein_id gnl|my_center|LOCUS_35800 5005 4715 gene locus_tag LOCUS_35810 5005 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35810 4803 4829 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6417 5017 gene locus_tag LOCUS_35820 gene leuC 6417 5017 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095560.1 protein_id gnl|my_center|LOCUS_35820 7511 6420 gene locus_tag LOCUS_35830 gene leuB 7511 6420 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095561.1 protein_id gnl|my_center|LOCUS_35830 <8383 7511 gene locus_tag LOCUS_35840 <8383 7511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095562.1:2-isopropylmalate synthase >Feature sequence182 747 136 gene locus_tag LOCUS_35850 747 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088985.1 protein_id gnl|my_center|LOCUS_35850 1074 763 gene locus_tag LOCUS_35860 1074 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 1284 2210 gene locus_tag LOCUS_35870 gene pbpG 1284 2210 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001319943.1 protein_id gnl|my_center|LOCUS_35870 2765 2211 gene locus_tag LOCUS_35880 2765 2211 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097939.1 protein_id gnl|my_center|LOCUS_35880 3924 2872 gene locus_tag LOCUS_35890 3924 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 3999 4124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4663 6960 gene locus_tag LOCUS_35900 gene bglX 4663 6960 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871488.1 protein_id gnl|my_center|LOCUS_35900 7106 8014 gene locus_tag LOCUS_35910 7106 8014 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097936.1 protein_id gnl|my_center|LOCUS_35910 >Feature sequence183 <1 593 gene locus_tag LOCUS_35920 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767194.1:L-fucose/L-arabinose isomerase family protein note possible pseudo, frameshifted 568 900 gene locus_tag LOCUS_35930 568 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35930 1099 2133 gene locus_tag LOCUS_35940 gene rhaT 1099 2133 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063537.1 protein_id gnl|my_center|LOCUS_35940 2763 2164 gene locus_tag LOCUS_35950 2763 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35950 3001 2768 gene locus_tag LOCUS_35960 3001 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35960 3974 3138 gene locus_tag LOCUS_35970 gene rhaS 3974 3138 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099335.1 protein_id gnl|my_center|LOCUS_35970 4395 5708 gene locus_tag LOCUS_35980 gene rhaB 4395 5708 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144073.1 protein_id gnl|my_center|LOCUS_35980 5705 6964 gene locus_tag LOCUS_35990 gene rhaA 5705 6964 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301857.1 protein_id gnl|my_center|LOCUS_35990 7023 7307 gene locus_tag LOCUS_36000 7023 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36000 7271 7813 gene locus_tag LOCUS_36010 7271 7813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36010 >Feature sequence184 871 344 gene locus_tag LOCUS_36020 gene cobO 871 344 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278878.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36020 1629 868 gene locus_tag LOCUS_36030 1629 868 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559310.1 protein_id gnl|my_center|LOCUS_36030 1879 2928 gene locus_tag LOCUS_36040 gene sohB 1879 2928 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422053.1 protein_id gnl|my_center|LOCUS_36040 3216 2965 gene locus_tag LOCUS_36050 3216 2965 CDS product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856804.1 protein_id gnl|my_center|LOCUS_36050 3445 3173 gene locus_tag LOCUS_36060 3445 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 3616 5430 gene locus_tag LOCUS_36070 3616 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36070 5440 6081 gene locus_tag LOCUS_36080 5440 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36080 6271 7233 gene locus_tag LOCUS_36090 gene cysB 6271 7233 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175683.1 protein_id gnl|my_center|LOCUS_36090 7418 7468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7522 7683 gene locus_tag LOCUS_36100 7522 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 >Feature sequence185 2744 1851 gene locus_tag LOCUS_36110 2744 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 3283 2735 gene locus_tag LOCUS_36120 3283 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 3913 4686 gene locus_tag LOCUS_36130 gene dapB 3913 4686 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543582.1 protein_id gnl|my_center|LOCUS_36130 5154 6302 gene locus_tag LOCUS_36140 gene carA 5154 6302 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298633.1 protein_id gnl|my_center|LOCUS_36140 6858 7017 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence186 1896 721 gene locus_tag LOCUS_36150 gene rhmD 1896 721 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 protein_id gnl|my_center|LOCUS_36150 2692 1910 gene locus_tag LOCUS_36160 2692 1910 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894172.1 protein_id gnl|my_center|LOCUS_36160 4090 2891 gene locus_tag LOCUS_36170 4090 2891 CDS product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098022.1 protein_id gnl|my_center|LOCUS_36170 4690 4184 gene locus_tag LOCUS_36180 4690 4184 CDS product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300392.1 protein_id gnl|my_center|LOCUS_36180 5000 6673 gene locus_tag LOCUS_36190 5000 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 6754 7179 gene locus_tag LOCUS_36200 gene nudI 6754 7179 CDS product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249902.1 protein_id gnl|my_center|LOCUS_36200 <7987 7181 gene locus_tag LOCUS_36210 <7987 7181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098091.1:o-succinylbenzoate--CoA ligase >Feature sequence187 247 275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3839 2634 gene locus_tag LOCUS_36220 3839 2634 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703474.1 protein_id gnl|my_center|LOCUS_36220 5125 3854 gene locus_tag LOCUS_36230 5125 3854 CDS product oligosaccharide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369698.1 protein_id gnl|my_center|LOCUS_36230 5367 6233 gene locus_tag LOCUS_36240 5367 6233 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369696.1 protein_id gnl|my_center|LOCUS_36240 7694 6306 gene locus_tag LOCUS_36250 gene narK 7694 6306 CDS product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019848.1 protein_id gnl|my_center|LOCUS_36250 >Feature sequence188 <1 541 gene locus_tag LOCUS_36260 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703307.1:GTP diphosphokinase 634 1320 gene locus_tag LOCUS_36270 gene mazG 634 1320 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703306.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36270 1619 3256 gene locus_tag LOCUS_36280 gene pyrG 1619 3256 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703305.1 protein_id gnl|my_center|LOCUS_36280 3339 4637 gene locus_tag LOCUS_36290 gene eno 3339 4637 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036734.1 protein_id gnl|my_center|LOCUS_36290 5221 4700 gene locus_tag LOCUS_36300 5221 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36300 6024 5248 gene locus_tag LOCUS_36310 6024 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36310 6325 6996 gene locus_tag LOCUS_36320 gene queE 6325 6996 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098510.1 protein_id gnl|my_center|LOCUS_36320 7406 7044 gene locus_tag LOCUS_36330 gene queD 7406 7044 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001329795.1 protein_id gnl|my_center|LOCUS_36330 >Feature sequence189 1105 554 gene locus_tag LOCUS_36340 gene apt 1105 554 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367908.1 protein_id gnl|my_center|LOCUS_36340 1635 1258 gene locus_tag LOCUS_36350 1635 1258 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095896.1 protein_id gnl|my_center|LOCUS_36350 1701 2228 gene locus_tag LOCUS_36360 gene priC 1701 2228 CDS product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704614.1 protein_id gnl|my_center|LOCUS_36360 2245 2403 gene locus_tag LOCUS_36370 2245 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 2784 2446 gene locus_tag LOCUS_36380 gene glnB 2784 2446 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 protein_id gnl|my_center|LOCUS_36380 4216 2879 gene locus_tag LOCUS_36390 gene glrR 4216 2879 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298983.1 protein_id gnl|my_center|LOCUS_36390 4903 4283 gene locus_tag LOCUS_36400 gene qseG 4903 4283 CDS product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098305.1 protein_id gnl|my_center|LOCUS_36400 6357 4969 gene locus_tag LOCUS_36410 gene qseE 6357 4969 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420402.1 protein_id gnl|my_center|LOCUS_36410 <7851 6938 gene locus_tag LOCUS_36420 <7851 6938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000970035.1:phosphoribosylformylglycinamidine synthase >Feature sequence190 <1 877 gene locus_tag LOCUS_36430 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095635.1:ATP-dependent helicase HrpB 972 3104 gene locus_tag LOCUS_36440 gene mrcB 972 3104 CDS product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918132.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36440 3105 3491 gene locus_tag LOCUS_36450 3105 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36450 3758 4837 gene locus_tag LOCUS_36460 3758 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36460 4862 5671 gene locus_tag LOCUS_36470 4862 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36470 5687 5968 gene locus_tag LOCUS_36480 5687 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36480 6016 6747 gene locus_tag LOCUS_36490 gene fhuC 6016 6747 CDS product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158929.1 protein_id gnl|my_center|LOCUS_36490 6761 7216 gene locus_tag LOCUS_36500 6761 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36500 >Feature sequence191 <1 1249 gene locus_tag LOCUS_36510 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704325.1:energy-dependent translational throttle protein EttA 2194 1280 gene locus_tag LOCUS_36520 2194 1280 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095499.1 protein_id gnl|my_center|LOCUS_36520 2310 3311 gene locus_tag LOCUS_36530 2310 3311 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095498.1 protein_id gnl|my_center|LOCUS_36530 4942 3356 gene locus_tag LOCUS_36540 gene lsrK 4942 3356 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703560.1 protein_id gnl|my_center|LOCUS_36540 5309 4986 gene locus_tag LOCUS_36550 5309 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 5818 5306 gene locus_tag LOCUS_36560 5818 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 6037 7233 gene locus_tag LOCUS_36570 6037 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 7068 7171 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7184 7468 gene locus_tag LOCUS_36580 7184 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence192 431 1990 gene locus_tag LOCUS_36590 431 1990 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861179.1 protein_id gnl|my_center|LOCUS_36590 1994 2746 gene locus_tag LOCUS_36600 1994 2746 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925505.1 protein_id gnl|my_center|LOCUS_36600 2731 3675 gene locus_tag LOCUS_36610 2731 3675 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361636.1 protein_id gnl|my_center|LOCUS_36610 4691 3672 gene locus_tag LOCUS_36620 gene malI 4691 3672 CDS product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169835.1 protein_id gnl|my_center|LOCUS_36620 5140 5559 gene locus_tag LOCUS_36630 gene psiE 5140 5559 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202900.1 protein_id gnl|my_center|LOCUS_36630 6543 5653 gene locus_tag LOCUS_36640 gene malG 6543 5653 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368774.1 protein_id gnl|my_center|LOCUS_36640 7511 6555 gene locus_tag LOCUS_36650 7511 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36650 >Feature sequence193 1572 2411 gene locus_tag LOCUS_36660 1572 2411 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266520.1 protein_id gnl|my_center|LOCUS_36660 3223 2414 gene locus_tag LOCUS_36670 3223 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 3485 3213 gene locus_tag LOCUS_36680 3485 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 4793 3507 gene locus_tag LOCUS_36690 4793 3507 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209057.1 protein_id gnl|my_center|LOCUS_36690 5044 6003 gene locus_tag LOCUS_36700 5044 6003 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209056.1 protein_id gnl|my_center|LOCUS_36700 6660 6049 gene locus_tag LOCUS_36710 6660 6049 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198752.1 protein_id gnl|my_center|LOCUS_36710 7583 6786 gene locus_tag LOCUS_36720 7583 6786 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383134.1 protein_id gnl|my_center|LOCUS_36720 >Feature sequence194 <1 808 gene locus_tag LOCUS_36730 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001041008.1:DNA-binding transcriptional regulator YhaJ 1201 836 gene locus_tag LOCUS_36740 1201 836 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369567.1 protein_id gnl|my_center|LOCUS_36740 2317 1331 gene locus_tag LOCUS_36750 gene yqjG 2317 1331 CDS product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531180.1 protein_id gnl|my_center|LOCUS_36750 2777 2385 gene locus_tag LOCUS_36760 2777 2385 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603618.1 protein_id gnl|my_center|LOCUS_36760 3264 2974 gene locus_tag LOCUS_36770 3264 2974 CDS product YqjK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095496.1 protein_id gnl|my_center|LOCUS_36770 3659 3261 gene locus_tag LOCUS_36780 3659 3261 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 protein_id gnl|my_center|LOCUS_36780 3963 3661 gene locus_tag LOCUS_36790 3963 3661 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031219.1 protein_id gnl|my_center|LOCUS_36790 4365 3997 gene locus_tag LOCUS_36800 gene yqjC 4365 3997 CDS product DUF1090 family protein YqjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298323.1 protein_id gnl|my_center|LOCUS_36800 4887 4510 gene locus_tag LOCUS_36810 gene mzrA 4887 4510 CDS product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703569.1 protein_id gnl|my_center|LOCUS_36810 5554 4892 gene locus_tag LOCUS_36820 gene yqjA 5554 4892 CDS product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422149.1 protein_id gnl|my_center|LOCUS_36820 6655 5876 gene locus_tag LOCUS_36830 gene exuR 6655 5876 CDS product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098862.1 protein_id gnl|my_center|LOCUS_36830 <7781 6781 gene locus_tag LOCUS_36840 <7781 6781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703568.1:hexuronate transporter ExuT >Feature sequence195 400 528 gene locus_tag LOCUS_36850 400 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 954 1526 gene locus_tag LOCUS_36860 gene pth 954 1526 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096226.1 protein_id gnl|my_center|LOCUS_36860 1665 2756 gene locus_tag LOCUS_36870 gene ychF 1665 2756 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 protein_id gnl|my_center|LOCUS_36870 3155 2811 gene locus_tag LOCUS_36880 gene yajD 3155 2811 CDS product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808895.1 protein_id gnl|my_center|LOCUS_36880 3308 3553 gene locus_tag LOCUS_36890 3308 3553 CDS product YmjA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015110.1 protein_id gnl|my_center|LOCUS_36890 4026 3643 gene locus_tag LOCUS_36900 4026 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36900 4388 4023 gene locus_tag LOCUS_36910 4388 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36910 4574 6958 gene locus_tag LOCUS_36920 4574 6958 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965926.1 protein_id gnl|my_center|LOCUS_36920 <7737 6955 gene locus_tag LOCUS_36930 <7737 6955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094912.1:MFS transporter >Feature sequence196 660 178 gene locus_tag LOCUS_36940 660 178 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301248.