>Feature sequence001 1193 1609 gene locus_tag LOCUS_00010 1193 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1998 2450 gene locus_tag LOCUS_00020 1998 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2577 2999 gene locus_tag LOCUS_00030 2577 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3150 3365 gene locus_tag LOCUS_00040 3150 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4507 3596 gene locus_tag LOCUS_00050 4507 3596 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703861.1 protein_id gnl|my_center|LOCUS_00050 4633 5178 gene locus_tag LOCUS_00060 4633 5178 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947825.1 protein_id gnl|my_center|LOCUS_00060 5794 5399 gene locus_tag LOCUS_00070 5794 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5921 6108 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7326 6151 gene locus_tag LOCUS_00080 gene tapW 7326 6151 CDS product type IVa pilus ATPase TapW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_00080 7559 7775 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8747 7935 gene locus_tag LOCUS_00090 8747 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9018 10001 gene locus_tag LOCUS_00100 9018 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10154 10609 gene locus_tag LOCUS_00110 10154 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10734 11744 gene locus_tag LOCUS_00120 10734 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12067 11756 gene locus_tag LOCUS_00130 12067 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12627 12064 gene locus_tag LOCUS_00140 12627 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12979 13983 gene locus_tag LOCUS_00150 12979 13983 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265996.1 protein_id gnl|my_center|LOCUS_00150 13980 15521 gene locus_tag LOCUS_00160 13980 15521 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070866.1 protein_id gnl|my_center|LOCUS_00160 15972 18269 gene locus_tag LOCUS_00170 15972 18269 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_00170 18305 19267 gene locus_tag LOCUS_00180 18305 19267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19264 22038 gene locus_tag LOCUS_00190 19264 22038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22035 24824 gene locus_tag LOCUS_00200 22035 24824 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836868.1 protein_id gnl|my_center|LOCUS_00200 24821 25948 gene locus_tag LOCUS_00210 24821 25948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25950 27650 gene locus_tag LOCUS_00220 25950 27650 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_00220 27647 28843 gene locus_tag LOCUS_00230 27647 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 29036 29287 gene locus_tag LOCUS_00240 gene rpsP 29036 29287 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023081.1 protein_id gnl|my_center|LOCUS_00240 29309 29848 gene locus_tag LOCUS_00250 gene rimM 29309 29848 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_00250 29865 30620 gene locus_tag LOCUS_00260 gene trmD 29865 30620 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704631.1 protein_id gnl|my_center|LOCUS_00260 30631 30984 gene locus_tag LOCUS_00270 gene rplS 30631 30984 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116654.1 protein_id gnl|my_center|LOCUS_00270 31218 32084 gene locus_tag LOCUS_00280 gene dsbC 31218 32084 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_00280 33840 33028 gene locus_tag LOCUS_00290 gene truC 33840 33028 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063386.1 protein_id gnl|my_center|LOCUS_00290 34042 35175 gene locus_tag LOCUS_00300 34042 35175 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072052.1 protein_id gnl|my_center|LOCUS_00300 35192 35503 gene locus_tag LOCUS_00310 35192 35503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 36376 35522 gene locus_tag LOCUS_00320 36376 35522 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_00320 36965 36438 gene locus_tag LOCUS_00330 36965 36438 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809462.1 protein_id gnl|my_center|LOCUS_00330 37186 40005 gene locus_tag LOCUS_00340 37186 40005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 40125 41714 gene locus_tag LOCUS_00350 40125 41714 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418263.1 protein_id gnl|my_center|LOCUS_00350 42270 41734 gene locus_tag LOCUS_00360 42270 41734 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_00360 42438 42683 gene locus_tag LOCUS_00370 42438 42683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43191 42772 gene locus_tag LOCUS_00380 43191 42772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 44726 43347 gene locus_tag LOCUS_00390 44726 43347 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406748.1 protein_id gnl|my_center|LOCUS_00390 46147 45242 gene locus_tag LOCUS_00400 46147 45242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 46342 47352 gene locus_tag LOCUS_00410 46342 47352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_00410 47355 48347 gene locus_tag LOCUS_00420 gene adeT1 47355 48347 CDS product putative multidrug efflux protein AdeT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_00420 48441 50567 gene locus_tag LOCUS_00430 48441 50567 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_00430 50843 52390 gene locus_tag LOCUS_00440 50843 52390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52484 54151 gene locus_tag LOCUS_00450 52484 54151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 54932 54225 gene locus_tag LOCUS_00460 54932 54225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 55414 56367 gene locus_tag LOCUS_00470 gene trxB 55414 56367 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 protein_id gnl|my_center|LOCUS_00470 57350 56415 gene locus_tag LOCUS_00480 57350 56415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 57834 57352 gene locus_tag LOCUS_00490 57834 57352 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_00490 58154 57834 gene locus_tag LOCUS_00500 58154 57834 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 protein_id gnl|my_center|LOCUS_00500 58301 59539 gene locus_tag LOCUS_00510 58301 59539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 59532 60242 gene locus_tag LOCUS_00520 59532 60242 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_00520 60239 60712 gene locus_tag LOCUS_00530 60239 60712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 61052 60750 gene locus_tag LOCUS_00540 61052 60750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 61822 61049 gene locus_tag LOCUS_00550 61822 61049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 62134 62059 gene locus_tag LOCUS_t00010 62134 62059 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 62923 62183 gene locus_tag LOCUS_00560 62923 62183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 63416 62946 gene locus_tag LOCUS_00570 63416 62946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63757 63431 gene locus_tag LOCUS_00580 63757 63431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 64537 63821 gene locus_tag LOCUS_00590 64537 63821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 64629 65555 gene locus_tag LOCUS_00600 64629 65555 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771567.1 protein_id gnl|my_center|LOCUS_00600 65561 66409 gene locus_tag LOCUS_00610 gene cheR 65561 66409 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_00610 66576 66974 gene locus_tag LOCUS_00620 gene flgB 66576 66974 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370068.1 protein_id gnl|my_center|LOCUS_00620 66977 67423 gene locus_tag LOCUS_00630 gene flgC 66977 67423 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082150.1 protein_id gnl|my_center|LOCUS_00630 67434 68225 gene locus_tag LOCUS_00640 gene flgD 67434 68225 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929365.1 protein_id gnl|my_center|LOCUS_00640 68253 71888 gene locus_tag LOCUS_00650 68253 71888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 72093 72839 gene locus_tag LOCUS_00660 gene flgF 72093 72839 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082159.1 protein_id gnl|my_center|LOCUS_00660 72853 73638 gene locus_tag LOCUS_00670 gene flgG 72853 73638 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082164.1 protein_id gnl|my_center|LOCUS_00670 73649 74347 gene locus_tag LOCUS_00680 gene flgH 73649 74347 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706638.1 protein_id gnl|my_center|LOCUS_00680 74368 75465 gene locus_tag LOCUS_00690 74368 75465 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268456.1 protein_id gnl|my_center|LOCUS_00690 75494 75793 gene locus_tag LOCUS_00700 75494 75793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 76085 77167 gene locus_tag LOCUS_00710 gene flgJ 76085 77167 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944830.1 protein_id gnl|my_center|LOCUS_00710 77160 80141 gene locus_tag LOCUS_00720 77160 80141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 80163 81401 gene locus_tag LOCUS_00730 gene flgL 80163 81401 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 protein_id gnl|my_center|LOCUS_00730 81455 82453 gene locus_tag LOCUS_00740 gene pseB 81455 82453 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867763.1 protein_id gnl|my_center|LOCUS_00740 82456 83613 gene locus_tag LOCUS_00750 gene pseC 82456 83613 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_00750 83610 84323 gene locus_tag LOCUS_00760 gene pseF 83610 84323 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_00760 84410 85840 gene locus_tag LOCUS_00770 gene pseG 84410 85840 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097861.1 protein_id gnl|my_center|LOCUS_00770 85824 86738 gene locus_tag LOCUS_00780 85824 86738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 86728 87363 gene locus_tag LOCUS_00790 86728 87363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 87353 88384 gene locus_tag LOCUS_00800 gene pseI 87353 88384 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097860.1 protein_id gnl|my_center|LOCUS_00800 88381 89058 gene locus_tag LOCUS_00810 88381 89058 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061513.1 protein_id gnl|my_center|LOCUS_00810 89061 90230 gene locus_tag LOCUS_00820 89061 90230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 92304 90274 gene locus_tag LOCUS_00830 92304 90274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 92624 95497 gene locus_tag LOCUS_00840 92624 95497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 95563 95946 gene locus_tag LOCUS_00850 95563 95946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 96084 100034 gene locus_tag LOCUS_00860 96084 100034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 100201 100638 gene locus_tag LOCUS_00870 100201 100638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 100923 100729 gene locus_tag LOCUS_00880 100923 100729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 101441 102343 gene locus_tag LOCUS_00890 gene prfB 101441 102343 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989230.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00890 102382 103914 gene locus_tag LOCUS_00900 gene lysS 102382 103914 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261233.1 protein_id gnl|my_center|LOCUS_00900 104021 104698 gene locus_tag LOCUS_00910 gene ung 104021 104698 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972337.1 protein_id gnl|my_center|LOCUS_00910 106793 104775 gene locus_tag LOCUS_00920 106793 104775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 107060 107524 gene locus_tag LOCUS_00930 gene fliS 107060 107524 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_00930 107775 109235 gene locus_tag LOCUS_00940 gene fleQ 107775 109235 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_00940 109268 109517 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 109636 110838 gene locus_tag LOCUS_00950 gene fleS 109636 110838 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_00950 110857 112227 gene locus_tag LOCUS_00960 gene fleR 110857 112227 CDS product sigma-54-dependent response regulator transcription factor FleR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082202.1 protein_id gnl|my_center|LOCUS_00960 112349 112747 gene locus_tag LOCUS_00970 112349 112747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 112763 114451 gene locus_tag LOCUS_00980 gene fliF 112763 114451 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947486.1 protein_id gnl|my_center|LOCUS_00980 114441 115475 gene locus_tag LOCUS_00990 gene fliG 114441 115475 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890098.1 protein_id gnl|my_center|LOCUS_00990 115477 116511 gene locus_tag LOCUS_01000 gene fliH 115477 116511 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082217.1 protein_id gnl|my_center|LOCUS_01000 116498 117835 gene locus_tag LOCUS_01010 gene fliI 116498 117835 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086458.1 protein_id gnl|my_center|LOCUS_01010 117832 118296 gene locus_tag LOCUS_01020 117832 118296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 118480 118331 gene locus_tag LOCUS_01030 118480 118331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 118547 118834 gene locus_tag LOCUS_01040 118547 118834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 118878 119240 gene locus_tag LOCUS_01050 118878 119240 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_01050 119246 121357 gene locus_tag LOCUS_01060 119246 121357 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_01060 121366 121893 gene locus_tag LOCUS_01070 121366 121893 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_01070 121966 124320 gene locus_tag LOCUS_01080 121966 124320 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072186.1 protein_id gnl|my_center|LOCUS_01080 124305 125189 gene locus_tag LOCUS_01090 124305 125189 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811915.1 protein_id gnl|my_center|LOCUS_01090 125186 125839 gene locus_tag LOCUS_01100 gene cheD 125186 125839 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102220.1 protein_id gnl|my_center|LOCUS_01100 125848 126885 gene locus_tag LOCUS_01110 125848 126885 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_01110 127098 127403 gene locus_tag LOCUS_01120 gene hsbA 127098 127403 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_01120 127415 129133 gene locus_tag LOCUS_01130 gene hsbR 127415 129133 CDS product two-component system response regulator HsbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_01130 129133 129474 gene locus_tag LOCUS_01140 gene htpB 129133 129474 CDS product two-component system sensor histidine kinase HtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109305.1 protein_id gnl|my_center|LOCUS_01140 129641 130990 gene locus_tag LOCUS_01150 129641 130990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 131305 131841 gene locus_tag LOCUS_01160 gene fliL 131305 131841 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_01160 132291 132544 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 132557 133018 gene locus_tag LOCUS_01170 132557 133018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 133031 133549 gene locus_tag LOCUS_01180 133031 133549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 133560 133943 gene locus_tag LOCUS_01190 133560 133943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 133940 134710 gene locus_tag LOCUS_01200 gene fliP 133940 134710 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083052.1 protein_id gnl|my_center|LOCUS_01200 134719 134988 gene locus_tag LOCUS_01210 gene fliQ 134719 134988 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_01210 134992 135771 gene locus_tag LOCUS_01220 gene fliR 134992 135771 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_01220 135773 136915 gene locus_tag LOCUS_01230 gene flhB 135773 136915 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_01230 137031 139229 gene locus_tag LOCUS_01240 gene flhA 137031 139229 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_01240 139256 140656 gene locus_tag LOCUS_01250 gene flhF 139256 140656 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881782.1 protein_id gnl|my_center|LOCUS_01250 140663 141481 gene locus_tag LOCUS_01260 gene fleN 140663 141481 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412391.1 protein_id gnl|my_center|LOCUS_01260 141506 142216 gene locus_tag LOCUS_01270 gene fliA 141506 142216 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_01270 142340 142726 gene locus_tag LOCUS_01280 gene cheY 142340 142726 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_01280 142743 143030 gene locus_tag LOCUS_01290 142743 143030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 143020 143520 gene locus_tag LOCUS_01300 143020 143520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01300 143533 145770 gene locus_tag LOCUS_01310 143533 145770 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268433.1 protein_id gnl|my_center|LOCUS_01310 145802 146821 gene locus_tag LOCUS_01320 145802 146821 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479477.1 protein_id gnl|my_center|LOCUS_01320 146821 147561 gene locus_tag LOCUS_01330 146821 147561 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_01330 147558 148250 gene locus_tag LOCUS_01340 gene motD 147558 148250 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 protein_id gnl|my_center|LOCUS_01340 148395 149123 gene locus_tag LOCUS_01350 148395 149123 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 protein_id gnl|my_center|LOCUS_01350 149116 149469 gene locus_tag LOCUS_01360 149116 149469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 149462 150316 gene locus_tag LOCUS_01370 149462 150316 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244357.1 protein_id gnl|my_center|LOCUS_01370 150494 150976 gene locus_tag LOCUS_01380 150494 150976 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554262.1 protein_id gnl|my_center|LOCUS_01380 150986 151369 gene locus_tag LOCUS_01390 150986 151369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 151589 151849 gene locus_tag LOCUS_01400 151589 151849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 152220 151846 gene locus_tag LOCUS_01410 152220 151846 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382364.1 protein_id gnl|my_center|LOCUS_01410 152864 152388 gene locus_tag LOCUS_01420 152864 152388 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_01420 153578 153863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 153975 154199 gene locus_tag LOCUS_01430 153975 154199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 155119 154196 gene locus_tag LOCUS_01440 155119 154196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 155643 155230 gene locus_tag LOCUS_01450 gene bcp 155643 155230 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01450 155993 155715 gene locus_tag LOCUS_01460 155993 155715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 156552 156091 gene locus_tag LOCUS_01470 156552 156091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 157682 156552 gene locus_tag LOCUS_01480 gene nrdB 157682 156552 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332020.1 protein_id gnl|my_center|LOCUS_01480 157883 158150 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 160616 161356 gene locus_tag LOCUS_01490 160616 161356 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_01490 161416 162933 gene locus_tag LOCUS_01500 161416 162933 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082362.1 protein_id gnl|my_center|LOCUS_01500 164056 163139 gene locus_tag LOCUS_01510 gene metR 164056 163139 CDS product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 protein_id gnl|my_center|LOCUS_01510 165647 164097 gene locus_tag LOCUS_01520 165647 164097 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087330.1 protein_id gnl|my_center|LOCUS_01520 165792 167279 gene locus_tag LOCUS_01530 gene glpK 165792 167279 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113887.1 protein_id gnl|my_center|LOCUS_01530 167382 168509 gene locus_tag LOCUS_01540 167382 168509 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101151.1 protein_id gnl|my_center|LOCUS_01540 169526 168621 gene locus_tag LOCUS_01550 gene argF 169526 168621 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092090.1 protein_id gnl|my_center|LOCUS_01550 169654 169928 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 170102 170716 gene locus_tag LOCUS_01560 170102 170716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence002 408 232 gene locus_tag LOCUS_01570 408 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 954 1490 gene locus_tag LOCUS_01580 954 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 1656 2021 gene locus_tag LOCUS_01590 1656 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 3709 2978 gene locus_tag LOCUS_01600 3709 2978 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456672.1 protein_id gnl|my_center|LOCUS_01600 3925 4476 gene locus_tag LOCUS_01610 3925 4476 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039237.1 protein_id gnl|my_center|LOCUS_01610 4944 6128 gene locus_tag LOCUS_01620 4944 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 6364 7836 gene locus_tag LOCUS_01630 6364 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 8041 9315 gene locus_tag LOCUS_01640 8041 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 9767 9378 gene locus_tag LOCUS_01650 9767 9378 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477789.1 protein_id gnl|my_center|LOCUS_01650 10911 9796 gene locus_tag LOCUS_01660 gene alr 10911 9796 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769528.1 protein_id gnl|my_center|LOCUS_01660 11156 12355 gene locus_tag LOCUS_01670 11156 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 12264 12932 gene locus_tag LOCUS_01680 12264 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 14722 13010 gene locus_tag LOCUS_01690 14722 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 17031 14920 gene locus_tag LOCUS_01700 17031 14920 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973965.1 protein_id gnl|my_center|LOCUS_01700 17061 17264 gene locus_tag LOCUS_01710 17061 17264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 17367 17574 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20597 17679 gene locus_tag LOCUS_01720 20597 17679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 21651 20611 gene locus_tag LOCUS_01730 21651 20611 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919014.1 protein_id gnl|my_center|LOCUS_01730 22235 21705 gene locus_tag LOCUS_01740 22235 21705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 22922 22422 gene locus_tag LOCUS_01750 22922 22422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 23161 25185 gene locus_tag LOCUS_01760 23161 25185 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_01760 25376 26563 gene locus_tag LOCUS_01770 25376 26563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 27235 26603 gene locus_tag LOCUS_01780 27235 26603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 27434 28150 gene locus_tag LOCUS_01790 27434 28150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 29028 28243 gene locus_tag LOCUS_01800 29028 28243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 29586 29056 gene locus_tag LOCUS_01810 29586 29056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 30200 29583 gene locus_tag LOCUS_01820 30200 29583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 31652 30252 gene locus_tag LOCUS_01830 gene dnaB 31652 30252 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112283.1 protein_id gnl|my_center|LOCUS_01830 32266 31820 gene locus_tag LOCUS_01840 gene rplI 32266 31820 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421134.1 protein_id gnl|my_center|LOCUS_01840 33151 32291 gene locus_tag LOCUS_01850 33151 32291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_01850 33548 33318 gene locus_tag LOCUS_01860 gene rpsR 33548 33318 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_01860 33989 33564 gene locus_tag LOCUS_01870 33989 33564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 34245 37220 gene locus_tag LOCUS_01880 34245 37220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 37270 37616 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38123 37731 gene locus_tag LOCUS_01890 38123 37731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 38481 38116 gene locus_tag LOCUS_01900 38481 38116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 39832 38483 gene locus_tag LOCUS_01910 39832 38483 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074242.1 protein_id gnl|my_center|LOCUS_01910 40506 39832 gene locus_tag LOCUS_01920 40506 39832 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_01920 40985 40503 gene locus_tag LOCUS_01930 40985 40503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 41230 41496 gene locus_tag LOCUS_01940 41230 41496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 41933 41502 gene locus_tag LOCUS_01950 41933 41502 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_01950 42349 41930 gene locus_tag LOCUS_01960 42349 41930 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818374.1 protein_id gnl|my_center|LOCUS_01960 42540 43907 gene locus_tag LOCUS_01970 42540 43907 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948334.1 protein_id gnl|my_center|LOCUS_01970 43951 44571 gene locus_tag LOCUS_01980 43951 44571 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 protein_id gnl|my_center|LOCUS_01980 44609 44980 gene locus_tag LOCUS_01990 44609 44980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 45686 45021 gene locus_tag LOCUS_02000 45686 45021 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115027.1 protein_id gnl|my_center|LOCUS_02000 47611 45797 gene locus_tag LOCUS_02010 gene oadA 47611 45797 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105539.1 protein_id gnl|my_center|LOCUS_02010 49043 47628 gene locus_tag LOCUS_02020 49043 47628 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401293.1 protein_id gnl|my_center|LOCUS_02020 49180 50136 gene locus_tag LOCUS_02030 gene pycR 49180 50136 CDS product LysR family transcriptional regulator PycR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_02030 50310 50185 gene locus_tag LOCUS_02040 50310 50185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 50603 50349 gene locus_tag LOCUS_02050 50603 50349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 51243 50629 gene locus_tag LOCUS_02060 51243 50629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 51247 51495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51507 51728 gene locus_tag LOCUS_02070 51507 51728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 51917 52459 gene locus_tag LOCUS_02080 51917 52459 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626149.1 protein_id gnl|my_center|LOCUS_02080 54023 52548 gene locus_tag LOCUS_02090 54023 52548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 54673 54131 gene locus_tag LOCUS_02100 54673 54131 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921635.1 protein_id gnl|my_center|LOCUS_02100 56387 54834 gene locus_tag LOCUS_02110 gene ahpF 56387 54834 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705620.1 protein_id gnl|my_center|LOCUS_02110 57180 56623 gene locus_tag LOCUS_02120 gene ahpC 57180 56623 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_02120 58436 57354 gene locus_tag LOCUS_02130 58436 57354 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_02130 59255 58512 gene locus_tag LOCUS_02140 gene rlmB 59255 58512 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064143.1 protein_id gnl|my_center|LOCUS_02140 61923 59263 gene locus_tag LOCUS_02150 gene rnr 61923 59263 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407829.1 protein_id gnl|my_center|LOCUS_02150 62346 61975 gene locus_tag LOCUS_02160 62346 61975 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095857.1 protein_id gnl|my_center|LOCUS_02160 62491 64125 gene locus_tag LOCUS_02170 62491 64125 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205011.1 protein_id gnl|my_center|LOCUS_02170 65537 64194 gene locus_tag LOCUS_02180 gene hslU 65537 64194 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095854.1 protein_id gnl|my_center|LOCUS_02180 66071 65541 gene locus_tag LOCUS_02190 gene hslV 66071 65541 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208249.1 protein_id gnl|my_center|LOCUS_02190 66230 66721 gene locus_tag LOCUS_02200 66230 66721 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072083.1 protein_id gnl|my_center|LOCUS_02200 67223 66825 gene locus_tag LOCUS_02210 67223 66825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 67340 67918 gene locus_tag LOCUS_02220 67340 67918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 67989 69560 gene locus_tag LOCUS_02230 67989 69560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_02230 69660 70307 gene locus_tag LOCUS_02240 69660 70307 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_02240 70954 70394 gene locus_tag LOCUS_02250 70954 70394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 71227 72090 gene locus_tag LOCUS_02260 71227 72090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 72524 72315 gene locus_tag LOCUS_02270 gene rpmE 72524 72315 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095846.1 protein_id gnl|my_center|LOCUS_02270 72667 74877 gene locus_tag LOCUS_02280 72667 74877 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_02280 75256 76071 gene locus_tag LOCUS_02290 75256 76071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 76094 76606 gene locus_tag LOCUS_02300 gene pgpA 76094 76606 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261429.1 protein_id gnl|my_center|LOCUS_02300 76784 77155 gene locus_tag LOCUS_02310 76784 77155 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918002.1 protein_id gnl|my_center|LOCUS_02310 77215 77790 gene locus_tag LOCUS_02320 77215 77790 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395469.1 protein_id gnl|my_center|LOCUS_02320 78662 77826 gene locus_tag LOCUS_02330 gene nudC 78662 77826 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_02330 79457 78690 gene locus_tag LOCUS_02340 79457 78690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 80355 79534 gene locus_tag LOCUS_02350 80355 79534 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419748.1 protein_id gnl|my_center|LOCUS_02350 82435 80348 gene locus_tag LOCUS_02360 82435 80348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 83178 82501 gene locus_tag LOCUS_02370 83178 82501 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831045.1 protein_id gnl|my_center|LOCUS_02370 83426 84082 gene locus_tag LOCUS_02380 gene ribA 83426 84082 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110510.1 protein_id gnl|my_center|LOCUS_02380 85438 84098 gene locus_tag LOCUS_02390 85438 84098 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_02390 87104 85428 gene locus_tag LOCUS_02400 87104 85428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 89064 87184 gene locus_tag LOCUS_02410 gene dxs 89064 87184 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266507.1 protein_id gnl|my_center|LOCUS_02410 90176 89274 gene locus_tag LOCUS_02420 90176 89274 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_02420 90418 90176 gene locus_tag LOCUS_02430 90418 90176 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379121.1 protein_id gnl|my_center|LOCUS_02430 90614 91372 gene locus_tag LOCUS_02440 gene pomA 90614 91372 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_02440 91378 92358 gene locus_tag LOCUS_02450 91378 92358 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340821.1 protein_id gnl|my_center|LOCUS_02450 92376 92933 gene locus_tag LOCUS_02460 92376 92933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 93044 93772 gene locus_tag LOCUS_02470 93044 93772 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 protein_id gnl|my_center|LOCUS_02470 94033 93800 gene locus_tag LOCUS_02480 94033 93800 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262218.1 protein_id gnl|my_center|LOCUS_02480 94803 94135 gene locus_tag LOCUS_02490 94803 94135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003024404.1 protein_id gnl|my_center|LOCUS_02490 95534 94800 gene locus_tag LOCUS_02500 95534 94800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 96224 95571 gene locus_tag LOCUS_02510 96224 95571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003024404.1 protein_id gnl|my_center|LOCUS_02510 97557 96286 gene locus_tag LOCUS_02520 97557 96286 CDS product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_02520 97737 99107 gene locus_tag LOCUS_02530 gene radA 97737 99107 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456064.1 protein_id gnl|my_center|LOCUS_02530 100089 99154 gene locus_tag LOCUS_02540 100089 99154 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704932.1 protein_id gnl|my_center|LOCUS_02540 100542 100183 gene locus_tag LOCUS_02550 100542 100183 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_02550 100832 100548 gene locus_tag LOCUS_02560 100832 100548 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035695.1 protein_id gnl|my_center|LOCUS_02560 101311 100826 gene locus_tag LOCUS_02570 101311 100826 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035696.1 protein_id gnl|my_center|LOCUS_02570 102828 101308 gene locus_tag LOCUS_02580 102828 101308 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_02580 103154 102831 gene locus_tag LOCUS_02590 103154 102831 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_02590 105949 103154 gene locus_tag LOCUS_02600 105949 103154 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_02600 107248 106181 gene locus_tag LOCUS_02610 gene hemE 107248 106181 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765484.1 protein_id gnl|my_center|LOCUS_02610 109302 107404 gene locus_tag LOCUS_02620 109302 107404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 110853 109435 gene locus_tag LOCUS_02630 110853 109435 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_02630 115335 110884 gene locus_tag LOCUS_02640 gene gltB 115335 110884 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_02640 117084 115540 gene locus_tag LOCUS_02650 117084 115540 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148292.1 protein_id gnl|my_center|LOCUS_02650 118198 117107 gene locus_tag LOCUS_02660 gene aroB 118198 117107 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_02660 118683 118204 gene locus_tag LOCUS_02670 gene aroK 118683 118204 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 protein_id gnl|my_center|LOCUS_02670 120771 118723 gene locus_tag LOCUS_02680 gene pilQ 120771 118723 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_02680 121369 120827 gene locus_tag LOCUS_02690 gene pilP 121369 120827 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_02690 122015 121371 gene locus_tag LOCUS_02700 gene pilO 122015 121371 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_02700 122568 122020 gene locus_tag LOCUS_02710 gene pilN 122568 122020 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_02710 123665 122568 gene locus_tag LOCUS_02720 gene pilM 123665 122568 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_02720 123841 126339 gene locus_tag LOCUS_02730 123841 126339 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114576.1 protein_id gnl|my_center|LOCUS_02730 127830 126427 gene locus_tag LOCUS_02740 127830 126427 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_02740 128063 129292 gene locus_tag LOCUS_02750 gene serA 128063 129292 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_02750 131577 129391 gene locus_tag LOCUS_02760 131577 129391 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_02760 132312 131899 gene locus_tag LOCUS_02770 132312 131899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 133185 132421 gene locus_tag LOCUS_02780 gene hisF 133185 132421 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001007.1 protein_id gnl|my_center|LOCUS_02780 133927 133187 gene locus_tag LOCUS_02790 gene hisA 133927 133187 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246848.1 protein_id gnl|my_center|LOCUS_02790 134600 133956 gene locus_tag LOCUS_02800 gene hisH 134600 133956 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 protein_id gnl|my_center|LOCUS_02800 135208 134618 gene locus_tag LOCUS_02810 gene hisB 135208 134618 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_02810 135354 135764 gene locus_tag LOCUS_02820 135354 135764 CDS product acetyl-CoA sensor PanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112623.1 protein_id gnl|my_center|LOCUS_02820 135875 136519 gene locus_tag LOCUS_02830 135875 136519 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_02830 136727 136948 gene locus_tag LOCUS_02840 136727 136948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 136945 139368 gene locus_tag LOCUS_02850 136945 139368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 139430 140533 gene locus_tag LOCUS_02860 gene mutY 139430 140533 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_02860 140530 140808 gene locus_tag LOCUS_02870 140530 140808 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555777.1 protein_id gnl|my_center|LOCUS_02870 140891 140966 gene locus_tag LOCUS_t00020 140891 140966 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 141202 142629 gene locus_tag LOCUS_02880 141202 142629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 144185 143724 gene locus_tag LOCUS_02890 gene radC 144185 143724 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148675.1 protein_id gnl|my_center|LOCUS_02890 144609 145580 gene locus_tag LOCUS_02900 144609 145580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 145583 146254 gene locus_tag LOCUS_02910 145583 146254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 146553 146738 gene locus_tag LOCUS_02920 146553 146738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 146680 148062 gene locus_tag LOCUS_02930 146680 148062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 148387 148899 gene locus_tag LOCUS_02940 148387 148899 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence003 1455 913 gene locus_tag LOCUS_02950 1455 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 1708 1915 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2189 2755 gene locus_tag LOCUS_02960 gene efp 2189 2755 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_02960 2844 3767 gene locus_tag LOCUS_02970 gene epmA 2844 3767 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036753.1 protein_id gnl|my_center|LOCUS_02970 4236 3769 gene locus_tag LOCUS_02980 4236 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 5323 4457 gene locus_tag LOCUS_02990 5323 4457 CDS product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 protein_id gnl|my_center|LOCUS_02990 6326 5469 gene locus_tag LOCUS_03000 gene asd 6326 5469 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113924.1 protein_id gnl|my_center|LOCUS_03000 7171 6335 gene locus_tag LOCUS_03010 7171 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 8882 7254 gene locus_tag LOCUS_03020 8882 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 9088 9939 gene locus_tag LOCUS_03030 gene motA 9088 9939 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102044.1 protein_id gnl|my_center|LOCUS_03030 9939 10964 gene locus_tag LOCUS_03040 gene motB 9939 10964 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763003.1 protein_id gnl|my_center|LOCUS_03040 12066 11035 gene locus_tag LOCUS_03050 gene rsgA 12066 11035 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_03050 12431 12973 gene locus_tag LOCUS_03060 gene orn 12431 12973 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 protein_id gnl|my_center|LOCUS_03060 14098 13049 gene locus_tag LOCUS_03070 14098 13049 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114426.1 protein_id gnl|my_center|LOCUS_03070 15308 14211 gene locus_tag LOCUS_03080 gene queG 15308 14211 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244608.1 protein_id gnl|my_center|LOCUS_03080 15374 16894 gene locus_tag LOCUS_03090 15374 16894 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_03090 16894 17370 gene locus_tag LOCUS_03100 gene tsaE 16894 17370 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317192.1 protein_id gnl|my_center|LOCUS_03100 17367 18695 gene locus_tag LOCUS_03110 17367 18695 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763015.1 protein_id gnl|my_center|LOCUS_03110 18714 20597 gene locus_tag LOCUS_03120 gene mutL 18714 20597 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105240.1 protein_id gnl|my_center|LOCUS_03120 20597 21556 gene locus_tag LOCUS_03130 gene miaA 20597 21556 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105239.1 protein_id gnl|my_center|LOCUS_03130 21662 21916 gene locus_tag LOCUS_03140 gene hfq 21662 21916 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_03140 21934 23244 gene locus_tag LOCUS_03150 gene hflX 21934 23244 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 protein_id gnl|my_center|LOCUS_03150 23342 24523 gene locus_tag LOCUS_03160 gene hflK 23342 24523 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_03160 24523 25392 gene locus_tag LOCUS_03170 gene hflC 24523 25392 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763025.1 protein_id gnl|my_center|LOCUS_03170 25507 25704 gene locus_tag LOCUS_03180 25507 25704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 25716 26882 gene locus_tag LOCUS_03190 25716 26882 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402926.1 protein_id gnl|my_center|LOCUS_03190 26892 28199 gene locus_tag LOCUS_03200 26892 28199 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_03200 28462 28914 gene locus_tag LOCUS_03210 28462 28914 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480116.1 protein_id gnl|my_center|LOCUS_03210 30611 29022 gene locus_tag LOCUS_03220 30611 29022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 31337 30627 gene locus_tag LOCUS_03230 gene mtnC 31337 30627 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267285.1 protein_id gnl|my_center|LOCUS_03230 31895 31350 gene locus_tag LOCUS_03240 31895 31350 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267284.1 protein_id gnl|my_center|LOCUS_03240 32528 31905 gene locus_tag LOCUS_03250 32528 31905 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103182.1 protein_id gnl|my_center|LOCUS_03250 33554 32538 gene locus_tag LOCUS_03260 gene mtnA 33554 32538 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091449.1 protein_id gnl|my_center|LOCUS_03260 35263 33647 gene locus_tag LOCUS_03270 35263 33647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 37100 35442 gene locus_tag LOCUS_03280 gene pgi 37100 35442 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073376.1 protein_id gnl|my_center|LOCUS_03280 37646 37266 gene locus_tag LOCUS_03290 37646 37266 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 protein_id gnl|my_center|LOCUS_03290 38617 37757 gene locus_tag LOCUS_03300 gene panC 38617 37757 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109313.1 protein_id gnl|my_center|LOCUS_03300 39423 38614 gene locus_tag LOCUS_03310 gene panB 39423 38614 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113913.1 protein_id gnl|my_center|LOCUS_03310 40006 39512 gene locus_tag LOCUS_03320 gene folK 40006 39512 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693858.1 protein_id gnl|my_center|LOCUS_03320 41397 40021 gene locus_tag LOCUS_03330 41397 40021 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086024044.1 protein_id gnl|my_center|LOCUS_03330 43963 42566 gene locus_tag LOCUS_03340 gene cbrB 43963 42566 CDS product two-component system response regulator CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_03340 46890 43960 gene locus_tag LOCUS_03350 gene cbrA 46890 43960 CDS product two-component system sensor histidine kinase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_03350 47056 46880 gene locus_tag LOCUS_03360 47056 46880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 protein_id gnl|my_center|LOCUS_03360 48010 47102 gene locus_tag LOCUS_03370 gene gluQRS 48010 47102 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951304.1 protein_id gnl|my_center|LOCUS_03370 48529 48095 gene locus_tag LOCUS_03380 gene dksA 48529 48095 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614892.1 protein_id gnl|my_center|LOCUS_03380 48784 49992 gene locus_tag LOCUS_03390 48784 49992 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113459.1 protein_id gnl|my_center|LOCUS_03390 49992 50750 gene locus_tag LOCUS_03400 gene sfsA 49992 50750 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545814.1 protein_id gnl|my_center|LOCUS_03400 50796 50996 gene locus_tag LOCUS_03410 50796 50996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 51329 51012 gene locus_tag LOCUS_03420 51329 51012 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246097.1 protein_id gnl|my_center|LOCUS_03420 51362 52357 gene locus_tag LOCUS_03430 51362 52357 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140582.1 protein_id gnl|my_center|LOCUS_03430 52351 53115 gene locus_tag LOCUS_03440 52351 53115 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209058.1 protein_id gnl|my_center|LOCUS_03440 54200 53406 gene locus_tag LOCUS_03450 gene cbpA 54200 53406 CDS product cAMP-binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 protein_id gnl|my_center|LOCUS_03450 54707 54363 gene locus_tag LOCUS_03460 54707 54363 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246096.1 protein_id gnl|my_center|LOCUS_03460 54760 57201 gene locus_tag LOCUS_03470 54760 57201 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050513484.1 protein_id gnl|my_center|LOCUS_03470 57297 58262 gene locus_tag LOCUS_03480 gene corA 57297 58262 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_03480 59552 58374 gene locus_tag LOCUS_03490 59552 58374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 60658 59585 gene locus_tag LOCUS_03500 60658 59585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 61837 60674 gene locus_tag LOCUS_03510 61837 60674 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527911.1 protein_id gnl|my_center|LOCUS_03510 63372 61837 gene locus_tag LOCUS_03520 63372 61837 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_03520 64929 63394 gene locus_tag LOCUS_03530 64929 63394 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067724.1 protein_id gnl|my_center|LOCUS_03530 65119 66339 gene locus_tag LOCUS_03540 65119 66339 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651618.1 protein_id gnl|my_center|LOCUS_03540 66472 67251 gene locus_tag LOCUS_03550 66472 67251 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_03550 67325 68056 gene locus_tag LOCUS_03560 67325 68056 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098478.1 protein_id gnl|my_center|LOCUS_03560 68849 68073 gene locus_tag LOCUS_03570 68849 68073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 70540 69119 gene locus_tag LOCUS_03580 70540 69119 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114363.1 protein_id gnl|my_center|LOCUS_03580 70839 70543 gene locus_tag LOCUS_03590 70839 70543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 71801 70965 gene locus_tag LOCUS_03600 71801 70965 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 protein_id gnl|my_center|LOCUS_03600 73181 71802 gene locus_tag LOCUS_03610 73181 71802 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413541.1 protein_id gnl|my_center|LOCUS_03610 74387 73263 gene locus_tag LOCUS_03620 74387 73263 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_03620 75933 74389 gene locus_tag LOCUS_03630 gene gpmM 75933 74389 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043126577.1 protein_id gnl|my_center|LOCUS_03630 76085 76306 gene locus_tag LOCUS_03640 76085 76306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 76290 76703 gene locus_tag LOCUS_03650 76290 76703 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 protein_id gnl|my_center|LOCUS_03650 76743 77216 gene locus_tag LOCUS_03660 gene secB 76743 77216 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070466.1 protein_id gnl|my_center|LOCUS_03660 78459 77314 gene locus_tag LOCUS_03670 78459 77314 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482589.1 protein_id gnl|my_center|LOCUS_03670 78946 78419 gene locus_tag LOCUS_03680 gene trmL 78946 78419 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094923.1 protein_id gnl|my_center|LOCUS_03680 79013 79978 gene locus_tag LOCUS_03690 79013 79978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 79978 80664 gene locus_tag LOCUS_03700 79978 80664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 80661 81338 gene locus_tag LOCUS_03710 80661 81338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 81331 81675 gene locus_tag LOCUS_03720 81331 81675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 81685 83307 gene locus_tag LOCUS_03730 gene mshL 81685 83307 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073814.1 protein_id gnl|my_center|LOCUS_03730 83310 84218 gene locus_tag LOCUS_03740 gene mshM 83310 84218 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_03740 84215 85171 gene locus_tag LOCUS_03750 84215 85171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 85175 86896 gene locus_tag LOCUS_03760 gene mshE 85175 86896 CDS product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_03760 86889 88115 gene locus_tag LOCUS_03770 gene mshG 86889 88115 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_03770 88224 88838 gene locus_tag LOCUS_03780 88224 88838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 88857 89351 gene locus_tag LOCUS_03790 88857 89351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 89364 89828 gene locus_tag LOCUS_03800 89364 89828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 89890 90375 gene locus_tag LOCUS_03810 89890 90375 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481015.1 protein_id gnl|my_center|LOCUS_03810 90375 91187 gene locus_tag LOCUS_03820 90375 91187 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086312.1 protein_id gnl|my_center|LOCUS_03820 91617 95459 gene locus_tag LOCUS_03830 91617 95459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 96910 95480 gene locus_tag LOCUS_03840 gene ntrC 96910 95480 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_03840 97989 96913 gene locus_tag LOCUS_03850 gene glnL 97989 96913 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_03850 98827 98315 gene locus_tag LOCUS_03860 98827 98315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 98932 100902 gene locus_tag LOCUS_03870 98932 100902 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463903.1 protein_id gnl|my_center|LOCUS_03870 100978 101412 gene locus_tag LOCUS_03880 gene dtd 100978 101412 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694618.1 protein_id gnl|my_center|LOCUS_03880 101621 101995 gene locus_tag LOCUS_03890 101621 101995 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_03890 102014 102295 gene locus_tag LOCUS_03900 102014 102295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 102306 102482 gene locus_tag LOCUS_03910 102306 102482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 102569 103966 gene locus_tag LOCUS_03920 102569 103966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 103973 105460 gene locus_tag LOCUS_03930 103973 105460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 105441 108587 gene locus_tag LOCUS_03940 105441 108587 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_03940 110289 108661 gene locus_tag LOCUS_03950 110289 108661 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114016.1 protein_id gnl|my_center|LOCUS_03950 112207 110474 gene locus_tag LOCUS_03960 112207 110474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 112992 112342 gene locus_tag LOCUS_03970 112992 112342 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819905.1 protein_id gnl|my_center|LOCUS_03970 113759 113145 gene locus_tag LOCUS_03980 113759 113145 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071325.1 protein_id gnl|my_center|LOCUS_03980 114152 114328 gene locus_tag LOCUS_03990 114152 114328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 114438 115523 gene locus_tag LOCUS_04000 114438 115523 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331752.1 protein_id gnl|my_center|LOCUS_04000 115547 116005 gene locus_tag LOCUS_04010 115547 116005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 116860 117157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 117656 117910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 117991 118134 gene locus_tag LOCUS_04020 117991 118134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 118770 118228 gene locus_tag LOCUS_04030 118770 118228 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074296.1 protein_id gnl|my_center|LOCUS_04030 119021 118767 gene locus_tag LOCUS_04040 gene minE 119021 118767 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 protein_id gnl|my_center|LOCUS_04040 119829 119023 gene locus_tag LOCUS_04050 gene minD 119829 119023 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382726.1 protein_id gnl|my_center|LOCUS_04050 120564 119872 gene locus_tag LOCUS_04060 gene minC 120564 119872 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114802.1 protein_id gnl|my_center|LOCUS_04060 120925 120566 gene locus_tag LOCUS_04070 120925 120566 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365480.1 protein_id gnl|my_center|LOCUS_04070 121135 122253 gene locus_tag LOCUS_04080 gene dinB 121135 122253 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533959.1 protein_id gnl|my_center|LOCUS_04080 122864 122280 gene locus_tag LOCUS_04090 122864 122280 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_04090 124032 122818 gene locus_tag LOCUS_04100 124032 122818 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_04100 124122 124382 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 125416 124388 gene locus_tag LOCUS_04110 gene oruR 125416 124388 CDS product ornithine utilization transcriptional regulator OruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114220.1 protein_id gnl|my_center|LOCUS_04110 126446 125571 gene locus_tag LOCUS_04120 126446 125571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 126531 126932 gene locus_tag LOCUS_04130 126531 126932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 127011 127463 gene locus_tag LOCUS_04140 127011 127463 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102319.1 protein_id gnl|my_center|LOCUS_04140 128240 127494 gene locus_tag LOCUS_04150 128240 127494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 128803 128324 gene locus_tag LOCUS_04160 128803 128324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 129623 128922 gene locus_tag LOCUS_04170 129623 128922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 129826 130536 gene locus_tag LOCUS_04180 129826 130536 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092520.1 protein_id gnl|my_center|LOCUS_04180 130825 130574 gene locus_tag LOCUS_04190 130825 130574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 132202 131102 gene locus_tag LOCUS_04200 132202 131102 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112621.1 protein_id gnl|my_center|LOCUS_04200 133392 132376 gene locus_tag LOCUS_04210 gene adeT1 133392 132376 CDS product putative multidrug efflux protein AdeT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_04210 133559 133759 gene locus_tag LOCUS_04220 133559 133759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 134365 134620 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 134765 135016 gene locus_tag LOCUS_04230 134765 135016 CDS product DUF4404 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407026.1 protein_id gnl|my_center|LOCUS_04230 135100 135534 gene locus_tag LOCUS_04240 135100 135534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 135758 136456 gene locus_tag LOCUS_04250 135758 136456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 137425 137820 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 137942 138244 gene locus_tag LOCUS_04260 137942 138244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 138319 140532 gene locus_tag LOCUS_04270 138319 140532 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444419.1 protein_id gnl|my_center|LOCUS_04270 142237 140597 gene locus_tag LOCUS_04280 142237 140597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 143631 142237 gene locus_tag LOCUS_04290 143631 142237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 144978 144205 gene locus_tag LOCUS_04300 gene rlpA 144978 144205 CDS product septal ring lytic transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080119.1 protein_id gnl|my_center|LOCUS_04300 145949 144975 gene locus_tag LOCUS_04310 gene mltB 145949 144975 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736753.1 protein_id gnl|my_center|LOCUS_04310 147103 145961 gene locus_tag LOCUS_04320 gene rodA 147103 145961 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483658.1 protein_id gnl|my_center|LOCUS_04320 <148207 147103 gene locus_tag LOCUS_04330 <148207 147103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093191.1:penicillin-binding protein 2 >Feature sequence004 2618 192 gene locus_tag LOCUS_04340 2618 192 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 protein_id gnl|my_center|LOCUS_04340 3562 2615 gene locus_tag LOCUS_04350 3562 2615 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_04350 5149 3632 gene locus_tag LOCUS_04360 5149 3632 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444662.1 protein_id gnl|my_center|LOCUS_04360 5379 6749 gene locus_tag LOCUS_04370 5379 6749 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444159.1 protein_id gnl|my_center|LOCUS_04370 6869 7711 gene locus_tag LOCUS_04380 6869 7711 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092159.1 protein_id gnl|my_center|LOCUS_04380 7906 8316 gene locus_tag LOCUS_04390 7906 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 12163 8336 gene locus_tag LOCUS_04400 12163 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 13450 12224 gene locus_tag LOCUS_04410 13450 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 14622 13789 gene locus_tag LOCUS_04420 14622 13789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 15612 14632 gene locus_tag LOCUS_04430 15612 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 17886 15778 gene locus_tag LOCUS_04440 gene pnp 17886 15778 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095181.1 protein_id gnl|my_center|LOCUS_04440 18423 18154 gene locus_tag LOCUS_04450 gene rpsO 18423 18154 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095184.1 protein_id gnl|my_center|LOCUS_04450 19494 18550 gene locus_tag LOCUS_04460 gene truB 19494 18550 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481564.1 protein_id gnl|my_center|LOCUS_04460 19911 19498 gene locus_tag LOCUS_04470 gene rbfA 19911 19498 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_04470 22567 20045 gene locus_tag LOCUS_04480 gene infB 22567 20045 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113908.1 protein_id gnl|my_center|LOCUS_04480 24089 22593 gene locus_tag LOCUS_04490 gene nusA 24089 22593 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_04490 24570 24112 gene locus_tag LOCUS_04500 gene rimP 24570 24112 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_04500 24912 24827 gene locus_tag LOCUS_t00030 24912 24827 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25319 24930 gene locus_tag LOCUS_04510 gene secG 25319 24930 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766452.1 protein_id gnl|my_center|LOCUS_04510 26068 25328 gene locus_tag LOCUS_04520 gene tpiA 26068 25328 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813996.1 protein_id gnl|my_center|LOCUS_04520 27493 26159 gene locus_tag LOCUS_04530 gene glmM 27493 26159 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_04530 28328 27486 gene locus_tag LOCUS_04540 gene folP 28328 27486 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815445.1 protein_id gnl|my_center|LOCUS_04540 30376 