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36940 1301 723 gene locus_tag LOCUS_36950 gene terD 1301 723 CDS product tellurium resistance membrane protein TerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116677.1 protein_id gnl|my_center|LOCUS_36950 2393 1350 gene locus_tag LOCUS_36960 gene terC 2393 1350 CDS product tellurium resistance membrane protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255079.1 protein_id gnl|my_center|LOCUS_36960 2871 2416 gene locus_tag LOCUS_36970 2871 2416 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007449.1 protein_id gnl|my_center|LOCUS_36970 4033 2894 gene locus_tag LOCUS_36980 4033 2894 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054789.1 protein_id gnl|my_center|LOCUS_36980 4617 4030 gene locus_tag LOCUS_36990 4617 4030 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254140.1 protein_id gnl|my_center|LOCUS_36990 4944 6020 gene locus_tag LOCUS_37000 4944 6020 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035169.1 protein_id gnl|my_center|LOCUS_37000 6013 7035 gene locus_tag LOCUS_37010 6013 7035 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285478.1 protein_id gnl|my_center|LOCUS_37010 >Feature sequence197 1491 139 gene locus_tag LOCUS_37020 1491 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37020 174 181 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1798 1475 gene locus_tag LOCUS_37030 1798 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37030 1994 3328 gene locus_tag LOCUS_37040 gene adeQ 1994 3328 CDS product adenine permease AdeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001513042.1 protein_id gnl|my_center|LOCUS_37040 3671 3411 gene locus_tag LOCUS_37050 gene ybiJ 3671 3411 CDS product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367588.1 protein_id gnl|my_center|LOCUS_37050 4336 4076 gene locus_tag LOCUS_37060 gene mcbA 4336 4076 CDS product DUF1471 family periplasmic protein McbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710619.1 protein_id gnl|my_center|LOCUS_37060 4715 5476 gene locus_tag LOCUS_37070 gene rlmF 4715 5476 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275941.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37070 7445 5631 gene locus_tag LOCUS_37080 gene ybiO 7445 5631 CDS product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097466.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37080 7455 7549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence198 411 453 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1340 654 gene locus_tag LOCUS_37090 1340 654 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367886.1 protein_id gnl|my_center|LOCUS_37090 1278 1937 gene locus_tag LOCUS_37100 gene tesA 1278 1937 CDS product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 protein_id gnl|my_center|LOCUS_37100 1966 2736 gene locus_tag LOCUS_37110 1966 2736 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095912.1 protein_id gnl|my_center|LOCUS_37110 2796 2984 gene locus_tag LOCUS_37120 2796 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37120 2935 3660 gene locus_tag LOCUS_37130 2935 3660 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095911.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37130 3916 4722 gene locus_tag LOCUS_37140 3916 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 5259 6173 gene locus_tag LOCUS_37150 5259 6173 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906145.1 protein_id gnl|my_center|LOCUS_37150 6170 6595 gene locus_tag LOCUS_37160 6170 6595 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561177.1 protein_id gnl|my_center|LOCUS_37160 7057 6641 gene locus_tag LOCUS_37170 gene cueR 7057 6641 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095907.1 protein_id gnl|my_center|LOCUS_37170 7399 7534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence199 3 710 gene locus_tag LOCUS_37180 3 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 862 1512 gene locus_tag LOCUS_37190 862 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37190 1460 1849 gene locus_tag LOCUS_37200 1460 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37200 1868 2170 gene locus_tag LOCUS_37210 1868 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37210 2557 2621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3010 2663 gene locus_tag LOCUS_37220 3010 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37220 2944 2955 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3350 3216 gene locus_tag LOCUS_37230 3350 3216 CDS product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705564.1 protein_id gnl|my_center|LOCUS_37230 4360 3350 gene locus_tag LOCUS_37240 gene cydB 4360 3350 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151052.1 protein_id gnl|my_center|LOCUS_37240 5763 4360 gene locus_tag LOCUS_37250 5763 4360 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393706.1 protein_id gnl|my_center|LOCUS_37250 6723 6121 gene locus_tag LOCUS_37260 gene dmsD 6723 6121 CDS product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705291.1 protein_id gnl|my_center|LOCUS_37260 7596 6733 gene locus_tag LOCUS_37270 7596 6733 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247794.1 protein_id gnl|my_center|LOCUS_37270 >Feature sequence200 <1 558 gene locus_tag LOCUS_37280 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001214346.1:NapC/NirT family cytochrome c 587 2413 gene locus_tag LOCUS_37290 587 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37290 2298 2885 gene locus_tag LOCUS_37300 2298 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37300 2904 3035 gene locus_tag LOCUS_37310 2904 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37310 3469 3080 gene locus_tag LOCUS_37320 3469 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37320 4233 3796 gene locus_tag LOCUS_37330 4233 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37330 4439 4678 gene locus_tag LOCUS_37340 4439 4678 CDS product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377230.1 protein_id gnl|my_center|LOCUS_37340 5206 4709 gene locus_tag LOCUS_37350 gene ftnA 5206 4709 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365960.1 protein_id gnl|my_center|LOCUS_37350 5790 5446 gene locus_tag LOCUS_37360 5790 5446 CDS product YecR-like lipofamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803230.1 protein_id gnl|my_center|LOCUS_37360 6011 6649 gene locus_tag LOCUS_37370 6011 6649 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096040.1 protein_id gnl|my_center|LOCUS_37370 <7603 6685 gene locus_tag LOCUS_37380 <7603 6685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705969.1:MFS transporter >Feature sequence201 231 1013 gene locus_tag LOCUS_37390 231 1013 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097114.1 protein_id gnl|my_center|LOCUS_37390 1319 2296 gene locus_tag LOCUS_37400 1319 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37400 2211 2732 gene locus_tag LOCUS_37410 2211 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37410 3799 2849 gene locus_tag LOCUS_37420 3799 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37420 4992 3799 gene locus_tag LOCUS_37430 4992 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37430 5404 6453 gene locus_tag LOCUS_37440 5404 6453 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 protein_id gnl|my_center|LOCUS_37440 6640 6999 gene locus_tag LOCUS_37450 gene hinT 6640 6999 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097111.1 protein_id gnl|my_center|LOCUS_37450 7001 7375 gene locus_tag LOCUS_37460 7001 7375 CDS product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225291.1 protein_id gnl|my_center|LOCUS_37460 >Feature sequence202 <1 568 gene locus_tag LOCUS_37470 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557877.1:ADP-ribosylglycohydrolase family protein 604 1326 gene locus_tag LOCUS_37480 604 1326 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764005.1 protein_id gnl|my_center|LOCUS_37480 1411 1860 gene locus_tag LOCUS_37490 1411 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37490 1860 2654 gene locus_tag LOCUS_37500 1860 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37500 3466 2699 gene locus_tag LOCUS_37510 gene tpiA 3466 2699 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862019.1 protein_id gnl|my_center|LOCUS_37510 4173 3574 gene locus_tag LOCUS_37520 4173 3574 CDS product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369137.1 protein_id gnl|my_center|LOCUS_37520 4284 4703 gene locus_tag LOCUS_37530 4284 4703 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155257.1 protein_id gnl|my_center|LOCUS_37530 5451 4705 gene locus_tag LOCUS_37540 gene fpr 5451 4705 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796330.1 protein_id gnl|my_center|LOCUS_37540 6561 5545 gene locus_tag LOCUS_37550 gene glpX 6561 5545 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250644.1 protein_id gnl|my_center|LOCUS_37550 6997 6677 gene locus_tag LOCUS_37560 6997 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 <7524 6888 gene locus_tag LOCUS_37570 <7524 6888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000137244.1:glycerol kinase GlpK 7124 7145 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence203 1822 905 gene locus_tag LOCUS_37580 1822 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37580 2527 1844 gene locus_tag LOCUS_37590 2527 1844 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211998.1 protein_id gnl|my_center|LOCUS_37590 3010 2570 gene locus_tag LOCUS_37600 3010 2570 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176232.1 protein_id gnl|my_center|LOCUS_37600 4595 3543 gene locus_tag LOCUS_37610 gene fbaB 4595 3543 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129551.1 protein_id gnl|my_center|LOCUS_37610 4838 6115 gene locus_tag LOCUS_37620 4838 6115 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 protein_id gnl|my_center|LOCUS_37620 6112 7110 gene locus_tag LOCUS_37630 6112 7110 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097909.1 protein_id gnl|my_center|LOCUS_37630 >Feature sequence204 <1 591 gene locus_tag LOCUS_37640 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096416.1:ABC transporter ATP-binding protein 1361 588 gene locus_tag LOCUS_37650 1361 588 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095552.1 protein_id gnl|my_center|LOCUS_37650 2336 1485 gene locus_tag LOCUS_37660 gene araC 2336 1485 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095551.1 protein_id gnl|my_center|LOCUS_37660 2676 4154 gene locus_tag LOCUS_37670 gene araB 2676 4154 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095550.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37670 4147 4347 gene locus_tag LOCUS_37680 4147 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37680 4358 5803 gene locus_tag LOCUS_37690 gene araA 4358 5803 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151734.1 protein_id gnl|my_center|LOCUS_37690 5863 6558 gene locus_tag LOCUS_37700 gene araD 5863 6558 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888666.1 protein_id gnl|my_center|LOCUS_37700 6641 7312 gene locus_tag LOCUS_37710 6641 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37710 >Feature sequence205 456 1124 gene locus_tag LOCUS_37720 gene narI 456 1124 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617139.1 protein_id gnl|my_center|LOCUS_37720 1707 1144 gene locus_tag LOCUS_37730 gene smrA 1707 1144 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046824.1 protein_id gnl|my_center|LOCUS_37730 2159 1980 gene locus_tag LOCUS_37740 2159 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 2239 2754 gene locus_tag LOCUS_37750 gene ogt 2239 2754 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096864.1 protein_id gnl|my_center|LOCUS_37750 2922 3674 gene locus_tag LOCUS_37760 gene fnr 2922 3674 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 protein_id gnl|my_center|LOCUS_37760 3812 4762 gene locus_tag LOCUS_37770 gene uspE 3812 4762 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096866.1 protein_id gnl|my_center|LOCUS_37770 4888 5910 gene locus_tag LOCUS_37780 4888 5910 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075361.1 protein_id gnl|my_center|LOCUS_37780 6898 5975 gene locus_tag LOCUS_37790 6898 5975 CDS product OmpG family monomeric porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419574.1 protein_id gnl|my_center|LOCUS_37790 >Feature sequence206 315 1457 gene locus_tag LOCUS_37800 315 1457 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 protein_id gnl|my_center|LOCUS_37800 1644 2267 gene locus_tag LOCUS_37810 1644 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 2150 2836 gene locus_tag LOCUS_37820 2150 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 2806 3615 gene locus_tag LOCUS_37830 2806 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 3637 5508 gene locus_tag LOCUS_37840 3637 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 6194 5547 gene locus_tag LOCUS_37850 6194 5547 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651594.1 protein_id gnl|my_center|LOCUS_37850 6195 6212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6351 6779 gene locus_tag LOCUS_37860 6351 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37860 6901 7206 gene locus_tag LOCUS_37870 6901 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37870 >Feature sequence207 928 242 gene locus_tag LOCUS_37880 928 242 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974074.1 protein_id gnl|my_center|LOCUS_37880 1618 941 gene locus_tag LOCUS_37890 1618 941 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383131.1 protein_id gnl|my_center|LOCUS_37890 2541 1633 gene locus_tag LOCUS_37900 2541 1633 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_37900 2906 2541 gene locus_tag LOCUS_37910 gene rpiB 2906 2541 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525805.1 protein_id gnl|my_center|LOCUS_37910 3673 2930 gene locus_tag LOCUS_37920 3673 2930 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525813.1 protein_id gnl|my_center|LOCUS_37920 4362 4655 gene locus_tag LOCUS_37930 4362 4655 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110456.1 protein_id gnl|my_center|LOCUS_37930 4877 5140 gene locus_tag LOCUS_37940 4877 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 5317 5610 gene locus_tag LOCUS_37950 5317 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37950 