28415 gene locus_tag LOCUS_04550 gene ftsH 30376 28415 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095200.1 protein_id gnl|my_center|LOCUS_04550 31040 30420 gene locus_tag LOCUS_04560 gene rlmE 31040 30420 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313635.1 protein_id gnl|my_center|LOCUS_04560 31178 31480 gene locus_tag LOCUS_04570 gene yhbY 31178 31480 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095204.1 protein_id gnl|my_center|LOCUS_04570 31872 31489 gene locus_tag LOCUS_04580 31872 31489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 32035 33153 gene locus_tag LOCUS_04590 32035 33153 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072810.1 protein_id gnl|my_center|LOCUS_04590 33309 33824 gene locus_tag LOCUS_04600 gene fabA 33309 33824 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316569.1 protein_id gnl|my_center|LOCUS_04600 34032 33847 gene locus_tag LOCUS_04610 34032 33847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 33958 34479 gene locus_tag LOCUS_04620 33958 34479 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815410.1 protein_id gnl|my_center|LOCUS_04620 35023 34547 gene locus_tag LOCUS_04630 gene greA 35023 34547 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095206.1 protein_id gnl|my_center|LOCUS_04630 38269 35054 gene locus_tag LOCUS_04640 gene carB 38269 35054 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340565.1 protein_id gnl|my_center|LOCUS_04640 39452 38286 gene locus_tag LOCUS_04650 gene carA 39452 38286 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071374.1 protein_id gnl|my_center|LOCUS_04650 40045 40653 gene locus_tag LOCUS_04660 40045 40653 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707289.1 protein_id gnl|my_center|LOCUS_04660 41519 40716 gene locus_tag LOCUS_04670 gene dapB 41519 40716 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_04670 42743 41625 gene locus_tag LOCUS_04680 gene dnaJ 42743 41625 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_04680 44814 42907 gene locus_tag LOCUS_04690 gene dnaK 44814 42907 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095212.1 protein_id gnl|my_center|LOCUS_04690 45581 44997 gene locus_tag LOCUS_04700 gene grpE 45581 44997 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095213.1 protein_id gnl|my_center|LOCUS_04700 45731 47404 gene locus_tag LOCUS_04710 gene recN 45731 47404 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418848.1 protein_id gnl|my_center|LOCUS_04710 47910 47503 gene locus_tag LOCUS_04720 gene fur 47910 47503 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555142.1 protein_id gnl|my_center|LOCUS_04720 48023 48421 gene locus_tag LOCUS_04730 48023 48421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 48829 48506 gene locus_tag LOCUS_04740 48829 48506 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 protein_id gnl|my_center|LOCUS_04740 49223 48792 gene locus_tag LOCUS_04750 49223 48792 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 protein_id gnl|my_center|LOCUS_04750 50643 49246 gene locus_tag LOCUS_04760 50643 49246 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243715.1 protein_id gnl|my_center|LOCUS_04760 50873 51355 gene locus_tag LOCUS_04770 gene smpB 50873 51355 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036652.1 protein_id gnl|my_center|LOCUS_04770 51478 51833 gene locus_tag LOCUS_tm00010 51478 51833 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 52216 53796 gene locus_tag LOCUS_04780 52216 53796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 53793 54770 gene locus_tag LOCUS_04790 53793 54770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 54926 56581 gene locus_tag LOCUS_04800 54926 56581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 56759 56568 gene locus_tag LOCUS_04810 56759 56568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 56694 57197 gene locus_tag LOCUS_04820 56694 57197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 57194 58540 gene locus_tag LOCUS_04830 57194 58540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 58537 59127 gene locus_tag LOCUS_04840 gene pnuC 58537 59127 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_04840 59114 60184 gene locus_tag LOCUS_04850 59114 60184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 60595 60930 gene locus_tag LOCUS_04860 60595 60930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 60924 61160 gene locus_tag LOCUS_04870 60924 61160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 61166 61705 gene locus_tag LOCUS_04880 61166 61705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04880 61938 62537 gene locus_tag LOCUS_04890 61938 62537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 63181 62615 gene locus_tag LOCUS_04900 gene efp 63181 62615 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090942.1 protein_id gnl|my_center|LOCUS_04900 64417 63221 gene locus_tag LOCUS_04910 gene earP 64417 63221 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268554.1 protein_id gnl|my_center|LOCUS_04910 64588 65361 gene locus_tag LOCUS_04920 64588 65361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 65801 65346 gene locus_tag LOCUS_04930 65801 65346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 65959 67521 gene locus_tag LOCUS_04940 65959 67521 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267236.1 protein_id gnl|my_center|LOCUS_04940 67524 67724 gene locus_tag LOCUS_04950 67524 67724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 67724 69166 gene locus_tag LOCUS_04960 67724 69166 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037642.1 protein_id gnl|my_center|LOCUS_04960 69264 70193 gene locus_tag LOCUS_04970 69264 70193 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705598.1 protein_id gnl|my_center|LOCUS_04970 70243 70719 gene locus_tag LOCUS_04980 gene dpsA 70243 70719 CDS product non-specific DNA-binding protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 protein_id gnl|my_center|LOCUS_04980 70977 70747 gene locus_tag LOCUS_04990 70977 70747 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070876.1 protein_id gnl|my_center|LOCUS_04990 71996 71007 gene locus_tag LOCUS_05000 71996 71007 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 protein_id gnl|my_center|LOCUS_05000 73102 72152 gene locus_tag LOCUS_05010 73102 72152 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_05010 74154 73099 gene locus_tag LOCUS_05020 gene cobD 74154 73099 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_05020 75100 74156 gene locus_tag LOCUS_05030 gene cbiB 75100 74156 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112351.1 protein_id gnl|my_center|LOCUS_05030 75227 76732 gene locus_tag LOCUS_05040 75227 76732 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766682.1 protein_id gnl|my_center|LOCUS_05040 76844 77242 gene locus_tag LOCUS_05050 76844 77242 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093127.1 protein_id gnl|my_center|LOCUS_05050 77440 78072 gene locus_tag LOCUS_05060 77440 78072 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 protein_id gnl|my_center|LOCUS_05060 78416 78102 gene locus_tag LOCUS_05070 78416 78102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 78736 78401 gene locus_tag LOCUS_05080 78736 78401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 79607 78822 gene locus_tag LOCUS_05090 79607 78822 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 protein_id gnl|my_center|LOCUS_05090 80248 79604 gene locus_tag LOCUS_05100 80248 79604 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 protein_id gnl|my_center|LOCUS_05100 81320 80265 gene locus_tag LOCUS_05110 gene cobT 81320 80265 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206640.1 protein_id gnl|my_center|LOCUS_05110 81901 81365 gene locus_tag LOCUS_05120 gene cobU 81901 81365 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_05120 81960 82310 gene locus_tag LOCUS_05130 81960 82310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 82402 83319 gene locus_tag LOCUS_05140 82402 83319 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_05140 83313 83675 gene locus_tag LOCUS_05150 83313 83675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 83769 84389 gene locus_tag LOCUS_05160 83769 84389 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 protein_id gnl|my_center|LOCUS_05160 84455 84901 gene locus_tag LOCUS_05170 84455 84901 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 protein_id gnl|my_center|LOCUS_05170 86325 84922 gene locus_tag LOCUS_05180 86325 84922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_05180 86810 86325 gene locus_tag LOCUS_05190 86810 86325 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809252.1 protein_id gnl|my_center|LOCUS_05190 87027 88130 gene locus_tag LOCUS_05200 87027 88130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 88278 89117 gene locus_tag LOCUS_05210 88278 89117 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103683318.1 protein_id gnl|my_center|LOCUS_05210 89162 91102 gene locus_tag LOCUS_05220 89162 91102 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106517.1 protein_id gnl|my_center|LOCUS_05220 91464 91231 gene locus_tag LOCUS_05230 91464 91231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 91586 93541 gene locus_tag LOCUS_05240 gene fecA 91586 93541 CDS product Fe(3+) dicitrate transport protein FecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188255.1 protein_id gnl|my_center|LOCUS_05240 93535 94734 gene locus_tag LOCUS_05250 93535 94734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 94771 95340 gene locus_tag LOCUS_05260 94771 95340 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_05260 97429 95411 gene locus_tag LOCUS_05270 97429 95411 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112846.1 protein_id gnl|my_center|LOCUS_05270 99231 97594 gene locus_tag LOCUS_05280 gene aceF 99231 97594 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244575.1 protein_id gnl|my_center|LOCUS_05280 101953 99242 gene locus_tag LOCUS_05290 gene aceE 101953 99242 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_05290 102059 102673 gene locus_tag LOCUS_05300 gene cobO 102059 102673 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 protein_id gnl|my_center|LOCUS_05300 103356 102682 gene locus_tag LOCUS_05310 103356 102682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 103628 105220 gene locus_tag LOCUS_05320 103628 105220 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_05320 106377 105295 gene locus_tag LOCUS_05330 gene modC 106377 105295 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104308.1 protein_id gnl|my_center|LOCUS_05330 107069 106374 gene locus_tag LOCUS_05340 gene modB 107069 106374 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_05340 107342 107073 gene locus_tag LOCUS_05350 107342 107073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 <107917 107369 gene locus_tag LOCUS_05360 <107917 107369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089689.1:molybdate ABC transporter substrate-binding protein >Feature sequence005 <1 528 gene locus_tag LOCUS_05370 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071344.1:TRAP transporter substrate-binding protein DctP 1453 575 gene locus_tag LOCUS_05380 1453 575 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118789.1 protein_id gnl|my_center|LOCUS_05380 1569 2765 gene locus_tag LOCUS_05390 1569 2765 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_05390 4122 2851 gene locus_tag LOCUS_05400 4122 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4789 4127 gene locus_tag LOCUS_05410 4789 4127 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_05410 5078 5599 gene locus_tag LOCUS_05420 5078 5599 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 protein_id gnl|my_center|LOCUS_05420 5606 7885 gene locus_tag LOCUS_05430 gene ptsP 5606 7885 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_05430 8455 7910 gene locus_tag LOCUS_05440 8455 7910 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072173.1 protein_id gnl|my_center|LOCUS_05440 10417 8627 gene locus_tag LOCUS_05450 gene ldtD 10417 8627 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925977.1 protein_id gnl|my_center|LOCUS_05450 11386 10625 gene locus_tag LOCUS_05460 11386 10625 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_05460 11499 12287 gene locus_tag LOCUS_05470 11499 12287 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_05470 12357 13166 gene locus_tag LOCUS_05480 gene lgt 12357 13166 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772080.1 protein_id gnl|my_center|LOCUS_05480 13163 13957 gene locus_tag LOCUS_05490 gene thyA 13163 13957 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098550.1 protein_id gnl|my_center|LOCUS_05490 14109 15809 gene locus_tag LOCUS_05500 14109 15809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 15912 16427 gene locus_tag LOCUS_05510 15912 16427 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244533.1 protein_id gnl|my_center|LOCUS_05510 16492 17154 gene locus_tag LOCUS_05520 16492 17154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 17197 17379 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19057 17429 gene locus_tag LOCUS_05530 19057 17429 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706041.1 protein_id gnl|my_center|LOCUS_05530 19626 19279 gene locus_tag LOCUS_05540 19626 19279 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_05540 19777 20805 gene locus_tag LOCUS_05550 19777 20805 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_05550 20891 22420 gene locus_tag LOCUS_05560 20891 22420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810425.1 protein_id gnl|my_center|LOCUS_05560 22417 23748 gene locus_tag LOCUS_05570 22417 23748 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_05570 24184 25404 gene locus_tag LOCUS_05580 gene phaZ 24184 25404 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536442.1 protein_id gnl|my_center|LOCUS_05580 26976 25480 gene locus_tag LOCUS_05590 26976 25480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 27028 27314 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28259 28411 gene locus_tag LOCUS_05600 28259 28411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 28849 30459 gene locus_tag LOCUS_05610 28849 30459 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479209.1 protein_id gnl|my_center|LOCUS_05610 30567 31727 gene locus_tag LOCUS_05620 30567 31727 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084535.1 protein_id gnl|my_center|LOCUS_05620 31724 32326 gene locus_tag LOCUS_05630 gene metW 31724 32326 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_05630 32329 32796 gene locus_tag LOCUS_05640 32329 32796 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261212.1 protein_id gnl|my_center|LOCUS_05640 32793 33407 gene locus_tag LOCUS_05650 32793 33407 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174736.1 protein_id gnl|my_center|LOCUS_05650 33487 33831 gene locus_tag LOCUS_05660 33487 33831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 33854 34996 gene locus_tag LOCUS_05670 gene hemW 33854 34996 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_05670 36004 35057 gene locus_tag LOCUS_05680 36004 35057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 protein_id gnl|my_center|LOCUS_05680 37431 35980 gene locus_tag LOCUS_05690 37431 35980 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263925.1 protein_id gnl|my_center|LOCUS_05690 37841 37443 gene locus_tag LOCUS_05700 37841 37443 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637098.1 protein_id gnl|my_center|LOCUS_05700 39195 37930 gene locus_tag LOCUS_05710 gene ectB 39195 37930 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 protein_id gnl|my_center|LOCUS_05710 39608 39204 gene locus_tag LOCUS_05720 39608 39204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 39904 40326 gene locus_tag LOCUS_05730 39904 40326 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554262.1 protein_id gnl|my_center|LOCUS_05730 40326 40874 gene locus_tag LOCUS_05740 40326 40874 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410818.1 protein_id gnl|my_center|LOCUS_05740 41157 42338 gene locus_tag LOCUS_05750 41157 42338 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266654.1 protein_id gnl|my_center|LOCUS_05750 43531 42449 gene locus_tag LOCUS_05760 43531 42449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 45628 43703 gene locus_tag LOCUS_05770 45628 43703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 46163 47845 gene locus_tag LOCUS_05780 46163 47845 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_05780 48551 47898 gene locus_tag LOCUS_05790 48551 47898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 51220 48602 gene locus_tag LOCUS_05800 51220 48602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 52132 51383 gene locus_tag LOCUS_05810 gene tatC 52132 51383 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266364.1 protein_id gnl|my_center|LOCUS_05810 52527 52129 gene locus_tag LOCUS_05820 gene tatB 52527 52129 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266365.1 protein_id gnl|my_center|LOCUS_05820 52787 52527 gene locus_tag LOCUS_05830 gene tatA 52787 52527 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704119.1 protein_id gnl|my_center|LOCUS_05830 53155 52823 gene locus_tag LOCUS_05840 53155 52823 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022010.1 protein_id gnl|my_center|LOCUS_05840 53521 53189 gene locus_tag LOCUS_05850 53521 53189 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105340.1 protein_id gnl|my_center|LOCUS_05850 53929 53549 gene locus_tag LOCUS_05860 gene hisI 53929 53549 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_05860 54249 55448 gene locus_tag LOCUS_05870 54249 55448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 55441 55986 gene locus_tag LOCUS_05880 55441 55986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 55996 56583 gene locus_tag LOCUS_05890 55996 56583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 56660 57214 gene locus_tag LOCUS_05900 56660 57214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 57228 57701 gene locus_tag LOCUS_05910 57228 57701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 57715 58230 gene locus_tag LOCUS_05920 57715 58230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 58367 59407 gene locus_tag LOCUS_05930 58367 59407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 60770 59502 gene locus_tag LOCUS_05940 60770 59502 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266429.1 protein_id gnl|my_center|LOCUS_05940 61816 60773 gene locus_tag LOCUS_05950 61816 60773 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084569.1 protein_id gnl|my_center|LOCUS_05950 62349 61855 gene locus_tag LOCUS_05960 gene pyrR 62349 61855 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_05960 62820 62359 gene locus_tag LOCUS_05970 gene ruvX 62820 62359 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084575.1 protein_id gnl|my_center|LOCUS_05970 63377 62820 gene locus_tag LOCUS_05980 63377 62820 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461717.1 protein_id gnl|my_center|LOCUS_05980 64252 63377 gene locus_tag LOCUS_05990 64252 63377 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_05990 65341 64382 gene locus_tag LOCUS_06000 gene gshB 65341 64382 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 protein_id gnl|my_center|LOCUS_06000 65484 65939 gene locus_tag LOCUS_06010 gene pilG 65484 65939 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084583.1 protein_id gnl|my_center|LOCUS_06010 65978 66343 gene locus_tag LOCUS_06020 gene pilH 65978 66343 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_06020 66345 66869 gene locus_tag LOCUS_06030 66345 66869 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_06030 66991 69021 gene locus_tag LOCUS_06040 gene pilJ 66991 69021 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_06040 69048 69938 gene locus_tag LOCUS_06050 gene pilK 69048 69938 CDS product type 4 fimbrial methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_06050 69935 76681 gene locus_tag LOCUS_06060 69935 76681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 76683 77723 gene locus_tag LOCUS_06070 76683 77723 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118811.1 protein_id gnl|my_center|LOCUS_06070 77704 78177 gene locus_tag LOCUS_06080 77704 78177 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_06080 78223 79260 gene locus_tag LOCUS_06090 gene waaC 78223 79260 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_06090 79253 79909 gene locus_tag LOCUS_06100 79253 79909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 79912 80628 gene locus_tag LOCUS_06110 79912 80628 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813221.1 protein_id gnl|my_center|LOCUS_06110 80674 81714 gene locus_tag LOCUS_06120 80674 81714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 82942 81674 gene locus_tag LOCUS_06130 82942 81674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 84099 83035 gene locus_tag LOCUS_06140 84099 83035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 85434 84361 gene locus_tag LOCUS_06150 85434 84361 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418344.1 protein_id gnl|my_center|LOCUS_06150 87074 85464 gene locus_tag LOCUS_06160 87074 85464 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556298.1 protein_id gnl|my_center|LOCUS_06160 88148 87222 gene locus_tag LOCUS_06170 88148 87222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 89220 88198 gene locus_tag LOCUS_06180 89220 88198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 90346 89213 gene locus_tag LOCUS_06190 90346 89213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 91256 90432 gene locus_tag LOCUS_06200 gene metF 91256 90432 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118821.1 protein_id gnl|my_center|LOCUS_06200 92716 91334 gene locus_tag LOCUS_06210 gene ahcY 92716 91334 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266417.1 protein_id gnl|my_center|LOCUS_06210 93984 92773 gene locus_tag LOCUS_06220 gene metK 93984 92773 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555698.1 protein_id gnl|my_center|LOCUS_06220 95056 94028 gene locus_tag LOCUS_06230 95056 94028 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_06230 95255 95419 gene locus_tag LOCUS_06240 95255 95419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 96220 95426 gene locus_tag LOCUS_06250 96220 95426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 96405 97568 gene locus_tag LOCUS_06260 96405 97568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 97565 98206 gene locus_tag LOCUS_06270 97565 98206 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 protein_id gnl|my_center|LOCUS_06270 100057 98210 gene locus_tag LOCUS_06280 100057 98210 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706983.1 protein_id gnl|my_center|LOCUS_06280 100181 102214 gene locus_tag LOCUS_06290 100181 102214 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707714.1 protein_id gnl|my_center|LOCUS_06290 103358 102240 gene locus_tag LOCUS_06300 103358 102240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence006 546 82 gene locus_tag LOCUS_06310 546 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2529 580 gene locus_tag LOCUS_06320 2529 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 3656 2514 gene locus_tag LOCUS_06330 3656 2514 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_06330 3918 3664 gene locus_tag LOCUS_06340 3918 3664 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456658.1 protein_id gnl|my_center|LOCUS_06340 5097 4030 gene locus_tag LOCUS_06350 5097 4030 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_06350 6240 5191 gene locus_tag LOCUS_06360 gene oruR 6240 5191 CDS product ornithine utilization transcriptional regulator OruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114220.1 protein_id gnl|my_center|LOCUS_06360 6373 8094 gene locus_tag LOCUS_06370 gene fadD2 6373 8094 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 protein_id gnl|my_center|LOCUS_06370 8321 10126 gene locus_tag LOCUS_06380 8321 10126 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 protein_id gnl|my_center|LOCUS_06380 11986 10208 gene locus_tag LOCUS_06390 11986 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 12315 12971 gene locus_tag LOCUS_06400 12315 12971 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_06400 13718 13068 gene locus_tag LOCUS_06410 13718 13068 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_06410 15217 13820 gene locus_tag LOCUS_06420 gene cls 15217 13820 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191365.1 protein_id gnl|my_center|LOCUS_06420 15810 15259 gene locus_tag LOCUS_06430 gene folE 15810 15259 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768747.1 protein_id gnl|my_center|LOCUS_06430 16719 15865 gene locus_tag LOCUS_06440 gene murI 16719 15865 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703959.1 protein_id gnl|my_center|LOCUS_06440 16849 17844 gene locus_tag LOCUS_06450 16849 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 17908 18768 gene locus_tag LOCUS_06460 gene ppk2 17908 18768 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_06460 18955 19102 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19369 19590 gene locus_tag LOCUS_06470 19369 19590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 20202 19630 gene locus_tag LOCUS_06480 20202 19630 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072802.1 protein_id gnl|my_center|LOCUS_06480 20730 20248 gene locus_tag LOCUS_06490 20730 20248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 20992 20807 gene locus_tag LOCUS_06500 20992 20807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 22716 21010 gene locus_tag LOCUS_06510 22716 21010 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_06510 23059 22703 gene locus_tag LOCUS_06520 23059 22703 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461077.1 protein_id gnl|my_center|LOCUS_06520 23160 24047 gene locus_tag LOCUS_06530 23160 24047 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521366.1 protein_id gnl|my_center|LOCUS_06530 24130 24567 gene locus_tag LOCUS_06540 24130 24567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 25414 24530 gene locus_tag LOCUS_06550 gene ylqF 25414 24530 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_06550 25648 25839 gene locus_tag LOCUS_06560 25648 25839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 26550 25927 gene locus_tag LOCUS_06570 26550 25927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 26673 26969 gene locus_tag LOCUS_06580 26673 26969 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705060.1 protein_id gnl|my_center|LOCUS_06580 27128 27790 gene locus_tag LOCUS_06590 27128 27790 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932842.1 protein_id gnl|my_center|LOCUS_06590 27904 29268 gene locus_tag LOCUS_06600 27904 29268 CDS product phosphate ABC transporter substrate-binding/OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267709.1 protein_id gnl|my_center|LOCUS_06600 29918 29343 gene locus_tag LOCUS_06610 29918 29343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 30056 30661 gene locus_tag LOCUS_06620 30056 30661 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_06620 30888 30742 gene locus_tag LOCUS_06630 30888 30742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 31971 30928 gene locus_tag LOCUS_06640 31971 30928 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_06640 32588 31968 gene locus_tag LOCUS_06650 32588 31968 CDS product DNA-J related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_06650 32893 32627 gene locus_tag LOCUS_06660 32893 32627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 33036 33584 gene locus_tag LOCUS_06670 gene greB 33036 33584 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090951.1 protein_id gnl|my_center|LOCUS_06670 33650 34144 gene locus_tag LOCUS_06680 33650 34144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 35036 34185 gene locus_tag LOCUS_06690 gene ttcA 35036 34185 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082462.1 protein_id gnl|my_center|LOCUS_06690 35654 35160 gene locus_tag LOCUS_06700 35654 35160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082640.1 protein_id gnl|my_center|LOCUS_06700 36694 35927 gene locus_tag LOCUS_06710 gene fnr 36694 35927 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244356.1 protein_id gnl|my_center|LOCUS_06710 37442 36780 gene locus_tag LOCUS_06720 37442 36780 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 protein_id gnl|my_center|LOCUS_06720 37633 37439 gene locus_tag LOCUS_06730 gene ccoS 37633 37439 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766953.1 protein_id gnl|my_center|LOCUS_06730 40081 37637 gene locus_tag LOCUS_06740 40081 37637 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268428.1 protein_id gnl|my_center|LOCUS_06740 40578 40078 gene locus_tag LOCUS_06750 40578 40078 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072347.1 protein_id gnl|my_center|LOCUS_06750 42121 40715 gene locus_tag LOCUS_06760 gene ccoG 42121 40715 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_06760 43254 42331 gene locus_tag LOCUS_06770 gene ccoP 43254 42331 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268424.1 protein_id gnl|my_center|LOCUS_06770 43433 43257 gene locus_tag LOCUS_06780 43433 43257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 44047 43439 gene locus_tag LOCUS_06790 gene ccoO 44047 43439 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_06790 45494 44061 gene locus_tag LOCUS_06800 gene ccoN 45494 44061 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_06800 45866 46501 gene locus_tag LOCUS_06810 45866 46501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 protein_id gnl|my_center|LOCUS_06810 46653 49016 gene locus_tag LOCUS_06820 46653 49016 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127697866.1 protein_id gnl|my_center|LOCUS_06820 49249 49872 gene locus_tag LOCUS_06830 49249 49872 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037903.1 protein_id gnl|my_center|LOCUS_06830 49883 50422 gene locus_tag LOCUS_06840 49883 50422 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930254.1 protein_id gnl|my_center|LOCUS_06840 50436 51263 gene locus_tag LOCUS_06850 50436 51263 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 protein_id gnl|my_center|LOCUS_06850 51266 52648 gene locus_tag LOCUS_06860 51266 52648 CDS product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063987.1 protein_id gnl|my_center|LOCUS_06860 53238 52771 gene locus_tag LOCUS_06870 53238 52771 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036240.1 protein_id gnl|my_center|LOCUS_06870 54073 53792 gene locus_tag LOCUS_06880 54073 53792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 54186 54926 gene locus_tag LOCUS_06890 54186 54926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 55010 55936 gene locus_tag LOCUS_06900 55010 55936 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024414.1 protein_id gnl|my_center|LOCUS_06900 56374 56018 gene locus_tag LOCUS_06910 56374 56018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 56524 56904 gene locus_tag LOCUS_06920 56524 56904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 56931 59441 gene locus_tag LOCUS_06930 56931 59441 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985413.1 protein_id gnl|my_center|LOCUS_06930 59438 60910 gene locus_tag LOCUS_06940 59438 60910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 60920 61510 gene locus_tag LOCUS_06950 60920 61510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 61515 62159 gene locus_tag LOCUS_06960 61515 62159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 62159 63229 gene locus_tag LOCUS_06970 62159 63229 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_06970 63421 66534 gene locus_tag LOCUS_06980 63421 66534 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 protein_id gnl|my_center|LOCUS_06980 66534 67247 gene locus_tag LOCUS_06990 66534 67247 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_06990 67306 69162 gene locus_tag LOCUS_07000 67306 69162 CDS product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 protein_id gnl|my_center|LOCUS_07000 69315 69872 gene locus_tag LOCUS_07010 69315 69872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 70008 70577 gene locus_tag LOCUS_07020 70008 70577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 70603 71019 gene locus_tag LOCUS_07030 70603 71019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 71125 71514 gene locus_tag LOCUS_07040 71125 71514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 71736 72545 gene locus_tag LOCUS_07050 71736 72545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 73031 72561 gene locus_tag LOCUS_07060 73031 72561 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115857.1 protein_id gnl|my_center|LOCUS_07060 73176 74135 gene locus_tag LOCUS_07070 73176 74135 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528172.1 protein_id gnl|my_center|LOCUS_07070 75939 74224 gene locus_tag LOCUS_07080 gene fabY 75939 74224 CDS product beta-ketoacyl-ACP synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114068.1 protein_id gnl|my_center|LOCUS_07080 76154 77140 gene locus_tag LOCUS_07090 76154 77140 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123657.1 protein_id gnl|my_center|LOCUS_07090 77239 78276 gene locus_tag LOCUS_07100 77239 78276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 78649 81327 gene locus_tag LOCUS_07110 gene aceE 78649 81327 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_07110 81341 83005 gene locus_tag LOCUS_07120 gene aceF 81341 83005 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115359.1 protein_id gnl|my_center|LOCUS_07120 83997 83128 gene locus_tag LOCUS_07130 83997 83128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence007 543 25 gene locus_tag LOCUS_07140 543 25 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 protein_id gnl|my_center|LOCUS_07140 1427 543 gene locus_tag LOCUS_07150 1427 543 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070869.1 protein_id gnl|my_center|LOCUS_07150 1624 1539 gene locus_tag LOCUS_t00040 1624 1539 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1739 1666 gene locus_tag LOCUS_t00050 1739 1666 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1841 1766 gene locus_tag LOCUS_t00060 1841 1766 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2465 1917 gene locus_tag LOCUS_07160 gene pgsA 2465 1917 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_07160 4301 2481 gene locus_tag LOCUS_07170 gene uvrC 4301 2481 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_07170 4948 4301 gene locus_tag LOCUS_07180 gene uvrY 4948 4301 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737926.1 protein_id gnl|my_center|LOCUS_07180 7747 5033 gene locus_tag LOCUS_07190 7747 5033 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016415173.1 protein_id gnl|my_center|LOCUS_07190 7829 8755 gene locus_tag LOCUS_07200 7829 8755 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_07200 9158 9069 gene locus_tag LOCUS_t00070 9158 9069 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9302 9691 gene locus_tag LOCUS_07210 gene tusD 9302 9691 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268013.1 protein_id gnl|my_center|LOCUS_07210 9698 10045 gene locus_tag LOCUS_07220 9698 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 10047 10310 gene locus_tag LOCUS_07230 10047 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 10315 10629 gene locus_tag LOCUS_07240 10315 10629 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119979.1 protein_id gnl|my_center|LOCUS_07240 10626 11603 gene locus_tag LOCUS_07250 10626 11603 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108776.1 protein_id gnl|my_center|LOCUS_07250 13297 11678 gene locus_tag LOCUS_07260 13297 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 14770 13400 gene locus_tag LOCUS_07270 gene cysG 14770 13400 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_07270 16041 14767 gene locus_tag LOCUS_07280 gene serS 16041 14767 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104505.1 protein_id gnl|my_center|LOCUS_07280 16422 16048 gene locus_tag LOCUS_07290 gene crcB 16422 16048 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975197.1 protein_id gnl|my_center|LOCUS_07290 17756 16419 gene locus_tag LOCUS_07300 17756 16419 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_07300 18432 17746 gene locus_tag LOCUS_07310 gene lolA 18432 17746 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090414.1 protein_id gnl|my_center|LOCUS_07310 20991 18445 gene locus_tag LOCUS_07320 20991 18445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 21140 21835 gene locus_tag LOCUS_07330 gene aat 21140 21835 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_07330 21832 22536 gene locus_tag LOCUS_07340 21832 22536 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_07340 22637 22855 gene locus_tag LOCUS_07350 gene infA 22637 22855 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 protein_id gnl|my_center|LOCUS_07350 25349 22836 gene locus_tag LOCUS_07360 gene clpA 25349 22836 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_07360 22877 23105 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25786 25364 gene locus_tag LOCUS_07370 gene clpS 25786 25364 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405085.1 protein_id gnl|my_center|LOCUS_07370 25970 26239 gene locus_tag LOCUS_07380 gene cspD 25970 26239 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090435.1 protein_id gnl|my_center|LOCUS_07380 28555 26321 gene locus_tag LOCUS_07390 28555 26321 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_07390 28820 29446 gene locus_tag LOCUS_07400 28820 29446 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399826.1 protein_id gnl|my_center|LOCUS_07400 29506 29955 gene locus_tag LOCUS_07410 29506 29955 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_07410 29958 31055 gene locus_tag LOCUS_07420 gene mnmA 29958 31055 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007019485.1 protein_id gnl|my_center|LOCUS_07420 31052 31702 gene locus_tag LOCUS_07430 gene hflD 31052 31702 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405097.1 protein_id gnl|my_center|LOCUS_07430 31749 31939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31943 32896 gene locus_tag LOCUS_07440 gene dusA 31943 32896 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095060.1 protein_id gnl|my_center|LOCUS_07440 33320 32982 gene locus_tag LOCUS_07450 33320 32982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 33487 34437 gene locus_tag LOCUS_07460 gene tal 33487 34437 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351598.1 protein_id gnl|my_center|LOCUS_07460 34434 34871 gene locus_tag LOCUS_07470 34434 34871 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454910.1 protein_id gnl|my_center|LOCUS_07470 34868 35725 gene locus_tag LOCUS_07480 34868 35725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 37195 35804 gene locus_tag LOCUS_07490 gene sthA 37195 35804 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 protein_id gnl|my_center|LOCUS_07490 37566 37333 gene locus_tag LOCUS_07500 gene nqrM 37566 37333 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_07500 38621 37584 gene locus_tag LOCUS_07510 38621 37584 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246830.1 protein_id gnl|my_center|LOCUS_07510 38839 39177 gene locus_tag LOCUS_07520 38839 39177 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_07520 40116 39187 gene locus_tag LOCUS_07530 40116 39187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 41125 40181 gene locus_tag LOCUS_07540 41125 40181 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 protein_id gnl|my_center|LOCUS_07540 41285 41647 gene locus_tag LOCUS_07550 41285 41647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 41647 42735 gene locus_tag LOCUS_07560 41647 42735 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071341.1 protein_id gnl|my_center|LOCUS_07560 42744 43361 gene locus_tag LOCUS_07570 42744 43361 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974304.1 protein_id gnl|my_center|LOCUS_07570 43755 43363 gene locus_tag LOCUS_07580 43755 43363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 44176 45219 gene locus_tag LOCUS_07590 44176 45219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 45216 45734 gene locus_tag LOCUS_07600 45216 45734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 45807 46352 gene locus_tag LOCUS_07610 45807 46352 CDS product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073835.1 protein_id gnl|my_center|LOCUS_07610 46453 47787 gene locus_tag LOCUS_07620 gene yegQ 46453 47787 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_07620 47886 49187 gene locus_tag LOCUS_07630 47886 49187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 49184 49801 gene locus_tag LOCUS_07640 49184 49801 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722188.1 protein_id gnl|my_center|LOCUS_07640 50552 49827 gene locus_tag LOCUS_07650 50552 49827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 51391 50549 gene locus_tag LOCUS_07660 51391 50549 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_07660 52173 51388 gene locus_tag LOCUS_07670 52173 51388 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947453.1 protein_id gnl|my_center|LOCUS_07670 52735 52271 gene locus_tag LOCUS_07680 gene sixA 52735 52271 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769602.1 protein_id gnl|my_center|LOCUS_07680 53025 52732 gene locus_tag LOCUS_07690 53025 52732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 54102 53077 gene locus_tag LOCUS_07700 54102 53077 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769608.1 protein_id gnl|my_center|LOCUS_07700 54633 54139 gene locus_tag LOCUS_07710 54633 54139 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_07710 55802 54630 gene locus_tag LOCUS_07720 55802 54630 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407019.1 protein_id gnl|my_center|LOCUS_07720 56073 56375 gene locus_tag LOCUS_07730 56073 56375 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382960.1 protein_id gnl|my_center|LOCUS_07730 57034 56444 gene locus_tag LOCUS_07740 gene nfuA 57034 56444 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_07740 57178 60888 gene locus_tag LOCUS_07750 gene metH 57178 60888 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_07750 60892 62250 gene locus_tag LOCUS_07760 60892 62250 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981895.1 protein_id gnl|my_center|LOCUS_07760 62289 63080 gene locus_tag LOCUS_07770 gene ugpQ 62289 63080 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063880.1 protein_id gnl|my_center|LOCUS_07770 63249 64910 gene locus_tag LOCUS_07780 63249 64910 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396332.1 protein_id gnl|my_center|LOCUS_07780 64894 65382 gene locus_tag LOCUS_07790 64894 65382 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762572.1 protein_id gnl|my_center|LOCUS_07790 65489 66649 gene locus_tag LOCUS_07800 65489 66649 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_07800 67040 66660 gene locus_tag LOCUS_07810 67040 66660 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971212.1 protein_id gnl|my_center|LOCUS_07810 67827 67114 gene locus_tag LOCUS_07820 67827 67114 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398720.1 protein_id gnl|my_center|LOCUS_07820 68958 67966 gene locus_tag LOCUS_07830 68958 67966 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_07830 70045 68984 gene locus_tag LOCUS_07840 gene sohB 70045 68984 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_07840 70280 70594 gene locus_tag LOCUS_07850 70280 70594 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_07850 71300 70659 gene locus_tag LOCUS_07860 71300 70659 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931630.1 protein_id gnl|my_center|LOCUS_07860 72945 71302 gene locus_tag LOCUS_07870 72945 71302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 73205 74716 gene locus_tag LOCUS_07880 gene nhaB 73205 74716 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113594.1 protein_id gnl|my_center|LOCUS_07880 75446 74748 gene locus_tag LOCUS_07890 gene dnaQ 75446 74748 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705465.1 protein_id gnl|my_center|LOCUS_07890 75883 75443 gene locus_tag LOCUS_07900 gene rnhA 75883 75443 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_07900 76655 75885 gene locus_tag LOCUS_07910 76655 75885 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087952.1 protein_id gnl|my_center|LOCUS_07910 76728 78275 gene locus_tag LOCUS_07920 76728 78275 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 protein_id gnl|my_center|LOCUS_07920 78363 80096 gene locus_tag LOCUS_07930 78363 80096 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_07930 80141 80938 gene locus_tag LOCUS_07940 gene fabI 80141 80938 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770759.1 protein_id gnl|my_center|LOCUS_07940 82861 81026 gene locus_tag LOCUS_07950 82861 81026 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267217.1 protein_id gnl|my_center|LOCUS_07950 83004 82928 gene locus_tag LOCUS_t00080 83004 82928 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 354 725 gene locus_tag LOCUS_07960 354 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 1678 923 gene locus_tag LOCUS_07970 1678 923 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207384.1 protein_id gnl|my_center|LOCUS_07970 1901 2539 gene locus_tag LOCUS_07980 1901 2539 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_07980 6365 2688 gene locus_tag LOCUS_07990 gene uca 6365 2688 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 protein_id gnl|my_center|LOCUS_07990 6647 6683 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7319 6684 gene locus_tag LOCUS_08000 7319 6684 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_08000 8086 7331 gene locus_tag LOCUS_08010 8086 7331 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_08010 8972 8109 gene locus_tag LOCUS_08020 8972 8109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268763.1 protein_id gnl|my_center|LOCUS_08020 9830 9018 gene locus_tag LOCUS_08030 9830 9018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413041.1 protein_id gnl|my_center|LOCUS_08030 10248 11243 gene locus_tag LOCUS_08040 10248 11243 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_08040 11385 11173 gene locus_tag LOCUS_08050 11385 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 12128 11430 gene locus_tag LOCUS_08060 12128 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 12699 12283 gene locus_tag LOCUS_08070 12699 12283 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 protein_id gnl|my_center|LOCUS_08070 13992 12865 gene locus_tag LOCUS_08080 13992 12865 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085824.1 protein_id gnl|my_center|LOCUS_08080 14679 14056 gene locus_tag LOCUS_08090 14679 14056 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109148.1 protein_id gnl|my_center|LOCUS_08090 14926 15435 gene locus_tag LOCUS_08100 14926 15435 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_08100 16214 15432 gene locus_tag LOCUS_08110 16214 15432 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_08110 16400 16753 gene locus_tag LOCUS_08120 16400 16753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 16756 17259 gene locus_tag LOCUS_08130 16756 17259 CDS product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071687.1 protein_id gnl|my_center|LOCUS_08130 17380 18786 gene locus_tag LOCUS_08140 gene thrC 17380 18786 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113831.1 protein_id gnl|my_center|LOCUS_08140 18929 20203 gene locus_tag LOCUS_08150 18929 20203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 20303 20785 gene locus_tag LOCUS_08160 20303 20785 CDS product DUF2947 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121059.1 protein_id gnl|my_center|LOCUS_08160 20953 21417 gene locus_tag LOCUS_08170 gene bfr 20953 21417 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 protein_id gnl|my_center|LOCUS_08170 21431 21901 gene locus_tag LOCUS_08180 gene bfr 21431 21901 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 protein_id gnl|my_center|LOCUS_08180 22131 23159 gene locus_tag LOCUS_08190 22131 23159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 23599 23852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23970 24917 gene locus_tag LOCUS_08200 23970 24917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 24907 25908 gene locus_tag LOCUS_08210 24907 25908 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_08210 26796 25969 gene locus_tag LOCUS_08220 26796 25969 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707806.1 protein_id gnl|my_center|LOCUS_08220 27022 27906 gene locus_tag LOCUS_08230 27022 27906 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_08230 27903 28697 gene locus_tag LOCUS_08240 27903 28697 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208387.1 protein_id gnl|my_center|LOCUS_08240 29337 28720 gene locus_tag LOCUS_08250 29337 28720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 29713 29504 gene locus_tag LOCUS_08260 29713 29504 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_08260 30031 30939 gene locus_tag LOCUS_08270 30031 30939 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112422.1 protein_id gnl|my_center|LOCUS_08270 31360 30959 gene locus_tag LOCUS_08280 gene gloA 31360 30959 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237796.1 protein_id gnl|my_center|LOCUS_08280 32005 31370 gene locus_tag LOCUS_08290 gene nth 32005 31370 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480814.1 protein_id gnl|my_center|LOCUS_08290 33279 32056 gene locus_tag LOCUS_08300 33279 32056 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054775797.1 protein_id gnl|my_center|LOCUS_08300 33413 33817 gene locus_tag LOCUS_08310 33413 33817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 34016 39085 gene locus_tag LOCUS_08320 34016 39085 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105203.1 protein_id gnl|my_center|LOCUS_08320 39125 41542 gene locus_tag LOCUS_08330 gene pbpC 39125 41542 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175631705.1 protein_id gnl|my_center|LOCUS_08330 41659 42201 gene locus_tag LOCUS_08340 gene rfbC 41659 42201 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 protein_id gnl|my_center|LOCUS_08340 42198 43085 gene locus_tag LOCUS_08350 gene rfbD 42198 43085 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071806.1 protein_id gnl|my_center|LOCUS_08350 43085 44155 gene locus_tag LOCUS_08360 gene rfbB 43085 44155 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_08360 45228 44197 gene locus_tag LOCUS_08370 gene dapD 45228 44197 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377783.1 protein_id gnl|my_center|LOCUS_08370 45624 45280 gene locus_tag LOCUS_08380 45624 45280 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043162216.1 protein_id gnl|my_center|LOCUS_08380 45819 50702 gene locus_tag LOCUS_08390 45819 50702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 50699 51649 gene locus_tag LOCUS_08400 50699 51649 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268102.1 protein_id gnl|my_center|LOCUS_08400 51809 53803 gene locus_tag LOCUS_08410 51809 53803 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817980.1 protein_id gnl|my_center|LOCUS_08410 54505 53807 gene locus_tag LOCUS_08420 54505 53807 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105021.1 protein_id gnl|my_center|LOCUS_08420 55389 54661 gene locus_tag LOCUS_08430 55389 54661 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225344.1 protein_id gnl|my_center|LOCUS_08430 56650 55460 gene locus_tag LOCUS_08440 56650 55460 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188734295.1 protein_id gnl|my_center|LOCUS_08440 57953 56691 gene locus_tag LOCUS_08450 57953 56691 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_08450 59476 58211 gene locus_tag LOCUS_08460 59476 58211 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_08460 61914 59620 gene locus_tag LOCUS_08470 gene feoB 61914 59620 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337005.1 protein_id gnl|my_center|LOCUS_08470 62150 61911 gene locus_tag LOCUS_08480 62150 61911 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390222.1 protein_id gnl|my_center|LOCUS_08480 62258 62515 gene locus_tag LOCUS_08490 62258 62515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 62519 62986 gene locus_tag LOCUS_08500 62519 62986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 64982 63054 gene locus_tag LOCUS_08510 64982 63054 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705733.1 protein_id gnl|my_center|LOCUS_08510 65253 67067 gene locus_tag LOCUS_08520 65253 67067 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 protein_id gnl|my_center|LOCUS_08520 67797 67117 gene locus_tag LOCUS_08530 67797 67117 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269047.1 protein_id gnl|my_center|LOCUS_08530 68480 67794 gene locus_tag LOCUS_08540 68480 67794 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 protein_id gnl|my_center|LOCUS_08540 68583 69215 gene locus_tag LOCUS_08550 gene msrA 68583 69215 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056729.1 protein_id gnl|my_center|LOCUS_08550 69356 69623 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69672 70187 gene locus_tag LOCUS_08560 69672 70187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 70611 70174 gene locus_tag LOCUS_08570 70611 70174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 70721 71530 gene locus_tag LOCUS_08580 70721 71530 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816840.1 protein_id gnl|my_center|LOCUS_08580 71682 72284 gene locus_tag LOCUS_08590 71682 72284 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_08590 72450 73778 gene locus_tag LOCUS_08600 72450 73778 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114884.1 protein_id gnl|my_center|LOCUS_08600 73954 74946 gene locus_tag LOCUS_08610 gene mltC 73954 74946 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419348.1 protein_id gnl|my_center|LOCUS_08610 75008 75673 gene locus_tag LOCUS_08620 75008 75673 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 protein_id gnl|my_center|LOCUS_08620 75723 76280 gene locus_tag LOCUS_08630 75723 76280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 76450 76905 gene locus_tag LOCUS_08640 76450 76905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 78018 76966 gene locus_tag LOCUS_08650 78018 76966 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967763.1 protein_id gnl|my_center|LOCUS_08650 78222 78406 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 78532 78747 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 79428 79207 gene locus_tag LOCUS_08660 79428 79207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 79554 79787 gene locus_tag LOCUS_08670 79554 79787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 79780 80964 gene locus_tag LOCUS_08680 79780 80964 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097284.1 protein_id gnl|my_center|LOCUS_08680 80974 81231 gene locus_tag LOCUS_08690 80974 81231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 81450 81244 gene locus_tag LOCUS_08700 81450 81244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence009 1872 1189 gene locus_tag LOCUS_08710 gene cmk 1872 1189 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554563.1 protein_id gnl|my_center|LOCUS_08710 4114 1883 gene locus_tag LOCUS_08720 4114 1883 CDS product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 protein_id gnl|my_center|LOCUS_08720 5256 4129 gene locus_tag LOCUS_08730 gene hisC 5256 4129 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_08730 6390 5299 gene locus_tag LOCUS_08740 gene pheA 6390 5299 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_08740 7480 6443 gene locus_tag LOCUS_08750 gene serC 7480 6443 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766746.1 protein_id gnl|my_center|LOCUS_08750 8721 7627 gene locus_tag LOCUS_08760 8721 7627 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112588.1 protein_id gnl|my_center|LOCUS_08760 11369 8727 gene locus_tag LOCUS_08770 gene gyrA 11369 8727 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210821.1 protein_id gnl|my_center|LOCUS_08770 11625 12959 gene locus_tag LOCUS_08780 11625 12959 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_08780 12991 13710 gene locus_tag LOCUS_08790 12991 13710 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766737.1 protein_id gnl|my_center|LOCUS_08790 13707 14399 gene locus_tag LOCUS_08800 gene mupP 13707 14399 CDS product N-acetylmuramic acid 6-phosphate phosphatase MupP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895650.1 protein_id gnl|my_center|LOCUS_08800 14466 15209 gene locus_tag LOCUS_08810 14466 15209 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_08810 15412 16542 gene locus_tag LOCUS_08820 15412 16542 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_08820 16894 17850 gene locus_tag LOCUS_08830 16894 17850 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_08830 18792 17923 gene locus_tag LOCUS_08840 18792 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 19881 18796 gene locus_tag LOCUS_08850 19881 18796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 20813 19878 gene locus_tag LOCUS_08860 20813 19878 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396554.1 protein_id gnl|my_center|LOCUS_08860 21985 20810 gene locus_tag LOCUS_08870 21985 20810 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_08870 23120 22059 gene locus_tag LOCUS_08880 gene trpS 23120 22059 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225097.1 protein_id gnl|my_center|LOCUS_08880 23804 23184 gene locus_tag LOCUS_08890 23804 23184 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_08890 24702 23866 gene locus_tag LOCUS_08900 24702 23866 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 protein_id gnl|my_center|LOCUS_08900 24768 25370 gene locus_tag LOCUS_08910 24768 25370 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813872.1 protein_id gnl|my_center|LOCUS_08910 25373 25672 gene locus_tag LOCUS_08920 25373 25672 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_08920 25699 26361 gene locus_tag LOCUS_08930 25699 26361 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104779.1 protein_id gnl|my_center|LOCUS_08930 26725 26435 gene locus_tag LOCUS_08940 26725 26435 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030451.1 protein_id gnl|my_center|LOCUS_08940 26798 27406 gene locus_tag LOCUS_08950 gene ppiA 26798 27406 CDS product peptidylprolyl isomerase PpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114812.1 protein_id gnl|my_center|LOCUS_08950 28418 27414 gene locus_tag LOCUS_08960 28418 27414 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087746.1 protein_id gnl|my_center|LOCUS_08960 28387 30489 gene locus_tag LOCUS_08970 gene mnmC 28387 30489 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114497.1 protein_id gnl|my_center|LOCUS_08970 30718 30500 gene locus_tag LOCUS_08980 30718 30500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 31034 30684 gene locus_tag LOCUS_08990 31034 30684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 31467 31024 gene locus_tag LOCUS_09000 31467 31024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_09000 33381 31570 gene locus_tag LOCUS_09010 gene phaC 33381 31570 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_09010 33844 33452 gene locus_tag LOCUS_09020 33844 33452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 34297 34043 gene locus_tag LOCUS_09030 34297 34043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 35497 34358 gene locus_tag LOCUS_09040 35497 34358 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_09040 36685 35585 gene locus_tag LOCUS_09050 gene aroC 36685 35585 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405788.1 protein_id gnl|my_center|LOCUS_09050 37669 36740 gene locus_tag LOCUS_09060 gene prmB 37669 36740 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_09060 38698 37778 gene locus_tag LOCUS_09070 38698 37778 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_09070 39561 38701 gene locus_tag LOCUS_09080 39561 38701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 39794 41665 gene locus_tag LOCUS_09090 39794 41665 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_09090 41905 42336 gene locus_tag LOCUS_09100 41905 42336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 43178 42432 gene locus_tag LOCUS_09110 43178 42432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 44290 43433 gene locus_tag LOCUS_09120 44290 43433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 44975 44265 gene locus_tag LOCUS_09130 44975 44265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 46480 45104 gene locus_tag LOCUS_09140 46480 45104 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_09140 47844 46549 gene locus_tag LOCUS_09150 47844 46549 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112579.1 protein_id gnl|my_center|LOCUS_09150 48044 48394 gene locus_tag LOCUS_09160 gene arsC 48044 48394 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705568.1 protein_id gnl|my_center|LOCUS_09160 48394 48999 gene locus_tag LOCUS_09170 gene wrbA 48394 48999 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381567.1 protein_id gnl|my_center|LOCUS_09170 48999 49373 gene locus_tag LOCUS_09180 48999 49373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 49388 49834 gene locus_tag LOCUS_09190 49388 49834 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_09190 50139 49909 gene locus_tag LOCUS_09200 50139 49909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 50262 52577 gene locus_tag LOCUS_09210 50262 52577 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 protein_id gnl|my_center|LOCUS_09210 52968 53159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53269 53937 gene locus_tag LOCUS_09220 53269 53937 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_09220 54040 56499 gene locus_tag LOCUS_09230 54040 56499 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263450.1 protein_id gnl|my_center|LOCUS_09230 57553 56519 gene locus_tag LOCUS_09240 57553 56519 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 protein_id gnl|my_center|LOCUS_09240 58467 57556 gene locus_tag LOCUS_09250 58467 57556 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104455.1 protein_id gnl|my_center|LOCUS_09250 58954 61695 gene locus_tag LOCUS_09260 58954 61695 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104454.1 protein_id gnl|my_center|LOCUS_09260 61806 63770 gene locus_tag LOCUS_09270 61806 63770 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104453.1 protein_id gnl|my_center|LOCUS_09270 67058 63816 gene locus_tag LOCUS_09280 67058 63816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 68710 67331 gene locus_tag LOCUS_09290 gene yegD 68710 67331 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072221.1 protein_id gnl|my_center|LOCUS_09290 69289 68810 gene locus_tag LOCUS_09300 69289 68810 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024946077.1 protein_id gnl|my_center|LOCUS_09300 69455 70051 gene locus_tag LOCUS_09310 69455 70051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 70513 70040 gene locus_tag LOCUS_09320 70513 70040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 71509 70559 gene locus_tag LOCUS_09330 71509 70559 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113106.1 protein_id gnl|my_center|LOCUS_09330 71617 72351 gene locus_tag LOCUS_09340 71617 72351 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086127.1 protein_id gnl|my_center|LOCUS_09340 72370 72733 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 73465 72878 gene locus_tag LOCUS_09350 73465 72878 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073219.1 protein_id gnl|my_center|LOCUS_09350 73939 73556 gene locus_tag LOCUS_09360 73939 73556 CDS product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706662.1 protein_id gnl|my_center|LOCUS_09360 74912 74001 gene locus_tag LOCUS_09370 74912 74001 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 protein_id gnl|my_center|LOCUS_09370 75042 76172 gene locus_tag LOCUS_09380 75042 76172 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307638.1 protein_id gnl|my_center|LOCUS_09380 76182 77048 gene locus_tag LOCUS_09390 gene fghA 76182 77048 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072128.1 protein_id gnl|my_center|LOCUS_09390 78434 77142 gene locus_tag LOCUS_09400 78434 77142 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418149.1 protein_id gnl|my_center|LOCUS_09400 78698 79240 gene locus_tag LOCUS_09410 78698 79240 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446416.1 protein_id gnl|my_center|LOCUS_09410 79311 80411 gene locus_tag LOCUS_09420 gene yejK 79311 80411 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266815.