5988 6215 gene locus_tag LOCUS_37960 5988 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 6184 6486 gene locus_tag LOCUS_37970 6184 6486 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 protein_id gnl|my_center|LOCUS_37970 6675 7352 gene locus_tag LOCUS_37980 6675 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37980 >Feature sequence208 <1 1480 gene locus_tag LOCUS_37990 <1 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000467180.1:cytochrome o ubiquinol oxidase subunit I 1470 2090 gene locus_tag LOCUS_38000 1470 2090 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179831.1 protein_id gnl|my_center|LOCUS_38000 2090 2419 gene locus_tag LOCUS_38010 2090 2419 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 protein_id gnl|my_center|LOCUS_38010 2431 3318 gene locus_tag LOCUS_38020 gene cyoE 2431 3318 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095848.1 protein_id gnl|my_center|LOCUS_38020 3458 4825 gene locus_tag LOCUS_38030 3458 4825 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216662111.1 protein_id gnl|my_center|LOCUS_38030 5343 4852 gene locus_tag LOCUS_38040 5343 4852 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503327.1 protein_id gnl|my_center|LOCUS_38040 5457 6371 gene locus_tag LOCUS_38050 gene panE 5457 6371 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705865.1 protein_id gnl|my_center|LOCUS_38050 6331 6921 gene locus_tag LOCUS_38060 gene yajL 6331 6921 CDS product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367984.1 protein_id gnl|my_center|LOCUS_38060 >Feature sequence209 1639 710 gene locus_tag LOCUS_38070 gene ilvE 1639 710 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208528.1 protein_id gnl|my_center|LOCUS_38070 1925 1656 gene locus_tag LOCUS_38080 gene ilvM 1925 1656 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368897.1 protein_id gnl|my_center|LOCUS_38080 3487 1922 gene locus_tag LOCUS_38090 gene ilvG 3487 1922 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703962.1 protein_id gnl|my_center|LOCUS_38090 4142 5662 gene locus_tag LOCUS_38100 4142 5662 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058957.1 protein_id gnl|my_center|LOCUS_38100 6026 5688 gene locus_tag LOCUS_38110 gene maoP 6026 5688 CDS product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 protein_id gnl|my_center|LOCUS_38110 6146 6967 gene locus_tag LOCUS_38120 gene hdfR 6146 6967 CDS product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379246.1 protein_id gnl|my_center|LOCUS_38120 >Feature sequence210 577 822 gene locus_tag LOCUS_38130 577 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705919.1 protein_id gnl|my_center|LOCUS_38130 833 961 gene locus_tag LOCUS_38140 833 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 1355 1552 gene locus_tag LOCUS_38150 1355 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 1619 1864 gene locus_tag LOCUS_38160 1619 1864 CDS product excisionase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065276.1 protein_id gnl|my_center|LOCUS_38160 1910 2734 gene locus_tag LOCUS_38170 1910 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38170 2757 3167 gene locus_tag LOCUS_38180 2757 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38180 3514 3203 gene locus_tag LOCUS_38190 gene fliE 3514 3203 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097729.1 protein_id gnl|my_center|LOCUS_38190 3676 5343 gene locus_tag LOCUS_38200 gene fliF 3676 5343 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097730.1 protein_id gnl|my_center|LOCUS_38200 5340 6335 gene locus_tag LOCUS_38210 gene fliG 5340 6335 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500327.1 protein_id gnl|my_center|LOCUS_38210 >Feature sequence211 1173 154 gene locus_tag LOCUS_38220 gene dppB 1173 154 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938843.1 protein_id gnl|my_center|LOCUS_38220 1877 1392 gene locus_tag LOCUS_38230 1877 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38230 2865 1897 gene locus_tag LOCUS_38240 2865 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38240 3622 4356 gene locus_tag LOCUS_38250 3622 4356 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470719.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38250 5324 4494 gene locus_tag LOCUS_38260 5324 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 5564 6223 gene locus_tag LOCUS_38270 5564 6223 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194414.1 protein_id gnl|my_center|LOCUS_38270 >Feature sequence212 1636 1115 gene locus_tag LOCUS_38280 1636 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38280 2081 1590 gene locus_tag LOCUS_38290 2081 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38290 3151 2078 gene locus_tag LOCUS_38300 gene ftsW 3151 2078 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239803.1 protein_id gnl|my_center|LOCUS_38300 3248 3069 gene locus_tag LOCUS_38310 3248 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 4564 3248 gene locus_tag LOCUS_38320 gene murD 4564 3248 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796441.1 protein_id gnl|my_center|LOCUS_38320 5577 4567 gene locus_tag LOCUS_38330 gene mraY 5577 4567 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964131.1 protein_id gnl|my_center|LOCUS_38330 6044 5571 gene locus_tag LOCUS_38340 6044 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38340 <6754 5999 gene locus_tag LOCUS_38350 <6754 5999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000626688.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase note possible pseudo, frameshifted >Feature sequence213 82 7 gene locus_tag LOCUS_t00290 82 7 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1676 222 gene locus_tag LOCUS_38360 1676 222 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428186.1 protein_id gnl|my_center|LOCUS_38360 2073 3188 gene locus_tag LOCUS_38370 2073 3188 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366474.1 protein_id gnl|my_center|LOCUS_38370 3284 4198 gene locus_tag LOCUS_38380 3284 4198 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705514.1 protein_id gnl|my_center|LOCUS_38380 4209 5531 gene locus_tag LOCUS_38390 gene livM 4209 5531 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705513.1 protein_id gnl|my_center|LOCUS_38390 5467 6321 gene locus_tag LOCUS_38400 5467 6321 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366477.1 protein_id gnl|my_center|LOCUS_38400 >Feature sequence214 1196 288 gene locus_tag LOCUS_38410 1196 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38410 2817 1210 gene locus_tag LOCUS_38420 2817 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38420 4130 2814 gene locus_tag LOCUS_38430 4130 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38430 4334 4939 gene locus_tag LOCUS_38440 gene azoR 4334 4939 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096706.1 protein_id gnl|my_center|LOCUS_38440 5326 4997 gene locus_tag LOCUS_38450 5326 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 5617 5405 gene locus_tag LOCUS_38460 5617 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 <6692 5614 gene locus_tag LOCUS_38470 <6692 5614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096772.1:YdbH family protein >Feature sequence215 354 37 gene locus_tag LOCUS_38480 354 37 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704005.1 protein_id gnl|my_center|LOCUS_38480 617 357 gene locus_tag LOCUS_38490 617 357 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704006.1 protein_id gnl|my_center|LOCUS_38490 857 2182 gene locus_tag LOCUS_38500 gene celB 857 2182 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 protein_id gnl|my_center|LOCUS_38500 2197 3255 gene locus_tag LOCUS_38510 2197 3255 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726689.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38510 3252 3500 gene locus_tag LOCUS_38520 3252 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38520 4220 3477 gene locus_tag LOCUS_38530 4220 3477 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476241.1 protein_id gnl|my_center|LOCUS_38530 4308 5453 gene locus_tag LOCUS_38540 4308 5453 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209877.1 protein_id gnl|my_center|LOCUS_38540 6613 5486 gene locus_tag LOCUS_38550 gene thiH 6613 5486 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847432.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence216 275 348 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1159 374 gene locus_tag LOCUS_38560 gene znuB 1159 374 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096087.1 protein_id gnl|my_center|LOCUS_38560 1911 1156 gene locus_tag LOCUS_38570 gene znuC 1911 1156 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832401.1 protein_id gnl|my_center|LOCUS_38570 2050 2934 gene locus_tag LOCUS_38580 gene znuA 2050 2934 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001376899.1 protein_id gnl|my_center|LOCUS_38580 2950 4125 gene locus_tag LOCUS_38590 gene mepM 2950 4125 CDS product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184019.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38590 4013 4216 gene locus_tag LOCUS_38600 4013 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38600 4342 5316 gene locus_tag LOCUS_38610 gene lpxM 4342 5316 CDS product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032705956.1 protein_id gnl|my_center|LOCUS_38610 5694 5431 gene locus_tag LOCUS_38620 5694 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 <6676 6080 gene locus_tag LOCUS_38630 <6676 6080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096092.1:pyruvate kinase >Feature sequence217 1395 259 gene locus_tag LOCUS_38640 1395 259 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047447.1 protein_id gnl|my_center|LOCUS_38640 2805 1729 gene locus_tag LOCUS_38650 2805 1729 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096471.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38650 2858 2987 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3364 3768 gene locus_tag LOCUS_38660 3364 3768 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704153.1 protein_id gnl|my_center|LOCUS_38660 5018 3801 gene locus_tag LOCUS_38670 5018 3801 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090144.1 protein_id gnl|my_center|LOCUS_38670 5870 5022 gene locus_tag LOCUS_38680 5870 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38680 6286 5831 gene locus_tag LOCUS_38690 6286 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38690 >Feature sequence218 300 442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1128 580 gene locus_tag LOCUS_38700 1128 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 2004 1222 gene locus_tag LOCUS_38710 gene hisJ 2004 1222 CDS product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737621.1 protein_id gnl|my_center|LOCUS_38710 3034 2279 gene locus_tag LOCUS_38720 gene argT 3034 2279 CDS product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098132.1 protein_id gnl|my_center|LOCUS_38720 3549 3307 gene locus_tag LOCUS_38730 3549 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38730 3827 3564 gene locus_tag LOCUS_38740 3827 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38740 3580 3585 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4284 3979 gene locus_tag LOCUS_38750 4284 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 5417 4248 gene locus_tag LOCUS_38760 5417 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 4286 4296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5941 5456 gene locus_tag LOCUS_38770 gene cvpA 5941 5456 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 protein_id gnl|my_center|LOCUS_38770 >Feature sequence219 2321 1338 gene locus_tag LOCUS_38780 gene pheS 2321 1338 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367044.1 protein_id gnl|my_center|LOCUS_38780 2970 2614 gene locus_tag LOCUS_38790 gene rplT 2970 2614 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 protein_id gnl|my_center|LOCUS_38790 3215 3018 gene locus_tag LOCUS_38800 gene rpmI 3215 3018 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 protein_id gnl|my_center|LOCUS_38800 3737 3303 gene locus_tag LOCUS_38810 gene infC 3737 3303 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 protein_id gnl|my_center|LOCUS_38810 5699 3849 gene locus_tag LOCUS_38820 gene thrS 5699 3849 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144226.1 protein_id gnl|my_center|LOCUS_38820 >Feature sequence220 781 260 gene locus_tag LOCUS_38830 781 260 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132914.1 protein_id gnl|my_center|LOCUS_38830 1862 816 gene locus_tag LOCUS_38840 1862 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38840 2766 1828 gene locus_tag LOCUS_38850 2766 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38850 3069 4415 gene locus_tag LOCUS_38860 3069 4415 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529494.1 protein_id gnl|my_center|LOCUS_38860 4426 4617 gene locus_tag LOCUS_38870 4426 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 4608 5000 gene locus_tag LOCUS_38880 4608 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 5050 5958 gene locus_tag LOCUS_38890 5050 5958 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969842.1 protein_id gnl|my_center|LOCUS_38890 6007 6252 gene locus_tag LOCUS_38900 6007 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38900 >Feature sequence221 2149 629 gene locus_tag LOCUS_38910 gene nikA 2149 629 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493127.1 protein_id gnl|my_center|LOCUS_38910 2556 2900 gene locus_tag LOCUS_38920 2556 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38920 2901 3698 gene locus_tag LOCUS_38930 2901 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38930 3831 4019 gene locus_tag LOCUS_38940 3831 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 4016 4300 gene locus_tag LOCUS_38950 4016 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 4935 4315 gene locus_tag LOCUS_38960 4935 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 5502 4981 gene locus_tag LOCUS_38970 5502 4981 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096965.1 protein_id gnl|my_center|LOCUS_38970 6192 5515 gene locus_tag LOCUS_38980 6192 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38980 >Feature sequence222 294 100 gene locus_tag LOCUS_38990 294 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38990 1822 281 gene locus_tag LOCUS_39000 gene proS 1822 281 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260716.1 protein_id gnl|my_center|LOCUS_39000 2636 1929 gene locus_tag LOCUS_39010 gene tsaA 2636 1929 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095676.1 protein_id gnl|my_center|LOCUS_39010 3037 2633 gene locus_tag LOCUS_39020 gene rcsF 3037 2633 CDS product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202315.1 protein_id gnl|my_center|LOCUS_39020 3968 3153 gene locus_tag LOCUS_39030 gene metQ 3968 3153 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 protein_id gnl|my_center|LOCUS_39030 4654 4001 gene locus_tag LOCUS_39040 4654 4001 CDS product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 protein_id gnl|my_center|LOCUS_39040 5678 4647 gene locus_tag LOCUS_39050 gene metN 5678 4647 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095679.1 protein_id gnl|my_center|LOCUS_39050 5868 6014 gene locus_tag LOCUS_39060 5868 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39060 >Feature sequence223 97 447 gene locus_tag LOCUS_39070 97 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39070 450 1493 gene locus_tag LOCUS_39080 450 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39080 1465 2424 gene locus_tag LOCUS_39090 1465 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39090 2421 3380 gene locus_tag LOCUS_39100 2421 3380 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096060.1 protein_id gnl|my_center|LOCUS_39100 3479 5026 gene locus_tag LOCUS_39110 gene tar 3479 5026 CDS product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096061.1 protein_id gnl|my_center|LOCUS_39110 6222 5023 gene locus_tag LOCUS_39120 6222 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 >Feature sequence224 56 835 gene locus_tag LOCUS_39130 56 835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_39130 207 270 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 828 1301 gene locus_tag LOCUS_39140 828 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39140 1319 1546 gene locus_tag LOCUS_39150 1319 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39150 1663 2730 gene locus_tag LOCUS_39160 1663 2730 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524498.1 protein_id gnl|my_center|LOCUS_39160 2745 3230 gene locus_tag LOCUS_39170 2745 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 3227 4279 gene locus_tag LOCUS_39180 3227 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 4758 6287 gene locus_tag LOCUS_39190 4758 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39190 6060 6181 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence225 <1 573 gene locus_tag LOCUS_39200 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877056.1:ornithine carbamoyltransferase 662 2098 gene locus_tag LOCUS_39210 662 2098 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_39210 2151 3002 gene locus_tag LOCUS_39220 2151 3002 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963698.1 protein_id gnl|my_center|LOCUS_39220 3126 4052 gene locus_tag LOCUS_39230 gene arcC 3126 4052 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100033.1 protein_id gnl|my_center|LOCUS_39230 4179 5564 gene locus_tag LOCUS_39240 4179 5564 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_39240 6044 5610 gene locus_tag LOCUS_39250 gene tpx 6044 5610 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096423.1 protein_id gnl|my_center|LOCUS_39250 >Feature sequence226 3 158 gene locus_tag LOCUS_39260 3 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 155 604 gene locus_tag LOCUS_39270 155 604 CDS product beta-galactosidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004900777.1 protein_id gnl|my_center|LOCUS_39270 727 2160 gene locus_tag LOCUS_39280 727 2160 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369594.1 protein_id gnl|my_center|LOCUS_39280 2198 3202 gene locus_tag LOCUS_39290 gene ygjJ 2198 3202 CDS product protein YgjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703555.1 protein_id gnl|my_center|LOCUS_39290 3278 5629 gene locus_tag LOCUS_39300 gene ygjK 3278 5629 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703556.1 protein_id gnl|my_center|LOCUS_39300 5929 5669 gene locus_tag LOCUS_39310 5929 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39310 >Feature sequence227 633 19 gene locus_tag LOCUS_39320 633 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 1166 888 gene locus_tag LOCUS_39330 1166 888 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132230.1 protein_id gnl|my_center|LOCUS_39330 1372 1674 gene locus_tag LOCUS_39340 1372 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 1980 2141 gene locus_tag LOCUS_39350 gene kil 1980 2141 CDS product host cell division inhibitory peptide Kil inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098077.1 protein_id gnl|my_center|LOCUS_39350 2075 2242 gene locus_tag LOCUS_39360 2075 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 2239 2421 gene locus_tag LOCUS_39370 2239 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 2430 3167 gene locus_tag LOCUS_39380 2430 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 3168 3581 gene locus_tag LOCUS_39390 gene ssb1 3168 3581 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168305.1 protein_id gnl|my_center|LOCUS_39390 3709 3930 gene locus_tag LOCUS_39400 3709 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 3941 4105 gene locus_tag LOCUS_39410 3941 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 4102 4602 gene locus_tag LOCUS_39420 4102 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 4599 4874 gene locus_tag LOCUS_39430 4599 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 4871 5566 gene locus_tag LOCUS_39440 4871 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 5572 5877 gene locus_tag LOCUS_39450 5572 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098055.1 protein_id gnl|my_center|LOCUS_39450 >Feature sequence228 158 244 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 282 1286 gene locus_tag LOCUS_39460 gene hybA 282 1286 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081721.1 protein_id gnl|my_center|LOCUS_39460 1279 2454 gene locus_tag LOCUS_39470 gene hybB 1279 2454 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017694.1 protein_id gnl|my_center|LOCUS_39470 2451 4151 gene locus_tag LOCUS_39480 gene hybC 2451 4151 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817177.1 protein_id gnl|my_center|LOCUS_39480 4151 4648 gene locus_tag LOCUS_39490 4151 4648 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173947.1 protein_id gnl|my_center|LOCUS_39490 4633 5121 gene locus_tag LOCUS_39500 gene hybE 4633 5121 CDS product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173946.1 protein_id gnl|my_center|LOCUS_39500 5145 5393 gene locus_tag LOCUS_39510 gene hybG 5145 5393 CDS product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817175.1 protein_id gnl|my_center|LOCUS_39510 5733 5452 gene locus_tag LOCUS_39520 gene ilvN 5733 5452 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171826.1 protein_id gnl|my_center|LOCUS_39520 >Feature sequence229 2268 1117 gene locus_tag LOCUS_39530 gene flhB 2268 1117 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797087.1 protein_id gnl|my_center|LOCUS_39530 2871 3854 gene locus_tag LOCUS_39540 2871 3854 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816705.1 protein_id gnl|my_center|LOCUS_39540 3961 5442 gene locus_tag LOCUS_39550 3961 5442 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081001.1 protein_id gnl|my_center|LOCUS_39550 5435 5896 gene locus_tag LOCUS_39560 5435 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39560 >Feature sequence230 <1 571 gene locus_tag LOCUS_39570 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001116587.1:thiamine kinase note possible pseudo, internal stop codon 647 1276 gene locus_tag LOCUS_39580 647 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39580 1318 1644 gene locus_tag LOCUS_39590 1318 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39590 1678 2220 gene locus_tag LOCUS_39600 gene ycfP 1678 2220 CDS product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367178.1 protein_id gnl|my_center|LOCUS_39600 2444 3748 gene locus_tag LOCUS_39610 2444 3748 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097105.1 protein_id gnl|my_center|LOCUS_39610 3941 4480 gene locus_tag LOCUS_39620 3941 4480 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043459.1 protein_id gnl|my_center|LOCUS_39620 4709 4560 gene locus_tag LOCUS_39630 4709 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 5783 5067 gene locus_tag LOCUS_39640 5783 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39640 5878 5896 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence231 1312 524 gene locus_tag LOCUS_39650 1312 524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 protein_id gnl|my_center|LOCUS_39650 2210 1323 gene locus_tag LOCUS_39660 gene ntrB 2210 1323 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 protein_id gnl|my_center|LOCUS_39660 3469 2207 gene locus_tag LOCUS_39670 3469 2207 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705089.1 protein_id gnl|my_center|LOCUS_39670 4710 3694 gene locus_tag LOCUS_39680 gene nasR 4710 3694 CDS product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096246.1 protein_id gnl|my_center|LOCUS_39680 4355 4371 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4795 5133 gene locus_tag LOCUS_39690 4795 5133 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705087.1 protein_id gnl|my_center|LOCUS_39690 5458 5694 gene locus_tag LOCUS_39700 5458 5694 CDS product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705086.1 protein_id gnl|my_center|LOCUS_39700 >Feature sequence232 711 490 gene locus_tag LOCUS_39710 711 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39710 953 2008 gene locus_tag LOCUS_39720 gene iap 953 2008 CDS product alkaline phosphatase isozyme conversion aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490413.1 protein_id gnl|my_center|LOCUS_39720 2222 2070 gene locus_tag LOCUS_39730 2222 2070 CDS product Hok/Gef family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956460.1 protein_id gnl|my_center|LOCUS_39730 3217 2483 gene locus_tag LOCUS_39740 gene cysH 3217 2483 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098507.1 protein_id gnl|my_center|LOCUS_39740 4554 3238 gene locus_tag LOCUS_39750 gene cysI 4554 3238 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420501.1 protein_id gnl|my_center|LOCUS_39750 4864 4637 gene locus_tag LOCUS_39760 4864 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 5643 4864 gene locus_tag LOCUS_39770 5643 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39770 5793 5803 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence233 254 994 gene locus_tag LOCUS_39780 gene sufC 254 994 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948872.1 protein_id gnl|my_center|LOCUS_39780 969 1547 gene locus_tag LOCUS_39790 969 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39790 1658 2206 gene locus_tag LOCUS_39800 1658 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39800 2203 3279 gene locus_tag LOCUS_39810 gene sufS 2203 3279 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705131.1 protein_id gnl|my_center|LOCUS_39810 3193 3208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3357 3590 gene locus_tag LOCUS_39820 3357 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39820 3577 3771 gene locus_tag LOCUS_39830 3577 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39830 3872 4921 gene locus_tag LOCUS_39840 3872 4921 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165628.1 protein_id gnl|my_center|LOCUS_39840 5222 4986 gene locus_tag LOCUS_39850 gene lpp 5222 4986 CDS product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082307.1 protein_id gnl|my_center|LOCUS_39850 <6122 5530 gene locus_tag LOCUS_39860 <6122 5530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705134.1:pyruvate kinase PykF >Feature sequence234 699 1877 gene locus_tag LOCUS_39870 gene pdxB 699 1877 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706175.1 protein_id gnl|my_center|LOCUS_39870 1137 1188 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1945 2958 gene locus_tag LOCUS_39880 1945 2958 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098141.1 protein_id gnl|my_center|LOCUS_39880 2958 3770 gene locus_tag LOCUS_39890 gene truA 2958 3770 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098140.1 protein_id gnl|my_center|LOCUS_39890 3795 4454 gene locus_tag LOCUS_39900 3795 4454 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365553.1 protein_id gnl|my_center|LOCUS_39900 4626 5546 gene locus_tag LOCUS_39910 gene accD 4626 5546 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118383.1 protein_id gnl|my_center|LOCUS_39910 5718 5854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence235 300 420 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2218 725 gene locus_tag LOCUS_39920 gene tolC 2218 725 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098744.1 protein_id gnl|my_center|LOCUS_39920 2576 3064 gene locus_tag LOCUS_39930 gene nudF 2576 3064 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098743.1 protein_id gnl|my_center|LOCUS_39930 3067 3495 gene locus_tag LOCUS_39940 3067 3495 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862516.1 protein_id gnl|my_center|LOCUS_39940 3520 4347 gene locus_tag LOCUS_39950 gene cpdA 3520 4347 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098742.1 protein_id gnl|my_center|LOCUS_39950 4347 4922 gene locus_tag LOCUS_39960 gene yqiA 4347 4922 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 protein_id gnl|my_center|LOCUS_39960 >Feature sequence236 384 818 gene locus_tag LOCUS_39970 384 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 1939 815 gene locus_tag LOCUS_39980 gene sstT 1939 815 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211386.1 protein_id gnl|my_center|LOCUS_39980 1434 1479 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3285 2317 gene locus_tag LOCUS_39990 3285 2317 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703564.1 protein_id gnl|my_center|LOCUS_39990 3814 3458 gene locus_tag LOCUS_40000 3814 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40000 4412 3744 gene locus_tag LOCUS_40010 4412 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40010 4985 4485 gene locus_tag LOCUS_40020 4985 4485 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026744.1 protein_id gnl|my_center|LOCUS_40020 >Feature sequence237 221 359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 692 1960 gene locus_tag LOCUS_40030 692 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 2044 2508 gene locus_tag LOCUS_40040 2044 2508 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209795.1 protein_id gnl|my_center|LOCUS_40040 2856 3572 gene locus_tag LOCUS_40050 2856 3572 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096995.1 protein_id gnl|my_center|LOCUS_40050 3637 5082 gene locus_tag LOCUS_40060 gene selO 3637 5082 CDS product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175719.1 protein_id gnl|my_center|LOCUS_40060 5346 5083 gene locus_tag LOCUS_40070 5346 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40070 5810 5304 gene locus_tag LOCUS_40080 5810 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40080 >Feature sequence238 2703 2287 gene locus_tag LOCUS_40090 2703 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 3408 2731 gene locus_tag LOCUS_40100 gene kdpE 3408 2731 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367692.1 protein_id gnl|my_center|LOCUS_40100 5390 3405 gene locus_tag LOCUS_40110 5390 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40110 >Feature sequence239 1405 197 gene locus_tag LOCUS_40120 gene cydA 1405 197 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884372.