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence010 <1 1041 gene locus_tag LOCUS_09430 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206943.1:NADPH-dependent 2,4-dienoyl-CoA reductase 2380 1511 gene locus_tag LOCUS_09440 2380 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 5419 3839 gene locus_tag LOCUS_09450 gene guaA 5419 3839 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105901.1 protein_id gnl|my_center|LOCUS_09450 6970 5486 gene locus_tag LOCUS_09460 gene guaB 6970 5486 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380633.1 protein_id gnl|my_center|LOCUS_09460 7938 7024 gene locus_tag LOCUS_09470 7938 7024 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103721.1 protein_id gnl|my_center|LOCUS_09470 9734 7938 gene locus_tag LOCUS_09480 9734 7938 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_09480 10420 9947 gene locus_tag LOCUS_09490 10420 9947 CDS product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094783.1 protein_id gnl|my_center|LOCUS_09490 10596 12035 gene locus_tag LOCUS_09500 gene xseA 10596 12035 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_09500 12207 12386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12482 13372 gene locus_tag LOCUS_09510 12482 13372 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771007.1 protein_id gnl|my_center|LOCUS_09510 13365 13574 gene locus_tag LOCUS_09520 13365 13574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 13657 14868 gene locus_tag LOCUS_09530 13657 14868 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706654.1 protein_id gnl|my_center|LOCUS_09530 15447 14887 gene locus_tag LOCUS_09540 15447 14887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 16337 15444 gene locus_tag LOCUS_09550 gene tesB 16337 15444 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_09550 17154 18293 gene locus_tag LOCUS_09560 gene trmA 17154 18293 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 protein_id gnl|my_center|LOCUS_09560 18290 19678 gene locus_tag LOCUS_09570 gene dbpA 18290 19678 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762956.1 protein_id gnl|my_center|LOCUS_09570 19972 19730 gene locus_tag LOCUS_09580 19972 19730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 20050 20673 gene locus_tag LOCUS_09590 20050 20673 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_09590 22656 20704 gene locus_tag LOCUS_09600 22656 20704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 24845 22635 gene locus_tag LOCUS_09610 24845 22635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 26707 25223 gene locus_tag LOCUS_09620 26707 25223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 27620 26862 gene locus_tag LOCUS_09630 27620 26862 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925727.1 protein_id gnl|my_center|LOCUS_09630 27724 28305 gene locus_tag LOCUS_09640 27724 28305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 29791 28394 gene locus_tag LOCUS_09650 29791 28394 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_09650 31544 30102 gene locus_tag LOCUS_09660 gene sbcB 31544 30102 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216700.1 protein_id gnl|my_center|LOCUS_09660 32544 31573 gene locus_tag LOCUS_09670 32544 31573 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_09670 32799 35525 gene locus_tag LOCUS_09680 32799 35525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 35744 36406 gene locus_tag LOCUS_09690 35744 36406 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090522.1 protein_id gnl|my_center|LOCUS_09690 37129 36464 gene locus_tag LOCUS_09700 37129 36464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 37844 37161 gene locus_tag LOCUS_09710 37844 37161 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 protein_id gnl|my_center|LOCUS_09710 38225 37863 gene locus_tag LOCUS_09720 38225 37863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 38966 38295 gene locus_tag LOCUS_09730 38966 38295 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_09730 40404 39151 gene locus_tag LOCUS_09740 40404 39151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 41255 40515 gene locus_tag LOCUS_09750 41255 40515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 42527 41388 gene locus_tag LOCUS_09760 42527 41388 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 protein_id gnl|my_center|LOCUS_09760 44084 42861 gene locus_tag LOCUS_09770 gene nqrF 44084 42861 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 protein_id gnl|my_center|LOCUS_09770 44711 44097 gene locus_tag LOCUS_09780 gene nqrE 44711 44097 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_09780 45373 44711 gene locus_tag LOCUS_09790 gene nqrD 45373 44711 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 protein_id gnl|my_center|LOCUS_09790 46172 45375 gene locus_tag LOCUS_09800 46172 45375 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_09800 47373 46159 gene locus_tag LOCUS_09810 47373 46159 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_09810 48584 47376 gene locus_tag LOCUS_09820 48584 47376 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_09820 50491 49043 gene locus_tag LOCUS_09830 50491 49043 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315085.1 protein_id gnl|my_center|LOCUS_09830 50672 54136 gene locus_tag LOCUS_09840 gene mfd 50672 54136 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_09840 54133 54945 gene locus_tag LOCUS_09850 54133 54945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 54953 55486 gene locus_tag LOCUS_09860 54953 55486 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703204.1 protein_id gnl|my_center|LOCUS_09860 55509 55703 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56517 55771 gene locus_tag LOCUS_09870 56517 55771 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_09870 57639 56569 gene locus_tag LOCUS_09880 gene nagZ 57639 56569 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104591.1 protein_id gnl|my_center|LOCUS_09880 58166 57624 gene locus_tag LOCUS_09890 gene elsL 58166 57624 CDS product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_09890 58859 58215 gene locus_tag LOCUS_09900 gene psrA 58859 58215 CDS product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091195.1 protein_id gnl|my_center|LOCUS_09900 59126 59725 gene locus_tag LOCUS_09910 gene lexA 59126 59725 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_09910 59758 60204 gene locus_tag LOCUS_09920 59758 60204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 60572 60321 gene locus_tag LOCUS_09930 60572 60321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315798.1 protein_id gnl|my_center|LOCUS_09930 61173 60694 gene locus_tag LOCUS_09940 61173 60694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 61771 61199 gene locus_tag LOCUS_09950 61771 61199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 63876 61975 gene locus_tag LOCUS_09960 gene htpG 63876 61975 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_09960 65524 63917 gene locus_tag LOCUS_09970 gene thiD 65524 63917 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071216.1 protein_id gnl|my_center|LOCUS_09970 66378 65521 gene locus_tag LOCUS_09980 66378 65521 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199935.1 protein_id gnl|my_center|LOCUS_09980 66632 66399 gene locus_tag LOCUS_09990 66632 66399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 67765 66623 gene locus_tag LOCUS_10000 67765 66623 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202820.1 protein_id gnl|my_center|LOCUS_10000 69684 67762 gene locus_tag LOCUS_10010 gene thiC 69684 67762 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_10010 70531 70097 gene locus_tag LOCUS_10020 70531 70097 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_10020 71022 70528 gene locus_tag LOCUS_10030 71022 70528 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 protein_id gnl|my_center|LOCUS_10030 71328 72131 gene locus_tag LOCUS_10040 71328 72131 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 protein_id gnl|my_center|LOCUS_10040 72274 72648 gene locus_tag LOCUS_10050 72274 72648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10050 72650 73270 gene locus_tag LOCUS_10060 72650 73270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10060 73274 74242 gene locus_tag LOCUS_10070 73274 74242 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_10070 74353 75366 gene locus_tag LOCUS_10080 74353 75366 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_10080 75329 78100 gene locus_tag LOCUS_10090 75329 78100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 78195 78977 gene locus_tag LOCUS_10100 78195 78977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence011 1029 52 gene locus_tag LOCUS_10110 1029 52 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_10110 1952 1026 gene locus_tag LOCUS_10120 1952 1026 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_10120 3369 2155 gene locus_tag LOCUS_10130 3369 2155 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770586.1 protein_id gnl|my_center|LOCUS_10130 4917 3397 gene locus_tag LOCUS_10140 gene purF 4917 3397 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 protein_id gnl|my_center|LOCUS_10140 5441 4947 gene locus_tag LOCUS_10150 5441 4947 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_10150 6141 5587 gene locus_tag LOCUS_10160 6141 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7412 6126 gene locus_tag LOCUS_10170 gene folC 7412 6126 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267159.1 protein_id gnl|my_center|LOCUS_10170 8220 7417 gene locus_tag LOCUS_10180 gene trpA 8220 7417 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_10180 9657 8443 gene locus_tag LOCUS_10190 gene trpB 9657 8443 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116129.1 protein_id gnl|my_center|LOCUS_10190 10282 9635 gene locus_tag LOCUS_10200 10282 9635 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_10200 10671 10375 gene locus_tag LOCUS_10210 10671 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 10711 10969 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14575 11420 gene locus_tag LOCUS_10220 gene fimV 14575 11420 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_10220 15955 14831 gene locus_tag LOCUS_10230 gene asd 15955 14831 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244780.1 protein_id gnl|my_center|LOCUS_10230 17043 15958 gene locus_tag LOCUS_10240 gene leuB 17043 15958 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769662.1 protein_id gnl|my_center|LOCUS_10240 17745 17104 gene locus_tag LOCUS_10250 gene leuD 17745 17104 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_10250 19175 17757 gene locus_tag LOCUS_10260 gene leuC 19175 17757 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038430.1 protein_id gnl|my_center|LOCUS_10260 19229 19482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20497 21420 gene locus_tag LOCUS_10270 gene uspE 20497 21420 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_10270 21431 22384 gene locus_tag LOCUS_10280 21431 22384 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064309.1 protein_id gnl|my_center|LOCUS_10280 22427 22888 gene locus_tag LOCUS_10290 22427 22888 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222817.1 protein_id gnl|my_center|LOCUS_10290 25184 22896 gene locus_tag LOCUS_10300 25184 22896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 27411 25516 gene locus_tag LOCUS_10310 27411 25516 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625986.1 protein_id gnl|my_center|LOCUS_10310 27506 27750 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28659 27787 gene locus_tag LOCUS_10320 gene sucD 28659 27787 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 protein_id gnl|my_center|LOCUS_10320 29835 28669 gene locus_tag LOCUS_10330 gene sucC 29835 28669 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 protein_id gnl|my_center|LOCUS_10330 31419 29974 gene locus_tag LOCUS_10340 gene lpdA 31419 29974 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_10340 32650 31442 gene locus_tag LOCUS_10350 gene odhB 32650 31442 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 protein_id gnl|my_center|LOCUS_10350 34725 32680 gene locus_tag LOCUS_10360 34725 32680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 34750 35017 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35095 35319 gene locus_tag LOCUS_10370 35095 35319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 36698 35988 gene locus_tag LOCUS_10380 36698 35988 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_10380 38486 36714 gene locus_tag LOCUS_10390 gene sdhA 38486 36714 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087407.1 protein_id gnl|my_center|LOCUS_10390 38837 38490 gene locus_tag LOCUS_10400 gene sdhD 38837 38490 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316551.1 protein_id gnl|my_center|LOCUS_10400 39205 38831 gene locus_tag LOCUS_10410 gene sdhC 39205 38831 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423585.1 protein_id gnl|my_center|LOCUS_10410 39558 40835 gene locus_tag LOCUS_10420 gene gltA 39558 40835 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087400.1 protein_id gnl|my_center|LOCUS_10420 40900 41778 gene locus_tag LOCUS_10430 40900 41778 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_10430 41840 42421 gene locus_tag LOCUS_10440 41840 42421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 43252 42452 gene locus_tag LOCUS_10450 43252 42452 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 protein_id gnl|my_center|LOCUS_10450 44339 43389 gene locus_tag LOCUS_10460 44339 43389 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378076.1 protein_id gnl|my_center|LOCUS_10460 44395 45666 gene locus_tag LOCUS_10470 44395 45666 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_10470 47230 45671 gene locus_tag LOCUS_10480 47230 45671 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_10480 48912 47317 gene locus_tag LOCUS_10490 48912 47317 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_10490 50676 48988 gene locus_tag LOCUS_10500 50676 48988 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_10500 50850 51872 gene locus_tag LOCUS_10510 50850 51872 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_10510 51974 52594 gene locus_tag LOCUS_10520 51974 52594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 52622 54499 gene locus_tag LOCUS_10530 52622 54499 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091605.1 protein_id gnl|my_center|LOCUS_10530 55599 54571 gene locus_tag LOCUS_10540 gene waaC 55599 54571 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 protein_id gnl|my_center|LOCUS_10540 55776 56711 gene locus_tag LOCUS_10550 55776 56711 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241008.1 protein_id gnl|my_center|LOCUS_10550 56937 58040 gene locus_tag LOCUS_10560 56937 58040 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327747.1 protein_id gnl|my_center|LOCUS_10560 58042 59634 gene locus_tag LOCUS_10570 58042 59634 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_10570 59631 60422 gene locus_tag LOCUS_10580 59631 60422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 60723 60472 gene locus_tag LOCUS_10590 60723 60472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 60898 62109 gene locus_tag LOCUS_10600 gene fabB 60898 62109 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_10600 62315 67234 gene locus_tag LOCUS_10610 62315 67234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 69709 67307 gene locus_tag LOCUS_10620 69709 67307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 70059 70541 gene locus_tag LOCUS_10630 70059 70541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 71581 71832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 73509 72031 gene locus_tag LOCUS_10640 73509 72031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 74374 73613 gene locus_tag LOCUS_10650 74374 73613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 74738 74451 gene locus_tag LOCUS_10660 74738 74451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 74763 75008 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence012 382 1614 gene locus_tag LOCUS_10670 382 1614 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 protein_id gnl|my_center|LOCUS_10670 1709 1891 gene locus_tag LOCUS_10680 1709 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2769 3209 gene locus_tag LOCUS_10690 gene umuD 2769 3209 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705001.1 protein_id gnl|my_center|LOCUS_10690 4011 3757 gene locus_tag LOCUS_10700 4011 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4201 4590 gene locus_tag LOCUS_10710 4201 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4601 6211 gene locus_tag LOCUS_10720 4601 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124433836.1 protein_id gnl|my_center|LOCUS_10720 6208 8052 gene locus_tag LOCUS_10730 6208 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 8042 8494 gene locus_tag LOCUS_10740 8042 8494 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463671.1 protein_id gnl|my_center|LOCUS_10740 8730 9716 gene locus_tag LOCUS_10750 8730 9716 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105579.1 protein_id gnl|my_center|LOCUS_10750 9970 11121 gene locus_tag LOCUS_10760 gene umuC 9970 11121 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096856.1 protein_id gnl|my_center|LOCUS_10760 11438 11229 gene locus_tag LOCUS_10770 11438 11229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10770 12021 11494 gene locus_tag LOCUS_10780 12021 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10780 13839 12835 gene locus_tag LOCUS_10790 13839 12835 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_10790 15158 13923 gene locus_tag LOCUS_10800 gene moeA 15158 13923 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 protein_id gnl|my_center|LOCUS_10800 15823 15158 gene locus_tag LOCUS_10810 15823 15158 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366057.1 protein_id gnl|my_center|LOCUS_10810 16258 15893 gene locus_tag LOCUS_10820 16258 15893 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268933.1 protein_id gnl|my_center|LOCUS_10820 18080 16419 gene locus_tag LOCUS_10830 gene ettA 18080 16419 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_10830 18296 22468 gene locus_tag LOCUS_10840 gene morA 18296 22468 CDS product cyclic di-GMP receptor MorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112799.1 protein_id gnl|my_center|LOCUS_10840 22452 23597 gene locus_tag LOCUS_10850 22452 23597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 23708 24643 gene locus_tag LOCUS_10860 23708 24643 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970199.1 protein_id gnl|my_center|LOCUS_10860 25968 24655 gene locus_tag LOCUS_10870 25968 24655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 28372 25961 gene locus_tag LOCUS_10880 28372 25961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 28630 29892 gene locus_tag LOCUS_10890 28630 29892 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 protein_id gnl|my_center|LOCUS_10890 30106 30801 gene locus_tag LOCUS_10900 30106 30801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 30903 31250 gene locus_tag LOCUS_10910 30903 31250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 31591 32490 gene locus_tag LOCUS_10920 31591 32490 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_10920 32638 33126 gene locus_tag LOCUS_10930 gene nrdR 32638 33126 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_10930 33123 34232 gene locus_tag LOCUS_10940 gene ribD 33123 34232 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 protein_id gnl|my_center|LOCUS_10940 34283 34945 gene locus_tag LOCUS_10950 34283 34945 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_10950 34958 36073 gene locus_tag LOCUS_10960 gene ribBA 34958 36073 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093313.1 protein_id gnl|my_center|LOCUS_10960 36087 36563 gene locus_tag LOCUS_10970 gene ribE 36087 36563 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555427.1 protein_id gnl|my_center|LOCUS_10970 36569 37039 gene locus_tag LOCUS_10980 gene nusB 36569 37039 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_10980 37059 38015 gene locus_tag LOCUS_10990 gene thiL 37059 38015 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269044.1 protein_id gnl|my_center|LOCUS_10990 38043 38354 gene locus_tag LOCUS_11000 38043 38354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 39484 38420 gene locus_tag LOCUS_11010 gene rsgA 39484 38420 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458373.1 protein_id gnl|my_center|LOCUS_11010 39825 40124 gene locus_tag LOCUS_11020 39825 40124 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 protein_id gnl|my_center|LOCUS_11020 40251 40964 gene locus_tag LOCUS_11030 40251 40964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 40984 41226 gene locus_tag LOCUS_11040 40984 41226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 41226 41702 gene locus_tag LOCUS_11050 gene ybaK 41226 41702 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186559.1 protein_id gnl|my_center|LOCUS_11050 41992 42414 gene locus_tag LOCUS_11060 41992 42414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 42504 45305 gene locus_tag LOCUS_11070 42504 45305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 45840 45310 gene locus_tag LOCUS_11080 45840 45310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 47350 45977 gene locus_tag LOCUS_11090 47350 45977 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877134.1 protein_id gnl|my_center|LOCUS_11090 47510 48745 gene locus_tag LOCUS_11100 47510 48745 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919479.1 protein_id gnl|my_center|LOCUS_11100 48739 49785 gene locus_tag LOCUS_11110 gene astA 48739 49785 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212031.1 protein_id gnl|my_center|LOCUS_11110 49782 51224 gene locus_tag LOCUS_11120 gene astD 49782 51224 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079221.1 protein_id gnl|my_center|LOCUS_11120 51221 52615 gene locus_tag LOCUS_11130 gene astB 51221 52615 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085956.1 protein_id gnl|my_center|LOCUS_11130 54043 52670 gene locus_tag LOCUS_11140 54043 52670 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105011.1 protein_id gnl|my_center|LOCUS_11140 55083 54193 gene locus_tag LOCUS_11150 55083 54193 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055030104.1 protein_id gnl|my_center|LOCUS_11150 55214 55855 gene locus_tag LOCUS_11160 55214 55855 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861284.1 protein_id gnl|my_center|LOCUS_11160 56186 57799 gene locus_tag LOCUS_11170 56186 57799 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073402.1 protein_id gnl|my_center|LOCUS_11170 58606 57959 gene locus_tag LOCUS_11180 58606 57959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114639.1 protein_id gnl|my_center|LOCUS_11180 59955 58615 gene locus_tag LOCUS_11190 59955 58615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 61221 60190 gene locus_tag LOCUS_11200 61221 60190 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111200.1 protein_id gnl|my_center|LOCUS_11200 62636 61605 gene locus_tag LOCUS_11210 62636 61605 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111200.1 protein_id gnl|my_center|LOCUS_11210 63070 63438 gene locus_tag LOCUS_11220 63070 63438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 64666 63602 gene locus_tag LOCUS_11230 gene fba 64666 63602 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763563.1 protein_id gnl|my_center|LOCUS_11230 66008 64767 gene locus_tag LOCUS_11240 66008 64767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 66807 66025 gene locus_tag LOCUS_11250 66807 66025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 68137 66992 gene locus_tag LOCUS_11260 68137 66992 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269229.1 protein_id gnl|my_center|LOCUS_11260 68551 69732 gene locus_tag LOCUS_11270 68551 69732 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538730.1 protein_id gnl|my_center|LOCUS_11270 69816 70928 gene locus_tag LOCUS_11280 69816 70928 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266802.1 protein_id gnl|my_center|LOCUS_11280 70957 71583 gene locus_tag LOCUS_11290 gene rhtB 70957 71583 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459098.1 protein_id gnl|my_center|LOCUS_11290 71813 72071 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence013 130 54 gene locus_tag LOCUS_t00090 130 54 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 417 145 gene locus_tag LOCUS_11300 gene hupB 417 145 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_11300 2925 535 gene locus_tag LOCUS_11310 gene lon 2925 535 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_11310 4343 3057 gene locus_tag LOCUS_11320 gene clpX 4343 3057 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552735.1 protein_id gnl|my_center|LOCUS_11320 5062 4439 gene locus_tag LOCUS_11330 gene clpP 5062 4439 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_11330 6490 5177 gene locus_tag LOCUS_11340 gene tig 6490 5177 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267215.1 protein_id gnl|my_center|LOCUS_11340 6737 6662 gene locus_tag LOCUS_t00100 6737 6662 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6841 6765 gene locus_tag LOCUS_t00110 6841 6765 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6941 6865 gene locus_tag LOCUS_t00120 6941 6865 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7167 8024 gene locus_tag LOCUS_11350 gene folD 7167 8024 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769204.1 protein_id gnl|my_center|LOCUS_11350 9474 8104 gene locus_tag LOCUS_11360 gene cysS 9474 8104 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 protein_id gnl|my_center|LOCUS_11360 11153 9483 gene locus_tag LOCUS_11370 11153 9483 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_11370 11315 11809 gene locus_tag LOCUS_11380 11315 11809 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_11380 11809 12534 gene locus_tag LOCUS_11390 gene lpxH 11809 12534 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267205.1 protein_id gnl|my_center|LOCUS_11390 13650 12625 gene locus_tag LOCUS_11400 gene murB 13650 12625 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930965.1 protein_id gnl|my_center|LOCUS_11400 14144 13647 gene locus_tag LOCUS_11410 14144 13647 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_11410 14365 14150 gene locus_tag LOCUS_11420 14365 14150 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422539.1 protein_id gnl|my_center|LOCUS_11420 15365 14358 gene locus_tag LOCUS_11430 gene lpxK 15365 14358 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091159.1 protein_id gnl|my_center|LOCUS_11430 17110 15371 gene locus_tag LOCUS_11440 gene msbA 17110 15371 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 protein_id gnl|my_center|LOCUS_11440 17538 17116 gene locus_tag LOCUS_11450 17538 17116 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_11450 18171 17539 gene locus_tag LOCUS_11460 18171 17539 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_11460 20641 18287 gene locus_tag LOCUS_11470 20641 18287 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 protein_id gnl|my_center|LOCUS_11470 20693 21244 gene locus_tag LOCUS_11480 20693 21244 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_11480 21308 21573 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21642 21887 gene locus_tag LOCUS_11490 21642 21887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 21888 22028 gene locus_tag LOCUS_11500 21888 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 23325 22174 gene locus_tag LOCUS_11510 23325 22174 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_11510 23572 23432 gene locus_tag LOCUS_11520 23572 23432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 23694 24332 gene locus_tag LOCUS_11530 23694 24332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 24520 25797 gene locus_tag LOCUS_11540 24520 25797 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114088.1 protein_id gnl|my_center|LOCUS_11540 27954 25864 gene locus_tag LOCUS_11550 gene dinG 27954 25864 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112522.1 protein_id gnl|my_center|LOCUS_11550 28666 27971 gene locus_tag LOCUS_11560 28666 27971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 30188 28668 gene locus_tag LOCUS_11570 30188 28668 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818860.1 protein_id gnl|my_center|LOCUS_11570 31404 30352 gene locus_tag LOCUS_11580 31404 30352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 34406 31401 gene locus_tag LOCUS_11590 34406 31401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 36716 34566 gene locus_tag LOCUS_11600 36716 34566 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 protein_id gnl|my_center|LOCUS_11600 37041 37985 gene locus_tag LOCUS_11610 37041 37985 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706000.1 protein_id gnl|my_center|LOCUS_11610 40994 38064 gene locus_tag LOCUS_11620 40994 38064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 41312 42148 gene locus_tag LOCUS_11630 41312 42148 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042007654.1 protein_id gnl|my_center|LOCUS_11630 42808 42248 gene locus_tag LOCUS_11640 42808 42248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 43054 44439 gene locus_tag LOCUS_11650 gene purB 43054 44439 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371741.1 protein_id gnl|my_center|LOCUS_11650 44518 45687 gene locus_tag LOCUS_11660 44518 45687 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097663.1 protein_id gnl|my_center|LOCUS_11660 45677 46588 gene locus_tag LOCUS_11670 45677 46588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 47029 46613 gene locus_tag LOCUS_11680 47029 46613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 48073 47306 gene locus_tag LOCUS_11690 gene kdsB 48073 47306 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 protein_id gnl|my_center|LOCUS_11690 49088 48081 gene locus_tag LOCUS_11700 49088 48081 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 protein_id gnl|my_center|LOCUS_11700 49645 49085 gene locus_tag LOCUS_11710 49645 49085 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413390.1 protein_id gnl|my_center|LOCUS_11710 49908 49833 gene locus_tag LOCUS_t00130 49908 49833 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 50003 49928 gene locus_tag LOCUS_t00140 50003 49928 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 50113 50038 gene locus_tag LOCUS_t00150 50113 50038 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 50210 50135 gene locus_tag LOCUS_t00160 50210 50135 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 51890 50373 gene locus_tag LOCUS_11720 gene gltX 51890 50373 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738107.1 protein_id gnl|my_center|LOCUS_11720 52341 52254 gene locus_tag LOCUS_t00170 52341 52254 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 52907 52425 gene locus_tag LOCUS_11730 52907 52425 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_11730 53180 54568 gene locus_tag LOCUS_11740 53180 54568 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_11740 55465 54644 gene locus_tag LOCUS_11750 gene queF 55465 54644 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114774.1 protein_id gnl|my_center|LOCUS_11750 56254 55478 gene locus_tag LOCUS_11760 56254 55478 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090884.1 protein_id gnl|my_center|LOCUS_11760 57135 56251 gene locus_tag LOCUS_11770 57135 56251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_11770 57197 57598 gene locus_tag LOCUS_11780 57197 57598 CDS product PA2817 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090890.1 protein_id gnl|my_center|LOCUS_11780 57759 57684 gene locus_tag LOCUS_t00180 57759 57684 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 57862 57787 gene locus_tag LOCUS_t00190 57862 57787 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 58048 57973 gene locus_tag LOCUS_t00200 58048 57973 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 58150 58075 gene locus_tag LOCUS_t00210 58150 58075 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 58338 59081 gene locus_tag LOCUS_11790 58338 59081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 59181 61328 gene locus_tag LOCUS_11800 59181 61328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 61764 61297 gene locus_tag LOCUS_11810 gene ospR 61764 61297 CDS product hydroperoxide stress response transcriptional regulator OspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114767.1 protein_id gnl|my_center|LOCUS_11810 62247 61768 gene locus_tag LOCUS_11820 62247 61768 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192400.1 protein_id gnl|my_center|LOCUS_11820 62759 62361 gene locus_tag LOCUS_11830 gene msrB 62759 62361 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114184.1 protein_id gnl|my_center|LOCUS_11830 62854 64071 gene locus_tag LOCUS_11840 62854 64071 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314686.1 protein_id gnl|my_center|LOCUS_11840 64071 64508 gene locus_tag LOCUS_11850 64071 64508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 65715 64573 gene locus_tag LOCUS_11860 gene pdxB 65715 64573 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267266.1 protein_id gnl|my_center|LOCUS_11860 67937 65802 gene locus_tag LOCUS_11870 67937 65802 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_11870 68437 71229 gene locus_tag LOCUS_11880 68437 71229 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence014 878 135 gene locus_tag LOCUS_11890 878 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1535 981 gene locus_tag LOCUS_11900 1535 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934391.1 protein_id gnl|my_center|LOCUS_11900 2139 4742 gene locus_tag LOCUS_11910 gene acnB 2139 4742 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087875.1 protein_id gnl|my_center|LOCUS_11910 4967 6736 gene locus_tag LOCUS_11920 4967 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6887 7405 gene locus_tag LOCUS_11930 6887 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 7542 8477 gene locus_tag LOCUS_11940 7542 8477 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_11940 8676 9665 gene locus_tag LOCUS_11950 8676 9665 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_11950 10058 9717 gene locus_tag LOCUS_11960 10058 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 11903 10128 gene locus_tag LOCUS_11970 gene aspS 11903 10128 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104814.1 protein_id gnl|my_center|LOCUS_11970 12204 13022 gene locus_tag LOCUS_11980 12204 13022 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_11980 13234 13752 gene locus_tag LOCUS_11990 13234 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 13925 14512 gene locus_tag LOCUS_12000 13925 14512 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_12000 14509 15273 gene locus_tag LOCUS_12010 14509 15273 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113828.1 protein_id gnl|my_center|LOCUS_12010 16090 15293 gene locus_tag LOCUS_12020 16090 15293 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010657.1 protein_id gnl|my_center|LOCUS_12020 16570 16112 gene locus_tag LOCUS_12030 16570 16112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 17274 17565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19919 18195 gene locus_tag LOCUS_12040 19919 18195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 20209 20421 gene locus_tag LOCUS_12050 20209 20421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 21209 20400 gene locus_tag LOCUS_12060 21209 20400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12060 21351 21166 gene locus_tag LOCUS_12070 21351 21166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12070 21370 21497 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21850 23322 gene locus_tag LOCUS_12080 21850 23322 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_12080 23459 24244 gene locus_tag LOCUS_12090 23459 24244 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121370.1 protein_id gnl|my_center|LOCUS_12090 24511 25638 gene locus_tag LOCUS_12100 24511 25638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 26669 25629 gene locus_tag LOCUS_12110 26669 25629 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_12110 27994 26666 gene locus_tag LOCUS_12120 27994 26666 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815839.1 protein_id gnl|my_center|LOCUS_12120 28350 27988 gene locus_tag LOCUS_12130 28350 27988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 29863 28520 gene locus_tag LOCUS_12140 gene rimO 29863 28520 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206991.1 protein_id gnl|my_center|LOCUS_12140 31308 30049 gene locus_tag LOCUS_12150 31308 30049 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 protein_id gnl|my_center|LOCUS_12150 31599 32303 gene locus_tag LOCUS_12160 gene rsuA 31599 32303 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706653.1 protein_id gnl|my_center|LOCUS_12160 32503 34773 gene locus_tag LOCUS_12170 32503 34773 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_12170 34949 37225 gene locus_tag LOCUS_12180 34949 37225 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_12180 38450 37332 gene locus_tag LOCUS_12190 38450 37332 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_12190 38475 38720 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39895 39050 gene locus_tag LOCUS_12200 39895 39050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 39989 40242 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41408 41655 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42981 43234 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43259 43384 gene locus_tag LOCUS_12210 43259 43384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 43511 43765 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44355 43819 gene locus_tag LOCUS_12220 44355 43819 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457944.1 protein_id gnl|my_center|LOCUS_12220 45303 44380 gene locus_tag LOCUS_12230 45303 44380 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815851.1 protein_id gnl|my_center|LOCUS_12230 47844 45412 gene locus_tag LOCUS_12240 47844 45412 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707108.1 protein_id gnl|my_center|LOCUS_12240 49672 47831 gene locus_tag LOCUS_12250 49672 47831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 52611 49807 gene locus_tag LOCUS_12260 52611 49807 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937562.1 protein_id gnl|my_center|LOCUS_12260 53320 52613 gene locus_tag LOCUS_12270 53320 52613 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688414.1 protein_id gnl|my_center|LOCUS_12270 54342 53317 gene locus_tag LOCUS_12280 54342 53317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12280 54925 54284 gene locus_tag LOCUS_12290 54925 54284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12290 55803 54922 gene locus_tag LOCUS_12300 55803 54922 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389167.1 protein_id gnl|my_center|LOCUS_12300 56081 56845 gene locus_tag LOCUS_12310 gene pdhR 56081 56845 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331776.1 protein_id gnl|my_center|LOCUS_12310 57720 56842 gene locus_tag LOCUS_12320 57720 56842 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039189.1 protein_id gnl|my_center|LOCUS_12320 57892 58515 gene locus_tag LOCUS_12330 57892 58515 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947686.1 protein_id gnl|my_center|LOCUS_12330 58684 59052 gene locus_tag LOCUS_12340 58684 59052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 59065 59274 gene locus_tag LOCUS_12350 59065 59274 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943568.1 protein_id gnl|my_center|LOCUS_12350 60183 59326 gene locus_tag LOCUS_12360 gene rlmF 60183 59326 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097467.1 protein_id gnl|my_center|LOCUS_12360 60511 60744 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 61055 61663 gene locus_tag LOCUS_12370 61055 61663 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262766.1 protein_id gnl|my_center|LOCUS_12370 61836 62705 gene locus_tag LOCUS_12380 61836 62705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 <64354 62893 gene locus_tag LOCUS_12390 <64354 62893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019828649.1:pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase >Feature sequence015 <1 847 gene locus_tag LOCUS_12400 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106226.1:DUF2333 family protein 1225 2322 gene locus_tag LOCUS_12410 1225 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2324 3787 gene locus_tag LOCUS_12420 2324 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 3801 5336 gene locus_tag LOCUS_12430 3801 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 5423 12166 gene locus_tag LOCUS_12440 5423 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 12169 13605 gene locus_tag LOCUS_12450 12169 13605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 13607 14077 gene locus_tag LOCUS_12460 13607 14077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 14157 15233 gene locus_tag LOCUS_12470 14157 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 16396 15755 gene locus_tag LOCUS_12480 16396 15755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 16570 17547 gene locus_tag LOCUS_12490 16570 17547 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704336.1 protein_id gnl|my_center|LOCUS_12490 17668 19563 gene locus_tag LOCUS_12500 17668 19563 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_12500 19763 22741 gene locus_tag LOCUS_12510 19763 22741 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_12510 22840 24219 gene locus_tag LOCUS_12520 22840 24219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 24536 25261 gene locus_tag LOCUS_12530 24536 25261 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_12530 25261 26643 gene locus_tag LOCUS_12540 25261 26643 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_12540 26647 27171 gene locus_tag LOCUS_12550 26647 27171 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 protein_id gnl|my_center|LOCUS_12550 27186 27596 gene locus_tag LOCUS_12560 27186 27596 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_12560 27599 28225 gene locus_tag LOCUS_12570 27599 28225 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071948.1 protein_id gnl|my_center|LOCUS_12570 28238 29557 gene locus_tag LOCUS_12580 28238 29557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_12580 30422 29679 gene locus_tag LOCUS_12590 30422 29679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444153.1 protein_id gnl|my_center|LOCUS_12590 30664 30422 gene locus_tag LOCUS_12600 30664 30422 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_12600 30766 31323 gene locus_tag LOCUS_12610 30766 31323 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_12610 31450 31715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33269 33536 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33730 34482 gene locus_tag LOCUS_12620 33730 34482 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_12620 34620 35480 gene locus_tag LOCUS_12630 34620 35480 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_12630 35584 36216 gene locus_tag LOCUS_12640 35584 36216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 36213 36815 gene locus_tag LOCUS_12650 gene wrbA 36213 36815 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170081.1 protein_id gnl|my_center|LOCUS_12650 37788 36886 gene locus_tag LOCUS_12660 37788 36886 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_12660 38573 37899 gene locus_tag LOCUS_12670 38573 37899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 38739 39863 gene locus_tag LOCUS_12680 38739 39863 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 protein_id gnl|my_center|LOCUS_12680 40707 39871 gene locus_tag LOCUS_12690 40707 39871 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_12690 41743 40745 gene locus_tag LOCUS_12700 41743 40745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 41976 42230 gene locus_tag LOCUS_12710 41976 42230 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085532.1 protein_id gnl|my_center|LOCUS_12710 42214 42606 gene locus_tag LOCUS_12720 42214 42606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 44257 42650 gene locus_tag LOCUS_12730 gene nadB 44257 42650 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405338.1 protein_id gnl|my_center|LOCUS_12730 44478 45128 gene locus_tag LOCUS_12740 gene rpoE 44478 45128 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_12740 45147 45722 gene locus_tag LOCUS_12750 gene mucA 45147 45722 CDS product anti-sigma factor MucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101958.1 protein_id gnl|my_center|LOCUS_12750 45719 46801 gene locus_tag LOCUS_12760 45719 46801 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268755.1 protein_id gnl|my_center|LOCUS_12760 46809 47255 gene locus_tag LOCUS_12770 gene rseC 46809 47255 CDS product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172756.1 protein_id gnl|my_center|LOCUS_12770 47269 48657 gene locus_tag LOCUS_12780 gene mucD 47269 48657 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_12780 48802 50610 gene locus_tag LOCUS_12790 gene lepA 48802 50610 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739190.1 protein_id gnl|my_center|LOCUS_12790 50603 50974 gene locus_tag LOCUS_12800 50603 50974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 50971 51687 gene locus_tag LOCUS_12810 gene rnc 50971 51687 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554906.1 protein_id gnl|my_center|LOCUS_12810 51746 52046 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52505 52761 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52975 53646 gene locus_tag LOCUS_12820 gene recO 52975 53646 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101972.1 protein_id gnl|my_center|LOCUS_12820 53706 54452 gene locus_tag LOCUS_12830 gene pdxJ 53706 54452 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 protein_id gnl|my_center|LOCUS_12830 54464 54871 gene locus_tag LOCUS_12840 gene acpS 54464 54871 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071561.1 protein_id gnl|my_center|LOCUS_12840 57729 54898 gene locus_tag LOCUS_12850 gene gacS 57729 54898 CDS product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 protein_id gnl|my_center|LOCUS_12850 57921 58823 gene locus_tag LOCUS_12860 gene cysM 57921 58823 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_12860 59028 60359 gene locus_tag LOCUS_12870 gene rlmD 59028 60359 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102417.1 protein_id gnl|my_center|LOCUS_12870 60352 62601 gene locus_tag LOCUS_12880 gene relA 60352 62601 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_12880 62598 63422 gene locus_tag LOCUS_12890 gene mazG 62598 63422 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103676.1 protein_id gnl|my_center|LOCUS_12890 63766 63434 gene locus_tag LOCUS_12900 63766 63434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113849.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence016 <1 1758 gene locus_tag LOCUS_12910 <1 1758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114254.1:ATP-binding protein 2793 1825 gene locus_tag LOCUS_12920 2793 1825 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073720.1 protein_id gnl|my_center|LOCUS_12920 3047 4459 gene locus_tag LOCUS_12930 gene mpl 3047 4459 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093229.1 protein_id gnl|my_center|LOCUS_12930 4456 5073 gene locus_tag LOCUS_12940 gene ubiX 4456 5073 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_12940 5164 5595 gene locus_tag LOCUS_12950 5164 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5721 8153 gene locus_tag LOCUS_12960 5721 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 8279 8527 gene locus_tag LOCUS_12970 8279 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 10172 8550 gene locus_tag LOCUS_12980 10172 8550 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269183.1 protein_id gnl|my_center|LOCUS_12980 10401 10772 gene locus_tag LOCUS_12990 10401 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 11360 10818 gene locus_tag LOCUS_13000 11360 10818 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330816.1 protein_id gnl|my_center|LOCUS_13000 11626 11426 gene locus_tag LOCUS_13010 11626 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 11648 11902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12235 12474 gene locus_tag LOCUS_13020 12235 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 13995 12625 gene locus_tag LOCUS_13030 13995 12625 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463934.1 protein_id gnl|my_center|LOCUS_13030 15062 14169 gene locus_tag LOCUS_13040 15062 14169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 15134 15396 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15729 16037 gene locus_tag LOCUS_13050 15729 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 16338 17165 gene locus_tag LOCUS_13060 16338 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 17803 17210 gene locus_tag LOCUS_13070 17803 17210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095035.1 protein_id gnl|my_center|LOCUS_13070 19007 18003 gene locus_tag LOCUS_13080 gene holA 19007 18003 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_13080 19540 19004 gene locus_tag LOCUS_13090 19540 19004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 22267 19691 gene locus_tag LOCUS_13100 gene leuS 22267 19691 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454506.1 protein_id gnl|my_center|LOCUS_13100 22626 23228 gene locus_tag LOCUS_13110 22626 23228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 23257 24771 gene locus_tag LOCUS_13120 23257 24771 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895701.1 protein_id gnl|my_center|LOCUS_13120 26670 26931 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27276 28406 gene locus_tag LOCUS_13130 27276 28406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 28403 28666 gene locus_tag LOCUS_13140 28403 28666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 28720 32409 gene locus_tag LOCUS_13150 28720 32409 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974950.1 protein_id gnl|my_center|LOCUS_13150 32492 32812 gene locus_tag LOCUS_13160 gene grxD 32492 32812 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_13160 33071 35122 gene locus_tag LOCUS_13170 33071 35122 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 protein_id gnl|my_center|LOCUS_13170 35294 35863 gene locus_tag LOCUS_13180 35294 35863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 35847 36575 gene locus_tag LOCUS_13190 35847 36575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 36734 39613 gene locus_tag LOCUS_13200 36734 39613 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103006.1 protein_id gnl|my_center|LOCUS_13200 39328 39587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39709 40890 gene locus_tag LOCUS_13210 39709 40890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 41767 40910 gene locus_tag LOCUS_13220 41767 40910 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072532.1 protein_id gnl|my_center|LOCUS_13220 42800 41811 gene locus_tag LOCUS_13230 42800 41811 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_13230 42903 43619 gene locus_tag LOCUS_13240 42903 43619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 45726 43642 gene locus_tag LOCUS_13250 45726 43642 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_13250 46594 45869 gene locus_tag LOCUS_13260 46594 45869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036528.1 protein_id gnl|my_center|LOCUS_13260 47067 46597 gene locus_tag LOCUS_13270 47067 46597 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103433.1 protein_id gnl|my_center|LOCUS_13270 48364 47108 gene locus_tag LOCUS_13280 48364 47108 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 protein_id gnl|my_center|LOCUS_13280 49206 48361 gene locus_tag LOCUS_13290 49206 48361 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145047.1 protein_id gnl|my_center|LOCUS_13290 50591 49332 gene locus_tag LOCUS_13300 50591 49332 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_13300 51409 50588 gene locus_tag LOCUS_13310 51409 50588 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768839.1 protein_id gnl|my_center|LOCUS_13310 51858 51406 gene locus_tag LOCUS_13320 51858 51406 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073250.1 protein_id gnl|my_center|LOCUS_13320 52850 51855 gene locus_tag LOCUS_13330 52850 51855 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_13330 54306 52843 gene locus_tag LOCUS_13340 gene phrB 54306 52843 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266743.1 protein_id gnl|my_center|LOCUS_13340 54370 54590 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 55305 55496 gene locus_tag LOCUS_13350 55305 55496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 56470 55466 gene locus_tag LOCUS_13360 56470 55466 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_13360 56575 56793 gene locus_tag LOCUS_13370 56575 56793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 57111 56719 gene locus_tag LOCUS_13380 57111 56719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 58154 57108 gene locus_tag LOCUS_13390 58154 57108 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_13390 58320 60089 gene locus_tag LOCUS_13400 58320 60089 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389063.1 protein_id gnl|my_center|LOCUS_13400 60124 61047 gene locus_tag LOCUS_13410 60124 61047 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103436.1 protein_id gnl|my_center|LOCUS_13410 61320 61649 gene locus_tag LOCUS_13420 61320 61649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 61951 63480 gene locus_tag LOCUS_13430 61951 63480 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence017 390 701 gene locus_tag LOCUS_13440 gene rpsJ 390 701 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555491.1 protein_id gnl|my_center|LOCUS_13440 806 1438 gene locus_tag LOCUS_13450 gene rplC 806 1438 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579663.1 protein_id gnl|my_center|LOCUS_13450 1442 2044 gene locus_tag LOCUS_13460 gene rplD 1442 2044 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422344.1 protein_id gnl|my_center|LOCUS_13460 2041 2337 gene locus_tag LOCUS_13470 gene rplW 2041 2337 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 protein_id gnl|my_center|LOCUS_13470 2350 3345 gene locus_tag LOCUS_13480 2350 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 2532 2598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3363 3638 gene locus_tag LOCUS_13490 gene rpsS 3363 3638 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027275662.1 protein_id gnl|my_center|LOCUS_13490 3652 3987 gene locus_tag LOCUS_13500 gene rplV 3652 3987 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555485.1 protein_id gnl|my_center|LOCUS_13500 3999 4688 gene locus_tag LOCUS_13510 gene rpsC 3999 4688 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 protein_id gnl|my_center|LOCUS_13510 4701 5114 gene locus_tag LOCUS_13520 gene rplP 4701 5114 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_13520 5114 5305 gene locus_tag LOCUS_13530 gene rpmC 5114 5305 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555481.1 protein_id gnl|my_center|LOCUS_13530 5308 5574 gene locus_tag LOCUS_13540 gene rpsQ 5308 5574 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_13540 5607 5975 gene locus_tag LOCUS_13550 gene rplN 5607 5975 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555479.1 protein_id gnl|my_center|LOCUS_13550 5992 6306 gene locus_tag LOCUS_13560 gene rplX 5992 6306 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093711.1 protein_id gnl|my_center|LOCUS_13560 6325 6864 gene locus_tag LOCUS_13570 gene rplE 6325 6864 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768935.1 protein_id gnl|my_center|LOCUS_13570 6875 7180 gene locus_tag LOCUS_13580 gene rpsN 6875 7180 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093701.1 protein_id gnl|my_center|LOCUS_13580 7241 7633 gene locus_tag LOCUS_13590 gene rpsH 7241 7633 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093700.1 protein_id gnl|my_center|LOCUS_13590 7645 8178 gene locus_tag LOCUS_13600 gene rplF 7645 8178 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_13600 8189 8539 gene locus_tag LOCUS_13610 gene rplR 8189 8539 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049741.1 protein_id gnl|my_center|LOCUS_13610 8551 9060 gene locus_tag LOCUS_13620 gene rpsE 8551 9060 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_13620 9067 9252 gene locus_tag LOCUS_13630 gene rpmD 9067 9252 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083582.1 protein_id gnl|my_center|LOCUS_13630 9254 9688 gene locus_tag LOCUS_13640 gene rplO 9254 9688 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391411.1 protein_id gnl|my_center|LOCUS_13640 9688 11007 gene locus_tag LOCUS_13650 gene secY 9688 11007 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555469.1 protein_id gnl|my_center|LOCUS_13650 11248 11604 gene locus_tag LOCUS_13660 gene rpsM 11248 11604 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 protein_id gnl|my_center|LOCUS_13660 11677 12066 gene locus_tag LOCUS_13670 gene rpsK 11677 12066 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093689.1 protein_id gnl|my_center|LOCUS_13670 12079 12699 gene locus_tag LOCUS_13680 gene rpsD 12079 12699 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417269.1 protein_id gnl|my_center|LOCUS_13680 12722 13723 gene locus_tag LOCUS_13690 gene rpoA 12722 13723 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_13690 13756 14166 gene locus_tag LOCUS_13700 gene rplQ 13756 14166 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093672.1 protein_id gnl|my_center|LOCUS_13700 15157 14240 gene locus_tag LOCUS_13710 15157 14240 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206170.1 protein_id gnl|my_center|LOCUS_13710 16637 15360 gene locus_tag LOCUS_13720 16637 15360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 17119 16634 gene locus_tag LOCUS_13730 17119 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 18120 17119 gene locus_tag LOCUS_13740 18120 17119 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_13740 18960 18127 gene locus_tag LOCUS_13750 18960 18127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 22833 19060 gene locus_tag LOCUS_13760 22833 19060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 24493 23111 gene locus_tag LOCUS_13770 24493 23111 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769514.1 protein_id gnl|my_center|LOCUS_13770 24679 24521 gene locus_tag LOCUS_13780 24679 24521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 24810 25007 gene locus_tag LOCUS_13790 24810 25007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 25004 26608 gene locus_tag LOCUS_13800 25004 26608 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073167.1 protein_id gnl|my_center|LOCUS_13800 26619 27755 gene locus_tag LOCUS_13810 gene cydB 26619 27755 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210731.1 protein_id gnl|my_center|LOCUS_13810 27891 28187 gene locus_tag LOCUS_13820 27891 28187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 28267 28647 gene locus_tag LOCUS_13830 28267 28647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 28661 29281 gene locus_tag LOCUS_13840 28661 29281 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_13840 29283 29720 gene locus_tag LOCUS_13850 29283 29720 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033743.1 protein_id gnl|my_center|LOCUS_13850 29849 30691 gene locus_tag LOCUS_13860 29849 30691 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256130.1 protein_id gnl|my_center|LOCUS_13860 31020 30688 gene locus_tag LOCUS_13870 31020 30688 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112819.1 protein_id gnl|my_center|LOCUS_13870 31162 32289 gene locus_tag LOCUS_13880 31162 32289 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_13880 32718 32296 gene locus_tag LOCUS_13890 32718 32296 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 protein_id gnl|my_center|LOCUS_13890 32842 33123 gene locus_tag LOCUS_13900 32842 33123 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071935.1 protein_id gnl|my_center|LOCUS_13900 33218 33913 gene locus_tag LOCUS_13910 33218 33913 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 protein_id gnl|my_center|LOCUS_13910 33917 35293 gene locus_tag LOCUS_13920 33917 35293 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208493.1 protein_id gnl|my_center|LOCUS_13920 35489 35716 gene locus_tag LOCUS_13930 35489 35716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 35774 36838 gene locus_tag LOCUS_13940 gene fabK 35774 36838 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080864.1 protein_id gnl|my_center|LOCUS_13940 36845 38395 gene locus_tag LOCUS_13950 36845 38395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 38661 39602 gene locus_tag LOCUS_13960 38661 39602 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033424.1 protein_id gnl|my_center|LOCUS_13960 39606 40601 gene locus_tag LOCUS_13970 39606 40601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 41405 40578 gene locus_tag LOCUS_13980 gene suhB 41405 40578 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098296.1 protein_id gnl|my_center|LOCUS_13980 44145 41473 gene locus_tag LOCUS_13990 44145 41473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 44803 44216 gene locus_tag LOCUS_14000 44803 44216 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 protein_id gnl|my_center|LOCUS_14000 44847 45611 gene locus_tag LOCUS_14010 44847 45611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_14010 45608 48106 gene locus_tag LOCUS_14020 45608 48106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267415.1 protein_id gnl|my_center|LOCUS_14020 48141 48448 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48676 49656 gene locus_tag LOCUS_14030 48676 49656 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610709.1 protein_id gnl|my_center|LOCUS_14030 49706 50461 gene locus_tag LOCUS_14040 49706 50461 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071482.1 protein_id gnl|my_center|LOCUS_14040 50580 53201 gene locus_tag LOCUS_14050 50580 53201 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071959.1 protein_id gnl|my_center|LOCUS_14050 53765 53307 gene locus_tag LOCUS_14060 53765 53307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 54403 53927 gene locus_tag LOCUS_14070 54403 53927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 54585 55475 gene locus_tag LOCUS_14080 54585 55475 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_14080 55610 57217 gene locus_tag LOCUS_14090 55610 57217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 57610 57227 gene locus_tag LOCUS_14100 57610 57227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 protein_id gnl|my_center|LOCUS_14100 57881 57603 gene locus_tag LOCUS_14110 57881 57603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 58114 60156 gene locus_tag LOCUS_14120 58114 60156 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202268.