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40120 1758 1420 gene locus_tag LOCUS_40130 1758 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40130 3289 2423 gene locus_tag LOCUS_40140 3289 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40140 4902 3286 gene locus_tag LOCUS_40150 4902 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40150 <5787 4915 gene locus_tag LOCUS_40160 <5787 4915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097538.1:PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC >Feature sequence240 1283 318 gene locus_tag LOCUS_40170 gene sapB 1283 318 CDS product peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583298.1 protein_id gnl|my_center|LOCUS_40170 2893 1280 gene locus_tag LOCUS_40180 gene sapA 2893 1280 CDS product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250215.1 protein_id gnl|my_center|LOCUS_40180 3991 3011 gene locus_tag LOCUS_40190 gene pspF 3991 3011 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298101.1 protein_id gnl|my_center|LOCUS_40190 4167 4835 gene locus_tag LOCUS_40200 gene pspA 4167 4835 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511000.1 protein_id gnl|my_center|LOCUS_40200 4892 5116 gene locus_tag LOCUS_40210 gene pspB 4892 5116 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274964.1 protein_id gnl|my_center|LOCUS_40210 5116 5475 gene locus_tag LOCUS_40220 gene pspC 5116 5475 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096405.1 protein_id gnl|my_center|LOCUS_40220 5494 5679 gene locus_tag LOCUS_40230 gene pspD 5494 5679 CDS product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295585.1 protein_id gnl|my_center|LOCUS_40230 >Feature sequence241 2694 1435 gene locus_tag LOCUS_40240 2694 1435 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267749.1 protein_id gnl|my_center|LOCUS_40240 3755 2841 gene locus_tag LOCUS_40250 3755 2841 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104205.1 protein_id gnl|my_center|LOCUS_40250 4032 4319 gene locus_tag LOCUS_40260 4032 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 4477 4689 gene locus_tag LOCUS_40270 4477 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 4996 4748 gene locus_tag LOCUS_40280 4996 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 >Feature sequence242 244 377 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1348 833 gene locus_tag LOCUS_40290 gene hscB 1348 833 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098293.1 protein_id gnl|my_center|LOCUS_40290 1817 1494 gene locus_tag LOCUS_40300 gene iscA 1817 1494 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540868.1 protein_id gnl|my_center|LOCUS_40300 2228 1842 gene locus_tag LOCUS_40310 gene iscU 2228 1842 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703172.1 protein_id gnl|my_center|LOCUS_40310 3471 2257 gene locus_tag LOCUS_40320 gene iscS 3471 2257 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 protein_id gnl|my_center|LOCUS_40320 4078 3590 gene locus_tag LOCUS_40330 gene iscR 4078 3590 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098294.1 protein_id gnl|my_center|LOCUS_40330 4948 4205 gene locus_tag LOCUS_40340 gene trmJ 4948 4205 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370313.1 protein_id gnl|my_center|LOCUS_40340 >Feature sequence243 131 1270 gene locus_tag LOCUS_40350 131 1270 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097611.1 protein_id gnl|my_center|LOCUS_40350 2187 1273 gene locus_tag LOCUS_40360 2187 1273 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097608.1 protein_id gnl|my_center|LOCUS_40360 3061 2303 gene locus_tag LOCUS_40370 gene dsbG 3061 2303 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597117.1 protein_id gnl|my_center|LOCUS_40370 3402 3965 gene locus_tag LOCUS_40380 gene ahpC 3402 3965 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859485.1 protein_id gnl|my_center|LOCUS_40380 4098 5666 gene locus_tag LOCUS_40390 gene ahpF 4098 5666 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314555.1 protein_id gnl|my_center|LOCUS_40390 >Feature sequence244 732 1562 gene locus_tag LOCUS_40400 732 1562 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_40400 2356 1577 gene locus_tag LOCUS_40410 gene rna 2356 1577 CDS product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097602.1 protein_id gnl|my_center|LOCUS_40410 3823 2450 gene locus_tag LOCUS_40420 gene dcuC 3823 2450 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958619.1 protein_id gnl|my_center|LOCUS_40420 4247 4651 gene locus_tag LOCUS_40430 4247 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817189.1 protein_id gnl|my_center|LOCUS_40430 4718 5053 gene locus_tag LOCUS_40440 4718 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 5381 5449 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence245 1168 389 gene locus_tag LOCUS_40450 1168 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40450 1767 2516 gene locus_tag LOCUS_40460 1767 2516 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099384.1 protein_id gnl|my_center|LOCUS_40460 3160 2537 gene locus_tag LOCUS_40470 gene dsbA 3160 2537 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368980.1 protein_id gnl|my_center|LOCUS_40470 4125 3187 gene locus_tag LOCUS_40480 gene srkA 4125 3187 CDS product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065519.1 protein_id gnl|my_center|LOCUS_40480 4518 4249 gene locus_tag LOCUS_40490 4518 4249 CDS product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 protein_id gnl|my_center|LOCUS_40490 4587 5159 gene locus_tag LOCUS_40500 gene mobA 4587 5159 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052181.1 protein_id gnl|my_center|LOCUS_40500 5368 5601 gene locus_tag LOCUS_40510 5368 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40510 >Feature sequence246 904 617 gene locus_tag LOCUS_40520 904 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40520 1305 922 gene locus_tag LOCUS_40530 1305 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40530 1826 2065 gene locus_tag LOCUS_40540 gene zapB 1826 2065 CDS product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296623.1 protein_id gnl|my_center|LOCUS_40540 2230 3252 gene locus_tag LOCUS_40550 gene nlpA 2230 3252 CDS product lipoprotein NlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779426.1 protein_id gnl|my_center|LOCUS_40550 3150 3398 gene locus_tag LOCUS_40560 3150 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 4600 3671 gene locus_tag LOCUS_40570 gene menA 4600 3671 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139635.1 protein_id gnl|my_center|LOCUS_40570 <5619 4773 gene locus_tag LOCUS_40580 <5619 4773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099313.1:HslU--HslV peptidase ATPase subunit >Feature sequence247 <1 909 gene locus_tag LOCUS_40590 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000402206.1:Na+/H+ antiporter 1806 913 gene locus_tag LOCUS_40600 1806 913 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095076.1 protein_id gnl|my_center|LOCUS_40600 3247 1937 gene locus_tag LOCUS_40610 3247 1937 CDS product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463069.1 protein_id gnl|my_center|LOCUS_40610 4541 3273 gene locus_tag LOCUS_40620 4541 3273 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 protein_id gnl|my_center|LOCUS_40620 <5505 4911 gene locus_tag LOCUS_40630 <5505 4911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095079.1:cation/acetate symporter ActP >Feature sequence248 1625 1912 gene locus_tag LOCUS_40640 1625 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40640 1890 2201 gene locus_tag LOCUS_40650 1890 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40650 2249 2827 gene locus_tag LOCUS_40660 2249 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40660 2767 3015 gene locus_tag LOCUS_40670 2767 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40670 3723 2986 gene locus_tag LOCUS_40680 gene dpaA 3723 2986 CDS product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095729.1 protein_id gnl|my_center|LOCUS_40680 >Feature sequence249 2090 1449 gene locus_tag LOCUS_40690 gene rlmE 2090 1449 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145971.1 protein_id gnl|my_center|LOCUS_40690 2234 2527 gene locus_tag LOCUS_40700 gene yhbY 2234 2527 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 protein_id gnl|my_center|LOCUS_40700 3218 2889 gene locus_tag LOCUS_40710 3218 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40710 3506 4855 gene locus_tag LOCUS_40720 gene dacB 3506 4855 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420697.1 protein_id gnl|my_center|LOCUS_40720 <5349 4839 gene locus_tag LOCUS_40730 <5349 4839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000673554.1:Obg family GTPase CgtA >Feature sequence250 <1 695 gene locus_tag LOCUS_40740 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001364217.1:glutamate synthase large subunit note possible pseudo, frameshifted 695 3577 gene locus_tag LOCUS_40750 695 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40750 3625 3864 gene locus_tag LOCUS_40760 3625 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40760 3839 4969 gene locus_tag LOCUS_40770 gene gltD 3839 4969 CDS product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081705.1 protein_id gnl|my_center|LOCUS_40770 >Feature sequence251 220 254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2869 2192 gene locus_tag LOCUS_40780 2869 2192 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096968.1 protein_id gnl|my_center|LOCUS_40780 3365 2925 gene locus_tag LOCUS_40790 3365 2925 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419182.1 protein_id gnl|my_center|LOCUS_40790 3796 4458 gene locus_tag LOCUS_40800 3796 4458 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096970.1 protein_id gnl|my_center|LOCUS_40800 4541 5173 gene locus_tag LOCUS_40810 4541 5173 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703599.1 protein_id gnl|my_center|LOCUS_40810 >Feature sequence252 1463 531 gene locus_tag LOCUS_40820 1463 531 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096711.1 protein_id gnl|my_center|LOCUS_40820 1563 1997 gene locus_tag LOCUS_40830 1563 1997 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096712.1 protein_id gnl|my_center|LOCUS_40830 2007 2495 gene locus_tag LOCUS_40840 2007 2495 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206857.1 protein_id gnl|my_center|LOCUS_40840 2710 2982 gene locus_tag LOCUS_40850 2710 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 2986 3261 gene locus_tag LOCUS_40860 2986 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 4248 3322 gene locus_tag LOCUS_40870 gene gcvA 4248 3322 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972039.1 protein_id gnl|my_center|LOCUS_40870 4349 4978 gene locus_tag LOCUS_40880 4349 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40880 >Feature sequence253 792 52 gene locus_tag LOCUS_40890 792 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 1143 1661 gene locus_tag LOCUS_40900 gene fabA 1143 1661 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097260.1 protein_id gnl|my_center|LOCUS_40900 1892 1725 gene locus_tag LOCUS_40910 gene rmf 1892 1725 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704906.1 protein_id gnl|my_center|LOCUS_40910 2712 2146 gene locus_tag LOCUS_40920 gene pqiC 2712 2146 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367436.1 protein_id gnl|my_center|LOCUS_40920 2999 2709 gene locus_tag LOCUS_40930 2999 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40930 4354 2975 gene locus_tag LOCUS_40940 gene pqiB 4354 2975 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097263.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40940 4592 4341 gene locus_tag LOCUS_40950 4592 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40950 5136 4576 gene locus_tag LOCUS_40960 5136 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40960 >Feature sequence254 206 625 gene locus_tag LOCUS_40970 206 625 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_40970 695 1777 gene locus_tag LOCUS_40980 gene hcxB 695 1777 CDS product hydroxycarboxylate dehydrogenase HcXB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443495.1 protein_id gnl|my_center|LOCUS_40980 2675 1827 gene locus_tag LOCUS_40990 gene mcrA 2675 1827 CDS product 5-methylcytosine-specific endonuclease McrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557907.1 protein_id gnl|my_center|LOCUS_40990 3325 2741 gene locus_tag LOCUS_41000 gene ttrR 3325 2741 CDS product tetrathionate respiration response regulator TtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190927.1 protein_id gnl|my_center|LOCUS_41000 4833 3325 gene locus_tag LOCUS_41010 gene ttrS 4833 3325 CDS product tetrathionate respiration histidine kinase TtrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816070.1 protein_id gnl|my_center|LOCUS_41010 >Feature sequence255 241 380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 419 2191 gene locus_tag LOCUS_41020 gene aspS 419 2191 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705958.1 protein_id gnl|my_center|LOCUS_41020 2193 2636 gene locus_tag LOCUS_41030 gene nudB 2193 2636 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620451.1 protein_id gnl|my_center|LOCUS_41030 2664 3404 gene locus_tag LOCUS_41040 2664 3404 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096082.1 protein_id gnl|my_center|LOCUS_41040 3435 3956 gene locus_tag LOCUS_41050 gene ruvC 3435 3956 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295503.1 protein_id gnl|my_center|LOCUS_41050 4067 4678 gene locus_tag LOCUS_41060 gene ruvA 4067 4678 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580323.1 protein_id gnl|my_center|LOCUS_41060 4687 5031 gene locus_tag LOCUS_41070 4687 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 4897 4905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence256 1484 1014 gene locus_tag LOCUS_41080 gene mntR 1484 1014 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091016.1 protein_id gnl|my_center|LOCUS_41080 2106 3059 gene locus_tag LOCUS_41090 2106 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41090 2996 3670 gene locus_tag LOCUS_41100 2996 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41100 4123 3734 gene locus_tag LOCUS_41110 gene ompX 4123 3734 CDS product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704823.1 protein_id gnl|my_center|LOCUS_41110 >Feature sequence257 258 638 gene locus_tag LOCUS_41120 258 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41120 1005 673 gene locus_tag LOCUS_41130 1005 673 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369597.1 protein_id gnl|my_center|LOCUS_41130 1227 2210 gene locus_tag LOCUS_41140 gene ebgR 1227 2210 CDS product transcriptional regulator EbgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009485173.1 protein_id gnl|my_center|LOCUS_41140 2374 2898 gene locus_tag LOCUS_41150 2374 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41150 3437 3549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4635 4639 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence258 185 338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2003 693 gene locus_tag LOCUS_41160 gene phoR 2003 693 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893648.1 protein_id gnl|my_center|LOCUS_41160 2716 2027 gene locus_tag LOCUS_41170 gene phoB 2716 2027 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428026.1 protein_id gnl|my_center|LOCUS_41170 2851 4119 gene locus_tag LOCUS_41180 gene sbcD 2851 4119 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095823.1 protein_id gnl|my_center|LOCUS_41180 >Feature sequence259 <1 623 gene locus_tag LOCUS_41190 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369639.1:bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE 1001 657 gene locus_tag LOCUS_41200 gene ubiK 1001 657 CDS product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098757.1 protein_id gnl|my_center|LOCUS_41200 1419 2072 gene locus_tag LOCUS_41210 gene ribB 1419 2072 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076993.1 protein_id gnl|my_center|LOCUS_41210 2578 2135 gene locus_tag LOCUS_41220 2578 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 2635 2708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2950 3738 gene locus_tag LOCUS_41230 gene ygiD 2950 3738 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098747.1 protein_id gnl|my_center|LOCUS_41230 4752 3772 gene locus_tag LOCUS_41240 4752 3772 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442833.1 protein_id gnl|my_center|LOCUS_41240 >Feature sequence260 <1 967 gene locus_tag LOCUS_41250 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097505.1:histidine ammonia-lyase 1252 998 gene locus_tag LOCUS_41260 1252 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41260 2814 1525 gene locus_tag LOCUS_41270 gene bioA 2814 1525 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123603.1 protein_id gnl|my_center|LOCUS_41270 3350 3403 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3407 3769 gene locus_tag LOCUS_41280 3407 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 4040 4132 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4455 4608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence261 1426 197 gene locus_tag LOCUS_41290 1426 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41290 1763 2596 gene locus_tag LOCUS_41300 gene ppsR 1763 2596 CDS product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620693.1 protein_id gnl|my_center|LOCUS_41300 2751 3881 gene locus_tag LOCUS_41310 gene aroH 2751 3881 CDS product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419178.1 protein_id gnl|my_center|LOCUS_41310 4003 4212 gene locus_tag LOCUS_41320 4003 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 4145 4157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4485 4620 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence262 <1 735 gene locus_tag LOCUS_41330 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705065.1:NADP-dependent isocitrate dehydrogenase 974 786 gene locus_tag LOCUS_41340 974 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 1136 1381 gene locus_tag LOCUS_41350 1136 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 1783 1544 gene locus_tag LOCUS_41360 1783 1544 CDS product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096351.1 protein_id gnl|my_center|LOCUS_41360 2202 2441 gene locus_tag LOCUS_41370 2202 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 2628 2897 gene locus_tag LOCUS_41380 2628 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 3298 2948 gene locus_tag LOCUS_41390 3298 2948 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097067.1 protein_id gnl|my_center|LOCUS_41390 3554 4261 gene locus_tag LOCUS_41400 3554 4261 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097066.1 protein_id gnl|my_center|LOCUS_41400 4598 4263 gene locus_tag LOCUS_41410 4598 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41410 >Feature sequence263 <1 1087 gene locus_tag LOCUS_41420 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096469.1:cytochrome ubiquinol oxidase subunit I 1084 1734 gene locus_tag LOCUS_41430 1084 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41430 1628 2068 gene locus_tag LOCUS_41440 1628 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41440 2068 2199 gene locus_tag LOCUS_41450 2068 2199 CDS product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096467.1 protein_id gnl|my_center|LOCUS_41450 3632 2394 gene locus_tag LOCUS_41460 3632 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 >Feature sequence264 640 912 gene locus_tag LOCUS_41470 640 912 CDS product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097042.1 protein_id gnl|my_center|LOCUS_41470 1285 872 gene locus_tag LOCUS_41480 gene nudG 1285 872 CDS product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781888.1 protein_id gnl|my_center|LOCUS_41480 2111 1305 gene locus_tag LOCUS_41490 gene xthA 2111 1305 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673924.1 protein_id gnl|my_center|LOCUS_41490 2533 3330 gene locus_tag LOCUS_41500 2533 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 3338 3613 gene locus_tag LOCUS_41510 3338 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 3610 4194 gene locus_tag LOCUS_41520 3610 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41520 4392 4492 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence265 2004 892 gene locus_tag LOCUS_41530 gene lptF 2004 892 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420700.1 protein_id gnl|my_center|LOCUS_41530 2273 3784 gene locus_tag LOCUS_41540 gene pepA 2273 3784 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098951.1 protein_id gnl|my_center|LOCUS_41540 4302 4444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence266 295 459 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1463 711 gene locus_tag LOCUS_41550 1463 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41550 2718 1549 gene locus_tag LOCUS_41560 2718 1549 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582864.1 protein_id gnl|my_center|LOCUS_41560 3005 2721 gene locus_tag LOCUS_41570 3005 2721 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_41570 3332 3198 gene locus_tag LOCUS_41580 3332 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 3399 4481 gene locus_tag LOCUS_41590 3399 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 4365 4465 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4502 4654 gene locus_tag LOCUS_41600 4502 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 >Feature sequence267 734 327 gene locus_tag LOCUS_41610 734 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41610 2161 854 gene locus_tag LOCUS_41620 2161 854 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095047.1 protein_id gnl|my_center|LOCUS_41620 2930 2250 gene locus_tag LOCUS_41630 2930 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41630 3342 2878 gene locus_tag LOCUS_41640 3342 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41640 >Feature sequence268 805 1329 gene locus_tag LOCUS_41650 gene aroL 805 1329 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095816.1 protein_id gnl|my_center|LOCUS_41650 1376 1567 gene locus_tag LOCUS_41660 gene yaiA 1376 1567 CDS product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095817.1 protein_id gnl|my_center|LOCUS_41660 1824 2429 gene locus_tag LOCUS_41670 1824 2429 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276434.1 protein_id gnl|my_center|LOCUS_41670 2615 2899 gene locus_tag LOCUS_41680 gene ppnP 2615 2899 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941953.1 protein_id gnl|my_center|LOCUS_41680 3882 2932 gene locus_tag LOCUS_41690 gene rdgC 3882 2932 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964305.1 protein_id gnl|my_center|LOCUS_41690 >Feature sequence269 308 1897 gene locus_tag LOCUS_41700 gene hyfG 308 1897 CDS product hydrogenase 4 catalytic subunit HyfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102329.1 protein_id gnl|my_center|LOCUS_41700 522 585 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1908 2459 gene locus_tag LOCUS_41710 gene hyfH 1908 2459 CDS product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816732.1 protein_id gnl|my_center|LOCUS_41710 2456 3238 gene locus_tag LOCUS_41720 2456 3238 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298699.1 protein_id gnl|my_center|LOCUS_41720 3231 3647 gene locus_tag LOCUS_41730 3231 3647 CDS product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816734.1 protein_id gnl|my_center|LOCUS_41730 3644 4141 gene locus_tag LOCUS_41740 gene hycI 3644 4141 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816735.1 protein_id gnl|my_center|LOCUS_41740 >Feature sequence270 1253 795 gene locus_tag LOCUS_41750 gene rpiB 1253 795 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209402.1 protein_id gnl|my_center|LOCUS_41750 1656 3038 gene locus_tag LOCUS_41760 1656 3038 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201828.1 protein_id gnl|my_center|LOCUS_41760 >Feature sequence271 2952 2068 gene locus_tag LOCUS_41770 gene nlpI 2952 2068 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098912.1 protein_id gnl|my_center|LOCUS_41770 3887 3069 gene locus_tag LOCUS_41780 3887 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 3916 4024 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence272 1187 570 gene locus_tag LOCUS_41790 gene satP 1187 570 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095518.1 protein_id gnl|my_center|LOCUS_41790 1828 2931 gene locus_tag LOCUS_41800 1828 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 3098 3751 gene locus_tag LOCUS_41810 3098 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 >Feature sequence273 737 189 gene locus_tag LOCUS_41820 gene ves 737 189 CDS product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097026.1 protein_id gnl|my_center|LOCUS_41820 1512 1021 gene locus_tag LOCUS_41830 gene spy 1512 1021 CDS product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228991.1 protein_id gnl|my_center|LOCUS_41830 2824 1862 gene locus_tag LOCUS_41840 gene astE 2824 1862 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097028.1 protein_id gnl|my_center|LOCUS_41840 4018 2834 gene locus_tag LOCUS_41850 gene astB 4018 2834 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097029.1 protein_id gnl|my_center|LOCUS_41850 4113 4193 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence274 1107 454 gene locus_tag LOCUS_41860 gene phnJ 1107 454 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002283.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41860 1276 1040 gene locus_tag LOCUS_41870 1276 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41870 1646 1269 gene locus_tag LOCUS_41880 1646 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41880 2017 1592 gene locus_tag LOCUS_41890 2017 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41890 2041 2100 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2860 2276 gene locus_tag LOCUS_41900 gene phnH 2860 2276 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095108.1 protein_id gnl|my_center|LOCUS_41900 3297 2857 gene locus_tag LOCUS_41910 gene phnG 3297 2857 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368696.1 protein_id gnl|my_center|LOCUS_41910 3884 3297 gene locus_tag LOCUS_41920 gene phnF 3884 3297 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309142.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41920 >Feature sequence275 515 330 gene locus_tag LOCUS_41930 515 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41930 774 529 gene locus_tag LOCUS_41940 774 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 1083 868 gene locus_tag LOCUS_41950 gene ydgT 1083 868 CDS product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366849.1 protein_id gnl|my_center|LOCUS_41950 1656 2177 gene locus_tag LOCUS_41960 1656 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41960 2120 2485 gene locus_tag LOCUS_41970 2120 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41970 2467 2688 gene locus_tag LOCUS_41980 2467 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41980 3732 2731 gene locus_tag LOCUS_41990 gene add 3732 2731 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565566.1 protein_id gnl|my_center|LOCUS_41990 >Feature sequence276 745 1365 gene locus_tag LOCUS_42000 gene sodA 745 1365 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861999.1 protein_id gnl|my_center|LOCUS_42000 1435 2124 gene locus_tag LOCUS_42010 gene yiiM 1435 2124 CDS product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703947.1 protein_id gnl|my_center|LOCUS_42010 2205 3041 gene locus_tag LOCUS_42020 2205 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42020 3013 3591 gene locus_tag LOCUS_42030 3013 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42030 <4318 3625 gene locus_tag LOCUS_42040 <4318 3625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369183.1:FMN-dependent L-lactate dehydrogenase LldD 4013 4058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence277 50 385 gene locus_tag LOCUS_42050 50 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42050 382 597 gene locus_tag LOCUS_42060 382 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42060 1849 614 gene locus_tag LOCUS_42070 1849 614 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098762.1 protein_id gnl|my_center|LOCUS_42070 2566 1946 gene locus_tag LOCUS_42080 2566 1946 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369636.1 protein_id gnl|my_center|LOCUS_42080 2811 4247 gene locus_tag LOCUS_42090 gene ygiF 2811 4247 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046301.1 protein_id gnl|my_center|LOCUS_42090 4006 4142 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence278 195 256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 415 1953 gene locus_tag LOCUS_42100 415 1953 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192512.1 protein_id gnl|my_center|LOCUS_42100 2187 1954 gene locus_tag LOCUS_42110 2187 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42110 3443 2121 gene locus_tag LOCUS_42120 gene yoaE 3443 2121 CDS product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394983.