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence018 1842 118 gene locus_tag LOCUS_14130 1842 118 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246092.1 protein_id gnl|my_center|LOCUS_14130 2376 2621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2674 3141 gene locus_tag LOCUS_14140 2674 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 3880 3149 gene locus_tag LOCUS_14150 gene yfiH 3880 3149 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040124.1 protein_id gnl|my_center|LOCUS_14150 4820 3867 gene locus_tag LOCUS_14160 gene rluD 4820 3867 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_14160 4979 5800 gene locus_tag LOCUS_14170 4979 5800 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102590.1 protein_id gnl|my_center|LOCUS_14170 7482 5860 gene locus_tag LOCUS_14180 7482 5860 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211555.1 protein_id gnl|my_center|LOCUS_14180 7598 9124 gene locus_tag LOCUS_14190 gene pilS 7598 9124 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_14190 9156 10499 gene locus_tag LOCUS_14200 gene pilR 9156 10499 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_14200 10670 11227 gene locus_tag LOCUS_14210 10670 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 11368 11922 gene locus_tag LOCUS_14220 11368 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 11978 15061 gene locus_tag LOCUS_14230 11978 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 15065 15538 gene locus_tag LOCUS_14240 15065 15538 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037629.1 protein_id gnl|my_center|LOCUS_14240 15532 16098 gene locus_tag LOCUS_14250 15532 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 16119 16934 gene locus_tag LOCUS_14260 16119 16934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 16934 17356 gene locus_tag LOCUS_14270 gene pilE 16934 17356 CDS product type 4a pilus minor pilin PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_14270 18300 17353 gene locus_tag LOCUS_14280 gene ispH 18300 17353 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_14280 18733 18290 gene locus_tag LOCUS_14290 gene fkpB 18733 18290 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 protein_id gnl|my_center|LOCUS_14290 19266 18760 gene locus_tag LOCUS_14300 gene lspA 19266 18760 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266581.1 protein_id gnl|my_center|LOCUS_14300 22161 19267 gene locus_tag LOCUS_14310 gene ileS 22161 19267 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073365.1 protein_id gnl|my_center|LOCUS_14310 23149 22196 gene locus_tag LOCUS_14320 gene ribF 23149 22196 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_14320 24819 23236 gene locus_tag LOCUS_14330 gene murJ 24819 23236 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948335.1 protein_id gnl|my_center|LOCUS_14330 25253 24987 gene locus_tag LOCUS_14340 gene rpsT 25253 24987 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094744.1 protein_id gnl|my_center|LOCUS_14340 26209 25370 gene locus_tag LOCUS_14350 gene kdsA 26209 25370 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073591.1 protein_id gnl|my_center|LOCUS_14350 27408 26269 gene locus_tag LOCUS_14360 gene proB 27408 26269 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_14360 28656 27466 gene locus_tag LOCUS_14370 gene cgtA 28656 27466 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551973.1 protein_id gnl|my_center|LOCUS_14370 29004 28744 gene locus_tag LOCUS_14380 gene rpmA 29004 28744 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 protein_id gnl|my_center|LOCUS_14380 29403 29092 gene locus_tag LOCUS_14390 gene rplU 29403 29092 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551971.1 protein_id gnl|my_center|LOCUS_14390 29813 30781 gene locus_tag LOCUS_14400 29813 30781 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_14400 30810 32627 gene locus_tag LOCUS_14410 30810 32627 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105207.1 protein_id gnl|my_center|LOCUS_14410 32822 33184 gene locus_tag LOCUS_14420 32822 33184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 33502 33939 gene locus_tag LOCUS_14430 gene trxC 33502 33939 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070806.1 protein_id gnl|my_center|LOCUS_14430 35081 33942 gene locus_tag LOCUS_14440 35081 33942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 35227 35466 gene locus_tag LOCUS_14450 35227 35466 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073163.1 protein_id gnl|my_center|LOCUS_14450 35467 35714 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36403 35729 gene locus_tag LOCUS_14460 36403 35729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 36761 36534 gene locus_tag LOCUS_14470 36761 36534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 36795 37083 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37227 37559 gene locus_tag LOCUS_14480 37227 37559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 38331 37696 gene locus_tag LOCUS_14490 gene lipB 38331 37696 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704733.1 protein_id gnl|my_center|LOCUS_14490 38624 38331 gene locus_tag LOCUS_14500 38624 38331 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100311.1 protein_id gnl|my_center|LOCUS_14500 39886 38765 gene locus_tag LOCUS_14510 39886 38765 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_14510 41261 40170 gene locus_tag LOCUS_14520 41261 40170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 41649 41930 gene locus_tag LOCUS_14530 41649 41930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 42423 41962 gene locus_tag LOCUS_14540 42423 41962 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819879.1 protein_id gnl|my_center|LOCUS_14540 43448 42420 gene locus_tag LOCUS_14550 43448 42420 CDS product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379749.1 protein_id gnl|my_center|LOCUS_14550 43605 43844 gene locus_tag LOCUS_14560 43605 43844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 43920 44151 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44773 45627 gene locus_tag LOCUS_14570 44773 45627 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093206.1 protein_id gnl|my_center|LOCUS_14570 45769 46032 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47764 46832 gene locus_tag LOCUS_14580 47764 46832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 48121 48372 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48418 49338 gene locus_tag LOCUS_14590 48418 49338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 49319 50008 gene locus_tag LOCUS_14600 gene nadD 49319 50008 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_14600 50015 50365 gene locus_tag LOCUS_14610 gene rsfS 50015 50365 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_14610 50362 50829 gene locus_tag LOCUS_14620 gene rlmH 50362 50829 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093193.1 protein_id gnl|my_center|LOCUS_14620 50837 52690 gene locus_tag LOCUS_14630 gene mrdA 50837 52690 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_14630 52690 53835 gene locus_tag LOCUS_14640 gene rodA 52690 53835 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483658.1 protein_id gnl|my_center|LOCUS_14640 53847 54821 gene locus_tag LOCUS_14650 gene mltB 53847 54821 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736753.1 protein_id gnl|my_center|LOCUS_14650 54818 55591 gene locus_tag LOCUS_14660 54818 55591 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261453.1 protein_id gnl|my_center|LOCUS_14660 55813 55694 gene locus_tag LOCUS_14670 55813 55694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 56164 57615 gene locus_tag LOCUS_14680 56164 57615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 57615 59315 gene locus_tag LOCUS_14690 57615 59315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 <60275 59336 gene locus_tag LOCUS_14700 <60275 59336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444419.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence019 843 142 gene locus_tag LOCUS_14710 843 142 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383265.1 protein_id gnl|my_center|LOCUS_14710 1538 840 gene locus_tag LOCUS_14720 1538 840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105543.1 protein_id gnl|my_center|LOCUS_14720 2342 1596 gene locus_tag LOCUS_14730 2342 1596 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_14730 3157 2381 gene locus_tag LOCUS_14740 3157 2381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407276.1 protein_id gnl|my_center|LOCUS_14740 3144 3332 gene locus_tag LOCUS_14750 3144 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4462 3506 gene locus_tag LOCUS_14760 4462 3506 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_14760 5990 4533 gene locus_tag LOCUS_14770 5990 4533 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895574.1 protein_id gnl|my_center|LOCUS_14770 6136 6828 gene locus_tag LOCUS_14780 6136 6828 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941085.1 protein_id gnl|my_center|LOCUS_14780 8542 6875 gene locus_tag LOCUS_14790 8542 6875 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_14790 9353 8574 gene locus_tag LOCUS_14800 9353 8574 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_14800 10463 9480 gene locus_tag LOCUS_14810 10463 9480 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112346.1 protein_id gnl|my_center|LOCUS_14810 10742 11362 gene locus_tag LOCUS_14820 10742 11362 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224580.1 protein_id gnl|my_center|LOCUS_14820 12178 11420 gene locus_tag LOCUS_14830 12178 11420 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706625.1 protein_id gnl|my_center|LOCUS_14830 12261 13448 gene locus_tag LOCUS_14840 gene algW 12261 13448 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_14840 13615 14739 gene locus_tag LOCUS_14850 13615 14739 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_14850 14794 14976 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16107 15031 gene locus_tag LOCUS_14860 gene hisC 16107 15031 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098833.1 protein_id gnl|my_center|LOCUS_14860 17417 16113 gene locus_tag LOCUS_14870 gene hisD 17417 16113 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 protein_id gnl|my_center|LOCUS_14870 18085 17435 gene locus_tag LOCUS_14880 gene hisG 18085 17435 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739058.1 protein_id gnl|my_center|LOCUS_14880 19401 18136 gene locus_tag LOCUS_14890 gene murA 19401 18136 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_14890 19646 19413 gene locus_tag LOCUS_14900 gene ibaG 19646 19413 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115399.1 protein_id gnl|my_center|LOCUS_14900 20092 19787 gene locus_tag LOCUS_14910 20092 19787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 20784 20125 gene locus_tag LOCUS_14920 20784 20125 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766521.1 protein_id gnl|my_center|LOCUS_14920 21273 20812 gene locus_tag LOCUS_14930 gene mlaD 21273 20812 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_14930 22070 21276 gene locus_tag LOCUS_14940 gene mlaE 22070 21276 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 protein_id gnl|my_center|LOCUS_14940 22882 22070 gene locus_tag LOCUS_14950 22882 22070 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_14950 23068 24030 gene locus_tag LOCUS_14960 23068 24030 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_14960 24027 25001 gene locus_tag LOCUS_14970 gene kdsD 24027 25001 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 protein_id gnl|my_center|LOCUS_14970 25001 25564 gene locus_tag LOCUS_14980 25001 25564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 25551 26132 gene locus_tag LOCUS_14990 gene lptA 25551 26132 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243690.1 protein_id gnl|my_center|LOCUS_14990 26129 26854 gene locus_tag LOCUS_15000 gene lptB 26129 26854 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094355.1 protein_id gnl|my_center|LOCUS_15000 26983 28482 gene locus_tag LOCUS_15010 26983 28482 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_15010 28515 28817 gene locus_tag LOCUS_15020 gene raiA 28515 28817 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_15020 28821 29285 gene locus_tag LOCUS_15030 gene ptsN 28821 29285 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 protein_id gnl|my_center|LOCUS_15030 29319 30191 gene locus_tag LOCUS_15040 gene rapZ 29319 30191 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_15040 30197 30466 gene locus_tag LOCUS_15050 30197 30466 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094362.1 protein_id gnl|my_center|LOCUS_15050 30576 31931 gene locus_tag LOCUS_15060 gene mgtE 30576 31931 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 protein_id gnl|my_center|LOCUS_15060 31953 32465 gene locus_tag LOCUS_15070 gene yjgA 31953 32465 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457057.1 protein_id gnl|my_center|LOCUS_15070 33274 32477 gene locus_tag LOCUS_15080 33274 32477 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112739.1 protein_id gnl|my_center|LOCUS_15080 37293 33274 gene locus_tag LOCUS_15090 37293 33274 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268867.1 protein_id gnl|my_center|LOCUS_15090 38753 37302 gene locus_tag LOCUS_15100 gene rng 38753 37302 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_15100 39345 38758 gene locus_tag LOCUS_15110 39345 38758 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_15110 39821 39342 gene locus_tag LOCUS_15120 gene mreD 39821 39342 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 protein_id gnl|my_center|LOCUS_15120 40663 39818 gene locus_tag LOCUS_15130 gene mreC 40663 39818 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 protein_id gnl|my_center|LOCUS_15130 41884 40847 gene locus_tag LOCUS_15140 gene mreB 41884 40847 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_15140 42011 42298 gene locus_tag LOCUS_15150 gene gatC 42011 42298 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_15150 42340 43806 gene locus_tag LOCUS_15160 gene gatA 42340 43806 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_15160 43817 45277 gene locus_tag LOCUS_15170 gene gatB 43817 45277 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_15170 45417 46028 gene locus_tag LOCUS_15180 45417 46028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 46363 46986 gene locus_tag LOCUS_15190 46363 46986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 48104 47040 gene locus_tag LOCUS_15200 48104 47040 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_15200 48750 48331 gene locus_tag LOCUS_15210 48750 48331 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313571.1 protein_id gnl|my_center|LOCUS_15210 49376 48750 gene locus_tag LOCUS_15220 gene sspA 49376 48750 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_15220 50221 49466 gene locus_tag LOCUS_15230 50221 49466 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 protein_id gnl|my_center|LOCUS_15230 51456 50224 gene locus_tag LOCUS_15240 51456 50224 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_15240 51941 51456 gene locus_tag LOCUS_15250 gene petA 51941 51456 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100631.1 protein_id gnl|my_center|LOCUS_15250 52671 52276 gene locus_tag LOCUS_15260 gene rpsI 52671 52276 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 protein_id gnl|my_center|LOCUS_15260 53104 52673 gene locus_tag LOCUS_15270 gene rplM 53104 52673 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094164.1 protein_id gnl|my_center|LOCUS_15270 53638 53327 gene locus_tag LOCUS_15280 53638 53327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 55526 53718 gene locus_tag LOCUS_15290 55526 53718 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_15290 56166 55537 gene locus_tag LOCUS_15300 56166 55537 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089752.1 protein_id gnl|my_center|LOCUS_15300 57837 56347 gene locus_tag LOCUS_15310 57837 56347 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093004.1 protein_id gnl|my_center|LOCUS_15310 57880 58071 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58393 59619 gene locus_tag LOCUS_15320 58393 59619 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence020 1096 209 gene locus_tag LOCUS_15330 1096 209 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_15330 1196 1966 gene locus_tag LOCUS_15340 1196 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3058 2030 gene locus_tag LOCUS_15350 3058 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112749.1 protein_id gnl|my_center|LOCUS_15350 3241 3585 gene locus_tag LOCUS_15360 3241 3585 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_15360 3593 5026 gene locus_tag LOCUS_15370 gene modF 3593 5026 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096923.1 protein_id gnl|my_center|LOCUS_15370 5083 6372 gene locus_tag LOCUS_15380 5083 6372 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_15380 7682 6417 gene locus_tag LOCUS_15390 7682 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 9643 7808 gene locus_tag LOCUS_15400 gene ilvD 9643 7808 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105291.1 protein_id gnl|my_center|LOCUS_15400 10126 10836 gene locus_tag LOCUS_15410 10126 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 11185 10859 gene locus_tag LOCUS_15420 11185 10859 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052362.1 protein_id gnl|my_center|LOCUS_15420 11883 11182 gene locus_tag LOCUS_15430 11883 11182 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_15430 12127 13509 gene locus_tag LOCUS_15440 12127 13509 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_15440 13888 14487 gene locus_tag LOCUS_15450 13888 14487 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 protein_id gnl|my_center|LOCUS_15450 14988 15201 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15560 17245 gene locus_tag LOCUS_15460 gene argS 15560 17245 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038936.1 protein_id gnl|my_center|LOCUS_15460 17475 18011 gene locus_tag LOCUS_15470 17475 18011 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_15470 18015 18824 gene locus_tag LOCUS_15480 18015 18824 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265558.1 protein_id gnl|my_center|LOCUS_15480 19053 19640 gene locus_tag LOCUS_15490 19053 19640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 20012 21091 gene locus_tag LOCUS_15500 20012 21091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 22063 21203 gene locus_tag LOCUS_15510 22063 21203 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 protein_id gnl|my_center|LOCUS_15510 22153 23196 gene locus_tag LOCUS_15520 22153 23196 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 protein_id gnl|my_center|LOCUS_15520 23203 25194 gene locus_tag LOCUS_15530 23203 25194 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105472.1 protein_id gnl|my_center|LOCUS_15530 25244 26107 gene locus_tag LOCUS_15540 25244 26107 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_15540 26396 28027 gene locus_tag LOCUS_15550 26396 28027 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_15550 28099 29979 gene locus_tag LOCUS_15560 28099 29979 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421488.1 protein_id gnl|my_center|LOCUS_15560 29983 30732 gene locus_tag LOCUS_15570 29983 30732 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483201.1 protein_id gnl|my_center|LOCUS_15570 30881 31000 gene locus_tag LOCUS_15580 30881 31000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 31112 31792 gene locus_tag LOCUS_15590 31112 31792 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074284.1 protein_id gnl|my_center|LOCUS_15590 32586 31813 gene locus_tag LOCUS_15600 32586 31813 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930182.1 protein_id gnl|my_center|LOCUS_15600 33947 32586 gene locus_tag LOCUS_15610 33947 32586 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529765.1 protein_id gnl|my_center|LOCUS_15610 34980 34120 gene locus_tag LOCUS_15620 34980 34120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072480.1 protein_id gnl|my_center|LOCUS_15620 37208 35493 gene locus_tag LOCUS_15630 37208 35493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 38170 37451 gene locus_tag LOCUS_15640 38170 37451 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 protein_id gnl|my_center|LOCUS_15640 39069 38185 gene locus_tag LOCUS_15650 39069 38185 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101741.1 protein_id gnl|my_center|LOCUS_15650 41052 39103 gene locus_tag LOCUS_15660 gene atuF 41052 39103 CDS product geranyl-CoA carboxylase subunit apha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_15660 41855 41049 gene locus_tag LOCUS_15670 gene atuE 41855 41049 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_15670 43027 41867 gene locus_tag LOCUS_15680 gene atuD 43027 41867 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_15680 44668 43052 gene locus_tag LOCUS_15690 gene atuC 44668 43052 CDS product geranyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_15690 46486 44678 gene locus_tag LOCUS_15700 46486 44678 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_15700 46634 47230 gene locus_tag LOCUS_15710 gene atuR 46634 47230 CDS product atu genes transcriptional repressor AtuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090989.1 protein_id gnl|my_center|LOCUS_15710 47250 47468 gene locus_tag LOCUS_15720 47250 47468 CDS product DUF6500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530530.1 protein_id gnl|my_center|LOCUS_15720 49351 47801 gene locus_tag LOCUS_15730 49351 47801 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 protein_id gnl|my_center|LOCUS_15730 50037 49408 gene locus_tag LOCUS_15740 50037 49408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 50714 50040 gene locus_tag LOCUS_15750 50714 50040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 51094 50831 gene locus_tag LOCUS_15760 51094 50831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 52950 51091 gene locus_tag LOCUS_15770 52950 51091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 53735 54334 gene locus_tag LOCUS_15780 53735 54334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 55433 54531 gene locus_tag LOCUS_15790 55433 54531 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464103.1 protein_id gnl|my_center|LOCUS_15790 55557 56696 gene locus_tag LOCUS_15800 55557 56696 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263670.1 protein_id gnl|my_center|LOCUS_15800 57292 57822 gene locus_tag LOCUS_15810 57292 57822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200835877.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence021 910 428 gene locus_tag LOCUS_15820 910 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2975 1014 gene locus_tag LOCUS_15830 gene recD 2975 1014 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103277.1 protein_id gnl|my_center|LOCUS_15830 6754 2972 gene locus_tag LOCUS_15840 gene recB 6754 2972 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816977.1 protein_id gnl|my_center|LOCUS_15840 10290 6751 gene locus_tag LOCUS_15850 gene recC 10290 6751 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707658.1 protein_id gnl|my_center|LOCUS_15850 11573 10455 gene locus_tag LOCUS_15860 gene ald 11573 10455 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_15860 12000 12386 gene locus_tag LOCUS_15870 12000 12386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 12489 13730 gene locus_tag LOCUS_15880 12489 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975366.1 protein_id gnl|my_center|LOCUS_15880 15267 13837 gene locus_tag LOCUS_15890 15267 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 15820 15275 gene locus_tag LOCUS_15900 15820 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 18038 15879 gene locus_tag LOCUS_15910 18038 15879 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177215181.1 protein_id gnl|my_center|LOCUS_15910 18309 18145 gene locus_tag LOCUS_15920 18309 18145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 18419 19057 gene locus_tag LOCUS_15930 18419 19057 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_15930 20198 19164 gene locus_tag LOCUS_15940 20198 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 22484 20331 gene locus_tag LOCUS_15950 22484 20331 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763035.1 protein_id gnl|my_center|LOCUS_15950 22751 23797 gene locus_tag LOCUS_15960 22751 23797 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083636.1 protein_id gnl|my_center|LOCUS_15960 24259 25995 gene locus_tag LOCUS_15970 24259 25995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 26053 27258 gene locus_tag LOCUS_15980 26053 27258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 27249 28385 gene locus_tag LOCUS_15990 27249 28385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 28644 29930 gene locus_tag LOCUS_16000 gene nasR 28644 29930 CDS product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096246.1 protein_id gnl|my_center|LOCUS_16000 30294 31691 gene locus_tag LOCUS_16010 30294 31691 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_16010 31783 32799 gene locus_tag LOCUS_16020 31783 32799 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_16020 32815 33753 gene locus_tag LOCUS_16030 32815 33753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_16030 33778 34953 gene locus_tag LOCUS_16040 33778 34953 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_16040 35023 36291 gene locus_tag LOCUS_16050 35023 36291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 36642 36310 gene locus_tag LOCUS_16060 36642 36310 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015014.1 protein_id gnl|my_center|LOCUS_16060 38122 36644 gene locus_tag LOCUS_16070 38122 36644 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382014.1 protein_id gnl|my_center|LOCUS_16070 38383 39351 gene locus_tag LOCUS_16080 38383 39351 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040494.1 protein_id gnl|my_center|LOCUS_16080 41217 39388 gene locus_tag LOCUS_16090 41217 39388 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_16090 42957 41461 gene locus_tag LOCUS_16100 42957 41461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 43385 43020 gene locus_tag LOCUS_16110 gene nirD 43385 43020 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_16110 45960 43396 gene locus_tag LOCUS_16120 gene nirB 45960 43396 CDS product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049205.1 protein_id gnl|my_center|LOCUS_16120 47881 46538 gene locus_tag LOCUS_16130 47881 46538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 48361 51117 gene locus_tag LOCUS_16140 48361 51117 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530462.1 protein_id gnl|my_center|LOCUS_16140 51117 51965 gene locus_tag LOCUS_16150 gene cobA 51117 51965 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113243.1 protein_id gnl|my_center|LOCUS_16150 54237 52036 gene locus_tag LOCUS_16160 54237 52036 CDS product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_16160 54496 55404 gene locus_tag LOCUS_16170 54496 55404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 56972 56577 gene locus_tag LOCUS_16180 56972 56577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 57285 57055 gene locus_tag LOCUS_16190 57285 57055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence022 2213 1998 gene locus_tag LOCUS_16200 2213 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 2363 2217 gene locus_tag LOCUS_16210 2363 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2444 2706 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3485 3321 gene locus_tag LOCUS_16220 3485 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 5074 3560 gene locus_tag LOCUS_16230 5074 3560 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_16230 5225 7915 gene locus_tag LOCUS_16240 5225 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 8003 8419 gene locus_tag LOCUS_16250 8003 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 9050 8427 gene locus_tag LOCUS_16260 gene senC 9050 8427 CDS product cytochrome c oxidase copper chaperone SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_16260 9124 10455 gene locus_tag LOCUS_16270 gene dinF 9124 10455 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819117.1 protein_id gnl|my_center|LOCUS_16270 10666 11307 gene locus_tag LOCUS_16280 10666 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115620.1 protein_id gnl|my_center|LOCUS_16280 12210 11314 gene locus_tag LOCUS_16290 12210 11314 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_16290 12354 12896 gene locus_tag LOCUS_16300 12354 12896 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419093.1 protein_id gnl|my_center|LOCUS_16300 12958 13533 gene locus_tag LOCUS_16310 12958 13533 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 protein_id gnl|my_center|LOCUS_16310 13938 13660 gene locus_tag LOCUS_16320 13938 13660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 14123 15055 gene locus_tag LOCUS_16330 14123 15055 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140179.1 protein_id gnl|my_center|LOCUS_16330 15654 15922 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16013 17725 gene locus_tag LOCUS_16340 16013 17725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 17735 18649 gene locus_tag LOCUS_16350 17735 18649 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_16350 18769 19209 gene locus_tag LOCUS_16360 gene cynS 18769 19209 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103774.1 protein_id gnl|my_center|LOCUS_16360 19335 20477 gene locus_tag LOCUS_16370 19335 20477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 21400 20474 gene locus_tag LOCUS_16380 21400 20474 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 protein_id gnl|my_center|LOCUS_16380 21557 22411 gene locus_tag LOCUS_16390 21557 22411 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_16390 23052 22459 gene locus_tag LOCUS_16400 23052 22459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 23947 23519 gene locus_tag LOCUS_16410 23947 23519 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 protein_id gnl|my_center|LOCUS_16410 25408 24014 gene locus_tag LOCUS_16420 gene atpD 25408 24014 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074330.1 protein_id gnl|my_center|LOCUS_16420 26309 25449 gene locus_tag LOCUS_16430 gene atpG 26309 25449 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_16430 27918 26374 gene locus_tag LOCUS_16440 gene atpA 27918 26374 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097134.1 protein_id gnl|my_center|LOCUS_16440 28470 27934 gene locus_tag LOCUS_16450 28470 27934 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_16450 28952 28482 gene locus_tag LOCUS_16460 28952 28482 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 protein_id gnl|my_center|LOCUS_16460 29231 29004 gene locus_tag LOCUS_16470 gene atpE 29231 29004 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424060.1 protein_id gnl|my_center|LOCUS_16470 30181 29282 gene locus_tag LOCUS_16480 gene atpB 30181 29282 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100237.1 protein_id gnl|my_center|LOCUS_16480 30573 30205 gene locus_tag LOCUS_16490 30573 30205 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948673.1 protein_id gnl|my_center|LOCUS_16490 30946 31872 gene locus_tag LOCUS_16500 30946 31872 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 protein_id gnl|my_center|LOCUS_16500 32779 31874 gene locus_tag LOCUS_16510 32779 31874 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315951.1 protein_id gnl|my_center|LOCUS_16510 33587 32805 gene locus_tag LOCUS_16520 gene soj 33587 32805 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_16520 34278 33625 gene locus_tag LOCUS_16530 gene rsmG 34278 33625 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100242.1 protein_id gnl|my_center|LOCUS_16530 34460 35632 gene locus_tag LOCUS_16540 34460 35632 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389341.1 protein_id gnl|my_center|LOCUS_16540 35643 36458 gene locus_tag LOCUS_16550 35643 36458 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 protein_id gnl|my_center|LOCUS_16550 38082 36466 gene locus_tag LOCUS_16560 38082 36466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 38617 38267 gene locus_tag LOCUS_16570 38617 38267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 39509 38730 gene locus_tag LOCUS_16580 39509 38730 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728650.1 protein_id gnl|my_center|LOCUS_16580 41556 39502 gene locus_tag LOCUS_16590 41556 39502 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_16590 42106 41639 gene locus_tag LOCUS_16600 42106 41639 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036240.1 protein_id gnl|my_center|LOCUS_16600 43113 42187 gene locus_tag LOCUS_16610 43113 42187 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267708.1 protein_id gnl|my_center|LOCUS_16610 43565 43110 gene locus_tag LOCUS_16620 43565 43110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 43598 44076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44126 44236 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44300 44893 gene locus_tag LOCUS_16630 44300 44893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 44909 45232 gene locus_tag LOCUS_16640 44909 45232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 45935 45150 gene locus_tag LOCUS_16650 45935 45150 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477148.1 protein_id gnl|my_center|LOCUS_16650 47549 45945 gene locus_tag LOCUS_16660 47549 45945 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040777.1 protein_id gnl|my_center|LOCUS_16660 48706 47549 gene locus_tag LOCUS_16670 gene liuA 48706 47549 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100385.1 protein_id gnl|my_center|LOCUS_16670 49162 48770 gene locus_tag LOCUS_16680 gene liuR 49162 48770 CDS product liu genes transcriptional regulator LiuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100383.1 protein_id gnl|my_center|LOCUS_16680 50085 49306 gene locus_tag LOCUS_16690 50085 49306 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819549.1 protein_id gnl|my_center|LOCUS_16690 50271 50864 gene locus_tag LOCUS_16700 50271 50864 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_16700 50857 51252 gene locus_tag LOCUS_16710 50857 51252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 51265 51876 gene locus_tag LOCUS_16720 51265 51876 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074113.1 protein_id gnl|my_center|LOCUS_16720 51857 52129 gene locus_tag LOCUS_16730 51857 52129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 52142 52813 gene locus_tag LOCUS_16740 52142 52813 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074115.1 protein_id gnl|my_center|LOCUS_16740 52810 54153 gene locus_tag LOCUS_16750 52810 54153 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074116.1 protein_id gnl|my_center|LOCUS_16750 <54909 54119 gene locus_tag LOCUS_16760 <54909 54119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001132585.1:L-threonylcarbamoyladenylate synthase >Feature sequence023 919 134 gene locus_tag LOCUS_16770 919 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1526 1924 gene locus_tag LOCUS_16780 1526 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1977 2576 gene locus_tag LOCUS_16790 1977 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2994 2596 gene locus_tag LOCUS_16800 2994 2596 CDS product DUF4150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366584.1 protein_id gnl|my_center|LOCUS_16800 3567 3025 gene locus_tag LOCUS_16810 3567 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4634 3564 gene locus_tag LOCUS_16820 4634 3564 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529730.1 protein_id gnl|my_center|LOCUS_16820 7242 4660 gene locus_tag LOCUS_16830 7242 4660 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705435.1 protein_id gnl|my_center|LOCUS_16830 10115 7245 gene locus_tag LOCUS_16840 10115 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 11711 11526 gene locus_tag LOCUS_16850 11711 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 12635 11739 gene locus_tag LOCUS_16860 12635 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 13568 12879 gene locus_tag LOCUS_16870 13568 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 13948 13640 gene locus_tag LOCUS_16880 13948 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 15137 14004 gene locus_tag LOCUS_16890 gene tssA 15137 14004 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115340.1 protein_id gnl|my_center|LOCUS_16890 15297 15115 gene locus_tag LOCUS_16900 15297 15115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 19503 15343 gene locus_tag LOCUS_16910 19503 15343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 20271 19510 gene locus_tag LOCUS_16920 20271 19510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 21722 20292 gene locus_tag LOCUS_16930 gene tssK 21722 20292 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122697.1 protein_id gnl|my_center|LOCUS_16930 22217 21729 gene locus_tag LOCUS_16940 22217 21729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104701.1 protein_id gnl|my_center|LOCUS_16940 22744 22214 gene locus_tag LOCUS_16950 22744 22214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 22745 22996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23149 23409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25438 23624 gene locus_tag LOCUS_16960 gene tssF 25438 23624 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114518.1 protein_id gnl|my_center|LOCUS_16960 25829 25476 gene locus_tag LOCUS_16970 25829 25476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 26451 25846 gene locus_tag LOCUS_16980 26451 25846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 28437 26491 gene locus_tag LOCUS_16990 gene tssC 28437 26491 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089494.1 protein_id gnl|my_center|LOCUS_16990 28729 28499 gene locus_tag LOCUS_17000 28729 28499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 29302 30492 gene locus_tag LOCUS_17010 29302 30492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 31851 30559 gene locus_tag LOCUS_17020 31851 30559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 32114 34873 gene locus_tag LOCUS_17030 gene rapA 32114 34873 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704377.1 protein_id gnl|my_center|LOCUS_17030 36345 34990 gene locus_tag LOCUS_17040 gene gorA 36345 34990 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 protein_id gnl|my_center|LOCUS_17040 36901 36377 gene locus_tag LOCUS_17050 gene xcpZ 36901 36377 CDS product GspM family type II secretion system protein XcpZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091369.1 protein_id gnl|my_center|LOCUS_17050 38154 36898 gene locus_tag LOCUS_17060 38154 36898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 39181 38165 gene locus_tag LOCUS_17070 gene xcpX 39181 38165 CDS product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 protein_id gnl|my_center|LOCUS_17070 39912 39181 gene locus_tag LOCUS_17080 gene xcpW 39912 39181 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_17080 40283 39912 gene locus_tag LOCUS_17090 gene xcpV 40283 39912 CDS product GspI family T2SS minor pseudopilin variant XcpV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103528.1 protein_id gnl|my_center|LOCUS_17090 40854 40273 gene locus_tag LOCUS_17100 gene exeH 40854 40273 CDS product GspH family T2SS minor pseudopilin variant ExeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704543.1 protein_id gnl|my_center|LOCUS_17100 41294 40854 gene locus_tag LOCUS_17110 gene xcpT 41294 40854 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_17110 42515 41304 gene locus_tag LOCUS_17120 gene xcpS 42515 41304 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_17120 44011 42518 gene locus_tag LOCUS_17130 gene xcpR 44011 42518 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_17130 45402 44062 gene locus_tag LOCUS_17140 45402 44062 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_17140 46450 45521 gene locus_tag LOCUS_17150 46450 45521 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 protein_id gnl|my_center|LOCUS_17150 47214 46465 gene locus_tag LOCUS_17160 47214 46465 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091107.1 protein_id gnl|my_center|LOCUS_17160 47567 49207 gene locus_tag LOCUS_17170 47567 49207 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102932.1 protein_id gnl|my_center|LOCUS_17170 49266 50786 gene locus_tag LOCUS_17180 49266 50786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 50894 52534 gene locus_tag LOCUS_17190 50894 52534 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102932.1 protein_id gnl|my_center|LOCUS_17190 53422 52607 gene locus_tag LOCUS_17200 53422 52607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence024 3803 309 gene locus_tag LOCUS_17210 gene dnaE 3803 309 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098578.1 protein_id gnl|my_center|LOCUS_17210 4756 3905 gene locus_tag LOCUS_17220 4756 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 5005 5301 gene locus_tag LOCUS_17230 5005 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 5437 5772 gene locus_tag LOCUS_17240 5437 5772 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640257.1 protein_id gnl|my_center|LOCUS_17240 5843 6289 gene locus_tag LOCUS_17250 5843 6289 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206083.1 protein_id gnl|my_center|LOCUS_17250 7829 6345 gene locus_tag LOCUS_17260 gene der 7829 6345 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_17260 8822 7911 gene locus_tag LOCUS_17270 8822 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 8823 9095 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10014 9352 gene locus_tag LOCUS_17280 10014 9352 CDS product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098275.1 protein_id gnl|my_center|LOCUS_17280 11342 10059 gene locus_tag LOCUS_17290 gene hisS 11342 10059 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266910.1 protein_id gnl|my_center|LOCUS_17290 12488 11370 gene locus_tag LOCUS_17300 gene ispG 12488 11370 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_17300 13294 12488 gene locus_tag LOCUS_17310 gene pilW 13294 12488 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771019.1 protein_id gnl|my_center|LOCUS_17310 14435 13305 gene locus_tag LOCUS_17320 gene rlmN 14435 13305 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092809.1 protein_id gnl|my_center|LOCUS_17320 14944 14519 gene locus_tag LOCUS_17330 gene ndk 14944 14519 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092811.1 protein_id gnl|my_center|LOCUS_17330 16249 15089 gene locus_tag LOCUS_17340 16249 15089 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705635.1 protein_id gnl|my_center|LOCUS_17340 16845 16360 gene locus_tag LOCUS_17350 gene iscR 16845 16360 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552474.1 protein_id gnl|my_center|LOCUS_17350 17774 16950 gene locus_tag LOCUS_17360 gene cysE 17774 16950 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_17360 18556 17771 gene locus_tag LOCUS_17370 gene trmJ 18556 17771 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771034.1 protein_id gnl|my_center|LOCUS_17370 18780 19553 gene locus_tag LOCUS_17380 gene suhB 18780 19553 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_17380 20873 19644 gene locus_tag LOCUS_17390 gene entS 20873 19644 CDS product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041793.1 protein_id gnl|my_center|LOCUS_17390 28265 20898 gene locus_tag LOCUS_17400 gene dhbF 28265 20898 CDS product non-ribosomal peptide synthetase DhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968094.1 protein_id gnl|my_center|LOCUS_17400 28480 28262 gene locus_tag LOCUS_17410 28480 28262 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062145.1 protein_id gnl|my_center|LOCUS_17410 29809 28496 gene locus_tag LOCUS_17420 gene fes 29809 28496 CDS product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298568.1 protein_id gnl|my_center|LOCUS_17420 32970 29824 gene locus_tag LOCUS_17430 32970 29824 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492806.1 protein_id gnl|my_center|LOCUS_17430 34104 32974 gene locus_tag LOCUS_17440 gene acrA 34104 32974 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095891.1 protein_id gnl|my_center|LOCUS_17440 34931 34179 gene locus_tag LOCUS_17450 gene amoA 34931 34179 CDS product amonabactin biosynthesis protein AmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706306.1 protein_id gnl|my_center|LOCUS_17450 35818 34934 gene locus_tag LOCUS_17460 gene amoB 35818 34934 CDS product amonabactin biosynthesis bifunctional protein AmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706308.1 protein_id gnl|my_center|LOCUS_17460 37509 35827 gene locus_tag LOCUS_17470 gene entE 37509 35827 CDS product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704713.1 protein_id gnl|my_center|LOCUS_17470 38471 37506 gene locus_tag LOCUS_17480 gene amoC 38471 37506 CDS product amonabactin biosynthesis isochorismate synthase AmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706310.1 protein_id gnl|my_center|LOCUS_17480 39008 40204 gene locus_tag LOCUS_17490 gene opmH 39008 40204 CDS product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_17490 40912 40187 gene locus_tag LOCUS_17500 40912 40187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 43006 41015 gene locus_tag LOCUS_17510 43006 41015 CDS product siderophore amonabactin TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 protein_id gnl|my_center|LOCUS_17510 43232 43360 gene locus_tag LOCUS_17520 43232 43360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 43918 43427 gene locus_tag LOCUS_17530 43918 43427 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106665.1 protein_id gnl|my_center|LOCUS_17530 44052 44312 gene locus_tag LOCUS_17540 44052 44312 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704936.1 protein_id gnl|my_center|LOCUS_17540 46288 44396 gene locus_tag LOCUS_17550 46288 44396 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_17550 47041 46307 gene locus_tag LOCUS_17560 47041 46307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_17560 47967 47050 gene locus_tag LOCUS_17570 47967 47050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_17570 48285 50957 gene locus_tag LOCUS_17580 gene plsB 48285 50957 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113856.1 protein_id gnl|my_center|LOCUS_17580 50609 50872 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51171 51487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51637 51984 gene locus_tag LOCUS_17590 51637 51984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence025 <1 733 gene locus_tag LOCUS_17600 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002554562.1:30S ribosomal protein S1 1172 1465 gene locus_tag LOCUS_17610 gene ihfB 1172 1465 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554561.1 protein_id gnl|my_center|LOCUS_17610 1492 1773 gene locus_tag LOCUS_17620 1492 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1780 2958 gene locus_tag LOCUS_17630 gene lapB 1780 2958 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_17630 3060 3692 gene locus_tag LOCUS_17640 gene pyrF 3060 3692 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481650.1 protein_id gnl|my_center|LOCUS_17640 4195 4542 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4572 5459 gene locus_tag LOCUS_17650 gene galU 4572 5459 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168324.1 protein_id gnl|my_center|LOCUS_17650 5819 5987 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6008 6198 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaatcgtaggagcgggccat 6252 7418 gene locus_tag LOCUS_17660 6252 7418 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_17660 7564 8862 gene locus_tag LOCUS_17670 gene tviB 7564 8862 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208043.1 protein_id gnl|my_center|LOCUS_17670 8880 9836 gene locus_tag LOCUS_17680 8880 9836 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_17680 9833 10414 gene locus_tag LOCUS_17690 gene wbpD 9833 10414 CDS product UDP-2-acetamido-3-amino-2,3-dideoxy-D-glucuronate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208045.1 protein_id gnl|my_center|LOCUS_17690 10559 11641 gene locus_tag LOCUS_17700 10559 11641 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208046.1 protein_id gnl|my_center|LOCUS_17700 11643 12911 gene locus_tag LOCUS_17710 11643 12911 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_17710 13138 12926 gene locus_tag LOCUS_17720 13138 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 13632 14120 gene locus_tag LOCUS_17730 13632 14120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 14219 15280 gene locus_tag LOCUS_17740 gene wecB 14219 15280 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113418.1 protein_id gnl|my_center|LOCUS_17740 15288 16409 gene locus_tag LOCUS_17750 15288 16409 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115615.1 protein_id gnl|my_center|LOCUS_17750 16399 17187 gene locus_tag LOCUS_17760 16399 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 17198 18316 gene locus_tag LOCUS_17770 17198 18316 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073075.1 protein_id gnl|my_center|LOCUS_17770 18316 19197 gene locus_tag LOCUS_17780 gene rfbA 18316 19197 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073074.1 protein_id gnl|my_center|LOCUS_17780 19194 19592 gene locus_tag LOCUS_17790 19194 19592 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_17790 19589 20110 gene locus_tag LOCUS_17800 19589 20110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 20107 21225 gene locus_tag LOCUS_17810 20107 21225 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036848.1 protein_id gnl|my_center|LOCUS_17810 21228 21821 gene locus_tag LOCUS_17820 21228 21821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 21818 22978 gene locus_tag LOCUS_17830 gene wlbF 21818 22978 CDS product O-antigen biosynthesis aminotransferase WlbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853419.1 protein_id gnl|my_center|LOCUS_17830 22971 23564 gene locus_tag LOCUS_17840 gene wlbG 22971 23564 CDS product O-antigen biosynthesis protein WlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038693.1 protein_id gnl|my_center|LOCUS_17840 23641 24150 gene locus_tag LOCUS_17850 23641 24150 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261383.1 protein_id gnl|my_center|LOCUS_17850 24375 25952 gene locus_tag LOCUS_17860 gene pgm 24375 25952 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480279.1 protein_id gnl|my_center|LOCUS_17860 28538 26643 gene locus_tag LOCUS_17870 28538 26643 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_17870 28773 28698 gene locus_tag LOCUS_t00220 28773 28698 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 28973 30466 gene locus_tag LOCUS_17880 28973 30466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 31125 30544 gene locus_tag LOCUS_17890 gene dcd 31125 30544 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072565.1 protein_id gnl|my_center|LOCUS_17890 32022 31201 gene locus_tag LOCUS_17900 32022 31201 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_17900 32715 32041 gene locus_tag LOCUS_17910 gene purN 32715 32041 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_17910 33764 32712 gene locus_tag LOCUS_17920 gene purM 33764 32712 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072699.1 protein_id gnl|my_center|LOCUS_17920 34029 35039 gene locus_tag LOCUS_17930 34029 35039 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262404.1 protein_id gnl|my_center|LOCUS_17930 35040 35747 gene locus_tag LOCUS_17940 gene hda 35040 35747 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 protein_id gnl|my_center|LOCUS_17940 37079 35898 gene locus_tag LOCUS_17950 37079 35898 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_17950 37196 39226 gene locus_tag LOCUS_17960 gene uvrB 37196 39226 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769676.1 protein_id gnl|my_center|LOCUS_17960 39439 39363 gene locus_tag LOCUS_t00230 39439 39363 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 40611 39592 gene locus_tag LOCUS_17970 40611 39592 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072210.1 protein_id gnl|my_center|LOCUS_17970 41656 40787 gene locus_tag LOCUS_17980 41656 40787 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 protein_id gnl|my_center|LOCUS_17980 41837 42832 gene locus_tag LOCUS_17990 41837 42832 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_17990 42948 44879 gene locus_tag LOCUS_18000 gene thrS 42948 44879 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090677.1 protein_id gnl|my_center|LOCUS_18000 44963 45424 gene locus_tag LOCUS_18010 gene infC 44963 45424 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367017.1 protein_id gnl|my_center|LOCUS_18010 45555 45749 gene locus_tag LOCUS_18020 gene rpmI 45555 45749 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553160.1 protein_id gnl|my_center|LOCUS_18020 45771 46124 gene locus_tag LOCUS_18030 gene rplT 45771 46124 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099086.1 protein_id gnl|my_center|LOCUS_18030 46264 47268 gene locus_tag LOCUS_18040 gene pheS 46264 47268 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_18040 47295 49688 gene locus_tag LOCUS_18050 gene pheT 47295 49688 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267471.1 protein_id gnl|my_center|LOCUS_18050 49690 49995 gene locus_tag LOCUS_18060 gene ihfA 49690 49995 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 protein_id gnl|my_center|LOCUS_18060 49973 50341 gene locus_tag LOCUS_18070 49973 50341 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_18070 50450 50526 gene locus_tag LOCUS_t00240 50450 50526 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence026 424 1290 gene locus_tag LOCUS_18080 424 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2478 1339 gene locus_tag LOCUS_18090 2478 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2757 4340 gene locus_tag LOCUS_18100 2757 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4451 4726 gene locus_tag LOCUS_18110 4451 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 4889 6400 gene locus_tag LOCUS_18120 4889 6400 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087885.1 protein_id gnl|my_center|LOCUS_18120 6411 8825 gene locus_tag LOCUS_18130 6411 8825 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_18130 8987 10555 gene locus_tag LOCUS_18140 gene gshA 8987 10555 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_18140 11090 10653 gene locus_tag LOCUS_18150 gene fliL 11090 10653 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_18150 11256 11786 gene locus_tag LOCUS_18160 11256 11786 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_18160 11950 12423 gene locus_tag LOCUS_18170 11950 12423 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738602.1 protein_id gnl|my_center|LOCUS_18170 12527 13495 gene locus_tag LOCUS_18180 12527 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 13969 13526 gene locus_tag LOCUS_18190 13969 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 14193 14867 gene locus_tag LOCUS_18200 14193 14867 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_18200 14946 16046 gene locus_tag LOCUS_18210 14946 16046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 16590 16075 gene locus_tag LOCUS_18220 16590 16075 CDS product TIGR02444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399874.1 protein_id gnl|my_center|LOCUS_18220 16617 18521 gene locus_tag LOCUS_18230 16617 18521 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_18230 21087 18589 gene locus_tag LOCUS_18240 21087 18589 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992271.1 protein_id gnl|my_center|LOCUS_18240 21556 21146 gene locus_tag LOCUS_18250 gene cueR 21556 21146 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 protein_id gnl|my_center|LOCUS_18250 21750 23363 gene locus_tag LOCUS_18260 21750 23363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 23531 24067 gene locus_tag LOCUS_18270 23531 24067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 24372 24079 gene locus_tag LOCUS_18280 24372 24079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 25254 24529 gene locus_tag LOCUS_18290 gene trmB 25254 24529 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073235.1 protein_id gnl|my_center|LOCUS_18290 25665 25273 gene locus_tag LOCUS_18300 25665 25273 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_18300 25766 27241 gene locus_tag LOCUS_18310 gene ubiD 25766 27241 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768425.1 protein_id gnl|my_center|LOCUS_18310 27238 28278 gene locus_tag LOCUS_18320 27238 28278 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266307.1 protein_id gnl|my_center|LOCUS_18320 28317 29144 gene locus_tag LOCUS_18330 gene mscS 28317 29144 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_18330 30074 29166 gene locus_tag LOCUS_18340 30074 29166 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706976.1 protein_id gnl|my_center|LOCUS_18340 30182 31039 gene locus_tag LOCUS_18350 30182 31039 CDS product Vmh family MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706975.1 protein_id gnl|my_center|LOCUS_18350 31174 32448 gene locus_tag LOCUS_18360 31174 32448 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064221.1 protein_id gnl|my_center|LOCUS_18360 33686 32496 gene locus_tag LOCUS_18370 33686 32496 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 protein_id gnl|my_center|LOCUS_18370 34837 33683 gene locus_tag LOCUS_18380 34837 33683 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183814.1 protein_id gnl|my_center|LOCUS_18380 35691 34912 gene locus_tag LOCUS_18390 35691 34912 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114032.1 protein_id gnl|my_center|LOCUS_18390 36632 35691 gene locus_tag LOCUS_18400 gene hemC 36632 35691 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073972.1 protein_id gnl|my_center|LOCUS_18400 38024 36744 gene locus_tag LOCUS_18410 38024 36744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 38724 38107 gene locus_tag LOCUS_18420 38724 38107 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482817.1 protein_id gnl|my_center|LOCUS_18420 39479 38724 gene locus_tag LOCUS_18430 39479 38724 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_18430 40777 39476 gene locus_tag LOCUS_18440 40777 39476 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267577.1 protein_id gnl|my_center|LOCUS_18440 41763 40774 gene locus_tag LOCUS_18450 41763 40774 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_18450 42617 41748 gene locus_tag LOCUS_18460 42617 41748 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813250.1 protein_id gnl|my_center|LOCUS_18460 43485 42730 gene locus_tag LOCUS_18470 43485 42730 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 protein_id gnl|my_center|LOCUS_18470 44585 43482 gene locus_tag LOCUS_18480 gene algZ 44585 43482 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_18480 44744 46141 gene locus_tag LOCUS_18490 gene argH 44744 46141 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_18490 46163 46492 gene locus_tag LOCUS_18500 46163 46492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407887.1 protein_id gnl|my_center|LOCUS_18500 46492 47247 gene locus_tag LOCUS_18510 46492 47247 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103245.1 protein_id gnl|my_center|LOCUS_18510 47263 47901 gene locus_tag LOCUS_18520 47263 47901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266513.1 protein_id gnl|my_center|LOCUS_18520 47894 48529 gene locus_tag LOCUS_18530 47894 48529 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266514.1 protein_id gnl|my_center|LOCUS_18530 48526 49605 gene locus_tag LOCUS_18540 48526 49605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 49598 50401 gene locus_tag LOCUS_18550 49598 50401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence027 606 2252 gene locus_tag LOCUS_18560 606 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2558 4771 gene locus_tag LOCUS_18570 2558 4771 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_18570 4820 5086 gene locus_tag LOCUS_18580 4820 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 protein_id gnl|my_center|LOCUS_18580 5113 5814 gene locus_tag LOCUS_18590 gene pnuC 5113 5814 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_18590 5834 6691 gene locus_tag LOCUS_18600 5834 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 8394 6736 gene locus_tag LOCUS_18610 8394 6736 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_18610 10039 8423 gene locus_tag LOCUS_18620 10039 8423 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113202.1 protein_id gnl|my_center|LOCUS_18620 10617 12485 gene locus_tag LOCUS_18630 10617 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 13429 12482 gene locus_tag LOCUS_18640 13429 12482 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266290.1 protein_id gnl|my_center|LOCUS_18640 13853 13569 gene locus_tag LOCUS_18650 13853 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 13940 16729 gene locus_tag LOCUS_18660 gene polA 13940 16729 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 protein_id gnl|my_center|LOCUS_18660 16769 16964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17012 17518 gene locus_tag LOCUS_18670 17012 17518 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219860.1 protein_id gnl|my_center|LOCUS_18670 18733 17681 gene locus_tag LOCUS_18680 18733 17681 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_18680 18971 20314 gene locus_tag LOCUS_18690 gene gdhA 18971 20314 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705519.1 protein_id gnl|my_center|LOCUS_18690 20744 20448 gene locus_tag LOCUS_18700 20744 20448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 24253 20780 gene locus_tag LOCUS_18710 24253 20780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 25164 24394 gene locus_tag LOCUS_18720 25164 24394 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190784.1 protein_id gnl|my_center|LOCUS_18720 25880 25188 gene locus_tag LOCUS_18730 25880 25188 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_18730 26977 25880 gene locus_tag LOCUS_18740 26977 25880 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228741.1 protein_id gnl|my_center|LOCUS_18740 27815 26979 gene locus_tag LOCUS_18750 27815 26979 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114078.1 protein_id gnl|my_center|LOCUS_18750 29178 27955 gene locus_tag LOCUS_18760 29178 27955 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205692.1 protein_id gnl|my_center|LOCUS_18760 31002 29305 gene locus_tag LOCUS_18770 31002 29305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 31111 33066 gene locus_tag LOCUS_18780 31111 33066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 33119 33631 gene locus_tag LOCUS_18790 33119 33631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 33868 35730 gene locus_tag LOCUS_18800 gene atzF 33868 35730 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 protein_id gnl|my_center|LOCUS_18800 35733 36449 gene locus_tag LOCUS_18810 35733 36449 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267779.1 protein_id gnl|my_center|LOCUS_18810 36696 38003 gene locus_tag LOCUS_18820 gene urtA 36696 38003 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244008.1 protein_id gnl|my_center|LOCUS_18820 38081 39718 gene locus_tag LOCUS_18830 gene urtB 38081 39718 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 protein_id gnl|my_center|LOCUS_18830 39730 40959 gene locus_tag LOCUS_18840 gene urtC 39730 40959 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_18840 40956 41735 gene locus_tag LOCUS_18850 gene urtD 40956 41735 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531846.1 protein_id gnl|my_center|LOCUS_18850 41757 42455 gene locus_tag LOCUS_18860 gene urtE 41757 42455 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969815.1 protein_id gnl|my_center|LOCUS_18860 42500 42686 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42968 42720 gene locus_tag LOCUS_18870 42968 42720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 43362 44054 gene locus_tag LOCUS_18880 43362 44054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 44133 44471 gene locus_tag LOCUS_18890 gene glnK 44133 44471 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_18890 44517 45785 gene locus_tag LOCUS_18900 44517 45785 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_18900 46047 45862 gene locus_tag LOCUS_18910 46047 45862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 47182 46328 gene locus_tag LOCUS_18920 gene hexR 47182 46328 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 protein_id gnl|my_center|LOCUS_18920 47369 49567 gene locus_tag LOCUS_18930 gene uvrD 47369 49567 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096872.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence028 814 1063 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1606 1073 gene locus_tag LOCUS_18940 1606 1073 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391429.1 protein_id gnl|my_center|LOCUS_18940 1940 1710 gene locus_tag LOCUS_18950 1940 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 6697 2162 gene locus_tag LOCUS_18960 6697 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 6750 6797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7405 6899 gene locus_tag LOCUS_18970 7405 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 10564 7556 gene locus_tag LOCUS_18980 10564 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 8022 8219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10764 12638 gene locus_tag LOCUS_18990 10764 12638 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707784.1 protein_id gnl|my_center|LOCUS_18990 13836 12715 gene locus_tag LOCUS_19000 13836 12715 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_19000 15074 13893 gene locus_tag LOCUS_19010 15074 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 15560 15111 gene locus_tag LOCUS_19020 15560 15111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 16549 15653 gene locus_tag LOCUS_19030 16549 15653 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223267.1 protein_id gnl|my_center|LOCUS_19030 16691 17191 gene locus_tag LOCUS_19040 16691 17191 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705436.1 protein_id gnl|my_center|LOCUS_19040 18083 17310 gene locus_tag LOCUS_19050 gene fpr 18083 17310 CDS product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_19050 18227 19129 gene locus_tag LOCUS_19060 18227 19129 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_19060 19160 19669 gene locus_tag LOCUS_19070 19160 19669 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263044.1 protein_id gnl|my_center|LOCUS_19070 19722 20165 gene locus_tag LOCUS_19080 19722 20165 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071603.1 protein_id gnl|my_center|LOCUS_19080 20967 20179 gene locus_tag LOCUS_19090 20967 20179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 22446 20968 gene locus_tag LOCUS_19100 22446 20968 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086653.1 protein_id gnl|my_center|LOCUS_19100 23061 22513 gene locus_tag LOCUS_19110 23061 22513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 23270 24145 gene locus_tag LOCUS_19120 23270 24145 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443274.1 protein_id gnl|my_center|LOCUS_19120 24464 25471 gene locus_tag LOCUS_19130 24464 25471 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864506.1 protein_id gnl|my_center|LOCUS_19130 25837 26037 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27304 26084 gene locus_tag LOCUS_19140 27304 26084 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363593.1 protein_id gnl|my_center|LOCUS_19140 28429 27491 gene locus_tag LOCUS_19150 28429 27491 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764856.1 protein_id gnl|my_center|LOCUS_19150 28552 29589 gene locus_tag LOCUS_19160 gene pyrC 28552 29589 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764852.1 protein_id gnl|my_center|LOCUS_19160 29592 30254 gene locus_tag LOCUS_19170 gene rnt 29592 30254 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282283.1 protein_id gnl|my_center|LOCUS_19170 30272 30643 gene locus_tag LOCUS_19180 gene yacL 30272 30643 CDS product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368214.1 protein_id gnl|my_center|LOCUS_19180 31009 33201 gene locus_tag LOCUS_19190 gene katG 31009 33201 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_19190 34313 34531 gene locus_tag LOCUS_19200 34313 34531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 34673 35197 gene locus_tag LOCUS_19210 34673 35197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 35294 35950 gene locus_tag LOCUS_19220 35294 35950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 36433 36981 gene locus_tag LOCUS_19230 36433 36981 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440749.1 protein_id gnl|my_center|LOCUS_19230 36986 37294 gene locus_tag LOCUS_19240 36986 37294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 37817 37320 gene locus_tag LOCUS_19250 37817 37320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_19250 37941 38909 gene locus_tag LOCUS_19260 37941 38909 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 protein_id gnl|my_center|LOCUS_19260 38957 39424 gene locus_tag LOCUS_19270 38957 39424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 39854 39432 gene locus_tag LOCUS_19280 39854 39432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 40043 40288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence029 1311 193 gene locus_tag LOCUS_19290 1311 193 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104670.1 protein_id gnl|my_center|LOCUS_19290 1619 2101 gene locus_tag LOCUS_19300 1619 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2190 2563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3412 2762 gene locus_tag LOCUS_19310 3412 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3762 4223 gene locus_tag LOCUS_19320 3762 4223 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_19320 4585 4250 gene locus_tag LOCUS_19330 4585 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 4614 5132 gene locus_tag LOCUS_19340 4614 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 6319 5264 gene locus_tag LOCUS_19350 6319 5264 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926108.1 protein_id gnl|my_center|LOCUS_19350 7314 6334 gene locus_tag LOCUS_19360 7314 6334 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112640.1 protein_id gnl|my_center|LOCUS_19360 7720 7930 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9158 8073 gene locus_tag LOCUS_19370 9158 8073 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895496.1 protein_id gnl|my_center|LOCUS_19370 10544 9444 gene locus_tag LOCUS_19380 10544 9444 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038953.1 protein_id gnl|my_center|LOCUS_19380 10834 10553 gene locus_tag LOCUS_19390 10834 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 11711 10893 gene locus_tag LOCUS_19400 11711 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19400 13104 12025 gene locus_tag LOCUS_19410 13104 12025 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340058.1 protein_id gnl|my_center|LOCUS_19410 13779 13420 gene locus_tag LOCUS_19420 13779 13420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 13813 14068 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14635 14885 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15053 15409 gene locus_tag LOCUS_19430 15053 15409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 16566 15619 gene locus_tag LOCUS_19440 16566 15619 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271642.1 protein_id gnl|my_center|LOCUS_19440 17105 16566 gene locus_tag LOCUS_19450 17105 16566 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072197.1 protein_id gnl|my_center|LOCUS_19450 18444 17242 gene locus_tag LOCUS_19460 18444 17242 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266455.1 protein_id gnl|my_center|LOCUS_19460 18523 19329 gene locus_tag LOCUS_19470 18523 19329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 19989 19351 gene locus_tag LOCUS_19480 gene rnhB 19989 19351 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_19480 21122 19989 gene locus_tag LOCUS_19490 gene lpxB 21122 19989 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103595.1 protein_id gnl|my_center|LOCUS_19490 21895 21125 gene locus_tag LOCUS_19500 gene lpxA 21895 21125 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071796.1 protein_id gnl|my_center|LOCUS_19500 22356 21892 gene locus_tag LOCUS_19510 gene fabZ 22356 21892 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554719.1 protein_id gnl|my_center|LOCUS_19510 23384 22356 gene locus_tag LOCUS_19520 gene lpxD 23384 22356 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_19520 23892 23398 gene locus_tag LOCUS_19530 gene skp 23892 23398 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816966.1 protein_id gnl|my_center|LOCUS_19530 26482 23924 gene locus_tag LOCUS_19540 gene bamA 26482 23924 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_19540 27855 26515 gene locus_tag LOCUS_19550 gene rseP 27855 26515 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 protein_id gnl|my_center|LOCUS_19550 29045 27852 gene locus_tag LOCUS_19560 gene ispC 29045 27852 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_19560 29887 29042 gene locus_tag LOCUS_19570 gene cdsA 29887 29042 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092388.1 protein_id gnl|my_center|LOCUS_19570 30647 29880 gene locus_tag LOCUS_19580 gene uppS 30647 29880 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314296.1 protein_id gnl|my_center|LOCUS_19580 31218 30661 gene locus_tag LOCUS_19590 gene frr 31218 30661 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092390.1 protein_id gnl|my_center|LOCUS_19590 31955 31221 gene locus_tag LOCUS_19600 gene pyrH 31955 31221 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 protein_id gnl|my_center|LOCUS_19600 33035 32181 gene locus_tag LOCUS_19610 gene tsf 33035 32181 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808106.1 protein_id gnl|my_center|LOCUS_19610 33869 33120 gene locus_tag LOCUS_19620 gene rpsB 33869 33120 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 protein_id gnl|my_center|LOCUS_19620 33966 34208 gene locus_tag LOCUS_19630 33966 34208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 34240 35019 gene locus_tag LOCUS_19640 gene map 34240 35019 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092395.1 protein_id gnl|my_center|LOCUS_19640 35023 37716 gene locus_tag LOCUS_19650 35023 37716 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_19650 37817 38659 gene locus_tag LOCUS_19660 37817 38659 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159137.1 protein_id gnl|my_center|LOCUS_19660 40101 38716 gene locus_tag LOCUS_19670 40101 38716 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence030 1012 314 gene locus_tag LOCUS_19680 1012 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1815 1231 gene locus_tag LOCUS_19690 1815 1231 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929768.1 protein_id gnl|my_center|LOCUS_19690 3351 1945 gene locus_tag LOCUS_19700 3351 1945 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_19700 4020 5066 gene locus_tag LOCUS_19710 4020 5066 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384354.1 protein_id gnl|my_center|LOCUS_19710 5204 6262 gene locus_tag LOCUS_19720 5204 6262 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139593.1 protein_id gnl|my_center|LOCUS_19720 6763 6968 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8196 9809 gene locus_tag LOCUS_19730 gene ctaD 8196 9809 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_19730 9812 10357 gene locus_tag LOCUS_19740 9812 10357 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_19740 10379 11236 gene locus_tag LOCUS_19750 10379 11236 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_19750 11452 11261 gene locus_tag LOCUS_19760 11452 11261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 11451 12206 gene locus_tag LOCUS_19770 11451 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 12203 12772 gene locus_tag LOCUS_19780 12203 12772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 12765 13811 gene locus_tag LOCUS_19790 12765 13811 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_19790 13808 14719 gene locus_tag LOCUS_19800 gene cyoE 13808 14719 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083746.1 protein_id gnl|my_center|LOCUS_19800 15354 14752 gene locus_tag LOCUS_19810 15354 14752 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197988.1 protein_id gnl|my_center|LOCUS_19810 16461 15466 gene locus_tag LOCUS_19820 16461 15466 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 protein_id gnl|my_center|LOCUS_19820 17587 16700 gene locus_tag LOCUS_19830 17587 16700 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523036.1 protein_id gnl|my_center|LOCUS_19830 17691 18068 gene locus_tag LOCUS_19840 17691 18068 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706317.1 protein_id gnl|my_center|LOCUS_19840 19769 18249 gene locus_tag LOCUS_19850 19769 18249 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074108.1 protein_id gnl|my_center|LOCUS_19850 20018 20408 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20471 21424 gene locus_tag LOCUS_19860 20471 21424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 22097 21435 gene locus_tag LOCUS_19870 22097 21435 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549852.1 protein_id gnl|my_center|LOCUS_19870 23425 22238 gene locus_tag LOCUS_19880 23425 22238 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267620.1 protein_id gnl|my_center|LOCUS_19880 23676 23422 gene locus_tag LOCUS_19890 23676 23422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 24400 23663 gene locus_tag LOCUS_19900 24400 23663 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391259.1 protein_id gnl|my_center|LOCUS_19900 25184 24402 gene locus_tag LOCUS_19910 25184 24402 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 protein_id gnl|my_center|LOCUS_19910 25291 26601 gene locus_tag LOCUS_19920 gene ptsJ 25291 26601 CDS product transcriptional regulator PtsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063850.1 protein_id gnl|my_center|LOCUS_19920 26685 27707 gene locus_tag LOCUS_19930 gene epd 26685 27707 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218338.1 protein_id gnl|my_center|LOCUS_19930 28801 27794 gene locus_tag LOCUS_19940 28801 27794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 29234 31177 gene locus_tag LOCUS_19950 29234 31177 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267518.1 protein_id gnl|my_center|LOCUS_19950 32955 31186 gene locus_tag LOCUS_19960 32955 31186 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478447.1 protein_id gnl|my_center|LOCUS_19960 33572 33141 gene locus_tag LOCUS_19970 gene csdE 33572 33141 CDS product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 protein_id gnl|my_center|LOCUS_19970 34784 33582 gene locus_tag LOCUS_19980 gene dapC 34784 33582 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_19980 35023 36753 gene locus_tag LOCUS_19990 35023 36753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 38529 36754 gene locus_tag LOCUS_20000 38529 36754 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267118.1 protein_id gnl|my_center|LOCUS_20000 39993 38713 gene locus_tag LOCUS_20010 39993 38713 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112635.1 protein_id gnl|my_center|LOCUS_20010 39874 40137 gene locus_tag LOCUS_20020 39874 40137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence031 175 392 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 729 1631 gene locus_tag LOCUS_20030 gene rimK 729 1631 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459235.1 protein_id gnl|my_center|LOCUS_20030 1670 2695 gene locus_tag LOCUS_20040 1670 2695 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_20040 3059 3532 gene locus_tag LOCUS_20050 3059 3532 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731391.1 protein_id gnl|my_center|LOCUS_20050 3664 4062 gene locus_tag LOCUS_20060 3664 4062 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_20060 4074 4484 gene locus_tag LOCUS_20070 4074 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 4651 5226 gene locus_tag LOCUS_20080 4651 5226 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_20080 5629 6387 gene locus_tag LOCUS_20090 5629 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957581.1 protein_id gnl|my_center|LOCUS_20090 6512 7147 gene locus_tag LOCUS_20100 gene catB 6512 7147 CDS product type B-5 chloramphenicol O-acetyltransferase CatB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009012.1 protein_id gnl|my_center|LOCUS_20100 7245 8045 gene locus_tag LOCUS_20110 7245 8045 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590336.1 protein_id gnl|my_center|LOCUS_20110 8045 8377 gene locus_tag LOCUS_20120 8045 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 8524 9123 gene locus_tag LOCUS_20130 8524 9123 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 protein_id gnl|my_center|LOCUS_20130 9519 9845 gene locus_tag LOCUS_20140 9519 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 9952 10221 gene locus_tag LOCUS_20150 9952 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 10392 10838 gene locus_tag LOCUS_20160 10392 10838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 12394 10952 gene locus_tag LOCUS_20170 12394 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 14480 12603 gene locus_tag LOCUS_20180 14480 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 16309 14555 gene locus_tag LOCUS_20190 16309 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 16634 17170 gene locus_tag LOCUS_20200 16634 17170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 17237 17725 gene locus_tag LOCUS_20210 17237 17725 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454218.1 protein_id gnl|my_center|LOCUS_20210 18650 17790 gene locus_tag LOCUS_20220 gene yghU 18650 17790 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530630.1 protein_id gnl|my_center|LOCUS_20220 19836 18763 gene locus_tag LOCUS_20230 19836 18763 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268074.1 protein_id gnl|my_center|LOCUS_20230 21318 20296 gene locus_tag LOCUS_20240 21318 20296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 22546 21545 gene locus_tag LOCUS_20250 gene cmoB 22546 21545 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114185.1 protein_id gnl|my_center|LOCUS_20250 23298 22546 gene locus_tag LOCUS_20260 gene cmoA 23298 22546 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123029.1 protein_id gnl|my_center|LOCUS_20260 23609 24793 gene locus_tag LOCUS_20270 23609 24793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 26390 24858 gene locus_tag LOCUS_20280 26390 24858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 26953 26423 gene locus_tag LOCUS_20290 26953 26423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 27202 28341 gene locus_tag LOCUS_20300 27202 28341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 28343 29296 gene locus_tag LOCUS_20310 28343 29296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 29517 30446 gene locus_tag LOCUS_20320 29517 30446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 30995 30558 gene locus_tag LOCUS_20330 gene soxR 30995 30558 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973425.1 protein_id gnl|my_center|LOCUS_20330 31064 32416 gene locus_tag LOCUS_20340 31064 32416 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112929.1 protein_id gnl|my_center|LOCUS_20340 33255 32449 gene locus_tag LOCUS_20350 33255 32449 CDS product glycoside hydrolase family 75 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211925049.1 protein_id gnl|my_center|LOCUS_20350 33438 33869 gene locus_tag LOCUS_20360 33438 33869 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464876.1 protein_id gnl|my_center|LOCUS_20360 35654 33993 gene locus_tag LOCUS_20370 35654 33993 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_20370 35923 35723 gene locus_tag LOCUS_20380 35923 35723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 35918 36922 gene locus_tag LOCUS_20390 35918 36922 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_20390 37969 37814 gene locus_tag LOCUS_20400 37969 37814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 38632 38766 gene locus_tag LOCUS_20410 38632 38766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence032 960 463 gene locus_tag LOCUS_20420 960 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087459406.1 protein_id gnl|my_center|LOCUS_20420 2814 1042 gene locus_tag LOCUS_20430 2814 1042 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763446.1 protein_id gnl|my_center|LOCUS_20430 4262 2856 gene locus_tag LOCUS_20440 4262 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 4356 5420 gene locus_tag LOCUS_20450 gene argE 4356 5420 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419049.1 protein_id gnl|my_center|LOCUS_20450 5568 6872 gene locus_tag LOCUS_20460 gene argA 5568 6872 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763455.1 protein_id gnl|my_center|LOCUS_20460 6886 7653 gene locus_tag LOCUS_20470 6886 7653 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404195.1 protein_id gnl|my_center|LOCUS_20470 7830 8705 gene locus_tag LOCUS_20480 7830 8705 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_20480 8882 10111 gene locus_tag LOCUS_20490 8882 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 10125 10556 gene locus_tag LOCUS_20500 10125 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 11313 11572 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11882 12442 gene locus_tag LOCUS_20510 11882 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 13569 12496 gene locus_tag LOCUS_20520 13569 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_20520 15681 13771 gene locus_tag LOCUS_20530 15681 13771 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074086.1 protein_id gnl|my_center|LOCUS_20530 15828 16081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17611 17869 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19228 18605 gene locus_tag LOCUS_20540 19228 18605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 19415 20014 gene locus_tag LOCUS_20550 gene smrA 19415 20014 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076436.1 protein_id gnl|my_center|LOCUS_20550 20110 20670 gene locus_tag LOCUS_20560 20110 20670 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071587.1 protein_id gnl|my_center|LOCUS_20560 20781 21116 gene locus_tag LOCUS_20570 20781 21116 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071588.1 protein_id gnl|my_center|LOCUS_20570 21986 21129 gene locus_tag LOCUS_20580 21986 21129 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114733.1 protein_id gnl|my_center|LOCUS_20580 22717 22001 gene locus_tag LOCUS_20590 22717 22001 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070907.1 protein_id gnl|my_center|LOCUS_20590 24413 22896 gene locus_tag LOCUS_20600 gene ilvA 24413 22896 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_20600 24533 25207 gene locus_tag LOCUS_20610 gene rpiA 24533 25207 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247432.1 protein_id gnl|my_center|LOCUS_20610 26503 26768 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27610 27863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27897 28430 gene locus_tag LOCUS_20620 27897 28430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 28927 29670 gene locus_tag LOCUS_20630 28927 29670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206816.1 protein_id gnl|my_center|LOCUS_20630 29680 31317 gene locus_tag LOCUS_20640 29680 31317 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206815.1 protein_id gnl|my_center|LOCUS_20640 31314 32405 gene locus_tag LOCUS_20650 31314 32405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206813.1 protein_id gnl|my_center|LOCUS_20650 32416 33375 gene locus_tag LOCUS_20660 32416 33375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 33407 33660 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33679 34746 gene locus_tag LOCUS_20670 33679 34746 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_20670 35254 35405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35638 38025 gene locus_tag LOCUS_20680 35638 38025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence033 306 956 gene locus_tag LOCUS_20690 306 956 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_20690 1024 1479 gene locus_tag LOCUS_20700 1024 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1476 1982 gene locus_tag LOCUS_20710 1476 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1982 2944 gene locus_tag LOCUS_20720 1982 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3511 3035 gene locus_tag LOCUS_20730 3511 3035 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740134.1 protein_id gnl|my_center|LOCUS_20730 4471 3560 gene locus_tag LOCUS_20740 4471 3560 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_20740 4708 6387 gene locus_tag LOCUS_20750 gene fadD1 4708 6387 CDS product long-chain-fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 protein_id gnl|my_center|LOCUS_20750 6500 10417 gene locus_tag LOCUS_20760 gene hrpA 6500 10417 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268680.1 protein_id gnl|my_center|LOCUS_20760 10581 10937 gene locus_tag LOCUS_20770 10581 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072091.1 protein_id gnl|my_center|LOCUS_20770 10997 11818 gene locus_tag LOCUS_20780 10997 11818 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 protein_id gnl|my_center|LOCUS_20780 11805 12584 gene locus_tag LOCUS_20790 11805 12584 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_20790 12600 13208 gene locus_tag LOCUS_20800 12600 13208 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 protein_id gnl|my_center|LOCUS_20800 13303 14043 gene locus_tag LOCUS_20810 13303 14043 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_20810 15184 14111 gene locus_tag LOCUS_20820 15184 14111 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315709.1 protein_id gnl|my_center|LOCUS_20820 15256 16185 gene locus_tag LOCUS_20830 15256 16185 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705417.1 protein_id gnl|my_center|LOCUS_20830 16378 16199 gene locus_tag LOCUS_20840 16378 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 17192 16500 gene locus_tag LOCUS_20850 17192 16500 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463393.1 protein_id gnl|my_center|LOCUS_20850 17408 18382 gene locus_tag LOCUS_20860 gene cysB 17408 18382 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_20860 19165 18440 gene locus_tag LOCUS_20870 19165 18440 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_20870 19410 20027 gene locus_tag LOCUS_20880 gene thrH 19410 20027 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 protein_id gnl|my_center|LOCUS_20880 21098 20139 gene locus_tag LOCUS_20890 21098 20139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 21855 22784 gene locus_tag LOCUS_20900 21855 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 22989 24167 gene locus_tag LOCUS_20910 22989 24167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 24355 25305 gene locus_tag LOCUS_20920 24355 25305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 25333 26400 gene locus_tag LOCUS_20930 25333 26400 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120313.1 protein_id gnl|my_center|LOCUS_20930 26452 28101 gene locus_tag LOCUS_20940 26452 28101 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 protein_id gnl|my_center|LOCUS_20940 28113 28898 gene locus_tag LOCUS_20950 28113 28898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 28879 29727 gene locus_tag LOCUS_20960 28879 29727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 30564 29743 gene locus_tag LOCUS_20970 30564 29743 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120310.1 protein_id gnl|my_center|LOCUS_20970 30688 33057 gene locus_tag LOCUS_20980 gene ppsA 30688 33057 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_20980 33058 34029 gene locus_tag LOCUS_20990 33058 34029 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113577.1 protein_id gnl|my_center|LOCUS_20990 34031 34717 gene locus_tag LOCUS_21000 34031 34717 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001638995.1 protein_id gnl|my_center|LOCUS_21000 34776 35267 gene locus_tag LOCUS_21010 gene rraA 34776 35267 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 protein_id gnl|my_center|LOCUS_21010 36655 35372 gene locus_tag LOCUS_21020 36655 35372 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684307.1 protein_id gnl|my_center|LOCUS_21020 36848 37516 gene locus_tag LOCUS_21030 36848 37516 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence034 1601 300 gene locus_tag LOCUS_21040 gene tyrS 1601 300 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262278.1 protein_id gnl|my_center|LOCUS_21040 1751 3037 gene locus_tag LOCUS_21050 1751 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 3034 4119 gene locus_tag LOCUS_21060 3034 4119 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 protein_id gnl|my_center|LOCUS_21060 4747 4133 gene locus_tag LOCUS_21070 4747 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 5376 4843 gene locus_tag LOCUS_21080 5376 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 5737 5390 gene locus_tag LOCUS_21090 gene erpA 5737 5390 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_21090 6214 5789 gene locus_tag LOCUS_21100 6214 5789 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_21100 6957 6226 gene locus_tag LOCUS_21110 6957 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085249.1 protein_id gnl|my_center|LOCUS_21110 8025 6994 gene locus_tag LOCUS_21120 gene argC 8025 6994 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_21120 8165 9907 gene locus_tag LOCUS_21130 8165 9907 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_21130 9907 10332 gene locus_tag LOCUS_21140 gene hemJ 9907 10332 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_21140 10355 11650 gene locus_tag LOCUS_21150 gene hemL 10355 11650 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_21150 11647 12228 gene locus_tag LOCUS_21160 11647 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 13378 12317 gene locus_tag LOCUS_21170 13378 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 14000 13503 gene locus_tag LOCUS_21180 14000 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 16327 13979 gene locus_tag LOCUS_21190 gene mrcB 16327 13979 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_21190 16955 18055 gene locus_tag LOCUS_21200 gene potF 16955 18055 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208762.1 protein_id gnl|my_center|LOCUS_21200 18164 19300 gene locus_tag LOCUS_21210 gene potA 18164 19300 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388772.1 protein_id gnl|my_center|LOCUS_21210 19297 20223 gene locus_tag LOCUS_21220 gene potH 19297 20223 CDS product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105439.1 protein_id gnl|my_center|LOCUS_21220 20236 21051 gene locus_tag LOCUS_21230 20236 21051 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_21230 21220 24135 gene locus_tag LOCUS_21240 gene glnE 21220 24135 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_21240 24192 25121 gene locus_tag LOCUS_21250 gene ilvE 24192 25121 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_21250 26031 25192 gene locus_tag LOCUS_21260 26031 25192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 26201 26998 gene locus_tag LOCUS_21270 26201 26998 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407244.1 protein_id gnl|my_center|LOCUS_21270 26998 28617 gene locus_tag LOCUS_21280 26998 28617 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479531.1 protein_id gnl|my_center|LOCUS_21280 29227 28661 gene locus_tag LOCUS_21290 29227 28661 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173810.1 protein_id gnl|my_center|LOCUS_21290 29552 29238 gene locus_tag LOCUS_21300 29552 29238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 30019 29549 gene locus_tag LOCUS_21310 30019 29549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 34380 30085 gene locus_tag LOCUS_21320 34380 30085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence035 358 843 gene locus_tag LOCUS_21330 gene moaC 358 843 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080921.1 protein_id gnl|my_center|LOCUS_21330 853 1101 gene locus_tag LOCUS_21340 gene moaD 853 1101 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074082.1 protein_id gnl|my_center|LOCUS_21340 1104 1583 gene locus_tag LOCUS_21350 gene moaE 1104 1583 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074081.1 protein_id gnl|my_center|LOCUS_21350 1840 2397 gene locus_tag LOCUS_21360 1840 2397 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083119.1 protein_id gnl|my_center|LOCUS_21360 2536 3192 gene locus_tag LOCUS_21370 2536 3192 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 protein_id gnl|my_center|LOCUS_21370 3383 3730 gene locus_tag LOCUS_21380 3383 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 4006 7500 gene locus_tag LOCUS_21390 4006 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 8353 7565 gene locus_tag LOCUS_21400 8353 7565 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384352.1 protein_id gnl|my_center|LOCUS_21400 9131 8346 gene locus_tag LOCUS_21410 9131 8346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384351.1 protein_id gnl|my_center|LOCUS_21410 10140 9133 gene locus_tag LOCUS_21420 10140 9133 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384354.1 protein_id gnl|my_center|LOCUS_21420 11676 10561 gene locus_tag LOCUS_21430 gene pilU 11676 10561 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_21430 11793 12120 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12384 12863 gene locus_tag LOCUS_21440 12384 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 13048 13749 gene locus_tag LOCUS_21450 13048 13749 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_21450 13855 14676 gene locus_tag LOCUS_21460 gene proC 13855 14676 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266426.1 protein_id gnl|my_center|LOCUS_21460 14814 15401 gene locus_tag LOCUS_21470 14814 15401 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_21470 15398 15709 gene locus_tag LOCUS_21480 gene yggU 15398 15709 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482461.1 protein_id gnl|my_center|LOCUS_21480 15805 17559 gene locus_tag LOCUS_21490 gene dauA 15805 17559 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925752.1 protein_id gnl|my_center|LOCUS_21490 20201 17706 gene locus_tag LOCUS_21500 20201 17706 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071198.1 protein_id gnl|my_center|LOCUS_21500 20378 21553 gene locus_tag LOCUS_21510 20378 21553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 22579 21560 gene locus_tag LOCUS_21520 22579 21560 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114843.1 protein_id gnl|my_center|LOCUS_21520 22759 24402 gene locus_tag LOCUS_21530 22759 24402 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543236.1 protein_id gnl|my_center|LOCUS_21530 25517 25936 gene locus_tag LOCUS_21540 25517 25936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 27088 26057 gene locus_tag LOCUS_21550 27088 26057 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195868.1 protein_id gnl|my_center|LOCUS_21550 27320 28747 gene locus_tag LOCUS_21560 27320 28747 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103255.1 protein_id gnl|my_center|LOCUS_21560 28740 29693 gene locus_tag LOCUS_21570 gene eutC 28740 29693 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114907.1 protein_id gnl|my_center|LOCUS_21570 29748 31178 gene locus_tag LOCUS_21580 gene eat 29748 31178 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112038.1 protein_id gnl|my_center|LOCUS_21580 31852 31247 gene locus_tag LOCUS_21590 31852 31247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 32034 32453 gene locus_tag LOCUS_21600 32034 32453 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037789.1 protein_id gnl|my_center|LOCUS_21600 32523 35762 gene locus_tag LOCUS_21610 32523 35762 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208107.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence036 613 53 gene locus_tag LOCUS_21620 613 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2080 623 gene locus_tag LOCUS_21630 gene zwf 2080 623 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186165.1 protein_id gnl|my_center|LOCUS_21630 2434 2509 gene locus_tag LOCUS_t00250 2434 2509 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2519 2595 gene locus_tag LOCUS_t00260 2519 2595 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3696 3004 gene locus_tag LOCUS_21640 3696 3004 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091600.1 protein_id gnl|my_center|LOCUS_21640 4033 3815 gene locus_tag LOCUS_21650 4033 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 4181 5023 gene locus_tag LOCUS_21660 4181 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 5844 5092 gene locus_tag LOCUS_21670 5844 5092 CDS product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 protein_id gnl|my_center|LOCUS_21670 6798 6088 gene locus_tag LOCUS_21680 6798 6088 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 protein_id gnl|my_center|LOCUS_21680 7593 6847 gene locus_tag LOCUS_21690 7593 6847 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_21690 8255 7605 gene locus_tag LOCUS_21700 8255 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 9144 8269 gene locus_tag LOCUS_21710 gene dapA 9144 8269 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317384.1 protein_id gnl|my_center|LOCUS_21710 10299 9229 gene locus_tag LOCUS_21720 10299 9229 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245780.1 protein_id gnl|my_center|LOCUS_21720 10546 10304 gene locus_tag LOCUS_21730 10546 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 10704 12164 gene locus_tag LOCUS_21740 10704 12164 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_21740 13300 12266 gene locus_tag LOCUS_21750 gene nadA 13300 12266 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072333.1 protein_id gnl|my_center|LOCUS_21750 13538 13463 gene locus_tag LOCUS_t00270 13538 13463 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13687 13612 gene locus_tag LOCUS_t00280 13687 13612 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14649 13873 gene locus_tag LOCUS_21760 14649 13873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 15200 14649 gene locus_tag LOCUS_21770 gene pal 15200 14649 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554651.1 protein_id gnl|my_center|LOCUS_21770 16512 15232 gene locus_tag LOCUS_21780 gene tolB 16512 15232 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112572.1 protein_id gnl|my_center|LOCUS_21780 17327 16506 gene locus_tag LOCUS_21790 17327 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 17778 17329 gene locus_tag LOCUS_21800 gene tolR 17778 17329 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 protein_id gnl|my_center|LOCUS_21800 18497 17778 gene locus_tag LOCUS_21810 gene tolQ 18497 17778 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 protein_id gnl|my_center|LOCUS_21810 18964 18494 gene locus_tag LOCUS_21820 gene ybgC 18964 18494 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 protein_id gnl|my_center|LOCUS_21820 19991 18966 gene locus_tag LOCUS_21830 gene ruvB 19991 18966 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 protein_id gnl|my_center|LOCUS_21830 20611 20000 gene locus_tag LOCUS_21840 gene ruvA 20611 20000 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816524.1 protein_id gnl|my_center|LOCUS_21840 21212 20697 gene locus_tag LOCUS_21850 gene ruvC 21212 20697 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457261.1 protein_id gnl|my_center|LOCUS_21850 21646 21209 gene locus_tag LOCUS_21860 21646 21209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 21714 21916 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24569 21984 gene locus_tag LOCUS_21870 gene clpB 24569 21984 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094682.1 protein_id gnl|my_center|LOCUS_21870 24855 25742 gene locus_tag LOCUS_21880 24855 25742 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_21880 25959 26867 gene locus_tag LOCUS_21890 25959 26867 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_21890 27383 26940 gene locus_tag LOCUS_21900 27383 26940 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_21900 27703 29820 gene locus_tag LOCUS_21910 27703 29820 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_21910 29875 30052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30693 30097 gene locus_tag LOCUS_21920 30693 30097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 31474 30686 gene locus_tag LOCUS_21930 gene yaaA 31474 30686 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707391.1 protein_id gnl|my_center|LOCUS_21930 31687 31939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31971 32444 gene locus_tag LOCUS_21940 31971 32444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 32699 34009 gene locus_tag LOCUS_21950 32699 34009 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123588.1 protein_id gnl|my_center|LOCUS_21950 34022 35230 gene locus_tag LOCUS_21960 34022 35230 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence037 3313 446 gene locus_tag LOCUS_21970 3313 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 1115 1399 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3456 3708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6177 5659 gene locus_tag LOCUS_21980 6177 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 6656 6174 gene locus_tag LOCUS_21990 6656 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 7270 6665 gene locus_tag LOCUS_22000 7270 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 7992 7267 gene locus_tag LOCUS_22010 7992 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 9298 8117 gene locus_tag LOCUS_22020 9298 8117 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101527.1 protein_id gnl|my_center|LOCUS_22020 10145 9303 gene locus_tag LOCUS_22030 10145 9303 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_22030 12523 10289 gene locus_tag LOCUS_22040 12523 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 13215 12547 gene locus_tag LOCUS_22050 13215 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 13928 13578 gene locus_tag LOCUS_22060 13928 13578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 14356 13916 gene locus_tag LOCUS_22070 14356 13916 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082662.1 protein_id gnl|my_center|LOCUS_22070 14637 14353 gene locus_tag LOCUS_22080 14637 14353 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162995.1 protein_id gnl|my_center|LOCUS_22080 15457 14618 gene locus_tag LOCUS_22090 15457 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 15527 15825 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16599 15988 gene locus_tag LOCUS_22100 gene recR 16599 15988 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193537.1 protein_id gnl|my_center|LOCUS_22100 16927 16601 gene locus_tag LOCUS_22110 16927 16601 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_22110 18926 16950 gene locus_tag LOCUS_22120 gene dnaX 18926 16950 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_22120 19650 19240 gene locus_tag LOCUS_22130 19650 19240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 20194 19925 gene locus_tag LOCUS_22140 gene ybfE 20194 19925 CDS product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367696.1 protein_id gnl|my_center|LOCUS_22140 20325 22715 gene locus_tag LOCUS_22150 20325 22715 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112820.1 protein_id gnl|my_center|LOCUS_22150 24331 22730 gene locus_tag LOCUS_22160 24331 22730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 25308 24748 gene locus_tag LOCUS_22170 25308 24748 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_22170 25762 25400 gene locus_tag LOCUS_22180 25762 25400 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460856.1 protein_id gnl|my_center|LOCUS_22180 26289 25825 gene locus_tag LOCUS_22190 26289 25825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 27279 26386 gene locus_tag LOCUS_22200 gene poxA 27279 26386 CDS product alpha/beta hydrolase PoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114132.1 protein_id gnl|my_center|LOCUS_22200 27533 27715 gene locus_tag LOCUS_22210 27533 27715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 28333 27716 gene locus_tag LOCUS_22220 gene miaE 28333 27716 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368536.1 protein_id gnl|my_center|LOCUS_22220 28746 28330 gene locus_tag LOCUS_22230 28746 28330 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095862.1 protein_id gnl|my_center|LOCUS_22230 29655 28888 gene locus_tag LOCUS_22240 gene xni 29655 28888 CDS product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261344.1 protein_id gnl|my_center|LOCUS_22240 30155 29655 gene locus_tag LOCUS_22250 30155 29655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 30159 30452 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31013 31258 gene locus_tag LOCUS_22260 31013 31258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 32373 32632 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32633 33001 gene locus_tag LOCUS_22270 32633 33001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 33147 33857 gene locus_tag LOCUS_22280 33147 33857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 33872 34726 gene locus_tag LOCUS_22290 33872 34726 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 protein_id gnl|my_center|LOCUS_22290 35183 34644 gene locus_tag LOCUS_22300 35183 34644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 <36346 35345 gene locus_tag LOCUS_22310 <36346 35345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003119269.1:ATP-dependent RNA helicase RhlB >Feature sequence038 678 346 gene locus_tag LOCUS_22320 678 346 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706244.1 protein_id gnl|my_center|LOCUS_22320 1345 1013 gene locus_tag LOCUS_22330 1345 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 1778 1335 gene locus_tag LOCUS_22340 1778 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952183.1 protein_id gnl|my_center|LOCUS_22340 3258 1786 gene locus_tag LOCUS_22350 3258 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 5004 3451 gene locus_tag LOCUS_22360 5004 3451 CDS product IS1182-like element ISMac1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020521.1 protein_id gnl|my_center|LOCUS_22360 5989 5099 gene locus_tag LOCUS_22370 5989 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 7232 6666 gene locus_tag LOCUS_22380 7232 6666 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_22380 8189 7239 gene locus_tag LOCUS_22390 8189 7239 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707304.1 protein_id gnl|my_center|LOCUS_22390 9119 11557 gene locus_tag LOCUS_22400 9119 11557 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403487.1 protein_id gnl|my_center|LOCUS_22400 11617 12852 gene locus_tag LOCUS_22410 11617 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 13037 13522 gene locus_tag LOCUS_22420 13037 13522 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736521.1 protein_id gnl|my_center|LOCUS_22420 14041 13637 gene locus_tag LOCUS_22430 14041 13637 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_22430 15866 14181 gene locus_tag LOCUS_22440 gene leuA 15866 14181 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706534.1 protein_id gnl|my_center|LOCUS_22440 15958 16140 gene locus_tag LOCUS_22450 15958 16140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 16258 16755 gene locus_tag LOCUS_22460 16258 16755 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_22460 16784 17680 gene locus_tag LOCUS_22470 16784 17680 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_22470 17742 19364 gene locus_tag LOCUS_22480 17742 19364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 20367 19441 gene locus_tag LOCUS_22490 20367 19441 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113629.1 protein_id gnl|my_center|LOCUS_22490 20485 21174 gene locus_tag LOCUS_22500 20485 21174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 21171 21869 gene locus_tag LOCUS_22510 21171 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 21966 22325 gene locus_tag LOCUS_22520 21966 22325 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 protein_id gnl|my_center|LOCUS_22520 22327 22947 gene locus_tag LOCUS_22530 22327 22947 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_22530 22940 24775 gene locus_tag LOCUS_22540 gene kefC 22940 24775 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141343.1 protein_id gnl|my_center|LOCUS_22540 24921 25222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25434 25785 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26288 25893 gene locus_tag LOCUS_22550 26288 25893 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_22550 26235 26396 gene locus_tag LOCUS_22560 26235 26396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 26438 26953 gene locus_tag LOCUS_22570 gene tadA 26438 26953 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247479.1 protein_id gnl|my_center|LOCUS_22570 27101 28096 gene locus_tag LOCUS_22580 27101 28096 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_22580 29536 28136 gene locus_tag LOCUS_22590 gene mltF 29536 28136 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_22590 29982 33887 gene locus_tag LOCUS_22600 gene purL 29982 33887 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_22600 34143 35168 gene locus_tag LOCUS_22610 34143 35168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 35170 35457 gene locus_tag LOCUS_22620 35170 35457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence039 327 172 gene locus_tag LOCUS_22630 327 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22630 788 1660 gene locus_tag LOCUS_22640 788 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 1708 1878 gene locus_tag LOCUS_22650 1708 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1956 2192 gene locus_tag LOCUS_22660 1956 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 3443 2262 gene locus_tag LOCUS_22670 3443 2262 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 protein_id gnl|my_center|LOCUS_22670 4728 3580 gene locus_tag LOCUS_22680 4728 3580 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 protein_id gnl|my_center|LOCUS_22680 5497 4736 gene locus_tag LOCUS_22690 5497 4736 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_22690 7162 5774 gene locus_tag LOCUS_22700 7162 5774 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_22700 7269 7595 gene locus_tag LOCUS_22710 7269 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 7613 8833 gene locus_tag LOCUS_22720 7613 8833 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_22720 9061 10035 gene locus_tag LOCUS_22730 9061 10035 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_22730 10117 12882 gene locus_tag LOCUS_22740 gene rbbA 10117 12882 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_22740 12885 14009 gene locus_tag LOCUS_22750 12885 14009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943323.1 protein_id gnl|my_center|LOCUS_22750 14111 14374 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15882 14761 gene locus_tag LOCUS_22760 gene adeT1 15882 14761 CDS product putative multidrug efflux protein AdeT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_22760 16173 17990 gene locus_tag LOCUS_22770 gene nadN 16173 17990 CDS product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 protein_id gnl|my_center|LOCUS_22770 19279 18101 gene locus_tag LOCUS_22780 19279 18101 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762604.1 protein_id gnl|my_center|LOCUS_22780 19292 19555 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20054 19635 gene locus_tag LOCUS_22790 20054 19635 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071599.1 protein_id gnl|my_center|LOCUS_22790 20250 20861 gene locus_tag LOCUS_22800 20250 20861 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071600.1 protein_id gnl|my_center|LOCUS_22800 21435 20866 gene locus_tag LOCUS_22810 21435 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 21914 21432 gene locus_tag LOCUS_22820 21914 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 22087 22887 gene locus_tag LOCUS_22830 22087 22887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 22944 23342 gene locus_tag LOCUS_22840 22944 23342 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025575720.1 protein_id gnl|my_center|LOCUS_22840 23511 24074 gene locus_tag LOCUS_22850 23511 24074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 24203 24409 gene locus_tag LOCUS_22860 24203 24409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 26149 24485 gene locus_tag LOCUS_22870 26149 24485 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070804.1 protein_id gnl|my_center|LOCUS_22870 26469 26146 gene locus_tag LOCUS_22880 26469 26146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070803.1 protein_id gnl|my_center|LOCUS_22880 26731 26459 gene locus_tag LOCUS_22890 26731 26459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 26974 27525 gene locus_tag LOCUS_22900 26974 27525 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085436.1 protein_id gnl|my_center|LOCUS_22900 29046 27805 gene locus_tag LOCUS_22910 29046 27805 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388899.1 protein_id gnl|my_center|LOCUS_22910 29157 30653 gene locus_tag LOCUS_22920 29157 30653 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388898.1 protein_id gnl|my_center|LOCUS_22920 31163 30744 gene locus_tag LOCUS_22930 31163 30744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263613.1 protein_id gnl|my_center|LOCUS_22930 33098 31458 gene locus_tag LOCUS_22940 gene groL 33098 31458 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094059.1 protein_id gnl|my_center|LOCUS_22940 33447 33154 gene locus_tag LOCUS_22950 33447 33154 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094064.1 protein_id gnl|my_center|LOCUS_22950 33864 33607 gene locus_tag LOCUS_22960 33864 33607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 33919 34182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34571 35062 gene locus_tag LOCUS_22970 34571 35062 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809464.