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42120 >Feature sequence279 1848 997 gene locus_tag LOCUS_42130 1848 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42130 2305 3012 gene locus_tag LOCUS_42140 2305 3012 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812168.1 protein_id gnl|my_center|LOCUS_42140 3811 3056 gene locus_tag LOCUS_42150 3811 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42150 3932 4035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence280 713 952 gene locus_tag LOCUS_42160 713 952 CDS product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096351.1 protein_id gnl|my_center|LOCUS_42160 952 1224 gene locus_tag LOCUS_42170 952 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 1903 1481 gene locus_tag LOCUS_42180 1903 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 3570 2101 gene locus_tag LOCUS_42190 3570 2101 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079784.1 protein_id gnl|my_center|LOCUS_42190 >Feature sequence281 225 1064 gene locus_tag LOCUS_42200 gene lsrD 225 1064 CDS product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098848.1 protein_id gnl|my_center|LOCUS_42200 1027 1037 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1051 1491 gene locus_tag LOCUS_42210 1051 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42210 1488 1922 gene locus_tag LOCUS_42220 1488 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42220 2033 2869 gene locus_tag LOCUS_42230 gene lsrF 2033 2869 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917724.1 protein_id gnl|my_center|LOCUS_42230 2866 3165 gene locus_tag LOCUS_42240 gene lsrG 2866 3165 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181386.1 protein_id gnl|my_center|LOCUS_42240 3315 3791 gene locus_tag LOCUS_42250 3315 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42250 >Feature sequence282 2322 1525 gene locus_tag LOCUS_42260 2322 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42260 2686 3528 gene locus_tag LOCUS_42270 2686 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42270 3470 3886 gene locus_tag LOCUS_42280 3470 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42280 3879 4058 gene locus_tag LOCUS_42290 3879 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42290 >Feature sequence283 2315 942 gene locus_tag LOCUS_42300 2315 942 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211002.1 protein_id gnl|my_center|LOCUS_42300 2529 3476 gene locus_tag LOCUS_42310 2529 3476 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211003.1 protein_id gnl|my_center|LOCUS_42310 3797 3528 gene locus_tag LOCUS_42320 3797 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 3841 3869 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence284 1402 272 gene locus_tag LOCUS_42330 1402 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 <4184 3587 gene locus_tag LOCUS_42340 <4184 3587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000610375.1:DUF551 domain-containing protein >Feature sequence285 502 95 gene locus_tag LOCUS_42350 gene fliN 502 95 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282098.1 protein_id gnl|my_center|LOCUS_42350 1503 499 gene locus_tag LOCUS_42360 gene fliM 1503 499 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502815.1 protein_id gnl|my_center|LOCUS_42360 1975 1508 gene locus_tag LOCUS_42370 gene fliL 1975 1508 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132172.1 protein_id gnl|my_center|LOCUS_42370 2560 2072 gene locus_tag LOCUS_42380 2560 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42380 3149 2565 gene locus_tag LOCUS_42390 3149 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42390 3589 3146 gene locus_tag LOCUS_42400 gene fliJ 3589 3146 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097733.1 protein_id gnl|my_center|LOCUS_42400 <4180 3611 gene locus_tag LOCUS_42410 <4180 3611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000213259.1:flagellar protein export ATPase FliI >Feature sequence286 <1 554 gene locus_tag LOCUS_42420 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095104.1:phosphonate C-P lyase system protein PhnL 687 702 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 710 1210 gene locus_tag LOCUS_42430 710 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 1061 1098 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1550 1654 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2051 2482 gene locus_tag LOCUS_42440 gene phnO 2051 2482 CDS product aminoalkylphosphonate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110514.1 protein_id gnl|my_center|LOCUS_42440 2492 3250 gene locus_tag LOCUS_42450 gene phnP 2492 3250 CDS product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059910.1 protein_id gnl|my_center|LOCUS_42450 3570 3247 gene locus_tag LOCUS_42460 3570 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 4165 3647 gene locus_tag LOCUS_42470 4165 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 >Feature sequence287 1575 1144 gene locus_tag LOCUS_42480 1575 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42480 3119 1617 gene locus_tag LOCUS_42490 gene proY 3119 1617 CDS product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445555.1 protein_id gnl|my_center|LOCUS_42490 3791 3156 gene locus_tag LOCUS_42500 3791 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42500 >Feature sequence288 <1 1187 gene locus_tag LOCUS_42510 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096236.1:invasion regulator SirB1 336 397 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1390 1487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1743 1915 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3062 2091 gene locus_tag LOCUS_42520 gene chaA 3062 2091 CDS product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 protein_id gnl|my_center|LOCUS_42520 2370 2390 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3335 3565 gene locus_tag LOCUS_42530 gene chaB 3335 3565 CDS product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096240.1 protein_id gnl|my_center|LOCUS_42530 >Feature sequence289 977 1049 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2738 1533 gene locus_tag LOCUS_42540 gene hemA 2738 1533 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096232.1 protein_id gnl|my_center|LOCUS_42540 2941 3564 gene locus_tag LOCUS_42550 gene lolB 2941 3564 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130678.1 protein_id gnl|my_center|LOCUS_42550 >Feature sequence290 339 160 gene locus_tag LOCUS_42560 339 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 1387 362 gene locus_tag LOCUS_42570 1387 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 373 453 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1411 1531 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3363 1705 gene locus_tag LOCUS_42580 3363 1705 CDS product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421580.1 protein_id gnl|my_center|LOCUS_42580 3722 3501 gene locus_tag LOCUS_42590 3722 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42590 >Feature sequence291 201 293 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1761 895 gene locus_tag LOCUS_42600 1761 895 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056719.1 protein_id gnl|my_center|LOCUS_42600 2108 2716 gene locus_tag LOCUS_42610 2108 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 2663 2682 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2923 3085 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3305 3472 gene locus_tag LOCUS_42620 3305 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42620 >Feature sequence292 549 112 gene locus_tag LOCUS_42630 549 112 CDS product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098208.1 protein_id gnl|my_center|LOCUS_42630 678 1676 gene locus_tag LOCUS_42640 678 1676 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971188.1 protein_id gnl|my_center|LOCUS_42640 1765 2265 gene locus_tag LOCUS_42650 1765 2265 CDS product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 protein_id gnl|my_center|LOCUS_42650 2718 2293 gene locus_tag LOCUS_42660 2718 2293 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406008.1 protein_id gnl|my_center|LOCUS_42660 2935 3801 gene locus_tag LOCUS_42670 gene amiA 2935 3801 CDS product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102910.1 protein_id gnl|my_center|LOCUS_42670 >Feature sequence293 616 158 gene locus_tag LOCUS_42680 616 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42680 1804 629 gene locus_tag LOCUS_42690 gene phrB 1804 629 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704758.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42690 1994 1776 gene locus_tag LOCUS_42700 1994 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42700 2949 2152 gene locus_tag LOCUS_42710 2949 2152 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367132.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42710 3492 3007 gene locus_tag LOCUS_42720 3492 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 >Feature sequence294 295 1020 gene locus_tag LOCUS_42730 gene uxuR 295 1020 CDS product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833686.1 protein_id gnl|my_center|LOCUS_42730 1545 1057 gene locus_tag LOCUS_42740 gene greB 1545 1057 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458979.1 protein_id gnl|my_center|LOCUS_42740 1681 3750 gene locus_tag LOCUS_42750 1681 3750 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703676.1 protein_id gnl|my_center|LOCUS_42750 >Feature sequence295 402 1031 gene locus_tag LOCUS_42760 gene yfcG 402 1031 CDS product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566559.1 protein_id gnl|my_center|LOCUS_42760 1109 1471 gene locus_tag LOCUS_42770 gene folX 1109 1471 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365570.1 protein_id gnl|my_center|LOCUS_42770 1490 2383 gene locus_tag LOCUS_42780 1490 2383 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 protein_id gnl|my_center|LOCUS_42780 3695 2415 gene locus_tag LOCUS_42790 3695 2415 CDS product RbtT/DalT/CsbX family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706071.1 protein_id gnl|my_center|LOCUS_42790 >Feature sequence296 435 1124 gene locus_tag LOCUS_42800 435 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 1605 1162 gene locus_tag LOCUS_42810 gene lysM 1605 1162 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098729.1 protein_id gnl|my_center|LOCUS_42810 1779 2279 gene locus_tag LOCUS_42820 1779 2279 CDS product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989016.1 protein_id gnl|my_center|LOCUS_42820 2340 2786 gene locus_tag LOCUS_42830 2340 2786 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460698.1 protein_id gnl|my_center|LOCUS_42830 2920 2792 gene locus_tag LOCUS_42840 2920 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 3013 3077 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3476 3581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence297 420 1160 gene locus_tag LOCUS_42850 420 1160 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085988.1 protein_id gnl|my_center|LOCUS_42850 2091 2999 gene locus_tag LOCUS_42860 2091 2999 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704306.1 protein_id gnl|my_center|LOCUS_42860 2999 3646 gene locus_tag LOCUS_42870 2999 3646 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116472.1 protein_id gnl|my_center|LOCUS_42870 >Feature sequence298 461 576 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1074 1919 gene locus_tag LOCUS_42880 gene potI 1074 1919 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097369.1 protein_id gnl|my_center|LOCUS_42880 2001 2471 gene locus_tag LOCUS_42890 2001 2471 CDS product DUF2593 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763976.1 protein_id gnl|my_center|LOCUS_42890 2597 3640 gene locus_tag LOCUS_42900 gene rlmC 2597 3640 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097367.1 protein_id gnl|my_center|LOCUS_42900 >Feature sequence299 1322 405 gene locus_tag LOCUS_42910 1322 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 <3673 1336 gene locus_tag LOCUS_42920 <3673 1336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263700.1:cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB >Feature sequence300 1217 1092 gene locus_tag LOCUS_42930 1217 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42930 1311 1495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1863 1930 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2611 2156 gene locus_tag LOCUS_42940 gene dksA 2611 2156 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007373199.1 protein_id gnl|my_center|LOCUS_42940 3494 2790 gene locus_tag LOCUS_42950 gene sfsA 3494 2790 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899414.1 protein_id gnl|my_center|LOCUS_42950 >Feature sequence301 95 994 gene locus_tag LOCUS_42960 95 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 1014 1559 gene locus_tag LOCUS_42970 1014 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42970 1499 1711 gene locus_tag LOCUS_42980 1499 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42980 1904 2014 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3295 2300 gene locus_tag LOCUS_42990 gene queG 3295 2300 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095281.1 protein_id gnl|my_center|LOCUS_42990 >Feature sequence302 367 158 gene locus_tag LOCUS_43000 367 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43000 1059 364 gene locus_tag LOCUS_43010 1059 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43010 1262 2872 gene locus_tag LOCUS_43020 1262 2872 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367567.1 protein_id gnl|my_center|LOCUS_43020 <3545 2916 gene locus_tag LOCUS_43030 <3545 2916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097884.1:TerC family protein >Feature sequence303 <1 1242 gene locus_tag LOCUS_43040 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529488.1:ABC transporter substrate-binding protein 1244 1870 gene locus_tag LOCUS_43050 1244 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 1747 1806 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1825 1995 gene locus_tag LOCUS_43060 1825 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 1992 2873 gene locus_tag LOCUS_43070 1992 2873 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970497.1 protein_id gnl|my_center|LOCUS_43070 3140 3264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence304 <1 2637 gene locus_tag LOCUS_43080 <1 2637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001235807.1:DNA topoisomerase III 3258 2818 gene locus_tag LOCUS_43090 3258 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43090 >Feature sequence305 1428 1282 gene locus_tag LOCUS_43100 1428 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 1580 2011 gene locus_tag LOCUS_43110 gene osmC 1580 2011 CDS product peroxiredoxin OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152305.1 protein_id gnl|my_center|LOCUS_43110 2093 2308 gene locus_tag LOCUS_43120 gene fumD 2093 2308 CDS product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096944.1 protein_id gnl|my_center|LOCUS_43120 <3504 2784 gene locus_tag LOCUS_43130 <3504 2784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001175077.1:multidrug efflux MATE transporter MdtK >Feature sequence306 728 1231 gene locus_tag LOCUS_43140 gene dps 728 1231 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100805.1 protein_id gnl|my_center|LOCUS_43140 1595 1879 gene locus_tag LOCUS_43150 1595 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43150 1935 2342 gene locus_tag LOCUS_43160 1935 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43160 2443 3039 gene locus_tag LOCUS_43170 gene glnP 2443 3039 CDS product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858462.1 protein_id gnl|my_center|LOCUS_43170 >Feature sequence307 178 197 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 807 1673 gene locus_tag LOCUS_43180 gene coaA 807 1673 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023068.1 protein_id gnl|my_center|LOCUS_43180 2662 1700 gene locus_tag LOCUS_43190 gene birA 2662 1700 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099224.1 protein_id gnl|my_center|LOCUS_43190 <3430 2659 gene locus_tag LOCUS_43200 <3430 2659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099225.1:UDP-N-acetylmuramate dehydrogenase >Feature sequence308 530 567 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 582 1223 gene locus_tag LOCUS_43210 582 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43210 1126 1932 gene locus_tag LOCUS_43220 1126 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43220 2156 3088 gene locus_tag LOCUS_43230 2156 3088 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086538.1 protein_id gnl|my_center|LOCUS_43230 >Feature sequence309 1611 85 gene locus_tag LOCUS_43240 1611 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 2249 1536 gene locus_tag LOCUS_43250 2249 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 1670 1697 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2747 2499 gene locus_tag LOCUS_43260 2747 2499 CDS product DUF2766 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365964.1 protein_id gnl|my_center|LOCUS_43260 >Feature sequence310 561 295 gene locus_tag LOCUS_43270 561 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43270 2029 593 gene locus_tag LOCUS_43280 2029 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43280 2812 2042 gene locus_tag LOCUS_43290 2812 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43290 3072 2809 gene locus_tag LOCUS_43300 3072 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43300 >Feature sequence311 1148 213 gene locus_tag LOCUS_43310 gene ldcA 1148 213 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705839.1 protein_id gnl|my_center|LOCUS_43310 1288 1899 gene locus_tag LOCUS_43320 gene emtA 1288 1899 CDS product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776974.1 protein_id gnl|my_center|LOCUS_43320 2631 1900 gene locus_tag LOCUS_43330 gene ycgR 2631 1900 CDS product flagellar brake protein YcgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017410.1 protein_id gnl|my_center|LOCUS_43330 2849 3103 gene locus_tag LOCUS_43340 2849 3103 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511323.1 protein_id gnl|my_center|LOCUS_43340 >Feature sequence312 69 392 gene locus_tag LOCUS_43350 gene yagB 69 392 CDS product type IV toxin-antitoxin system antitoxin YagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030800.1 protein_id gnl|my_center|LOCUS_43350 459 779 gene locus_tag LOCUS_43360 gene ypjF 459 779 CDS product type IV toxin-antitoxin system toxin YpjF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094400.1 protein_id gnl|my_center|LOCUS_43360 1468 2343 gene locus_tag LOCUS_43370 1468 2343 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141174869.1 protein_id gnl|my_center|LOCUS_43370 <3200 2558 gene locus_tag LOCUS_43380 <3200 2558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095674.1:envelope stress response activation lipoprotein NlpE >Feature sequence313 255 1679 gene locus_tag LOCUS_43390 255 1679 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005128983.1 protein_id gnl|my_center|LOCUS_43390 2232 1723 gene locus_tag LOCUS_43400 gene cheW 2232 1723 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147302.1 protein_id gnl|my_center|LOCUS_43400 2910 2248 gene locus_tag LOCUS_43410 2910 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 2913 2992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence314 112 906 gene locus_tag LOCUS_43420 112 906 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096623.1 protein_id gnl|my_center|LOCUS_43420 1876 950 gene locus_tag LOCUS_43430 gene dgcZ 1876 950 CDS product diguanylate cyclase DgcZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592774.1 protein_id gnl|my_center|LOCUS_43430 2956 2096 gene locus_tag LOCUS_43440 2956 2096 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096613.1 protein_id gnl|my_center|LOCUS_43440 >Feature sequence315 631 89 gene locus_tag LOCUS_43450 631 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43450 1653 628 gene locus_tag LOCUS_43460 gene chuS 1653 628 CDS product hematinate-forming heme oxygenase ChuS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096984.1 protein_id gnl|my_center|LOCUS_43460 <3046 1676 gene locus_tag LOCUS_43470 <3046 1676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096983.1:TonB-dependent hemoglobin/transferrin/lactoferrin family receptor >Feature sequence316 388 2763 gene locus_tag LOCUS_43480 388 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43480 2722 2759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence317 <1 643 gene locus_tag LOCUS_43490 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187753.1:NAD(P)H-dependent oxidoreductase 783 658 gene locus_tag LOCUS_43500 783 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43500 1924 800 gene locus_tag LOCUS_43510 gene hemL 1924 800 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045295.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43510 >Feature sequence318 225 656 gene locus_tag LOCUS_43520 225 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43520 562 2409 gene locus_tag LOCUS_43530 gene dinG 562 2409 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704815.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43530 >Feature sequence319 2440 875 gene locus_tag LOCUS_43540 gene kdpA 2440 875 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730077.1 protein_id gnl|my_center|LOCUS_43540 2481 2486 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence320 <1 659 gene locus_tag LOCUS_43550 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000055936.1:metalloprotease TldD 1630 698 gene locus_tag LOCUS_43560 gene aaeR 1630 698 CDS product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098979.1 protein_id gnl|my_center|LOCUS_43560 1802 2005 gene locus_tag LOCUS_43570 gene aaeX 1802 2005 CDS product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051840.1 protein_id gnl|my_center|LOCUS_43570 1998 2840 gene locus_tag LOCUS_43580 gene aaeA 1998 2840 CDS product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098978.1 protein_id gnl|my_center|LOCUS_43580 2737 2810 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence321 <1 598 gene locus_tag LOCUS_43590 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000619478.1:L-rhamnose mutarotase 1180 632 gene locus_tag LOCUS_43600 1180 632 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368954.1 protein_id gnl|my_center|LOCUS_43600 1283 1942 gene locus_tag LOCUS_43610 1283 1942 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683586.1 protein_id gnl|my_center|LOCUS_43610 2094 2216 gene locus_tag LOCUS_43620 2094 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43620 2465 2256 gene locus_tag LOCUS_43630 2465 2256 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099352.1 protein_id gnl|my_center|LOCUS_43630 2483 2490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence322 1028 909 gene locus_tag LOCUS_43640 1028 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 2202 1000 gene locus_tag LOCUS_43650 gene uxaC 2202 1000 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 protein_id gnl|my_center|LOCUS_43650 >Feature sequence323 1408 620 gene locus_tag LOCUS_43660 1408 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43660 1424 1476 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2470 1595 gene locus_tag LOCUS_43670 2470 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43670 <2929 2409 gene locus_tag LOCUS_43680 <2929 2409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703518.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase note possible pseudo, frameshifted 2505 2517 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence324 1192 836 gene locus_tag LOCUS_43690 1192 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43690 904 934 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1833 1132 gene locus_tag LOCUS_43700 1833 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43700 2469 1882 gene locus_tag LOCUS_43710 2469 1882 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002882824.1 protein_id gnl|my_center|LOCUS_43710 >Feature sequence325 61 291 gene locus_tag LOCUS_43720 61 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 272 874 gene locus_tag LOCUS_43730 272 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 1067 2806 gene locus_tag LOCUS_43740 1067 2806 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096163.1 protein_id gnl|my_center|LOCUS_43740 >Feature sequence326 1474 170 gene locus_tag LOCUS_43750 1474 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43750 2339 1602 gene locus_tag LOCUS_43760 2339 1602 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704791.1 protein_id gnl|my_center|LOCUS_43760 >Feature sequence327 338 355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 376 678 gene locus_tag LOCUS_43770 376 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43770 671 1153 gene locus_tag LOCUS_43780 gene tsaE 671 1153 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704166.1 protein_id gnl|my_center|LOCUS_43780 1204 2532 gene locus_tag LOCUS_43790 gene amiB 1204 2532 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990321.1 protein_id gnl|my_center|LOCUS_43790 >Feature sequence328 1735 701 gene locus_tag LOCUS_43800 gene cytR 1735 701 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368928.1 protein_id gnl|my_center|LOCUS_43800 2443 1895 gene locus_tag LOCUS_43810 2443 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43810 2454 2554 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence329 442 1092 gene locus_tag LOCUS_43820 gene narL 442 1092 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070491.1 protein_id gnl|my_center|LOCUS_43820 2477 1074 gene locus_tag LOCUS_43830 2477 1074 CDS product YchO/YchP family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419841.1 protein_id gnl|my_center|LOCUS_43830 >Feature sequence330 492 181 gene locus_tag LOCUS_43840 gene ftsB 492 181 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862095.1 protein_id gnl|my_center|LOCUS_43840 992 669 gene locus_tag LOCUS_43850 992 669 CDS product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098502.1 protein_id gnl|my_center|LOCUS_43850 1649 1044 gene locus_tag LOCUS_43860 gene cysC 1649 1044 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098503.1 protein_id gnl|my_center|LOCUS_43860 2278 1649 gene locus_tag LOCUS_43870 2278 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43870 >Feature sequence331 317 354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1959 571 gene locus_tag LOCUS_43880 1959 571 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198245.1 protein_id gnl|my_center|LOCUS_43880 2460 2245 gene locus_tag LOCUS_43890 2460 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43890 2791 2450 gene locus_tag LOCUS_43900 2791 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43900 >Feature sequence332 736 314 gene locus_tag LOCUS_43910 gene arfB 736 314 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095673.1 protein_id gnl|my_center|LOCUS_43910 1278 733 gene locus_tag LOCUS_43920 1278 733 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185290.1 protein_id gnl|my_center|LOCUS_43920 1492 1692 gene locus_tag LOCUS_43930 1492 1692 CDS product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417058.1 protein_id gnl|my_center|LOCUS_43930 1679 1939 gene locus_tag LOCUS_43940 gene rof 1679 1939 CDS product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830722.1 protein_id gnl|my_center|LOCUS_43940 2245 1862 gene locus_tag LOCUS_43950 2245 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 <2802 2248 gene locus_tag LOCUS_43960 <2802 2248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000210062.1:tRNA lysidine(34) synthetase TilS >Feature sequence333 819 151 gene locus_tag LOCUS_43970 819 151 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602542.1 protein_id gnl|my_center|LOCUS_43970 1416 940 gene locus_tag LOCUS_43980 gene terW 1416 940 CDS product tellurium resistance protein TerW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176766.1 protein_id gnl|my_center|LOCUS_43980 2511 1555 gene locus_tag LOCUS_43990 2511 1555 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797363.1 protein_id gnl|my_center|LOCUS_43990 >Feature sequence334 1 198 gene locus_tag LOCUS_44000 1 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 360 824 gene locus_tag LOCUS_44010 gene ndk 360 824 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963837.1 protein_id gnl|my_center|LOCUS_44010 845 1252 gene locus_tag LOCUS_44020 845 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 1182 1814 gene locus_tag LOCUS_44030 1182 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 2192 2629 gene locus_tag LOCUS_44040 2192 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44040 2536 2554 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence335 188 354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1433 1236 gene locus_tag LOCUS_44050 1433 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 1750 2463 gene locus_tag LOCUS_44060 1750 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44060 >Feature sequence336 1003 1569 gene locus_tag LOCUS_44070 1003 1569 CDS product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096056.1 protein_id gnl|my_center|LOCUS_44070 1584 2087 gene locus_tag LOCUS_44080 1584 2087 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027938.1 protein_id gnl|my_center|LOCUS_44080 >Feature sequence337 441 490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 500 1048 gene locus_tag LOCUS_44090 500 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44090 <2708 1086 gene locus_tag LOCUS_44100 <2708 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098021.1:anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC >Feature sequence338 2 325 gene locus_tag LOCUS_44110 2 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44110 255 2654 gene locus_tag LOCUS_44120 255 2654 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419180.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44120 >Feature sequence339 2222 1266 gene locus_tag LOCUS_44130 2222 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44130 2392 2547 gene locus_tag LOCUS_44140 2392 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 >Feature sequence340 1055 387 gene locus_tag LOCUS_44150 gene yecA 1055 387 CDS product UPF0149 family protein YecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847882.1 protein_id gnl|my_center|LOCUS_44150 1326 1189 gene locus_tag LOCUS_44160 1326 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 >Feature sequence341 137 562 gene locus_tag LOCUS_44170 137 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44170 540 1259 gene locus_tag LOCUS_44180 540 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44180 1264 1956 gene locus_tag LOCUS_44190 1264 1956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117262.1 protein_id gnl|my_center|LOCUS_44190 1943 2428 gene locus_tag LOCUS_44200 1943 2428 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132911.1 protein_id gnl|my_center|LOCUS_44200 >Feature sequence342 745 1425 gene locus_tag LOCUS_44210 gene cecR 745 1425 CDS product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097480.1 protein_id gnl|my_center|LOCUS_44210 1425 2429 gene locus_tag LOCUS_44220 gene hlyD 1425 2429 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097481.1 protein_id gnl|my_center|LOCUS_44220 >Feature sequence343 381 507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 532 660 gene locus_tag LOCUS_44230 532 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 653 1291 gene locus_tag LOCUS_44240 653 1291 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889716.1 protein_id gnl|my_center|LOCUS_44240 1295 1891 gene locus_tag LOCUS_44250 gene nqrE 1295 1891 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368115.1 protein_id gnl|my_center|LOCUS_44250 2001 2075 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence344 236 892 gene locus_tag LOCUS_44260 236 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 1801 926 gene locus_tag LOCUS_44270 gene ttdR 1801 926 CDS product DNA-binding transcriptional activator TtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935206.1 protein_id gnl|my_center|LOCUS_44270