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence040 <1 867 gene locus_tag LOCUS_22980 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000140408.1:sulfate adenylyltransferase subunit CysD 869 2482 gene locus_tag LOCUS_22990 gene cysN 869 2482 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110029.1 protein_id gnl|my_center|LOCUS_22990 2866 2942 gene locus_tag LOCUS_t00290 2866 2942 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3937 3041 gene locus_tag LOCUS_23000 3937 3041 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300279.1 protein_id gnl|my_center|LOCUS_23000 5293 3941 gene locus_tag LOCUS_23010 5293 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115206.1 protein_id gnl|my_center|LOCUS_23010 5566 5294 gene locus_tag LOCUS_23020 5566 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 6716 5550 gene locus_tag LOCUS_23030 6716 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 7056 6718 gene locus_tag LOCUS_23040 7056 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 8888 7059 gene locus_tag LOCUS_23050 8888 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 9186 8956 gene locus_tag LOCUS_23060 9186 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 9686 9396 gene locus_tag LOCUS_23070 9686 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 10201 9893 gene locus_tag LOCUS_23080 10201 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 10574 10852 gene locus_tag LOCUS_23090 10574 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 11169 10897 gene locus_tag LOCUS_23100 11169 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 11470 12270 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgcctatgcggcagcgaac 12980 12399 gene locus_tag LOCUS_23110 gene cas6f 12980 12399 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_23110 13992 12970 gene locus_tag LOCUS_23120 gene csy3 13992 12970 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_23120 15038 14016 gene locus_tag LOCUS_23130 gene csy2 15038 14016 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_23130 16372 15035 gene locus_tag LOCUS_23140 gene csy1 16372 15035 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_23140 19872 16429 gene locus_tag LOCUS_23150 gene cas3f 19872 16429 CDS product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_23150 20852 19869 gene locus_tag LOCUS_23160 gene cas1f 20852 19869 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_23160 21167 22240 gene locus_tag LOCUS_23170 21167 22240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 23622 22381 gene locus_tag LOCUS_23180 23622 22381 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765125.1 protein_id gnl|my_center|LOCUS_23180 24372 23725 gene locus_tag LOCUS_23190 24372 23725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 24663 25610 gene locus_tag LOCUS_23200 24663 25610 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455078.1 protein_id gnl|my_center|LOCUS_23200 26326 25688 gene locus_tag LOCUS_23210 gene pdxH 26326 25688 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112518.1 protein_id gnl|my_center|LOCUS_23210 27269 26415 gene locus_tag LOCUS_23220 27269 26415 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072012.1 protein_id gnl|my_center|LOCUS_23220 27428 27883 gene locus_tag LOCUS_23230 27428 27883 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_23230 29001 27937 gene locus_tag LOCUS_23240 gene lptG 29001 27937 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_23240 29717 29001 gene locus_tag LOCUS_23250 29717 29001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 29733 30056 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30389 31855 gene locus_tag LOCUS_23260 30389 31855 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_23260 32768 33346 gene locus_tag LOCUS_23270 32768 33346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 33431 33889 gene locus_tag LOCUS_23280 33431 33889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 33979 34404 gene locus_tag LOCUS_23290 33979 34404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence041 876 178 gene locus_tag LOCUS_23300 876 178 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_23300 1759 929 gene locus_tag LOCUS_23310 gene aroE 1759 929 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266136.1 protein_id gnl|my_center|LOCUS_23310 2723 1770 gene locus_tag LOCUS_23320 gene hemF 2723 1770 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_23320 3300 2755 gene locus_tag LOCUS_23330 3300 2755 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097300.1 protein_id gnl|my_center|LOCUS_23330 3546 5018 gene locus_tag LOCUS_23340 3546 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 4906 6291 gene locus_tag LOCUS_23350 4906 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 6288 10415 gene locus_tag LOCUS_23360 6288 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 10457 13549 gene locus_tag LOCUS_23370 10457 13549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 13554 14075 gene locus_tag LOCUS_23380 13554 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 14205 15545 gene locus_tag LOCUS_23390 14205 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 15690 16034 gene locus_tag LOCUS_23400 15690 16034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 16768 17109 gene locus_tag LOCUS_23410 16768 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 17968 18201 gene locus_tag LOCUS_23420 17968 18201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 18419 18715 gene locus_tag LOCUS_23430 18419 18715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 19264 19500 gene locus_tag LOCUS_23440 19264 19500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 19523 19915 gene locus_tag LOCUS_23450 19523 19915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 20096 20326 gene locus_tag LOCUS_23460 20096 20326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 21441 20353 gene locus_tag LOCUS_23470 gene dprA 21441 20353 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654772.1 protein_id gnl|my_center|LOCUS_23470 22512 21454 gene locus_tag LOCUS_23480 22512 21454 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_23480 22624 23148 gene locus_tag LOCUS_23490 gene def 22624 23148 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401459.1 protein_id gnl|my_center|LOCUS_23490 23148 24098 gene locus_tag LOCUS_23500 gene fmt 23148 24098 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166852057.1 protein_id gnl|my_center|LOCUS_23500 24095 25429 gene locus_tag LOCUS_23510 gene rsmB 24095 25429 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_23510 25492 26865 gene locus_tag LOCUS_23520 gene trkA 25492 26865 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_23520 26878 28326 gene locus_tag LOCUS_23530 26878 28326 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 protein_id gnl|my_center|LOCUS_23530 28329 28919 gene locus_tag LOCUS_23540 28329 28919 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_23540 28916 29110 gene locus_tag LOCUS_23550 28916 29110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 30061 29156 gene locus_tag LOCUS_23560 30061 29156 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401447.1 protein_id gnl|my_center|LOCUS_23560 31098 30190 gene locus_tag LOCUS_23570 31098 30190 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 protein_id gnl|my_center|LOCUS_23570 31238 32890 gene locus_tag LOCUS_23580 31238 32890 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103766.1 protein_id gnl|my_center|LOCUS_23580 32907 33539 gene locus_tag LOCUS_23590 32907 33539 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_23590 <34388 33531 gene locus_tag LOCUS_23600 <34388 33531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096496.1:choline BCCT transporter BetT >Feature sequence042 584 1759 gene locus_tag LOCUS_23610 584 1759 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187023.1 protein_id gnl|my_center|LOCUS_23610 2580 2909 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2913 3944 gene locus_tag LOCUS_23620 2913 3944 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531243.1 protein_id gnl|my_center|LOCUS_23620 3975 4778 gene locus_tag LOCUS_23630 3975 4778 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095098.1 protein_id gnl|my_center|LOCUS_23630 4887 5315 gene locus_tag LOCUS_23640 4887 5315 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087490.1 protein_id gnl|my_center|LOCUS_23640 6496 5414 gene locus_tag LOCUS_23650 6496 5414 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209176.1 protein_id gnl|my_center|LOCUS_23650 7592 6528 gene locus_tag LOCUS_23660 7592 6528 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395239.1 protein_id gnl|my_center|LOCUS_23660 8558 7728 gene locus_tag LOCUS_23670 8558 7728 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228241.1 protein_id gnl|my_center|LOCUS_23670 8968 10521 gene locus_tag LOCUS_23680 8968 10521 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228753.1 protein_id gnl|my_center|LOCUS_23680 10518 11486 gene locus_tag LOCUS_23690 10518 11486 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_23690 12932 11538 gene locus_tag LOCUS_23700 12932 11538 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109023.1 protein_id gnl|my_center|LOCUS_23700 15220 12935 gene locus_tag LOCUS_23710 15220 12935 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550100.1 protein_id gnl|my_center|LOCUS_23710 15412 15825 gene locus_tag LOCUS_23720 15412 15825 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110101.1 protein_id gnl|my_center|LOCUS_23720 15855 16556 gene locus_tag LOCUS_23730 15855 16556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 16663 17430 gene locus_tag LOCUS_23740 16663 17430 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 protein_id gnl|my_center|LOCUS_23740 17540 18418 gene locus_tag LOCUS_23750 17540 18418 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705863.1 protein_id gnl|my_center|LOCUS_23750 18573 18433 gene locus_tag LOCUS_23760 18573 18433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 18700 18960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19119 19362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19401 19745 gene locus_tag LOCUS_23770 19401 19745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 19755 19964 gene locus_tag LOCUS_23780 19755 19964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 21754 20792 gene locus_tag LOCUS_23790 21754 20792 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224790.1 protein_id gnl|my_center|LOCUS_23790 22841 21768 gene locus_tag LOCUS_23800 22841 21768 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227175.1 protein_id gnl|my_center|LOCUS_23800 22973 24556 gene locus_tag LOCUS_23810 22973 24556 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007420.1 protein_id gnl|my_center|LOCUS_23810 24585 25277 gene locus_tag LOCUS_23820 24585 25277 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227178.1 protein_id gnl|my_center|LOCUS_23820 25972 27630 gene locus_tag LOCUS_23830 25972 27630 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113006.1 protein_id gnl|my_center|LOCUS_23830 27632 28129 gene locus_tag LOCUS_23840 27632 28129 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093457.1 protein_id gnl|my_center|LOCUS_23840 29551 28139 gene locus_tag LOCUS_23850 29551 28139 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769539.1 protein_id gnl|my_center|LOCUS_23850 29692 31092 gene locus_tag LOCUS_23860 gene cioA 29692 31092 CDS product cyanide-insensitive cytochrome bd quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103027.1 protein_id gnl|my_center|LOCUS_23860 31104 32111 gene locus_tag LOCUS_23870 gene cydB 31104 32111 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151052.1 protein_id gnl|my_center|LOCUS_23870 33166 32507 gene locus_tag LOCUS_23880 33166 32507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence043 233 650 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1321 833 gene locus_tag LOCUS_23890 1321 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 3031 1544 gene locus_tag LOCUS_23900 3031 1544 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115383.1 protein_id gnl|my_center|LOCUS_23900 3695 3387 gene locus_tag LOCUS_23910 3695 3387 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268830.1 protein_id gnl|my_center|LOCUS_23910 3827 4465 gene locus_tag LOCUS_23920 3827 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 5341 4505 gene locus_tag LOCUS_23930 5341 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 6319 5561 gene locus_tag LOCUS_23940 6319 5561 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_23940 6624 7088 gene locus_tag LOCUS_23950 6624 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 7333 8613 gene locus_tag LOCUS_23960 7333 8613 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_23960 8610 9746 gene locus_tag LOCUS_23970 8610 9746 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_23970 9772 10977 gene locus_tag LOCUS_23980 9772 10977 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_23980 11143 13284 gene locus_tag LOCUS_23990 11143 13284 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524570.1 protein_id gnl|my_center|LOCUS_23990 13989 13381 gene locus_tag LOCUS_24000 13989 13381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 15352 14894 gene locus_tag LOCUS_24010 15352 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 15640 15473 gene locus_tag LOCUS_24020 15640 15473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 18369 15736 gene locus_tag LOCUS_24030 18369 15736 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267002.1 protein_id gnl|my_center|LOCUS_24030 18911 19099 gene locus_tag LOCUS_24040 18911 19099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 19759 19352 gene locus_tag LOCUS_24050 19759 19352 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_24050 20842 19793 gene locus_tag LOCUS_24060 20842 19793 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267361.1 protein_id gnl|my_center|LOCUS_24060 21142 21387 gene locus_tag LOCUS_24070 21142 21387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 21448 22896 gene locus_tag LOCUS_24080 gene oadA 21448 22896 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_24080 23016 23078 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23233 23436 gene locus_tag LOCUS_24090 23233 23436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 23446 24747 gene locus_tag LOCUS_24100 23446 24747 CDS product oxalacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444843.1 protein_id gnl|my_center|LOCUS_24100 26302 24869 gene locus_tag LOCUS_24110 26302 24869 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102300.1 protein_id gnl|my_center|LOCUS_24110 27000 27995 gene locus_tag LOCUS_24120 gene gap 27000 27995 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114837.1 protein_id gnl|my_center|LOCUS_24120 28139 30895 gene locus_tag LOCUS_24130 28139 30895 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence044 264 467 gene locus_tag LOCUS_24140 264 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 480 866 gene locus_tag LOCUS_24150 480 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 866 2908 gene locus_tag LOCUS_24160 866 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2919 3239 gene locus_tag LOCUS_24170 2919 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 3233 3526 gene locus_tag LOCUS_24180 3233 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 3550 4545 gene locus_tag LOCUS_24190 3550 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 4592 5167 gene locus_tag LOCUS_24200 4592 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344637.1 protein_id gnl|my_center|LOCUS_24200 5234 5734 gene locus_tag LOCUS_24210 5234 5734 CDS product DNA N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203018.1 protein_id gnl|my_center|LOCUS_24210 6021 6251 gene locus_tag LOCUS_24220 6021 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 6264 6479 gene locus_tag LOCUS_24230 6264 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 6608 6886 gene locus_tag LOCUS_24240 6608 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 7602 7123 gene locus_tag LOCUS_24250 7602 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 7884 7660 gene locus_tag LOCUS_24260 7884 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706168.1 protein_id gnl|my_center|LOCUS_24260 8261 7953 gene locus_tag LOCUS_24270 8261 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 8584 8369 gene locus_tag LOCUS_24280 8584 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 8705 8890 gene locus_tag LOCUS_24290 8705 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 9276 8905 gene locus_tag LOCUS_24300 9276 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 9587 9273 gene locus_tag LOCUS_24310 9587 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24310 9731 9838 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9914 10117 gene locus_tag LOCUS_24320 9914 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 12186 10315 gene locus_tag LOCUS_24330 12186 10315 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389558.1 protein_id gnl|my_center|LOCUS_24330 12411 13295 gene locus_tag LOCUS_24340 12411 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 13353 14423 gene locus_tag LOCUS_24350 13353 14423 CDS product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098795.1 protein_id gnl|my_center|LOCUS_24350 14488 15252 gene locus_tag LOCUS_24360 14488 15252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 15368 15841 gene locus_tag LOCUS_24370 15368 15841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 15838 16296 gene locus_tag LOCUS_24380 15838 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 16913 17166 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17192 18361 gene locus_tag LOCUS_24390 17192 18361 CDS product DUF2586 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097393.1 protein_id gnl|my_center|LOCUS_24390 18365 18829 gene locus_tag LOCUS_24400 18365 18829 CDS product DUF2597 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097392.1 protein_id gnl|my_center|LOCUS_24400 18845 19324 gene locus_tag LOCUS_24410 18845 19324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 19302 19565 gene locus_tag LOCUS_24420 19302 19565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 19575 19820 gene locus_tag LOCUS_24430 19575 19820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 19840 20109 gene locus_tag LOCUS_24440 19840 20109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 20291 22567 gene locus_tag LOCUS_24450 20291 22567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 22569 22898 gene locus_tag LOCUS_24460 22569 22898 CDS product DUF2590 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938931.1 protein_id gnl|my_center|LOCUS_24460 22898 24109 gene locus_tag LOCUS_24470 22898 24109 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136930.1 protein_id gnl|my_center|LOCUS_24470 24109 24651 gene locus_tag LOCUS_24480 24109 24651 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767209.1 protein_id gnl|my_center|LOCUS_24480 24654 27035 gene locus_tag LOCUS_24490 24654 27035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 27035 27430 gene locus_tag LOCUS_24500 27035 27430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 27627 28262 gene locus_tag LOCUS_24510 27627 28262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 28259 28810 gene locus_tag LOCUS_24520 28259 28810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 28810 29544 gene locus_tag LOCUS_24530 28810 29544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 29541 30542 gene locus_tag LOCUS_24540 29541 30542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055010900.1 protein_id gnl|my_center|LOCUS_24540 31178 31102 gene locus_tag LOCUS_t00300 31178 31102 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence045 1094 249 gene locus_tag LOCUS_24550 1094 249 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_24550 1434 2450 gene locus_tag LOCUS_24560 1434 2450 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444337.1 protein_id gnl|my_center|LOCUS_24560 2583 4079 gene locus_tag LOCUS_24570 2583 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 4317 4574 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5344 4730 gene locus_tag LOCUS_24580 5344 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 6020 5442 gene locus_tag LOCUS_24590 6020 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 6953 6516 gene locus_tag LOCUS_24600 6953 6516 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_24600 7064 7288 gene locus_tag LOCUS_24610 7064 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 7825 7184 gene locus_tag LOCUS_24620 7825 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 8153 9475 gene locus_tag LOCUS_24630 8153 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 10110 9502 gene locus_tag LOCUS_24640 10110 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 10125 10322 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10831 10340 gene locus_tag LOCUS_24650 10831 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 11397 10834 gene locus_tag LOCUS_24660 11397 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 12763 11384 gene locus_tag LOCUS_24670 12763 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 12891 13147 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16491 16808 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17180 17593 gene locus_tag LOCUS_24680 gene rnk 17180 17593 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 protein_id gnl|my_center|LOCUS_24680 17821 18438 gene locus_tag LOCUS_24690 17821 18438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 18431 19516 gene locus_tag LOCUS_24700 18431 19516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 20396 19578 gene locus_tag LOCUS_24710 20396 19578 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071548.1 protein_id gnl|my_center|LOCUS_24710 21101 20622 gene locus_tag LOCUS_24720 21101 20622 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093104.1 protein_id gnl|my_center|LOCUS_24720 22195 21200 gene locus_tag LOCUS_24730 gene hemH 22195 21200 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927663.1 protein_id gnl|my_center|LOCUS_24730 22404 22877 gene locus_tag LOCUS_24740 22404 22877 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 protein_id gnl|my_center|LOCUS_24740 23272 22886 gene locus_tag LOCUS_24750 23272 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 23997 23284 gene locus_tag LOCUS_24760 23997 23284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 24120 25034 gene locus_tag LOCUS_24770 24120 25034 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_24770 26773 25193 gene locus_tag LOCUS_24780 gene sph 26773 25193 CDS product sphingomyelin phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608692.1 protein_id gnl|my_center|LOCUS_24780 27432 27028 gene locus_tag LOCUS_24790 27432 27028 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_24790 27722 27492 gene locus_tag LOCUS_24800 27722 27492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 28674 27895 gene locus_tag LOCUS_24810 28674 27895 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208285.1 protein_id gnl|my_center|LOCUS_24810 29336 28752 gene locus_tag LOCUS_24820 29336 28752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 29935 29522 gene locus_tag LOCUS_24830 29935 29522 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461346.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence046 893 1507 gene locus_tag LOCUS_24840 893 1507 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_24840 2341 1571 gene locus_tag LOCUS_24850 2341 1571 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113283.1 protein_id gnl|my_center|LOCUS_24850 5322 2476 gene locus_tag LOCUS_24860 5322 2476 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894214.1 protein_id gnl|my_center|LOCUS_24860 5592 5332 gene locus_tag LOCUS_24870 5592 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 7529 5685 gene locus_tag LOCUS_24880 7529 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 7723 8265 gene locus_tag LOCUS_24890 7723 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 8313 10364 gene locus_tag LOCUS_24900 8313 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 10750 10346 gene locus_tag LOCUS_24910 10750 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 10905 12080 gene locus_tag LOCUS_24920 10905 12080 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204879.1 protein_id gnl|my_center|LOCUS_24920 12077 13180 gene locus_tag LOCUS_24930 12077 13180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 14041 13244 gene locus_tag LOCUS_24940 14041 13244 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101159.1 protein_id gnl|my_center|LOCUS_24940 15050 14193 gene locus_tag LOCUS_24950 15050 14193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 15229 16095 gene locus_tag LOCUS_24960 gene fieF 15229 16095 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815283.1 protein_id gnl|my_center|LOCUS_24960 16102 17118 gene locus_tag LOCUS_24970 16102 17118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 17696 17115 gene locus_tag LOCUS_24980 17696 17115 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_24980 18690 17743 gene locus_tag LOCUS_24990 gene cysK 18690 17743 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036918.1 protein_id gnl|my_center|LOCUS_24990 18817 20079 gene locus_tag LOCUS_25000 18817 20079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 21019 20135 gene locus_tag LOCUS_25010 21019 20135 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_25010 22909 21023 gene locus_tag LOCUS_25020 gene pta 22909 21023 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114221.1 protein_id gnl|my_center|LOCUS_25020 22943 23215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23791 23348 gene locus_tag LOCUS_25030 23791 23348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 23807 24064 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24295 24513 gene locus_tag LOCUS_25040 24295 24513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 24550 24699 gene locus_tag LOCUS_25050 24550 24699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 25145 24771 gene locus_tag LOCUS_25060 25145 24771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 25953 25147 gene locus_tag LOCUS_25070 25953 25147 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 protein_id gnl|my_center|LOCUS_25070 26229 27167 gene locus_tag LOCUS_25080 26229 27167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 27504 27172 gene locus_tag LOCUS_25090 27504 27172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 28062 27583 gene locus_tag LOCUS_25100 28062 27583 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 protein_id gnl|my_center|LOCUS_25100 28950 28189 gene locus_tag LOCUS_25110 28950 28189 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405915.1 protein_id gnl|my_center|LOCUS_25110 29065 29664 gene locus_tag LOCUS_25120 29065 29664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 30264 29677 gene locus_tag LOCUS_25130 30264 29677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence047 281 33 gene locus_tag LOCUS_25140 281 33 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048897891.1 protein_id gnl|my_center|LOCUS_25140 764 453 gene locus_tag LOCUS_25150 764 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1272 1027 gene locus_tag LOCUS_25160 1272 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1880 1350 gene locus_tag LOCUS_25170 1880 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2403 2149 gene locus_tag LOCUS_25180 2403 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2619 3434 gene locus_tag LOCUS_25190 2619 3434 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_25190 3538 3906 gene locus_tag LOCUS_25200 3538 3906 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793035.1 protein_id gnl|my_center|LOCUS_25200 4525 4187 gene locus_tag LOCUS_25210 4525 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073990.1 protein_id gnl|my_center|LOCUS_25210 5097 4606 gene locus_tag LOCUS_25220 5097 4606 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_25220 5338 5925 gene locus_tag LOCUS_25230 5338 5925 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 protein_id gnl|my_center|LOCUS_25230 5925 6212 gene locus_tag LOCUS_25240 5925 6212 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975509.1 protein_id gnl|my_center|LOCUS_25240 6234 6839 gene locus_tag LOCUS_25250 6234 6839 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_25250 7835 6897 gene locus_tag LOCUS_25260 7835 6897 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206238.1 protein_id gnl|my_center|LOCUS_25260 8860 7892 gene locus_tag LOCUS_25270 8860 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 9230 10240 gene locus_tag LOCUS_25280 gene hemB 9230 10240 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 protein_id gnl|my_center|LOCUS_25280 11773 12045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12085 12546 gene locus_tag LOCUS_25290 12085 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 12574 12829 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14042 12831 gene locus_tag LOCUS_25300 14042 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 14081 14369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16041 15043 gene locus_tag LOCUS_25310 16041 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 18595 16034 gene locus_tag LOCUS_25320 18595 16034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 19836 18592 gene locus_tag LOCUS_25330 19836 18592 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973070.1 protein_id gnl|my_center|LOCUS_25330 21596 19833 gene locus_tag LOCUS_25340 21596 19833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 22879 21992 gene locus_tag LOCUS_25350 22879 21992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 24571 23069 gene locus_tag LOCUS_25360 gene ppx 24571 23069 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_25360 24798 25124 gene locus_tag LOCUS_25370 gene trxA 24798 25124 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280776.1 protein_id gnl|my_center|LOCUS_25370 25897 26145 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26334 26755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27953 27084 gene locus_tag LOCUS_25380 gene rpoH 27953 27084 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 protein_id gnl|my_center|LOCUS_25380 29078 28098 gene locus_tag LOCUS_25390 gene ftsX 29078 28098 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_25390 29763 29071 gene locus_tag LOCUS_25400 gene ftsE 29763 29071 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence048 <1 826 gene locus_tag LOCUS_25410 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405354.1:EAL domain-containing protein 823 1680 gene locus_tag LOCUS_25420 823 1680 CDS product DUF3034 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052844658.1 protein_id gnl|my_center|LOCUS_25420 1691 2116 gene locus_tag LOCUS_25430 1691 2116 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_25430 4001 2226 gene locus_tag LOCUS_25440 4001 2226 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_25440 4285 4016 gene locus_tag LOCUS_25450 4285 4016 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_25450 4519 4773 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5003 4821 gene locus_tag LOCUS_25460 5003 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 5002 5490 gene locus_tag LOCUS_25470 5002 5490 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526860.1 protein_id gnl|my_center|LOCUS_25470 5714 8509 gene locus_tag LOCUS_25480 5714 8509 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_25480 8667 8954 gene locus_tag LOCUS_25490 8667 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 9016 9906 gene locus_tag LOCUS_25500 9016 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 10005 11366 gene locus_tag LOCUS_25510 10005 11366 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 protein_id gnl|my_center|LOCUS_25510 11369 12097 gene locus_tag LOCUS_25520 gene phnR 11369 12097 CDS product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703875.1 protein_id gnl|my_center|LOCUS_25520 12190 12565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12876 13340 gene locus_tag LOCUS_25530 12876 13340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 13817 14092 gene locus_tag LOCUS_25540 13817 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 14285 15400 gene locus_tag LOCUS_25550 gene phnW 14285 15400 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786490.1 protein_id gnl|my_center|LOCUS_25550 15424 16017 gene locus_tag LOCUS_25560 15424 16017 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090877.1 protein_id gnl|my_center|LOCUS_25560 16010 16837 gene locus_tag LOCUS_25570 16010 16837 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 protein_id gnl|my_center|LOCUS_25570 17846 16953 gene locus_tag LOCUS_25580 17846 16953 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_25580 18588 18034 gene locus_tag LOCUS_25590 18588 18034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 18930 18607 gene locus_tag LOCUS_25600 18930 18607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 20215 19703 gene locus_tag LOCUS_25610 20215 19703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 21203 20289 gene locus_tag LOCUS_25620 21203 20289 CDS product DUF4868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071329.1 protein_id gnl|my_center|LOCUS_25620 21495 21824 gene locus_tag LOCUS_25630 21495 21824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 22089 22304 gene locus_tag LOCUS_25640 22089 22304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 22223 22522 gene locus_tag LOCUS_25650 22223 22522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 22739 22488 gene locus_tag LOCUS_25660 22739 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 25512 23200 gene locus_tag LOCUS_25670 25512 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 28693 26315 gene locus_tag LOCUS_25680 28693 26315 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence049 723 1235 gene locus_tag LOCUS_25690 723 1235 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_25690 2057 1290 gene locus_tag LOCUS_25700 2057 1290 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970188.1 protein_id gnl|my_center|LOCUS_25700 2825 2127 gene locus_tag LOCUS_25710 2825 2127 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482811.1 protein_id gnl|my_center|LOCUS_25710 2948 3976 gene locus_tag LOCUS_25720 2948 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 3830 3921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4072 4254 gene locus_tag LOCUS_25730 4072 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 4807 4310 gene locus_tag LOCUS_25740 4807 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 4844 5056 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5302 6210 gene locus_tag LOCUS_25750 5302 6210 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_25750 6660 7721 gene locus_tag LOCUS_25760 6660 7721 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 protein_id gnl|my_center|LOCUS_25760 7862 9982 gene locus_tag LOCUS_25770 gene metG 7862 9982 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 protein_id gnl|my_center|LOCUS_25770 10493 10071 gene locus_tag LOCUS_25780 10493 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 10992 11780 gene locus_tag LOCUS_25790 10992 11780 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973520.1 protein_id gnl|my_center|LOCUS_25790 12030 11791 gene locus_tag LOCUS_25800 12030 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 12324 12112 gene locus_tag LOCUS_25810 12324 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 12587 12839 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13511 13032 gene locus_tag LOCUS_25820 13511 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 14284 14829 gene locus_tag LOCUS_25830 14284 14829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 14820 15803 gene locus_tag LOCUS_25840 14820 15803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 16047 18809 gene locus_tag LOCUS_25850 16047 18809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 20166 18922 gene locus_tag LOCUS_25860 20166 18922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962527.1 protein_id gnl|my_center|LOCUS_25860 24690 20494 gene locus_tag LOCUS_25870 24690 20494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 28135 24851 gene locus_tag LOCUS_25880 28135 24851 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_25880 28339 28151 gene locus_tag LOCUS_25890 28339 28151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence050 334 558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1185 2438 gene locus_tag LOCUS_25900 1185 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 3181 2483 gene locus_tag LOCUS_25910 3181 2483 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770041.1 protein_id gnl|my_center|LOCUS_25910 3237 3502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4287 3517 gene locus_tag LOCUS_25920 4287 3517 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 protein_id gnl|my_center|LOCUS_25920 5498 4572 gene locus_tag LOCUS_25930 5498 4572 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414641.1 protein_id gnl|my_center|LOCUS_25930 6572 5502 gene locus_tag LOCUS_25940 6572 5502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112631.1 protein_id gnl|my_center|LOCUS_25940 8103 6565 gene locus_tag LOCUS_25950 8103 6565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266557.1 protein_id gnl|my_center|LOCUS_25950 8377 9837 gene locus_tag LOCUS_25960 gene xdhA 8377 9837 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_25960 9834 12194 gene locus_tag LOCUS_25970 gene xdhB 9834 12194 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267257.1 protein_id gnl|my_center|LOCUS_25970 12191 13114 gene locus_tag LOCUS_25980 gene xdhC 12191 13114 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 protein_id gnl|my_center|LOCUS_25980 13188 13316 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13376 14371 gene locus_tag LOCUS_25990 gene alc 13376 14371 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104661.1 protein_id gnl|my_center|LOCUS_25990 14393 14905 gene locus_tag LOCUS_26000 gene uraD 14393 14905 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097235.1 protein_id gnl|my_center|LOCUS_26000 14916 15275 gene locus_tag LOCUS_26010 gene uraH 14916 15275 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626013.1 protein_id gnl|my_center|LOCUS_26010 15287 15805 gene locus_tag LOCUS_26020 15287 15805 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396040.1 protein_id gnl|my_center|LOCUS_26020 15814 17103 gene locus_tag LOCUS_26030 gene guaD 15814 17103 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_26030 17103 18278 gene locus_tag LOCUS_26040 17103 18278 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920461.1 protein_id gnl|my_center|LOCUS_26040 19272 18304 gene locus_tag LOCUS_26050 19272 18304 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850579.1 protein_id gnl|my_center|LOCUS_26050 19481 20752 gene locus_tag LOCUS_26060 19481 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 20785 21360 gene locus_tag LOCUS_26070 20785 21360 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209691.1 protein_id gnl|my_center|LOCUS_26070 23421 21409 gene locus_tag LOCUS_26080 23421 21409 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104461.1 protein_id gnl|my_center|LOCUS_26080 25524 23536 gene locus_tag LOCUS_26090 gene tkt 25524 23536 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244559.1 protein_id gnl|my_center|LOCUS_26090 26031 26894 gene locus_tag LOCUS_26100 26031 26894 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence051 607 20 gene locus_tag LOCUS_26110 607 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1955 576 gene locus_tag LOCUS_26120 gene hemN 1955 576 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103794.1 protein_id gnl|my_center|LOCUS_26120 2180 2842 gene locus_tag LOCUS_26130 2180 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 3200 2913 gene locus_tag LOCUS_26140 3200 2913 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370273.1 protein_id gnl|my_center|LOCUS_26140 5220 3211 gene locus_tag LOCUS_26150 5220 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 5317 5964 gene locus_tag LOCUS_26160 gene ccmA 5317 5964 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268406.1 protein_id gnl|my_center|LOCUS_26160 5961 6629 gene locus_tag LOCUS_26170 gene ccmB 5961 6629 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_26170 6635 7381 gene locus_tag LOCUS_26180 6635 7381 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083135.1 protein_id gnl|my_center|LOCUS_26180 7381 7569 gene locus_tag LOCUS_26190 gene ccmD 7381 7569 CDS product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083136.1 protein_id gnl|my_center|LOCUS_26190 7553 8014 gene locus_tag LOCUS_26200 gene ccmE 7553 8014 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_26200 8016 10010 gene locus_tag LOCUS_26210 8016 10010 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 protein_id gnl|my_center|LOCUS_26210 10007 10522 gene locus_tag LOCUS_26220 10007 10522 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457723.1 protein_id gnl|my_center|LOCUS_26220 10519 10980 gene locus_tag LOCUS_26230 10519 10980 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104639.1 protein_id gnl|my_center|LOCUS_26230 10977 12194 gene locus_tag LOCUS_26240 gene ccmI 10977 12194 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 protein_id gnl|my_center|LOCUS_26240 13272 12283 gene locus_tag LOCUS_26250 13272 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 13800 13405 gene locus_tag LOCUS_26260 13800 13405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 13966 14222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20664 14785 gene locus_tag LOCUS_26270 20664 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 21842 20667 gene locus_tag LOCUS_26280 21842 20667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 22318 21857 gene locus_tag LOCUS_26290 22318 21857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 23351 22332 gene locus_tag LOCUS_26300 23351 22332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 26403 23362 gene locus_tag LOCUS_26310 26403 23362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 <27994 27133 gene locus_tag LOCUS_26320 <27994 27133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042595882.1:DcaP family trimeric outer membrane transporter >Feature sequence052 711 1043 gene locus_tag LOCUS_26330 711 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 1178 1044 gene locus_tag LOCUS_26340 1178 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1194 1454 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1926 2175 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3604 3038 gene locus_tag LOCUS_26350 gene yeiP 3604 3038 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465079.1 protein_id gnl|my_center|LOCUS_26350 4109 4564 gene locus_tag LOCUS_26360 gene mraZ 4109 4564 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213343.1 protein_id gnl|my_center|LOCUS_26360 4561 5496 gene locus_tag LOCUS_26370 gene rsmH 4561 5496 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 protein_id gnl|my_center|LOCUS_26370 5511 5747 gene locus_tag LOCUS_26380 5511 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 5744 7468 gene locus_tag LOCUS_26390 gene ftsI 5744 7468 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_26390 7465 8961 gene locus_tag LOCUS_26400 7465 8961 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268848.1 protein_id gnl|my_center|LOCUS_26400 8951 10336 gene locus_tag LOCUS_26410 8951 10336 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103103.1 protein_id gnl|my_center|LOCUS_26410 10339 11421 gene locus_tag LOCUS_26420 gene mraY 10339 11421 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_26420 11435 12808 gene locus_tag LOCUS_26430 gene murD 11435 12808 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766566.1 protein_id gnl|my_center|LOCUS_26430 12805 13965 gene locus_tag LOCUS_26440 gene ftsW 12805 13965 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406017.1 protein_id gnl|my_center|LOCUS_26440 13962 15044 gene locus_tag LOCUS_26450 gene murG 13962 15044 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_26450 15034 16488 gene locus_tag LOCUS_26460 gene murC 15034 16488 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_26460 16485 17411 gene locus_tag LOCUS_26470 16485 17411 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268844.1 protein_id gnl|my_center|LOCUS_26470 17476 18162 gene locus_tag LOCUS_26480 17476 18162 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489880.1 protein_id gnl|my_center|LOCUS_26480 18159 19397 gene locus_tag LOCUS_26490 gene ftsA 18159 19397 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_26490 19435 20622 gene locus_tag LOCUS_26500 gene ftsZ 19435 20622 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094113.1 protein_id gnl|my_center|LOCUS_26500 20715 21623 gene locus_tag LOCUS_26510 gene lpxC 20715 21623 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_26510 22272 22538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23013 25748 gene locus_tag LOCUS_26520 gene secA 23013 25748 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112752.1 protein_id gnl|my_center|LOCUS_26520 25777 26994 gene locus_tag LOCUS_26530 gene argJ 25777 26994 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208443.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence053 <1 1249 gene locus_tag LOCUS_26540 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001157059.1:cell division protein ZipA 1329 1591 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3587 4276 gene locus_tag LOCUS_26550 3587 4276 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947139.1 protein_id gnl|my_center|LOCUS_26550 4414 6195 gene locus_tag LOCUS_26560 4414 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 6513 6244 gene locus_tag LOCUS_26570 6513 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 8003 6567 gene locus_tag LOCUS_26580 8003 6567 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_26580 9976 7997 gene locus_tag LOCUS_26590 9976 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 10980 9976 gene locus_tag LOCUS_26600 10980 9976 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 protein_id gnl|my_center|LOCUS_26600 11510 10980 gene locus_tag LOCUS_26610 11510 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 12463 11513 gene locus_tag LOCUS_26620 12463 11513 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948544.1 protein_id gnl|my_center|LOCUS_26620 13422 12463 gene locus_tag LOCUS_26630 13422 12463 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 protein_id gnl|my_center|LOCUS_26630 13604 18469 gene locus_tag LOCUS_26640 gene gdhB 13604 18469 CDS product NAD-glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103491.1 protein_id gnl|my_center|LOCUS_26640 18516 19637 gene locus_tag LOCUS_26650 18516 19637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 19637 19861 gene locus_tag LOCUS_26660 19637 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 19968 20999 gene locus_tag LOCUS_26670 19968 20999 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_26670 21303 21109 gene locus_tag LOCUS_26680 gene rmf 21303 21109 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110566.1 protein_id gnl|my_center|LOCUS_26680 21500 23620 gene locus_tag LOCUS_26690 gene rlmKL 21500 23620 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_26690 23884 25110 gene locus_tag LOCUS_26700 23884 25110 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484151.1 protein_id gnl|my_center|LOCUS_26700 25339 25121 gene locus_tag LOCUS_26710 25339 25121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 25486 26526 gene locus_tag LOCUS_26720 25486 26526 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770011.1 protein_id gnl|my_center|LOCUS_26720 26560 26928 gene locus_tag LOCUS_26730 26560 26928 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704967.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence054 <1 1132 gene locus_tag LOCUS_26740 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070720.1:AMP-binding protein 2011 1160 gene locus_tag LOCUS_26750 gene rlmJ 2011 1160 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300574.1 protein_id gnl|my_center|LOCUS_26750 2285 2100 gene locus_tag LOCUS_26760 2285 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2289 2551 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2923 3175 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3896 3393 gene locus_tag LOCUS_26770 3896 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 3924 4261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5887 5522 gene locus_tag LOCUS_26780 gene yajC 5887 5522 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_26780 6930 5977 gene locus_tag LOCUS_26790 gene tgt 6930 5977 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420264.1 protein_id gnl|my_center|LOCUS_26790 6985 7247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8475 7345 gene locus_tag LOCUS_26800 gene queA 8475 7345 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705623.1 protein_id gnl|my_center|LOCUS_26800 8578 8664 gene locus_tag LOCUS_t00310 8578 8664 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8720 8805 gene locus_tag LOCUS_t00320 8720 8805 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8845 8930 gene locus_tag LOCUS_t00330 8845 8930 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8974 9059 gene locus_tag LOCUS_t00340 8974 9059 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9069 9331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9708 9971 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13369 11420 gene locus_tag LOCUS_26810 13369 11420 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 protein_id gnl|my_center|LOCUS_26810 13738 16053 gene locus_tag LOCUS_26820 13738 16053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 16064 17416 gene locus_tag LOCUS_26830 16064 17416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 17432 17932 gene locus_tag LOCUS_26840 17432 17932 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_26840 17948 18160 gene locus_tag LOCUS_26850 17948 18160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 18163 19350 gene locus_tag LOCUS_26860 18163 19350 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926978.1 protein_id gnl|my_center|LOCUS_26860 19328 20257 gene locus_tag LOCUS_26870 19328 20257 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_26870 20341 21888 gene locus_tag LOCUS_26880 20341 21888 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_26880 22066 22917 gene locus_tag LOCUS_26890 22066 22917 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113772.1 protein_id gnl|my_center|LOCUS_26890 24081 23017 gene locus_tag LOCUS_26900 24081 23017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 25378 24212 gene locus_tag LOCUS_26910 gene choV 25378 24212 CDS product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096690.1 protein_id gnl|my_center|LOCUS_26910 26276 25380 gene locus_tag LOCUS_26920 gene choW 26276 25380 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555599.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence055 882 268 gene locus_tag LOCUS_26930 882 268 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_26930 1377 883 gene locus_tag LOCUS_26940 1377 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1696 1960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2464 2234 gene locus_tag LOCUS_26950 2464 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2566 2829 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2923 3756 gene locus_tag LOCUS_26960 2923 3756 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_26960 3863 4600 gene locus_tag LOCUS_26970 3863 4600 CDS product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099106.1 protein_id gnl|my_center|LOCUS_26970 5204 5469 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5590 5886 gene locus_tag LOCUS_26980 5590 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 5895 6683 gene locus_tag LOCUS_26990 5895 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 6680 6847 gene locus_tag LOCUS_27000 6680 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 7001 7789 gene locus_tag LOCUS_27010 7001 7789 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121370.1 protein_id gnl|my_center|LOCUS_27010 8379 7783 gene locus_tag LOCUS_27020 8379 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 8512 9579 gene locus_tag LOCUS_27030 gene selD 8512 9579 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070592.1 protein_id gnl|my_center|LOCUS_27030 9506 9565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9772 10869 gene locus_tag LOCUS_27040 gene mnmH 9772 10869 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266576.1 protein_id gnl|my_center|LOCUS_27040 10874 11737 gene locus_tag LOCUS_27050 10874 11737 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119656.1 protein_id gnl|my_center|LOCUS_27050 11743 12420 gene locus_tag LOCUS_27060 11743 12420 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103284.1 protein_id gnl|my_center|LOCUS_27060 12434 13939 gene locus_tag LOCUS_27070 gene phnE 12434 13939 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707871.1 protein_id gnl|my_center|LOCUS_27070 14075 15070 gene locus_tag LOCUS_27080 14075 15070 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705146.1 protein_id gnl|my_center|LOCUS_27080 15449 15132 gene locus_tag LOCUS_27090 15449 15132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 17033 15645 gene locus_tag LOCUS_27100 17033 15645 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_27100 17562 17023 gene locus_tag LOCUS_27110 17562 17023 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_27110 18674 17625 gene locus_tag LOCUS_27120 18674 17625 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_27120 19208 19409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19512 22610 gene locus_tag LOCUS_27130 19512 22610 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 protein_id gnl|my_center|LOCUS_27130 23282 22671 gene locus_tag LOCUS_27140 23282 22671 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378642.1 protein_id gnl|my_center|LOCUS_27140 23596 24687 gene locus_tag LOCUS_27150 23596 24687 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence056 223 969 gene locus_tag LOCUS_27160 223 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2342 963 gene locus_tag LOCUS_27170 gene ppnN 2342 963 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771604.1 protein_id gnl|my_center|LOCUS_27170 2983 2369 gene locus_tag LOCUS_27180 2983 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 3241 4542 gene locus_tag LOCUS_27190 3241 4542 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405103.1 protein_id gnl|my_center|LOCUS_27190 4553 5224 gene locus_tag LOCUS_27200 4553 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 6011 5235 gene locus_tag LOCUS_27210 6011 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 6174 6983 gene locus_tag LOCUS_27220 gene purU 6174 6983 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_27220 8401 7214 gene locus_tag LOCUS_27230 8401 7214 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_27230 8704 11775 gene locus_tag LOCUS_27240 8704 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 11825 13726 gene locus_tag LOCUS_27250 11825 13726 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_27250 13766 15127 gene locus_tag LOCUS_27260 13766 15127 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 protein_id gnl|my_center|LOCUS_27260 15732 15229 gene locus_tag LOCUS_27270 15732 15229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 16759 15773 gene locus_tag LOCUS_27280 16759 15773 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_27280 17248 16826 gene locus_tag LOCUS_27290 17248 16826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 17646 18704 gene locus_tag LOCUS_27300 gene bioB 17646 18704 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103330.1 protein_id gnl|my_center|LOCUS_27300 18753 19013 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19274 20206 gene locus_tag LOCUS_27310 19274 20206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 20436 22241 gene locus_tag LOCUS_27320 20436 22241 CDS product phenylacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_27320 22415 24211 gene locus_tag LOCUS_27330 22415 24211 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113245.1 protein_id gnl|my_center|LOCUS_27330 24307 24942 gene locus_tag LOCUS_27340 24307 24942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 25017 25604 gene locus_tag LOCUS_27350 25017 25604 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004139.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence057 921 1175 gene locus_tag LOCUS_27360 921 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1256 1801 gene locus_tag LOCUS_27370 1256 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 2390 4582 gene locus_tag LOCUS_27380 2390 4582 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_27380 4584 5561 gene locus_tag LOCUS_27390 4584 5561 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_27390 5577 7001 gene locus_tag LOCUS_27400 5577 7001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_27400 7012 8622 gene locus_tag LOCUS_27410 7012 8622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087940.1 protein_id gnl|my_center|LOCUS_27410 8733 9827 gene locus_tag LOCUS_27420 gene apbC 8733 9827 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268717.1 protein_id gnl|my_center|LOCUS_27420 10039 12081 gene locus_tag LOCUS_27430 10039 12081 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_27430 12743 12225 gene locus_tag LOCUS_27440 12743 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 15350 12909 gene locus_tag LOCUS_27450 15350 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 15897 15376 gene locus_tag LOCUS_27460 15897 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 15871 16059 gene locus_tag LOCUS_27470 15871 16059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 16100 17602 gene locus_tag LOCUS_27480 16100 17602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 17605 18567 gene locus_tag LOCUS_27490 17605 18567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 18573 22229 gene locus_tag LOCUS_27500 18573 22229 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459255.1 protein_id gnl|my_center|LOCUS_27500 22229 22645 gene locus_tag LOCUS_27510 22229 22645 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972276.1 protein_id gnl|my_center|LOCUS_27510 22611 23573 gene locus_tag LOCUS_27520 22611 23573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 24237 23593 gene locus_tag LOCUS_27530 24237 23593 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033930894.1 protein_id gnl|my_center|LOCUS_27530 <24900 24234 gene locus_tag LOCUS_27540 <24900 24234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001128510.1:cache domain-containing protein >Feature sequence058 197 572 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 769 1119 gene locus_tag LOCUS_27550 769 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1189 1422 gene locus_tag LOCUS_27560 1189 1422 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070492.1 protein_id gnl|my_center|LOCUS_27560 2180 1476 gene locus_tag LOCUS_27570 2180 1476 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113570.1 protein_id gnl|my_center|LOCUS_27570 2449 2192 gene locus_tag LOCUS_27580 2449 2192 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 protein_id gnl|my_center|LOCUS_27580 2628 3281 gene locus_tag LOCUS_27590 2628 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 3308 5971 gene locus_tag LOCUS_27600 3308 5971 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084250.1 protein_id gnl|my_center|LOCUS_27600 6290 6009 gene locus_tag LOCUS_27610 6290 6009 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087375.1 protein_id gnl|my_center|LOCUS_27610 7120 6362 gene locus_tag LOCUS_27620 7120 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27620 7067 7279 gene locus_tag LOCUS_27630 7067 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 7360 7615 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7618 7899 gene locus_tag LOCUS_27640 7618 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 7909 8346 gene locus_tag LOCUS_27650 7909 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 8371 8514 gene locus_tag LOCUS_27660 8371 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 9051 10937 gene locus_tag LOCUS_27670 9051 10937 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 protein_id gnl|my_center|LOCUS_27670 11476 11102 gene locus_tag LOCUS_27680 11476 11102 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 protein_id gnl|my_center|LOCUS_27680 12723 11491 gene locus_tag LOCUS_27690 12723 11491 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619903.1 protein_id gnl|my_center|LOCUS_27690 13535 12846 gene locus_tag LOCUS_27700 gene urtE 13535 12846 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083792.1 protein_id gnl|my_center|LOCUS_27700 14321 13557 gene locus_tag LOCUS_27710 gene urtD 14321 13557 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083791.1 protein_id gnl|my_center|LOCUS_27710 15492 14305 gene locus_tag LOCUS_27720 gene urtC 15492 14305 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083790.1 protein_id gnl|my_center|LOCUS_27720 16428 15502 gene locus_tag LOCUS_27730 gene urtB 16428 15502 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083789.1 protein_id gnl|my_center|LOCUS_27730 17739 16486 gene locus_tag LOCUS_27740 gene urtA 17739 16486 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965210.1 protein_id gnl|my_center|LOCUS_27740 18042 21464 gene locus_tag LOCUS_27750 18042 21464 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 protein_id gnl|my_center|LOCUS_27750 21451 22362 gene locus_tag LOCUS_27760 21451 22362 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532938.1 protein_id gnl|my_center|LOCUS_27760 23115 22534 gene locus_tag LOCUS_27770 23115 22534 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 protein_id gnl|my_center|LOCUS_27770 23272 23883 gene locus_tag LOCUS_27780 23272 23883 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071742.1 protein_id gnl|my_center|LOCUS_27780 23941 24549 gene locus_tag LOCUS_27790 23941 24549 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence059 <1 967 gene locus_tag LOCUS_27800 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104132.1:beta-ketoacyl-ACP synthase II 957 1808 gene locus_tag LOCUS_27810 gene pabC 957 1808 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072564.1 protein_id gnl|my_center|LOCUS_27810 1805 2845 gene locus_tag LOCUS_27820 gene mltG 1805 2845 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_27820 2861 3523 gene locus_tag LOCUS_27830 gene tmk 2861 3523 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_27830 3534 4535 gene locus_tag LOCUS_27840 3534 4535 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104126.1 protein_id gnl|my_center|LOCUS_27840 4532 4882 gene locus_tag LOCUS_27850 4532 4882 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_27850 6099 4960 gene locus_tag LOCUS_27860 6099 4960 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_27860 6244 9141 gene locus_tag LOCUS_27870 6244 9141 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_27870 9274 10110 gene locus_tag LOCUS_27880 9274 10110 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_27880 10110 11507 gene locus_tag LOCUS_27890 10110 11507 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_27890 11880 12132 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12228 12635 gene locus_tag LOCUS_27900 12228 12635 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_27900 12635 13255 gene locus_tag LOCUS_27910 12635 13255 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071948.1 protein_id gnl|my_center|LOCUS_27910 13255 14535 gene locus_tag LOCUS_27920 13255 14535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_27920 15423 14611 gene locus_tag LOCUS_27930 gene xthA 15423 14611 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706756.1 protein_id gnl|my_center|LOCUS_27930 16113 16502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16617 18200 gene locus_tag LOCUS_27940 16617 18200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 17094 17165 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19847 18330 gene locus_tag LOCUS_27950 gene thiI 19847 18330 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096011.1 protein_id gnl|my_center|LOCUS_27950 20095 20841 gene locus_tag LOCUS_27960 gene phbB 20095 20841 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946156.1 protein_id gnl|my_center|LOCUS_27960 22139 20904 gene locus_tag LOCUS_27970 22139 20904 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947587.1 protein_id gnl|my_center|LOCUS_27970 22404 22571 gene locus_tag LOCUS_27980 22404 22571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 22790 23089 gene locus_tag LOCUS_27990 22790 23089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence060 <1 541 gene locus_tag LOCUS_28000 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091201.1:type I DNA topoisomerase 649 942 gene locus_tag LOCUS_28010 649 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 1040 1297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1678 1866 gene locus_tag LOCUS_28020 1678 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 2212 1949 gene locus_tag LOCUS_28030 2212 1949 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_28030 2749 2312 gene locus_tag LOCUS_28040 2749 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2831 3093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4001 3714 gene locus_tag LOCUS_28050 4001 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 5171 4149 gene locus_tag LOCUS_28060 5171 4149 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_28060 5738 6002 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6862 6473 gene locus_tag LOCUS_28070 6862 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 7236 7970 gene locus_tag LOCUS_28080 7236 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 8270 9319 gene locus_tag LOCUS_28090 8270 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 9557 9808 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12504 10339 gene locus_tag LOCUS_28100 12504 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 13746 12733 gene locus_tag LOCUS_28110 13746 12733 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_28110 14212 13853 gene locus_tag LOCUS_28120 14212 13853 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087752.1 protein_id gnl|my_center|LOCUS_28120 15348 14518 gene locus_tag LOCUS_28130 gene lepB 15348 14518 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101969.1 protein_id gnl|my_center|LOCUS_28130 15452 16516 gene locus_tag LOCUS_28140 15452 16516 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_28140 17404 16520 gene locus_tag LOCUS_28150 17404 16520 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407991.1 protein_id gnl|my_center|LOCUS_28150 17527 18270 gene locus_tag LOCUS_28160 17527 18270 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185732.1 protein_id gnl|my_center|LOCUS_28160 18522 19106 gene locus_tag LOCUS_28170 18522 19106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 20435 19107 gene locus_tag LOCUS_28180 20435 19107 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210164.1 protein_id gnl|my_center|LOCUS_28180 21949 20435 gene locus_tag LOCUS_28190 21949 20435 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091265.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence061 582 841 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1677 1213 gene locus_tag LOCUS_28200 1677 1213 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070873.1 protein_id gnl|my_center|LOCUS_28200 2067 1696 gene locus_tag LOCUS_28210 2067 1696 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017131138.1 protein_id gnl|my_center|LOCUS_28210 2262 3542 gene locus_tag LOCUS_28220 2262 3542 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_28220 3586 4500 gene locus_tag LOCUS_28230 3586 4500 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 protein_id gnl|my_center|LOCUS_28230 4827 4618 gene locus_tag LOCUS_28240 4827 4618 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115279.1 protein_id gnl|my_center|LOCUS_28240 6012 5059 gene locus_tag LOCUS_28250 6012 5059 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 protein_id gnl|my_center|LOCUS_28250 6528 6082 gene locus_tag LOCUS_28260 6528 6082 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 protein_id gnl|my_center|LOCUS_28260 6658 7557 gene locus_tag LOCUS_28270 6658 7557 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_28270 9655 7622 gene locus_tag LOCUS_28280 9655 7622 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971472.1 protein_id gnl|my_center|LOCUS_28280 10874 9927 gene locus_tag LOCUS_28290 10874 9927 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_28290 11129 11374 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12026 12817 gene locus_tag LOCUS_28300 12026 12817 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976335.1 protein_id gnl|my_center|LOCUS_28300 13443 13792 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13990 14658 gene locus_tag LOCUS_28310 13990 14658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 15022 14768 gene locus_tag LOCUS_28320 15022 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 15442 15122 gene locus_tag LOCUS_28330 15442 15122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 16036 15680 gene locus_tag LOCUS_28340 16036 15680 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642310.1 protein_id gnl|my_center|LOCUS_28340 18261 16048 gene locus_tag LOCUS_28350 18261 16048 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_28350 19002 18448 gene locus_tag LOCUS_28360 19002 18448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 19416 19063 gene locus_tag LOCUS_28370 19416 19063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 20364 19453 gene locus_tag LOCUS_28380 20364 19453 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 protein_id gnl|my_center|LOCUS_28380 22202 20361 gene locus_tag LOCUS_28390 22202 20361 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 protein_id gnl|my_center|LOCUS_28390 22474 23157 gene locus_tag LOCUS_28400 22474 23157 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence062 <1 676 gene locus_tag LOCUS_28410 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014070847.1:site-specific integrase 676 933 gene locus_tag LOCUS_28420 676 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 1068 1592 gene locus_tag LOCUS_28430 1068 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 2198 1866 gene locus_tag LOCUS_28440 2198 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 2748 2227 gene locus_tag LOCUS_28450 2748 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087175.1 protein_id gnl|my_center|LOCUS_28450 3289 2759 gene locus_tag LOCUS_28460 3289 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 3185 3403 gene locus_tag LOCUS_28470 3185 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 6549 3442 gene locus_tag LOCUS_28480 6549 3442 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_28480 7802 6564 gene locus_tag LOCUS_28490 7802 6564 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920247.1 protein_id gnl|my_center|LOCUS_28490 9086 7812 gene locus_tag LOCUS_28500 9086 7812 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 protein_id gnl|my_center|LOCUS_28500 10053 9097 gene locus_tag LOCUS_28510 10053 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 10433 10050 gene locus_tag LOCUS_28520 10433 10050 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895085.1 protein_id gnl|my_center|LOCUS_28520 10530 11837 gene locus_tag LOCUS_28530 10530 11837 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970462.1 protein_id gnl|my_center|LOCUS_28530 12300 11998 gene locus_tag LOCUS_28540 12300 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 12823 12593 gene locus_tag LOCUS_28550 12823 12593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 13026 13526 gene locus_tag LOCUS_28560 13026 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 13516 13908 gene locus_tag LOCUS_28570 13516 13908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 13955 14317 gene locus_tag LOCUS_28580 13955 14317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 19073 16893 gene locus_tag LOCUS_28590 19073 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 19309 20316 gene locus_tag LOCUS_28600 19309 20316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 20300 21130 gene locus_tag LOCUS_28610 20300 21130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 21639 21415 gene locus_tag LOCUS_28620 21639 21415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence063 479 2218 gene locus_tag LOCUS_28630 479 2218 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_28630 3124 2255 gene locus_tag LOCUS_28640 3124 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 4253 3285 gene locus_tag LOCUS_28650 4253 3285 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033424.1 protein_id gnl|my_center|LOCUS_28650 4971 4471 gene locus_tag LOCUS_28660 4971 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 5919 5050 gene locus_tag LOCUS_28670 5919 5050 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_28670 6075 6479 gene locus_tag LOCUS_28680 6075 6479 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365982.1 protein_id gnl|my_center|LOCUS_28680 7094 6564 gene locus_tag LOCUS_28690 7094 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 9142 7148 gene locus_tag LOCUS_28700 9142 7148 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963667.1 protein_id gnl|my_center|LOCUS_28700 9983 10192 gene locus_tag LOCUS_28710 9983 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 11939 10287 gene locus_tag LOCUS_28720 gene ubiB 11939 10287 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095885.1 protein_id gnl|my_center|LOCUS_28720 12645 11947 gene locus_tag LOCUS_28730 12645 11947 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_28730 13394 12645 gene locus_tag LOCUS_28740 gene ubiE 13394 12645 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378884.1 protein_id gnl|my_center|LOCUS_28740 13587 14345 gene locus_tag LOCUS_28750 13587 14345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 14496 14753 gene locus_tag LOCUS_28760 14496 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550164.1 protein_id gnl|my_center|LOCUS_28760 15723 14860 gene locus_tag LOCUS_28770 15723 14860 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115024.1 protein_id gnl|my_center|LOCUS_28770 17083 15734 gene locus_tag LOCUS_28780 17083 15734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 20323 17084 gene locus_tag LOCUS_28790 20323 17084 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208107.1 protein_id gnl|my_center|LOCUS_28790 20811 20392 gene locus_tag LOCUS_28800 20811 20392 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037789.1 protein_id gnl|my_center|LOCUS_28800 20981 21580 gene locus_tag LOCUS_28810 20981 21580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 <22908 21648 gene locus_tag LOCUS_28820 <22908 21648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112038.1:ethanolamine permease >Feature sequence064 1053 250 gene locus_tag LOCUS_28830 gene pstB 1053 250 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 protein_id gnl|my_center|LOCUS_28830 2375 1095 gene locus_tag LOCUS_28840 gene pstA 2375 1095 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_28840 3741 2368 gene locus_tag LOCUS_28850 gene pstC 3741 2368 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_28850 4874 3831 gene locus_tag LOCUS_28860 4874 3831 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_28860 5108 5650 gene locus_tag LOCUS_28870 5108 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 5643 7019 gene locus_tag LOCUS_28880 5643 7019 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_28880 7115 7558 gene locus_tag LOCUS_28890 gene yciA 7115 7558 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210317.1 protein_id gnl|my_center|LOCUS_28890 7891 7604 gene locus_tag LOCUS_28900 7891 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 7907 8158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8194 8643 gene locus_tag LOCUS_28910 8194 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 10227 9265 gene locus_tag LOCUS_28920 gene egtD 10227 9265 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967207.1 protein_id gnl|my_center|LOCUS_28920 11362 10274 gene locus_tag LOCUS_28930 gene egtB 11362 10274 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967201.1 protein_id gnl|my_center|LOCUS_28930 12343 11513 gene locus_tag LOCUS_28940 gene znuA 12343 11513 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455470.1 protein_id gnl|my_center|LOCUS_28940 12405 12881 gene locus_tag LOCUS_28950 12405 12881 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_28950 12878 13663 gene locus_tag LOCUS_28960 gene znuC 12878 13663 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169189.1 protein_id gnl|my_center|LOCUS_28960 13660 14472 gene locus_tag LOCUS_28970 gene znuB 13660 14472 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_28970 15475 14822 gene locus_tag LOCUS_28980 gene yihA 15475 14822 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456829.1 protein_id gnl|my_center|LOCUS_28980 15617 15916 gene locus_tag LOCUS_28990 gene scyA 15617 15916 CDS product monoheme cytochrome c5 ScyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070638.1 protein_id gnl|my_center|LOCUS_28990 15962 16567 gene locus_tag LOCUS_29000 15962 16567 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_29000 16723 17364 gene locus_tag LOCUS_29010 16723 17364 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403888.1 protein_id gnl|my_center|LOCUS_29010 17366 18154 gene locus_tag LOCUS_29020 17366 18154 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_29020 18269 19927 gene locus_tag LOCUS_29030 18269 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 20036 20842 gene locus_tag LOCUS_29040 20036 20842 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269443.1 protein_id gnl|my_center|LOCUS_29040 20846 22660 gene locus_tag LOCUS_29050 gene glmS 20846 22660 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074325.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence065 1699 122 gene locus_tag LOCUS_29060 1699 122 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_29060 5163 1630 gene locus_tag LOCUS_29070 5163 1630 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_29070 1824 2086 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6362 5160 gene locus_tag LOCUS_29080 6362 5160 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_29080 7783 6359 gene locus_tag LOCUS_29090 7783 6359 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927472.1 protein_id gnl|my_center|LOCUS_29090 9207 7915 gene locus_tag LOCUS_29100 9207 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_29100 10030 9227 gene locus_tag LOCUS_29110 10030 9227 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_29110 12345 10027 gene locus_tag LOCUS_29120 12345 10027 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_29120 13401 12430 gene locus_tag LOCUS_29130 13401 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 14038 13550 gene locus_tag LOCUS_29140 14038 13550 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707397.1 protein_id gnl|my_center|LOCUS_29140 14723 14160 gene locus_tag LOCUS_29150 14723 14160 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_29150 14942 16069 gene locus_tag LOCUS_29160 gene dapE 14942 16069 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082377.1 protein_id gnl|my_center|LOCUS_29160 16080 16925 gene locus_tag LOCUS_29170 16080 16925 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207834.1 protein_id gnl|my_center|LOCUS_29170 17053 17760 gene locus_tag LOCUS_29180 17053 17760 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120055.1 protein_id gnl|my_center|LOCUS_29180 17757 18194 gene locus_tag LOCUS_29190 17757 18194 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948332.1 protein_id gnl|my_center|LOCUS_29190 18194 18976 gene locus_tag LOCUS_29200 18194 18976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 19161 22103 gene locus_tag LOCUS_29210 19161 22103 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416450.1 protein_id gnl|my_center|LOCUS_29210 >Feature sequence066 1006 311 gene locus_tag LOCUS_29220 1006 311 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113205.1 protein_id gnl|my_center|LOCUS_29220 1684 1010 gene locus_tag LOCUS_29230 gene rpe 1684 1010 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174695.1 protein_id gnl|my_center|LOCUS_29230 1838 3199 gene locus_tag LOCUS_29240 1838 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 3281 3880 gene locus_tag LOCUS_29250 3281 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 3918 4655 gene locus_tag LOCUS_29260 3918 4655 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147199.1 protein_id gnl|my_center|LOCUS_29260 5604 4729 gene locus_tag LOCUS_29270 gene ampE 5604 4729 CDS product regulatory signaling modulator protein AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103363.1 protein_id gnl|my_center|LOCUS_29270 6171 5614 gene locus_tag LOCUS_29280 gene ampD 6171 5614 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 protein_id gnl|my_center|LOCUS_29280 6302 7684 gene locus_tag LOCUS_29290 6302 7684 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_29290 7659 8519 gene locus_tag LOCUS_29300 gene nadC 7659 8519 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_29300 8780 9280 gene locus_tag LOCUS_29310 8780 9280 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_29310 10800 12539 gene locus_tag LOCUS_29320 gene pilB 10800 12539 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_29320 12588 13814 gene locus_tag LOCUS_29330 12588 13814 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 protein_id gnl|my_center|LOCUS_29330 13814 14692 gene locus_tag LOCUS_29340 13814 14692 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 protein_id gnl|my_center|LOCUS_29340 14709 15308 gene locus_tag LOCUS_29350 gene coaE 14709 15308 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115011.1 protein_id gnl|my_center|LOCUS_29350 15363 15563 gene locus_tag LOCUS_29360 gene yacG 15363 15563 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094656.1 protein_id gnl|my_center|LOCUS_29360 16576 15620 gene locus_tag LOCUS_29370 16576 15620 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922686.1 protein_id gnl|my_center|LOCUS_29370 17131 16595 gene locus_tag LOCUS_29380 17131 16595 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056565.1 protein_id gnl|my_center|LOCUS_29380 17282 18970 gene locus_tag LOCUS_29390 17282 18970 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_29390 19549 19124 gene locus_tag LOCUS_29400 19549 19124 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707377.1 protein_id gnl|my_center|LOCUS_29400 20740 19634 gene locus_tag LOCUS_29410 20740 19634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 20797 21065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence067 86 1279 gene locus_tag LOCUS_29420 86 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 1335 2414 gene locus_tag LOCUS_29430 1335 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 2415 5471 gene locus_tag LOCUS_29440 2415 5471 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_29440 5473 5793 gene locus_tag LOCUS_29450 5473 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 7120 5777 gene locus_tag LOCUS_29460 gene carS 7120 5777 CDS product two-component system sensor histidine kinase CarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_29460 7800 7120 gene locus_tag LOCUS_29470 7800 7120 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074115.1 protein_id gnl|my_center|LOCUS_29470 9375 7858 gene locus_tag LOCUS_29480 9375 7858 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055873.1 protein_id gnl|my_center|LOCUS_29480 9511 10179 gene locus_tag LOCUS_29490 9511 10179 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529074.1 protein_id gnl|my_center|LOCUS_29490 11215 10220 gene locus_tag LOCUS_29500 11215 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 12729 13499 gene locus_tag LOCUS_29510 12729 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 13606 14028 gene locus_tag LOCUS_29520 13606 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 14466 14960 gene locus_tag LOCUS_29530 14466 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 15147 15584 gene locus_tag LOCUS_29540 15147 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 16086 15619 gene locus_tag LOCUS_29550 16086 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 16339 16713 gene locus_tag LOCUS_29560 16339 16713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 16822 17385 gene locus_tag LOCUS_29570 16822 17385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 17607 17812 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17904 18509 gene locus_tag LOCUS_29580 17904 18509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 18556 19008 gene locus_tag LOCUS_29590 18556 19008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 19051 19410 gene locus_tag LOCUS_29600 19051 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 19496 19882 gene locus_tag LOCUS_29610 19496 19882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 20730 20002 gene locus_tag LOCUS_29620 20730 20002 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269309.1 protein_id gnl|my_center|LOCUS_29620 20877 21755 gene locus_tag LOCUS_29630 20877 21755 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464972.1 protein_id gnl|my_center|LOCUS_29630 >Feature sequence068 <1 656 gene locus_tag LOCUS_29640 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001154025.1:tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM 660 1190 gene locus_tag LOCUS_29650 660 1190 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816335.1 protein_id gnl|my_center|LOCUS_29650 1299 1637 gene locus_tag LOCUS_29660 1299 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 1972 2327 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2514 2425 gene locus_tag LOCUS_t00350 2514 2425 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2789 2583 gene locus_tag LOCUS_29670 gene csrA 2789 2583 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085981.1 protein_id gnl|my_center|LOCUS_29670 4216 2984 gene locus_tag LOCUS_29680 4216 2984 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369901.1 protein_id gnl|my_center|LOCUS_29680 7070 4440 gene locus_tag LOCUS_29690 gene alaS 7070 4440 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_29690 7358 7561 gene locus_tag LOCUS_29700 7358 7561 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_29700 7670 8635 gene locus_tag LOCUS_29710 7670 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 8660 8890 gene locus_tag LOCUS_29720 8660 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 9008 10291 gene locus_tag LOCUS_29730 9008 10291 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706404.1 protein_id gnl|my_center|LOCUS_29730 11312 10296 gene locus_tag LOCUS_29740 11312 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 11994 11506 gene locus_tag LOCUS_29750 gene recX 11994 11506 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406202.1 protein_id gnl|my_center|LOCUS_29750 13012 11975 gene locus_tag LOCUS_29760 gene recA 13012 11975 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092260.1 protein_id gnl|my_center|LOCUS_29760 13629 13144 gene locus_tag LOCUS_29770 13629 13144 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 protein_id gnl|my_center|LOCUS_29770 13704 16325 gene locus_tag LOCUS_29780 gene mutS 13704 16325 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_29780 16545 16868 gene locus_tag LOCUS_29790 16545 16868 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_29790 17081 16956 gene locus_tag LOCUS_29800 17081 16956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29800 17290 17060 gene locus_tag LOCUS_29810 17290 17060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 17943 17404 gene locus_tag LOCUS_29820 17943 17404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29820 18791 18021 gene locus_tag LOCUS_29830 18791 18021 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 protein_id gnl|my_center|LOCUS_29830 19943 19047 gene locus_tag LOCUS_29840 19943 19047 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_29840 20672 20010 gene locus_tag LOCUS_29850 20672 20010 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766015.1 protein_id gnl|my_center|LOCUS_29850 20868 20686 gene locus_tag LOCUS_29860 20868 20686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 20885 21143 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence069 2770 1478 gene locus_tag LOCUS_29870 2770 1478 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_29870 3297 2767 gene locus_tag LOCUS_29880 3297 2767 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_29880 4443 3370 gene locus_tag LOCUS_29890 4443 3370 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918468.1 protein_id gnl|my_center|LOCUS_29890 4982 5182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8648 6300 gene locus_tag LOCUS_29900 8648 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 8864 9559 gene locus_tag LOCUS_29910 8864 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 9592 10122 gene locus_tag LOCUS_29920 9592 10122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 10119 11054 gene locus_tag LOCUS_29930 10119 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 11867 11223 gene locus_tag LOCUS_29940 11867 11223 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_29940 13601 11868 gene locus_tag LOCUS_29950 13601 11868 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 protein_id gnl|my_center|LOCUS_29950 13827 14489 gene locus_tag LOCUS_29960 13827 14489 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_29960 14482 15075 gene locus_tag LOCUS_29970 14482 15075 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817446.1 protein_id gnl|my_center|LOCUS_29970 15159 15527 gene locus_tag LOCUS_29980 15159 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 15748 16443 gene locus_tag LOCUS_29990 15748 16443 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337653.1 protein_id gnl|my_center|LOCUS_29990 17631 16456 gene locus_tag LOCUS_30000 17631 16456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071851.1 protein_id gnl|my_center|LOCUS_30000 18592 17624 gene locus_tag LOCUS_30010 18592 17624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071850.1 protein_id gnl|my_center|LOCUS_30010 19560 18589 gene locus_tag LOCUS_30020 19560 18589 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071849.1 protein_id gnl|my_center|LOCUS_30020 20330 19557 gene locus_tag LOCUS_30030 20330 19557 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175326.1 protein_id gnl|my_center|LOCUS_30030 20678 21145 gene locus_tag LOCUS_30040 20678 21145 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479613.1 protein_id gnl|my_center|LOCUS_30040 21155 21571 gene locus_tag LOCUS_30050 21155 21571 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706242.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence070 5096 7654 gene locus_tag LOCUS_30060 gene quiP 5096 7654 CDS product acyl-homoserine-lactone acylase QuiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112526.1 protein_id gnl|my_center|LOCUS_30060 7729 8442 gene locus_tag LOCUS_30070 7729 8442 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707726.1 protein_id gnl|my_center|LOCUS_30070 8834 8424 gene locus_tag LOCUS_30080 8834 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 8967 9869 gene locus_tag LOCUS_30090 8967 9869 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454987.1 protein_id gnl|my_center|LOCUS_30090 9316 9404 gene locus_tag LOCUS_t00360 9316 9404 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9987 11699 gene locus_tag LOCUS_30100 gene recJ 9987 11699 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_30100 11722 12162 gene locus_tag LOCUS_30110 11722 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 12755 12174 gene locus_tag LOCUS_30120 12755 12174 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_30120 16023 12910 gene locus_tag LOCUS_30130 16023 12910 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706711.1 protein_id gnl|my_center|LOCUS_30130 17169 16039 gene locus_tag LOCUS_30140 17169 16039 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 protein_id gnl|my_center|LOCUS_30140 17743 18597 gene locus_tag LOCUS_30150 17743 18597 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_30150 18698 19204 gene locus_tag LOCUS_30160 18698 19204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 19209 21059 gene locus_tag LOCUS_30170 19209 21059 CDS product TIGR03545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957002.1 protein_id gnl|my_center|LOCUS_30170 21072 21389 gene locus_tag LOCUS_30180 21072 21389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 >Feature sequence071 622 1749 gene locus_tag LOCUS_30190 622 1749 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_30190 2080 2484 gene locus_tag LOCUS_30200 2080 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 2989 2501 gene locus_tag LOCUS_30210 2989 2501 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884720.1 protein_id gnl|my_center|LOCUS_30210 3164 4159 gene locus_tag LOCUS_30220 3164 4159 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209270.1 protein_id gnl|my_center|LOCUS_30220 4163 5041 gene locus_tag LOCUS_30230 4163 5041 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175357.1 protein_id gnl|my_center|LOCUS_30230 5183 6775 gene locus_tag LOCUS_30240 5183 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 7163 6792 gene locus_tag LOCUS_30250 7163 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 7894 7574 gene locus_tag LOCUS_30260 7894 7574 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262420.1 protein_id gnl|my_center|LOCUS_30260 8184 7924 gene locus_tag LOCUS_30270 8184 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 8780 8199 gene locus_tag LOCUS_30280 8780 8199 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118864.1 protein_id gnl|my_center|LOCUS_30280 10618 8777 gene locus_tag LOCUS_30290 10618 8777 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_30290 11526 10624 gene locus_tag LOCUS_30300 11526 10624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 12985 11582 gene locus_tag LOCUS_30310 gene norB 12985 11582 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_30310 13476 13030 gene locus_tag LOCUS_30320 gene norC 13476 13030 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_30320 14324 13512 gene locus_tag LOCUS_30330 gene nirQ 14324 13512 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_30330 14707 16770 gene locus_tag LOCUS_30340 14707 16770 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966626.1 protein_id gnl|my_center|LOCUS_30340 16818 18521 gene locus_tag LOCUS_30350 gene nirS 16818 18521 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_30350 19004 18552 gene locus_tag LOCUS_30360 19004 18552 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524104.1 protein_id gnl|my_center|LOCUS_30360 19115 19672 gene locus_tag LOCUS_30370 19115 19672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 >Feature sequence072 612 253 gene locus_tag LOCUS_30380 612 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 820 1344 gene locus_tag LOCUS_30390 820 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 1387 2058 gene locus_tag LOCUS_30400 1387 2058 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112481.1 protein_id gnl|my_center|LOCUS_30400 2285 3769 gene locus_tag LOCUS_30410 gene trpE 2285 3769 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 protein_id gnl|my_center|LOCUS_30410 3819 4406 gene locus_tag LOCUS_30420 3819 4406 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_30420 4439 5485 gene locus_tag LOCUS_30430 gene trpD 4439 5485 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316297.1 protein_id gnl|my_center|LOCUS_30430 5489 6289 gene locus_tag LOCUS_30440 gene trpC 5489 6289 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_30440 7917 6370 gene locus_tag LOCUS_30450 7917 6370 CDS product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362852.1 protein_id gnl|my_center|LOCUS_30450 8648 8010 gene locus_tag LOCUS_30460 gene crp 8648 8010 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_30460 8833 9255 gene locus_tag LOCUS_30470 8833 9255 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_30470 9294 10085 gene locus_tag LOCUS_30480 gene speD 9294 10085 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101641.1 protein_id gnl|my_center|LOCUS_30480 10096 11262 gene locus_tag LOCUS_30490 10096 11262 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532243.1 protein_id gnl|my_center|LOCUS_30490 13704 11611 gene locus_tag LOCUS_30500 13704 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 13846 13727 gene locus_tag LOCUS_30510 13846 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 13961 14224 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14362 14838 gene locus_tag LOCUS_30520 14362 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 15848 14919 gene locus_tag LOCUS_30530 15848 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 16041 16505 gene locus_tag LOCUS_30540 16041 16505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 17118 16594 gene locus_tag LOCUS_30550 gene ppa 17118 16594 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093248.1 protein_id gnl|my_center|LOCUS_30550 17365 19722 gene locus_tag LOCUS_30560 17365 19722 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_30560 19722 20633 gene locus_tag LOCUS_30570 19722 20633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence073 384 184 gene locus_tag LOCUS_30580 384 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 513 558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1235 621 gene locus_tag LOCUS_30590 gene msrQ 1235 621 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036769.1 protein_id gnl|my_center|LOCUS_30590 2246 1251 gene locus_tag LOCUS_30600 gene msrP 2246 1251 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113450.1 protein_id gnl|my_center|LOCUS_30600 3160 2357 gene locus_tag LOCUS_30610 gene pssA 3160 2357 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_30610 4071 3196 gene locus_tag LOCUS_30620 gene ilvY 4071 3196 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_30620 4214 5701 gene locus_tag LOCUS_30630 gene ilvC 4214 5701 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 protein_id gnl|my_center|LOCUS_30630 6519 5785 gene locus_tag LOCUS_30640 6519 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 7178 6606 gene locus_tag LOCUS_30650 7178 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 8032 7241 gene locus_tag LOCUS_30660 8032 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 8290 8862 gene locus_tag LOCUS_30670 8290 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 8874 10553 gene locus_tag LOCUS_30680 8874 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 10550 12307 gene locus_tag LOCUS_30690 10550 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 12163 12241 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12249 13589 gene locus_tag LOCUS_30700 12249 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 13576 14304 gene locus_tag LOCUS_30710 13576 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 14308 14589 gene locus_tag LOCUS_30720 14308 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 14591 15280 gene locus_tag LOCUS_30730 14591 15280 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120828.1 protein_id gnl|my_center|LOCUS_30730 15280 15768 gene locus_tag LOCUS_30740 15280 15768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 15774 16277 gene locus_tag LOCUS_30750 15774 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 16279 17199 gene locus_tag LOCUS_30760 16279 17199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 19052 19375 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence074 1311 1573 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1613 2092 gene locus_tag LOCUS_30770 1613 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 2089 2781 gene locus_tag LOCUS_30780 2089 2781 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704884.1 protein_id gnl|my_center|LOCUS_30780 2778 3602 gene locus_tag LOCUS_30790 gene djlA 2778 3602 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220839.1 protein_id gnl|my_center|LOCUS_30790 3860 3615 gene locus_tag LOCUS_30800 3860 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 4304 3870 gene locus_tag LOCUS_30810 gene arfB 4304 3870 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_30810 5049 4396 gene locus_tag LOCUS_30820 5049 4396 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_30820 5156 5437 gene locus_tag LOCUS_30830 5156 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 6959 5478 gene locus_tag LOCUS_30840 6959 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 7189 9264 gene locus_tag LOCUS_30850 7189 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 9448 10218 gene locus_tag LOCUS_30860 9448 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 10276 11121 gene locus_tag LOCUS_30870 10276 11121 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275266.1 protein_id gnl|my_center|LOCUS_30870 11134 13041 gene locus_tag LOCUS_30880 gene xcpQ 11134 13041 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_30880 13696 13109 gene locus_tag LOCUS_30890 gene yceF 13696 13109 CDS product 7-methyl-GTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125202.1 protein_id gnl|my_center|LOCUS_30890 14356 13775 gene locus_tag LOCUS_30900 gene sodB 14356 13775 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485383.1 protein_id gnl|my_center|LOCUS_30900 14668 15486 gene locus_tag LOCUS_30910 14668 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 15486 16358 gene locus_tag LOCUS_30920 15486 16358 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093969.1 protein_id gnl|my_center|LOCUS_30920 16765 16355 gene locus_tag LOCUS_30930 16765 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 17274 16783 gene locus_tag LOCUS_30940 17274 16783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 17468 18169 gene locus_tag LOCUS_30950 17468 18169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 18260 19768 gene locus_tag LOCUS_30960 18260 19768 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 protein_id gnl|my_center|LOCUS_30960 >Feature sequence075 936 505 gene locus_tag LOCUS_30970 936 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 3425 1008 gene locus_tag LOCUS_30980 gene gyrB 3425 1008 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340175.1 protein_id gnl|my_center|LOCUS_30980 3792 4058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4499 4669 gene locus_tag LOCUS_30990 4499 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 5250 4858 gene locus_tag LOCUS_31000 5250 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 5272 5531 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7674 6259 gene locus_tag LOCUS_31010 gene dnaA 7674 6259 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401422.1 protein_id gnl|my_center|LOCUS_31010 8271 8405 gene locus_tag LOCUS_31020 gene rpmH 8271 8405 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539760.1 protein_id gnl|my_center|LOCUS_31020 8438 8842 gene locus_tag LOCUS_31030 gene rnpA 8438 8842 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161101.1 protein_id gnl|my_center|LOCUS_31030 9023 8769 gene locus_tag LOCUS_31040 9023 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 9089 10741 gene locus_tag LOCUS_31050 gene yidC 9089 10741 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114648.1 protein_id gnl|my_center|LOCUS_31050 10961 12355 gene locus_tag LOCUS_31060 gene mnmE 10961 12355 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019075.1 protein_id gnl|my_center|LOCUS_31060 13331 12480 gene locus_tag LOCUS_31070 13331 12480 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_31070 14213 13545 gene locus_tag LOCUS_31080 14213 13545 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_31080 14431 15261 gene locus_tag LOCUS_31090 14431 15261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 15642 17540 gene locus_tag LOCUS_31100 gene mnmG 15642 17540 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993407.1 protein_id gnl|my_center|LOCUS_31100 >Feature sequence076 <1 1063 gene locus_tag LOCUS_31110 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113922.1:cyclic-di-GMP receptor FimW 1181 3280 gene locus_tag LOCUS_31120 gene fimX 1181 3280 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_31120 4542 3355 gene locus_tag LOCUS_31130 gene serB 4542 3355 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380690.1 protein_id gnl|my_center|LOCUS_31130 4830 4603 gene locus_tag LOCUS_31140 4830 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 5034 6296 gene locus_tag LOCUS_31150 5034 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 6406 7530 gene locus_tag LOCUS_31160 6406 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 7542 7970 gene locus_tag LOCUS_31170 7542 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 8643 8059 gene locus_tag LOCUS_31180 8643 8059 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092435.1 protein_id gnl|my_center|LOCUS_31180 11477 8640 gene locus_tag LOCUS_31190 gene uvrA 11477 8640 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_31190 12485 11805 gene locus_tag LOCUS_31200 12485 11805 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707638.1 protein_id gnl|my_center|LOCUS_31200 12765 14171 gene locus_tag LOCUS_31210 12765 14171 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768949.1 protein_id gnl|my_center|LOCUS_31210 14155 14811 gene locus_tag LOCUS_31220 14155 14811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 14957 16174 gene locus_tag LOCUS_31230 14957 16174 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815728.1 protein_id gnl|my_center|LOCUS_31230 16171 17685 gene locus_tag LOCUS_31240 16171 17685 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815729.1 protein_id gnl|my_center|LOCUS_31240 17678 19678 gene locus_tag LOCUS_31250 17678 19678 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815730.1 protein_id gnl|my_center|LOCUS_31250 19681 20091 gene locus_tag LOCUS_31260 19681 20091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815731.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence077 1048 185 gene locus_tag LOCUS_31270 1048 185 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403997.1 protein_id gnl|my_center|LOCUS_31270 1150 1866 gene locus_tag LOCUS_31280 gene rph 1150 1866 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096595.1 protein_id gnl|my_center|LOCUS_31280 2682 1909 gene locus_tag LOCUS_31290 2682 1909 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_31290 2752 3492 gene locus_tag LOCUS_31300 gene pyrE 2752 3492 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_31300 3535 4212 gene locus_tag LOCUS_31310 3535 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266258.1 protein_id gnl|my_center|LOCUS_31310 4873 4253 gene locus_tag LOCUS_31320 gene slmA 4873 4253 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073926.1 protein_id gnl|my_center|LOCUS_31320 5786 4884 gene locus_tag LOCUS_31330 gene argB 5786 4884 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_31330 7553 5919 gene locus_tag LOCUS_31340 7553 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 7578 7836 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7879 8082 gene locus_tag LOCUS_31350 7879 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 8152 8289 gene locus_tag LOCUS_31360 8152 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 8710 9000 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9207 9326 gene locus_tag LOCUS_31370 9207 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 10578 9352 gene locus_tag LOCUS_31380 gene coaBC 10578 9352 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_31380 10705 11379 gene locus_tag LOCUS_31390 gene radC 10705 11379 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_31390 11565 11801 gene locus_tag LOCUS_31400 gene rpmB 11565 11801 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096556.1 protein_id gnl|my_center|LOCUS_31400 11813 11971 gene locus_tag LOCUS_31410 gene rpmG 11813 11971 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004410866.1 protein_id gnl|my_center|LOCUS_31410 12368 13177 gene locus_tag LOCUS_31420 gene mutM 12368 13177 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_31420 13271 14098 gene locus_tag LOCUS_31430 13271 14098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 14901 14164 gene locus_tag LOCUS_31440 gene elyC 14901 14164 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899602.1 protein_id gnl|my_center|LOCUS_31440 16699 14921 gene locus_tag LOCUS_31450 gene ggt 16699 14921 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112970.1 protein_id gnl|my_center|LOCUS_31450 17051 16794 gene locus_tag LOCUS_31460 17051 16794 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 protein_id gnl|my_center|LOCUS_31460 17551 17075 gene locus_tag LOCUS_31470 gene coaD 17551 17075 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737440.1 protein_id gnl|my_center|LOCUS_31470 19341 17707 gene locus_tag LOCUS_31480 19341 17707 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_31480 19902 19369 gene locus_tag LOCUS_31490 19902 19369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence078 1383 1150 gene locus_tag LOCUS_31500 gene acpP 1383 1150 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300909.1 protein_id gnl|my_center|LOCUS_31500 1943 1428 gene locus_tag LOCUS_31510 1943 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 1960 2232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2981 2376 gene locus_tag LOCUS_31520 2981 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 3027 3341 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4687 3683 gene locus_tag LOCUS_31530 gene plsX 4687 3683 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443174.1 protein_id gnl|my_center|LOCUS_31530 4874 4689 gene locus_tag LOCUS_31540 gene rpmF 4874 4689 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857964.1 protein_id gnl|my_center|LOCUS_31540 5416 4895 gene locus_tag LOCUS_31550 5416 4895 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_31550 6448 5462 gene locus_tag LOCUS_31560 gene sppA 6448 5462 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267147.1 protein_id gnl|my_center|LOCUS_31560 7100 6441 gene locus_tag LOCUS_31570 7100 6441 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_31570 8052 7084 gene locus_tag LOCUS_31580 gene rluC 8052 7084 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693754.1 protein_id gnl|my_center|LOCUS_31580 8526 11690 gene locus_tag LOCUS_31590 8526 11690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 11848 13743 gene locus_tag LOCUS_31600 11848 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 14614 13826 gene locus_tag LOCUS_31610 14614 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 15940 14762 gene locus_tag LOCUS_31620 gene prpF 15940 14762 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_31620 18882 16087 gene locus_tag LOCUS_31630 gene acnD 18882 16087 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115200.1 protein_id gnl|my_center|LOCUS_31630 16363 16618 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18993 19311 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <20059 19396 gene locus_tag LOCUS_31640 <20059 19396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070709.1:2-methylcitrate synthase >Feature sequence079 2153 867 gene locus_tag LOCUS_31650 gene hemA 2153 867 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_31650 2418 4271 gene locus_tag LOCUS_31660 2418 4271 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_31660 4283 4876 gene locus_tag LOCUS_31670 gene lolB 4283 4876 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958471.1 protein_id gnl|my_center|LOCUS_31670 4869 5750 gene locus_tag LOCUS_31680 gene ispE 4869 5750 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099284.1 protein_id gnl|my_center|LOCUS_31680 5758 5832 gene locus_tag LOCUS_t00370 5758 5832 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5880 6821 gene locus_tag LOCUS_31690 5880 6821 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317125.1 protein_id gnl|my_center|LOCUS_31690 6913 7539 gene locus_tag LOCUS_31700 6913 7539 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_31700 7618 8205 gene locus_tag LOCUS_31710 gene pth 7618 8205 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266729.1 protein_id gnl|my_center|LOCUS_31710 8263 9354 gene locus_tag LOCUS_31720 gene ychF 8263 9354 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099270.1 protein_id gnl|my_center|LOCUS_31720 9547 12555 gene locus_tag LOCUS_31730 9547 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 9609 9863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12850 13950 gene locus_tag LOCUS_31740 12850 13950 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 protein_id gnl|my_center|LOCUS_31740 14021 14614 gene locus_tag LOCUS_31750 14021 14614 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 protein_id gnl|my_center|LOCUS_31750 14717 14881 gene locus_tag LOCUS_31760 14717 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 15505 14909 gene locus_tag LOCUS_31770 15505 14909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 15771 16718 gene locus_tag LOCUS_31780 15771 16718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 17146 16802 gene locus_tag LOCUS_31790 17146 16802 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313868.1 protein_id gnl|my_center|LOCUS_31790 17328 18677 gene locus_tag LOCUS_31800 gene miaB 17328 18677 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093158.1 protein_id gnl|my_center|LOCUS_31800 18749 19876 gene locus_tag LOCUS_31810 18749 19876 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_31810 >Feature sequence080 2459 45 gene locus_tag LOCUS_31820 2459 45 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205278.1 protein_id gnl|my_center|LOCUS_31820 3500 2541 gene locus_tag LOCUS_31830 3500 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 3954 3607 gene locus_tag LOCUS_31840 3954 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 4525 4052 gene locus_tag LOCUS_31850 4525 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 4977 4639 gene locus_tag LOCUS_31860 4977 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 5448 5200 gene locus_tag LOCUS_31870 5448 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 5335 6303 gene locus_tag LOCUS_31880 5335 6303 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 protein_id gnl|my_center|LOCUS_31880 6702 6496 gene locus_tag LOCUS_31890 6702 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 6775 7170 gene locus_tag LOCUS_31900 6775 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 7962 7201 gene locus_tag LOCUS_31910 7962 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 8173 8391 gene locus_tag LOCUS_31920 8173 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 8981 8580 gene locus_tag LOCUS_31930 8981 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 9637 9089 gene locus_tag LOCUS_31940 9637 9089 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072147.1 protein_id gnl|my_center|LOCUS_31940 10363 9704 gene locus_tag LOCUS_31950 10363 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 11584 10448 gene locus_tag LOCUS_31960 11584 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 11806 12166 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13166 12243 gene locus_tag LOCUS_31970 13166 12243 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_31970 13339 14415 gene locus_tag LOCUS_31980 13339 14415 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175517123.1 protein_id gnl|my_center|LOCUS_31980 14874 14479 gene locus_tag LOCUS_31990 14874 14479 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 protein_id gnl|my_center|LOCUS_31990 15427 14888 gene locus_tag LOCUS_32000 15427 14888 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816397.1 protein_id gnl|my_center|LOCUS_32000 15782 15528 gene locus_tag LOCUS_32010 15782 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 16679 15963 gene locus_tag LOCUS_32020 16679 15963 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 protein_id gnl|my_center|LOCUS_32020 16783 17688 gene locus_tag LOCUS_32030 gene nhaR 16783 17688 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_32030 18853 17735 gene locus_tag LOCUS_32040 18853 17735 CDS product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_32040 >Feature sequence081 446 1840 gene locus_tag LOCUS_32050 446 1840 CDS product aminoacyl-tRNA deacylase and HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769583.1 protein_id gnl|my_center|LOCUS_32050 2722 1901 gene locus_tag LOCUS_32060 2722 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 4020 2725 gene locus_tag LOCUS_32070 4020 2725 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_32070 4475 4104 gene locus_tag LOCUS_32080 4475 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096629.1 protein_id gnl|my_center|LOCUS_32080 4948 4511 gene locus_tag LOCUS_32090 4948 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 5364 5092 gene locus_tag LOCUS_32100 5364 5092 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096630.1 protein_id gnl|my_center|LOCUS_32100 6616 5459 gene locus_tag LOCUS_32110 6616 5459 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_32110 6860 6696 gene locus_tag LOCUS_32120 6860 6696 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098329.1 protein_id gnl|my_center|LOCUS_32120 7070 7636 gene locus_tag LOCUS_32130 7070 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 7947 8221 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8925 9623 gene locus_tag LOCUS_32140 gene phoB 8925 9623 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096653.1 protein_id gnl|my_center|LOCUS_32140 9629 11038 gene locus_tag LOCUS_32150 gene phoR 9629 11038 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_32150 11913 10975 gene locus_tag LOCUS_32160 11913 10975 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096657.1 protein_id gnl|my_center|LOCUS_32160 12688 11885 gene locus_tag LOCUS_32170 gene cysZ 12688 11885 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254839.1 protein_id gnl|my_center|LOCUS_32170 12807 13490 gene locus_tag LOCUS_32180 gene trmH 12807 13490 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068431.1 protein_id gnl|my_center|LOCUS_32180 14269 13454 gene locus_tag LOCUS_32190 14269 13454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 15121 14801 gene locus_tag LOCUS_32200 15121 14801 CDS product DUF3392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084525.1 protein_id gnl|my_center|LOCUS_32200 15315 15785 gene locus_tag LOCUS_32210 15315 15785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 15919 15844 gene locus_tag LOCUS_t00380 15919 15844 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16187 16891 gene locus_tag LOCUS_32220 gene phoB 16187 16891 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_32220 16902 18182 gene locus_tag LOCUS_32230 gene phoR 16902 18182 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071728.1 protein_id gnl|my_center|LOCUS_32230 19199 18267 gene locus_tag LOCUS_32240 19199 18267 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 protein_id gnl|my_center|LOCUS_32240 >Feature sequence082 2270 1416 gene locus_tag LOCUS_32250 gene speE 2270 1416 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114619.1 protein_id gnl|my_center|LOCUS_32250 4747 2486 gene locus_tag LOCUS_32260 gene parC 4747 2486 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_32260 4955 5815 gene locus_tag LOCUS_32270 4955 5815 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039958.1 protein_id gnl|my_center|LOCUS_32270 6188 5880 gene locus_tag LOCUS_32280 6188 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 6500 6195 gene locus_tag LOCUS_32290 6500 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 6931 6521 gene locus_tag LOCUS_32300 6931 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 8447 7044 gene locus_tag LOCUS_32310 8447 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 8467 8720 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11991 10102 gene locus_tag LOCUS_32320 gene parE 11991 10102 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_32320 12680 12081 gene locus_tag LOCUS_32330 12680 12081 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113918.1 protein_id gnl|my_center|LOCUS_32330 13487 12681 gene locus_tag LOCUS_32340 gene cpdA 13487 12681 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266482.1 protein_id gnl|my_center|LOCUS_32340 14047 13577 gene locus_tag LOCUS_32350 14047 13577 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862516.1 protein_id gnl|my_center|LOCUS_32350 14784 14167 gene locus_tag LOCUS_32360 14784 14167 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_32360 14961 16292 gene locus_tag LOCUS_32370 gene vpoC 14961 16292 CDS product efflux RND transporter outer membrane protein VpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 protein_id gnl|my_center|LOCUS_32370 17628 16360 gene locus_tag LOCUS_32380 gene waaA 17628 16360 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence083 790 1049 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1107 1628 gene locus_tag LOCUS_32390 1107 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 1659 3581 gene locus_tag LOCUS_32400 gene nosZ 1659 3581 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098686.1 protein_id gnl|my_center|LOCUS_32400 3602 4879 gene locus_tag LOCUS_32410 3602 4879 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 protein_id gnl|my_center|LOCUS_32410 4881 5795 gene locus_tag LOCUS_32420 4881 5795 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113111.1 protein_id gnl|my_center|LOCUS_32420 5923 6178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6840 7388 gene locus_tag LOCUS_32430 6840 7388 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113109.1 protein_id gnl|my_center|LOCUS_32430 7402 7557 gene locus_tag LOCUS_32440 7402 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 8171 7638 gene locus_tag LOCUS_32450 gene mog 8171 7638 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422732.1 protein_id gnl|my_center|LOCUS_32450 9045 8350 gene locus_tag LOCUS_32460 gene ytfE 9045 8350 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694400.1 protein_id gnl|my_center|LOCUS_32460 9227 10771 gene locus_tag LOCUS_32470 gene norR 9227 10771 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_32470 11536 10787 gene locus_tag LOCUS_32480 gene moeB 11536 10787 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807436.1 protein_id gnl|my_center|LOCUS_32480 12767 11541 gene locus_tag LOCUS_32490 gene moeA 12767 11541 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 protein_id gnl|my_center|LOCUS_32490 13402 12770 gene locus_tag LOCUS_32500 gene narL 13402 12770 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064595.1 protein_id gnl|my_center|LOCUS_32500 13781 14716 gene locus_tag LOCUS_32510 13781 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 14906 15877 gene locus_tag LOCUS_32520 gene moaA 14906 15877 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168084.1 protein_id gnl|my_center|LOCUS_32520 15881 16420 gene locus_tag LOCUS_32530 15881 16420 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037164.1 protein_id gnl|my_center|LOCUS_32530 16422 16958 gene locus_tag LOCUS_32540 gene moaB 16422 16958 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084629.1 protein_id gnl|my_center|LOCUS_32540 16984 17472 gene locus_tag LOCUS_32550 gene moaC 16984 17472 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705487.1 protein_id gnl|my_center|LOCUS_32550 17465 17710 gene locus_tag LOCUS_32560 gene moaD 17465 17710 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093027.1 protein_id gnl|my_center|LOCUS_32560 17712 18179 gene locus_tag LOCUS_32570 gene moaE 17712 18179 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350081.1 protein_id gnl|my_center|LOCUS_32570 <18822 18174 gene locus_tag LOCUS_32580 <18822 18174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113876.1:phosphoketolase >Feature sequence084 2769 2224 gene locus_tag LOCUS_32590 2769 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3753 2866 gene locus_tag LOCUS_32600 3753 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 4700 5281 gene locus_tag LOCUS_32610 gene rsxA 4700 5281 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_32610 5290 5898 gene locus_tag LOCUS_32620 gene rsxB 5290 5898 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072472.1 protein_id gnl|my_center|LOCUS_32620 7127 7380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7381 8385 gene locus_tag LOCUS_32630 7381 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 8388 9440 gene locus_tag LOCUS_32640 gene rsxD 8388 9440 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050901.1 protein_id gnl|my_center|LOCUS_32640 9450 10118 gene locus_tag LOCUS_32650 gene rsxG 9450 10118 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_32650 10118 10834 gene locus_tag LOCUS_32660 10118 10834 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_32660 11854 11033 gene locus_tag LOCUS_32670 11854 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 12165 13160 gene locus_tag LOCUS_32680 12165 13160 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072295.1 protein_id gnl|my_center|LOCUS_32680 13440 13964 gene locus_tag LOCUS_32690 13440 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 15572 14058 gene locus_tag LOCUS_32700 15572 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 15579 15843 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16222 16569 gene locus_tag LOCUS_32710 16222 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 16792 16661 gene locus_tag LOCUS_32720 16792 16661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 17111 16761 gene locus_tag LOCUS_32730 17111 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 17292 17152 gene locus_tag LOCUS_32740 17292 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 17433 18080 gene locus_tag LOCUS_32750 17433 18080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 18136 18512 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence085 1706 114 gene locus_tag LOCUS_32760 1706 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 4365 1870 gene locus_tag LOCUS_32770 4365 1870 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 protein_id gnl|my_center|LOCUS_32770 4429 4679 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6339 5263 gene locus_tag LOCUS_32780 6339 5263 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 protein_id gnl|my_center|LOCUS_32780 7257 6553 gene locus_tag LOCUS_32790 7257 6553 CDS product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706480.1 protein_id gnl|my_center|LOCUS_32790 7409 7257 gene locus_tag LOCUS_32800 7409 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 7981 7421 gene locus_tag LOCUS_32810 7981 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 8156 8557 gene locus_tag LOCUS_32820 8156 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 8597 8866 gene locus_tag LOCUS_32830 8597 8866 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340598.1 protein_id gnl|my_center|LOCUS_32830 10569 8959 gene locus_tag LOCUS_32840 10569 8959 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088888.1 protein_id gnl|my_center|LOCUS_32840 10664 10975 gene locus_tag LOCUS_32850 10664 10975 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_32850 11337 10999 gene locus_tag LOCUS_32860 11337 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 11410 11568 gene locus_tag LOCUS_32870 11410 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 11976 11626 gene locus_tag LOCUS_32880 11976 11626 CDS product DUF3135 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707145.1 protein_id gnl|my_center|LOCUS_32880 12311 12883 gene locus_tag LOCUS_32890 12311 12883 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092664.1 protein_id gnl|my_center|LOCUS_32890 12894 13418 gene locus_tag LOCUS_32900 12894 13418 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 protein_id gnl|my_center|LOCUS_32900 13415 13612 gene locus_tag LOCUS_32910 13415 13612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 13635 14843 gene locus_tag LOCUS_32920 gene purT 13635 14843 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765861.1 protein_id gnl|my_center|LOCUS_32920 16383 14806 gene locus_tag LOCUS_32930 16383 14806 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052610.1 protein_id gnl|my_center|LOCUS_32930 16683 17129 gene locus_tag LOCUS_32940 16683 17129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence086 1849 254 gene locus_tag LOCUS_32950 1849 254 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_32950 2030 2584 gene locus_tag LOCUS_32960 2030 2584 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_32960 2731 3195 gene locus_tag LOCUS_32970 2731 3195 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261942.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32970 3214 3723 gene locus_tag LOCUS_32980 gene def 3214 3723 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395192.1 protein_id gnl|my_center|LOCUS_32980 4167 3787 gene locus_tag LOCUS_32990 4167 3787 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463606.1 protein_id gnl|my_center|LOCUS_32990 4593 4237 gene locus_tag LOCUS_33000 4593 4237 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070495.1 protein_id gnl|my_center|LOCUS_33000 5515 4703 gene locus_tag LOCUS_33010 5515 4703 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_33010 6435 5512 gene locus_tag LOCUS_33020 6435 5512 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_33020 7618 6446 gene locus_tag LOCUS_33030 7618 6446 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_33030 8500 9708 gene locus_tag LOCUS_33040 8500 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 9720 10184 gene locus_tag LOCUS_33050 9720 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 10196 10627 gene locus_tag LOCUS_33060 10196 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 11837 10707 gene locus_tag LOCUS_33070 11837 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 14165 12045 gene locus_tag LOCUS_33080 14165 12045 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071497.1 protein_id gnl|my_center|LOCUS_33080 15106 14324 gene locus_tag LOCUS_33090 15106 14324 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086719.1 protein_id gnl|my_center|LOCUS_33090 16923 15133 gene locus_tag LOCUS_33100 16923 15133 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_33100 17128 18108 gene locus_tag LOCUS_33110 17128 18108 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162840014.1 protein_id gnl|my_center|LOCUS_33110 >Feature sequence087 2169 1423 gene locus_tag LOCUS_33120 2169 1423 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357968.1 protein_id gnl|my_center|LOCUS_33120 3802 2174 gene locus_tag LOCUS_33130 3802 2174 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 protein_id gnl|my_center|LOCUS_33130 4113 4649 gene locus_tag LOCUS_33140 4113 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 5675 4773 gene locus_tag LOCUS_33150 5675 4773 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460107.1 protein_id gnl|my_center|LOCUS_33150 5789 6706 gene locus_tag LOCUS_33160 5789 6706 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242776.1 protein_id gnl|my_center|LOCUS_33160 6820 8781 gene locus_tag LOCUS_33170 6820 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 8781 10421 gene locus_tag LOCUS_33180 8781 10421 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704133.1 protein_id gnl|my_center|LOCUS_33180 >Feature sequence088 4 846 gene locus_tag LOCUS_33190 4 846 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419381.1 protein_id gnl|my_center|LOCUS_33190 1282 866 gene locus_tag LOCUS_33200 1282 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 2200 1739 gene locus_tag LOCUS_33210 2200 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 3735 2200 gene locus_tag LOCUS_33220 3735 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 3917 4111 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5374 4205 gene locus_tag LOCUS_33230 5374 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 5952 5386 gene locus_tag LOCUS_33240 5952 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 9228 6196 gene locus_tag LOCUS_33250 9228 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 10153 9527 gene locus_tag LOCUS_33260 10153 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 10196 10450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10618 10886 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10983 11555 gene locus_tag LOCUS_33270 10983 11555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 11569 11790 gene locus_tag LOCUS_33280 11569 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 12863 11889 gene locus_tag LOCUS_33290 12863 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 14333 13263 gene locus_tag LOCUS_33300 14333 13263 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550696.1 protein_id gnl|my_center|LOCUS_33300 15280 15552 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16337 15858 gene locus_tag LOCUS_33310 16337 15858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 17006 17605 gene locus_tag LOCUS_33320 17006 17605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 >Feature sequence089 721 2091 gene locus_tag LOCUS_33330 gene tilS 721 2091 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816961.1 protein_id gnl|my_center|LOCUS_33330 2248 2733 gene locus_tag LOCUS_33340 2248 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 2878 3612 gene locus_tag LOCUS_33350 2878 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 4942 3689 gene locus_tag LOCUS_33360 gene nhaD 4942 3689 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 protein_id gnl|my_center|LOCUS_33360 5838 5191 gene locus_tag LOCUS_33370 5838 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 6729 5950 gene locus_tag LOCUS_33380 gene map 6729 5950 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114411.1 protein_id gnl|my_center|LOCUS_33380 6931 6719 gene locus_tag LOCUS_33390 6931 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 8395 7109 gene locus_tag LOCUS_33400 8395 7109 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_33400 9290 8493 gene locus_tag LOCUS_33410 9290 8493 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_33410 9462 10868 gene locus_tag LOCUS_33420 gene ffh 9462 10868 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462555.1 protein_id gnl|my_center|LOCUS_33420 11756 12445 gene locus_tag LOCUS_33430 11756 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 12540 12956 gene locus_tag LOCUS_33440 12540 12956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 13005 13496 gene locus_tag LOCUS_33450 13005 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 13654 14076 gene locus_tag LOCUS_33460 13654 14076 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_33460 14277 15584 gene locus_tag LOCUS_33470 14277 15584 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939264.1 protein_id gnl|my_center|LOCUS_33470 15610 16539 gene locus_tag LOCUS_33480 15610 16539 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528797.1 protein_id gnl|my_center|LOCUS_33480 16821 17003 gene locus_tag LOCUS_33490 16821 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 >Feature sequence090 448 867 gene locus_tag LOCUS_33500 448 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 1192 2706 gene locus_tag LOCUS_33510 1192 2706 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_33510 2925 3521 gene locus_tag LOCUS_33520 2925 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3633 4172 gene locus_tag LOCUS_33530 3633 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_33530 4699 5196 gene locus_tag LOCUS_33540 4699 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 8338 5408 gene locus_tag LOCUS_33550 gene gcvP 8338 5408 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071084.1 protein_id gnl|my_center|LOCUS_33550 8840 8457 gene locus_tag LOCUS_33560 gene gcvH 8840 8457 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222872.1 protein_id gnl|my_center|LOCUS_33560 9984 8890 gene locus_tag LOCUS_33570 gene gcvT 9984 8890 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_33570 10950 10270 gene locus_tag LOCUS_33580 10950 10270 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089896.1 protein_id gnl|my_center|LOCUS_33580 12011 10995 gene locus_tag LOCUS_33590 12011 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 12272 16666 gene locus_tag LOCUS_33600 12272 16666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 13385 13639 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16938 16783 gene locus_tag LOCUS_33610 16938 16783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 >Feature sequence091 866 1336 gene locus_tag LOCUS_33620 866 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 1422 3053 gene locus_tag LOCUS_33630 1422 3053 CDS product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_33630 3686 3126 gene locus_tag LOCUS_33640 3686 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 4035 3748 gene locus_tag LOCUS_33650 4035 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 4222 4746 gene locus_tag LOCUS_33660 4222 4746 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_33660 4877 6718 gene locus_tag LOCUS_33670 4877 6718 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895689.1 protein_id gnl|my_center|LOCUS_33670 7862 6801 gene locus_tag LOCUS_33680 7862 6801 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479913.1 protein_id gnl|my_center|LOCUS_33680 8380 7877 gene locus_tag LOCUS_33690 8380 7877 CDS product 2,4'-dihydroxyacetophenone dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479856.1 protein_id gnl|my_center|LOCUS_33690 9215 8448 gene locus_tag LOCUS_33700 9215 8448 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479886.1 protein_id gnl|my_center|LOCUS_33700 9345 10346 gene locus_tag LOCUS_33710 9345 10346 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479808.1 protein_id gnl|my_center|LOCUS_33710 11107 10598 gene locus_tag LOCUS_33720 11107 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 11628 11224 gene locus_tag LOCUS_33730 11628 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 12226 11696 gene locus_tag LOCUS_33740 12226 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 13701 12388 gene locus_tag LOCUS_33750 13701 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 14828 14181 gene locus_tag LOCUS_33760 14828 14181 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 protein_id gnl|my_center|LOCUS_33760 15928 14918 gene locus_tag LOCUS_33770 15928 14918 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812183.1 protein_id gnl|my_center|LOCUS_33770 <16762 15944 gene locus_tag LOCUS_33780 <16762 15944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940876.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence092 450 1280 gene locus_tag LOCUS_33790 gene aroE 450 1280 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266136.1 protein_id gnl|my_center|LOCUS_33790 1331 2029 gene locus_tag LOCUS_33800 1331 2029 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_33800 3961 2099 gene locus_tag LOCUS_33810 3961 2099 CDS product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106299.1 protein_id gnl|my_center|LOCUS_33810 4321 4647 gene locus_tag LOCUS_33820 4321 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 4657 5715 gene locus_tag LOCUS_33830 4657 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 5718 6200 gene locus_tag LOCUS_33840 5718 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 7007 6285 gene locus_tag LOCUS_33850 7007 6285 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 protein_id gnl|my_center|LOCUS_33850 7314 8453 gene locus_tag LOCUS_33860 7314 8453 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 protein_id gnl|my_center|LOCUS_33860 8450 8950 gene locus_tag LOCUS_33870 8450 8950 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257683.1 protein_id gnl|my_center|LOCUS_33870 9596 9045 gene locus_tag LOCUS_33880 9596 9045 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103010.1 protein_id gnl|my_center|LOCUS_33880 9719 10588 gene locus_tag LOCUS_33890 9719 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33890 11783 12044 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12651 14375 gene locus_tag LOCUS_33900 12651 14375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 14408 15013 gene locus_tag LOCUS_33910 14408 15013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 15023 16063 gene locus_tag LOCUS_33920 15023 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 16645 16511 gene locus_tag LOCUS_33930 16645 16511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence093 2856 1609 gene locus_tag LOCUS_33940 2856 1609 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 protein_id gnl|my_center|LOCUS_33940 3602 2850 gene locus_tag LOCUS_33950 3602 2850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 protein_id gnl|my_center|LOCUS_33950 5734 3608 gene locus_tag LOCUS_33960 5734 3608 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037461425.1 protein_id gnl|my_center|LOCUS_33960 7261 5807 gene locus_tag LOCUS_33970 7261 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 7383 8009 gene locus_tag LOCUS_33980 7383 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 9270 8032 gene locus_tag LOCUS_33990 gene zigA 9270 8032 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105544.1 protein_id gnl|my_center|LOCUS_33990 9469 10170 gene locus_tag LOCUS_34000 9469 10170 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390821.1 protein_id gnl|my_center|LOCUS_34000 10671 10183 gene locus_tag LOCUS_34010 10671 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 11324 10827 gene locus_tag LOCUS_34020 11324 10827 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704430.1 protein_id gnl|my_center|LOCUS_34020 11785 11378 gene locus_tag LOCUS_34030 11785 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 12037 11801 gene locus_tag LOCUS_34040 12037 11801 CDS product Rad51 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074138.1 protein_id gnl|my_center|LOCUS_34040 12734 12210 gene locus_tag LOCUS_34050 12734 12210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 13367 12762 gene locus_tag LOCUS_34060 13367 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 13815 13450 gene locus_tag LOCUS_34070 13815 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 14609 13899 gene locus_tag LOCUS_34080 14609 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 15042 14704 gene locus_tag LOCUS_34090 15042 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence094 1601 3553 gene locus_tag LOCUS_34100 gene acs 1601 3553 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245081.1 protein_id gnl|my_center|LOCUS_34100 3722 4396 gene locus_tag LOCUS_34110 3722 4396 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_34110 7936 4499 gene locus_tag LOCUS_34120 7936 4499 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_34120 8139 8453 gene locus_tag LOCUS_34130 8139 8453 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705924.1 protein_id gnl|my_center|LOCUS_34130 8463 10124 gene locus_tag LOCUS_34140 gene actP 8463 10124 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832573.1 protein_id gnl|my_center|LOCUS_34140 10288 12087 gene locus_tag LOCUS_34150 10288 12087 CDS product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112968.1 protein_id gnl|my_center|LOCUS_34150 12087 12704 gene locus_tag LOCUS_34160 12087 12704 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114810.1 protein_id gnl|my_center|LOCUS_34160 13117 12863 gene locus_tag LOCUS_34170 13117 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 13022 13513 gene locus_tag LOCUS_34180 13022 13513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 >Feature sequence095 819 1152 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1388 2578 gene locus_tag LOCUS_34190 gene bioF 1388 2578 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 protein_id gnl|my_center|LOCUS_34190 2575 3375 gene locus_tag LOCUS_34200 gene bioH 2575 3375 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074222.1 protein_id gnl|my_center|LOCUS_34200 3372 4202 gene locus_tag LOCUS_34210 gene bioC 3372 4202 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113247.1 protein_id gnl|my_center|LOCUS_34210 4220 4939 gene locus_tag LOCUS_34220 gene bioD 4220 4939 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763772.1 protein_id gnl|my_center|LOCUS_34220 5038 6084 gene locus_tag LOCUS_34230 5038 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 6987 6106 gene locus_tag LOCUS_34240 6987 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 7387 10146 gene locus_tag LOCUS_34250 7387 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 10852 10250 gene locus_tag LOCUS_34260 10852 10250 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_34260 11104 11817 gene locus_tag LOCUS_34270 11104 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 13024 11909 gene locus_tag LOCUS_34280 13024 11909 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457676.1 protein_id gnl|my_center|LOCUS_34280 13025 13293 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14057 13431 gene locus_tag LOCUS_34290 gene upp 14057 13431 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072698.1 protein_id gnl|my_center|LOCUS_34290 14182 14460 gene locus_tag LOCUS_34300 14182 14460 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705448.1 protein_id gnl|my_center|LOCUS_34300 14806 14576 gene locus_tag LOCUS_34310 14806 14576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 >Feature sequence096 52 762 gene locus_tag LOCUS_34320 gene arsH 52 762 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095191.1 protein_id gnl|my_center|LOCUS_34320 759 1301 gene locus_tag LOCUS_34330 759 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 3240 1351 gene locus_tag LOCUS_34340 3240 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 3643 3428 gene locus_tag LOCUS_34350 3643 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 3915 4655 gene locus_tag LOCUS_34360 3915 4655 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_34360 5122 4697 gene locus_tag LOCUS_34370 5122 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 5231 5499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5765 6277 gene locus_tag LOCUS_34380 5765 6277 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071597.1 protein_id gnl|my_center|LOCUS_34380 6284 6919 gene locus_tag LOCUS_34390 6284 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 6940 7782 gene locus_tag LOCUS_34400 6940 7782 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922574.1 protein_id gnl|my_center|LOCUS_34400 7838 8578 gene locus_tag LOCUS_34410 7838 8578 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938152.1 protein_id gnl|my_center|LOCUS_34410 9203 9456 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10074 9526 gene locus_tag LOCUS_34420 10074 9526 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350817.1 protein_id gnl|my_center|LOCUS_34420 10559 11638 gene locus_tag LOCUS_34430 gene pdhA 10559 11638 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114486.1 protein_id gnl|my_center|LOCUS_34430 11640 12677 gene locus_tag LOCUS_34440 11640 12677 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947288.1 protein_id gnl|my_center|LOCUS_34440 12720 13877 gene locus_tag LOCUS_34450 12720 13877 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114484.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence097 738 2336 gene locus_tag LOCUS_34460 738 2336 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 protein_id gnl|my_center|LOCUS_34460 2444 3682 gene locus_tag LOCUS_34470 2444 3682 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212197.1 protein_id gnl|my_center|LOCUS_34470 4215 3715 gene locus_tag LOCUS_34480 gene folK 4215 3715 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262665.1 protein_id gnl|my_center|LOCUS_34480 4586 4215 gene locus_tag LOCUS_34490 gene folB 4586 4215 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099587.1 protein_id gnl|my_center|LOCUS_34490 5652 4579 gene locus_tag LOCUS_34500 gene tsaD 5652 4579 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694133.1 protein_id gnl|my_center|LOCUS_34500 5948 6163 gene locus_tag LOCUS_34510 gene rpsU 5948 6163 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551877.1 protein_id gnl|my_center|LOCUS_34510 6194 6640 gene locus_tag LOCUS_34520 6194 6640 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_34520 6744 8597 gene locus_tag LOCUS_34530 gene dnaG 6744 8597 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244455.1 protein_id gnl|my_center|LOCUS_34530 10185 10329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10330 11037 gene locus_tag LOCUS_34540 10330 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 11566 11123 gene locus_tag LOCUS_34550 11566 11123 CDS product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211616.1 protein_id gnl|my_center|LOCUS_34550 11655 12542 gene locus_tag LOCUS_34560 11655 12542 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815868.1 protein_id gnl|my_center|LOCUS_34560 12686 13609 gene locus_tag LOCUS_34570 12686 13609 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039561.1 protein_id gnl|my_center|LOCUS_34570 13843 13919 gene locus_tag LOCUS_t00390 13843 13919 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence098 1883 660 gene locus_tag LOCUS_34580 gene tuf 1883 660 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 protein_id gnl|my_center|LOCUS_34580 2044 1969 gene locus_tag LOCUS_t00400 2044 1969 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2124 2051 gene locus_tag LOCUS_t00410 2124 2051 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2289 2206 gene locus_tag LOCUS_t00420 2289 2206 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3073 2405 gene locus_tag LOCUS_34590 3073 2405 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115071.1 protein_id gnl|my_center|LOCUS_34590 3783 3049 gene locus_tag LOCUS_34600 3783 3049 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768914.1 protein_id gnl|my_center|LOCUS_34600 4720 3764 gene locus_tag LOCUS_34610 gene birA 4720 3764 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 protein_id gnl|my_center|LOCUS_34610 4888 5769 gene locus_tag LOCUS_34620 4888 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223047.1 protein_id gnl|my_center|LOCUS_34620 6170 7654 gene locus_tag LOCUS_34630 6170 7654 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963862.1 protein_id gnl|my_center|LOCUS_34630 7706 8842 gene locus_tag LOCUS_34640 7706 8842 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_34640 8848 9132 gene locus_tag LOCUS_34650 8848 9132 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_34650 9147 10556 gene locus_tag LOCUS_34660 9147 10556 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127254.1 protein_id gnl|my_center|LOCUS_34660 11639 10734 gene locus_tag LOCUS_34670 11639 10734 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719323.1 protein_id gnl|my_center|LOCUS_34670 11541 11753 gene locus_tag LOCUS_34680 11541 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 11764 12390 gene locus_tag LOCUS_34690 11764 12390 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640263.1 protein_id gnl|my_center|LOCUS_34690 12539 13225 gene locus_tag LOCUS_34700 12539 13225 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073279.1 protein_id gnl|my_center|LOCUS_34700 13689 13231 gene locus_tag LOCUS_34710 13689 13231 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263284.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence099 157 450 gene locus_tag LOCUS_34720 157 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 1356 589 gene locus_tag LOCUS_34730 1356 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 1628 2629 gene locus_tag LOCUS_34740 gene dmeF 1628 2629 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 protein_id gnl|my_center|LOCUS_34740 2716 3096 gene locus_tag LOCUS_34750 2716 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 3296 3649 gene locus_tag LOCUS_34760 3296 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 4471 3677 gene locus_tag LOCUS_34770 gene tcdA 4471 3677 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112469.1 protein_id gnl|my_center|LOCUS_34770 5229 4561 gene locus_tag LOCUS_34780 5229 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 6562 5387 gene locus_tag LOCUS_34790 6562 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 7109 6639 gene locus_tag LOCUS_34800 7109 6639 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_34800 7434 8876 gene locus_tag LOCUS_34810 gene sufB 7434 8876 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_34810 8962 9720 gene locus_tag LOCUS_34820 gene sufC 8962 9720 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_34820 9722 11092 gene locus_tag LOCUS_34830 gene sufD 9722 11092 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_34830 11089 12321 gene locus_tag LOCUS_34840 11089 12321 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 protein_id gnl|my_center|LOCUS_34840 12335 12721 gene locus_tag LOCUS_34850 gene sufA 12335 12721 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367160.1 protein_id gnl|my_center|LOCUS_34850 12829 13338 gene locus_tag LOCUS_34860 gene sufT 12829 13338 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_34860 >Feature sequence100 1147 1512 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1894 3072 gene locus_tag LOCUS_34870 1894 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 3116 3303 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3992 3441 gene locus_tag LOCUS_34880 3992 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 5424 4210 gene locus_tag LOCUS_34890 gene alkB1 5424 4210 CDS product alkane 1-monooxygenase AlkB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102475.1 protein_id gnl|my_center|LOCUS_34890 6524 5451 gene locus_tag LOCUS_34900 6524 5451 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086459.1 protein_id gnl|my_center|LOCUS_34900 6699 7751 gene locus_tag LOCUS_34910 6699 7751 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444337.1 protein_id gnl|my_center|LOCUS_34910 8591 7743 gene locus_tag LOCUS_34920 8591 7743 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707055.1 protein_id gnl|my_center|LOCUS_34920 9138 8593 gene locus_tag LOCUS_34930 9138 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 9838 9125 gene locus_tag LOCUS_34940 9838 9125 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950377.1 protein_id gnl|my_center|LOCUS_34940 10079 10492 gene locus_tag LOCUS_34950 10079 10492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 10509 11351 gene locus_tag LOCUS_34960 10509 11351 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087999.1 protein_id gnl|my_center|LOCUS_34960 11417 11857 gene locus_tag LOCUS_34970 11417 11857 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098177.1 protein_id gnl|my_center|LOCUS_34970 13135 11906 gene locus_tag LOCUS_34980 13135 11906 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705326.1 protein_id gnl|my_center|LOCUS_34980 >Feature sequence101 147 2246 gene locus_tag LOCUS_34990 147 2246 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103345.1 protein_id gnl|my_center|LOCUS_34990 2248 2772 gene locus_tag LOCUS_35000 2248 2772 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_35000 2787 4415 gene locus_tag LOCUS_35010 2787 4415 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942023.1 protein_id gnl|my_center|LOCUS_35010 4387 5229 gene locus_tag LOCUS_35020 4387 5229 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266627.1 protein_id gnl|my_center|LOCUS_35020 5384 5652 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5679 5888 gene locus_tag LOCUS_35030 5679 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 5895 6935 gene locus_tag LOCUS_35040 5895 6935 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 protein_id gnl|my_center|LOCUS_35040 6963 8168 gene locus_tag LOCUS_35050 6963 8168 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037833.1 protein_id gnl|my_center|LOCUS_35050 8270 8578 gene locus_tag LOCUS_35060 8270 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 11720 8652 gene locus_tag LOCUS_35070 gene vexK 11720 8652 CDS product efflux RND transporter permease subunit VexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625968.1 protein_id gnl|my_center|LOCUS_35070 12826 11723 gene locus_tag LOCUS_35080 12826 11723 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625967.1 protein_id gnl|my_center|LOCUS_35080 >Feature sequence102 1028 402 gene locus_tag LOCUS_35090 1028 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 3434 1410 gene locus_tag LOCUS_35100 3434 1410 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_35100 4051 3455 gene locus_tag LOCUS_35110 4051 3455 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_35110 4418 4098 gene locus_tag LOCUS_35120 4418 4098 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072130.1 protein_id gnl|my_center|LOCUS_35120 4644 4447 gene locus_tag LOCUS_35130 4644 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 5973 4738 gene locus_tag LOCUS_35140 5973 4738 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063821.1 protein_id gnl|my_center|LOCUS_35140 6078 6848 gene locus_tag LOCUS_35150 6078 6848 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707640.1 protein_id gnl|my_center|LOCUS_35150 7926 6817 gene locus_tag LOCUS_35160 gene mltC 7926 6817 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369719.1 protein_id gnl|my_center|LOCUS_35160 8205 8606 gene locus_tag LOCUS_35170 8205 8606 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367640.1 protein_id gnl|my_center|LOCUS_35170 9704 8697 gene locus_tag LOCUS_35180 9704 8697 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202848.1 protein_id gnl|my_center|LOCUS_35180 10595 9804 gene locus_tag LOCUS_35190 10595 9804 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202847.1 protein_id gnl|my_center|LOCUS_35190 10871 11179 gene locus_tag LOCUS_35200 10871 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 11353 12033 gene locus_tag LOCUS_35210 11353 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 12688 11972 gene locus_tag LOCUS_35220 12688 11972 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_35220 <13213 12691 gene locus_tag LOCUS_35230 <13213 12691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266243.1:DUF484 family protein >Feature sequence103 3085 2240 gene locus_tag LOCUS_35240 3085 2240 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208878.1 protein_id gnl|my_center|LOCUS_35240 3343 3089 gene locus_tag LOCUS_35250 3343 3089 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104989.1 protein_id gnl|my_center|LOCUS_35250 4238 3387 gene locus_tag LOCUS_35260 4238 3387 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_35260 5194 4238 gene locus_tag LOCUS_35270 5194 4238 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406489.1 protein_id gnl|my_center|LOCUS_35270 6081 5197 gene locus_tag LOCUS_35280 6081 5197 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409651.1 protein_id gnl|my_center|LOCUS_35280 6179 7075 gene locus_tag LOCUS_35290 6179 7075 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267174.1 protein_id gnl|my_center|LOCUS_35290 7749 7126 gene locus_tag LOCUS_35300 7749 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 7922 8195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9406 8207 gene locus_tag LOCUS_35310 9406 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119759.1 protein_id gnl|my_center|LOCUS_35310 10481 9702 gene locus_tag LOCUS_35320 10481 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 >Feature sequence104 792 550 gene locus_tag LOCUS_35330 792 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 882 1114 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2086 1436 gene locus_tag LOCUS_35340 gene coq7 2086 1436 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269103.1 protein_id gnl|my_center|LOCUS_35340 2229 3704 gene locus_tag LOCUS_35350 2229 3704 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_35350 6055 3701 gene locus_tag LOCUS_35360 6055 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 7373 6081 gene locus_tag LOCUS_35370 gene purD 7373 6081 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_35370 9242 7611 gene locus_tag LOCUS_35380 gene purH 9242 7611 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105151.1 protein_id gnl|my_center|LOCUS_35380 9645 9313 gene locus_tag LOCUS_35390 gene fis 9645 9313 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121116.1 protein_id gnl|my_center|LOCUS_35390 10580 9642 gene locus_tag LOCUS_35400 gene dusB 10580 9642 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399694.1 protein_id gnl|my_center|LOCUS_35400 10947 11215 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11542 11694 gene locus_tag LOCUS_35410 11542 11694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 >Feature sequence105 1613 99 gene locus_tag LOCUS_35420 1613 99 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 protein_id gnl|my_center|LOCUS_35420 2890 1610 gene locus_tag LOCUS_35430 2890 1610 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244449.1 protein_id gnl|my_center|LOCUS_35430 4801 2933 gene locus_tag LOCUS_35440 4801 2933 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_35440 5515 5192 gene locus_tag LOCUS_35450 gene glpE 5515 5192 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085081.1 protein_id gnl|my_center|LOCUS_35450 6370 5555 gene locus_tag LOCUS_35460 6370 5555 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_35460 6784 6407 gene locus_tag LOCUS_35470 gene apaG 6784 6407 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085085.1 protein_id gnl|my_center|LOCUS_35470 7668 6781 gene locus_tag LOCUS_35480 gene rsmA 7668 6781 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768067.1 protein_id gnl|my_center|LOCUS_35480 8644 7670 gene locus_tag LOCUS_35490 gene pdxA 8644 7670 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 protein_id gnl|my_center|LOCUS_35490 9921 8641 gene locus_tag LOCUS_35500 9921 8641 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_35500 <11769 9911 gene locus_tag LOCUS_35510 <11769 9911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269131.1:LPS-assembly protein LptD >Feature sequence106 3507 2368 gene locus_tag LOCUS_35520 gene vmeJ 3507 2368 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_35520 3731 5179 gene locus_tag LOCUS_35530 3731 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35530 5151 5636 gene locus_tag LOCUS_35540 5151 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35540 5633 6103 gene locus_tag LOCUS_35550 5633 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 7038 6247 gene locus_tag LOCUS_35560 7038 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 8970 9234 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9898 11073 gene locus_tag LOCUS_35570 gene fadA 9898 11073 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245350.1 protein_id gnl|my_center|LOCUS_35570 >Feature sequence107 4065 553 gene locus_tag LOCUS_35580 gene smc 4065 553 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_35580 4742 4068 gene locus_tag LOCUS_35590 4742 4068 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083350.1 protein_id gnl|my_center|LOCUS_35590 5008 6363 gene locus_tag LOCUS_35600 gene alkB2 5008 6363 CDS product alkane 1-monooxygenase AlkB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083349.1 protein_id gnl|my_center|LOCUS_35600 7380 8222 gene locus_tag LOCUS_35610 7380 8222 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_35610 8319 10064 gene locus_tag LOCUS_35620 8319 10064 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_35620 10719 10099 gene locus_tag LOCUS_35630 10719 10099 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081997.1 protein_id gnl|my_center|LOCUS_35630 >Feature sequence108 <1 907 gene locus_tag LOCUS_35640 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338916.1:alpha-amylase family glycosyl hydrolase 1753 917 gene locus_tag LOCUS_35650 1753 917 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_35650 3049 3313 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3332 4165 gene locus_tag LOCUS_35660 3332 4165 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 protein_id gnl|my_center|LOCUS_35660 4158 5369 gene locus_tag LOCUS_35670 4158 5369 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_35670 5704 5417 gene locus_tag LOCUS_35680 5704 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 5911 6522 gene locus_tag LOCUS_35690 5911 6522 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088087.1 protein_id gnl|my_center|LOCUS_35690 8272 6533 gene locus_tag LOCUS_35700 8272 6533 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_35700 8891 8283 gene locus_tag LOCUS_35710 8891 8283 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416953.1 protein_id gnl|my_center|LOCUS_35710 8938 9236 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence109 1022 27 gene locus_tag LOCUS_35720 gene truD 1022 27 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 protein_id gnl|my_center|LOCUS_35720 1535 1056 gene locus_tag LOCUS_35730 gene ispF 1535 1056 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_35730 2261 1548 gene locus_tag LOCUS_35740 gene ispD 2261 1548 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262540.1 protein_id gnl|my_center|LOCUS_35740 2578 2261 gene locus_tag LOCUS_35750 2578 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 3972 2680 gene locus_tag LOCUS_35760 gene eno 3972 2680 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_35760 5600 4014 gene locus_tag LOCUS_35770 5600 4014 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_35770 5663 5905 gene locus_tag LOCUS_35780 5663 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 6521 6784 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6960 7199 gene locus_tag LOCUS_35790 6960 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 8059 7247 gene locus_tag LOCUS_35800 8059 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 8306 8052 gene locus_tag LOCUS_35810 8306 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 8442 8876 gene locus_tag LOCUS_35820 8442 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 9790 8903 gene locus_tag LOCUS_35830 9790 8903 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120877.1 protein_id gnl|my_center|LOCUS_35830 >Feature sequence110 539 1855 gene locus_tag LOCUS_35840 539 1855 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_35840 2018 3235 gene locus_tag LOCUS_35850 2018 3235 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_35850 3238 5721 gene locus_tag LOCUS_35860 3238 5721 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_35860 5810 6610 gene locus_tag LOCUS_35870 5810 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 6739 7791 gene locus_tag LOCUS_35880 6739 7791 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 protein_id gnl|my_center|LOCUS_35880 8227 8151 gene locus_tag LOCUS_t00430 8227 8151 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8340 8265 gene locus_tag LOCUS_t00440 8340 8265 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8420 8646 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8770 8695 gene locus_tag LOCUS_t00450 8770 8695 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8808 9041 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9183 9108 gene locus_tag LOCUS_t00460 9183 9108 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <10184 9333 gene locus_tag LOCUS_35890 <10184 9333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479069.1:multidrug efflux RND transporter permease subunit VmeK >Feature sequence111 442 1833 gene locus_tag LOCUS_35900 442 1833 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073057.1 protein_id gnl|my_center|LOCUS_35900 1830 2117 gene locus_tag LOCUS_35910 1830 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 2226 2459 gene locus_tag LOCUS_35920 2226 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 3415 2528 gene locus_tag LOCUS_35930 3415 2528 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216246.1 protein_id gnl|my_center|LOCUS_35930 3525 5147 gene locus_tag LOCUS_35940 3525 5147 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292956.1 protein_id gnl|my_center|LOCUS_35940 5144 7582 gene locus_tag LOCUS_35950 5144 7582 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993482.1 protein_id gnl|my_center|LOCUS_35950 7575 8510 gene locus_tag LOCUS_35960 gene cysD 7575 8510 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094311.1 protein_id gnl|my_center|LOCUS_35960 8510 9286 gene locus_tag LOCUS_35970 8510 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444911.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence112 880 1608 gene locus_tag LOCUS_35980 880 1608 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390821.1 protein_id gnl|my_center|LOCUS_35980 2235 1621 gene locus_tag LOCUS_35990 2235 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 2762 2265 gene locus_tag LOCUS_36000 2762 2265 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704430.1 protein_id gnl|my_center|LOCUS_36000 3223 2816 gene locus_tag LOCUS_36010 3223 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 3475 3239 gene locus_tag LOCUS_36020 3475 3239 CDS product Rad51 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074138.1 protein_id gnl|my_center|LOCUS_36020 4017 3646 gene locus_tag LOCUS_36030 4017 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 4525 4103 gene locus_tag LOCUS_36040 4525 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 6075 4639 gene locus_tag LOCUS_36050 6075 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 7868 7008 gene locus_tag LOCUS_36060 7868 7008 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495957.1 protein_id gnl|my_center|LOCUS_36060 8134 8604 gene locus_tag LOCUS_36070 8134 8604 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087637.1 protein_id gnl|my_center|LOCUS_36070 <9558 8682 gene locus_tag LOCUS_36080 <9558 8682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462594.1:DASS family sodium-coupled anion symporter >Feature sequence113 797 3580 gene locus_tag LOCUS_36090 797 3580 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210878.1 protein_id gnl|my_center|LOCUS_36090 4237 3590 gene locus_tag LOCUS_36100 4237 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 4735 4247 gene locus_tag LOCUS_36110 4735 4247 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967076.1 protein_id gnl|my_center|LOCUS_36110 4882 6282 gene locus_tag LOCUS_36120 4882 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 7214 7362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7388 7885 gene locus_tag LOCUS_36130 7388 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 7878 8804 gene locus_tag LOCUS_36140 7878 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 <9528 8814 gene locus_tag LOCUS_36150 <9528 8814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104583.1:lipase >Feature sequence114 1000 335 gene locus_tag LOCUS_36160 1000 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 2608 1019 gene locus_tag LOCUS_36170 2608 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 2802 3617 gene locus_tag LOCUS_36180 2802 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 3683 5227 gene locus_tag LOCUS_36190 3683 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 5217 5357 gene locus_tag LOCUS_36200 5217 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 5473 6234 gene locus_tag LOCUS_36210 5473 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 7281 6244 gene locus_tag LOCUS_36220 7281 6244 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206604.1 protein_id gnl|my_center|LOCUS_36220 7425 9008 gene locus_tag LOCUS_36230 7425 9008 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206603.1 protein_id gnl|my_center|LOCUS_36230 >Feature sequence115 1045 1953 gene locus_tag LOCUS_36240 1045 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106143.1 protein_id gnl|my_center|LOCUS_36240 1970 3022 gene locus_tag LOCUS_36250 1970 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 3019 3582 gene locus_tag LOCUS_36260 3019 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113522.1 protein_id gnl|my_center|LOCUS_36260 3624 5915 gene locus_tag LOCUS_36270 3624 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 5990 7540 gene locus_tag LOCUS_36280 5990 7540 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_36280 7544 8281 gene locus_tag LOCUS_36290 7544 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 8286 8729 gene locus_tag LOCUS_36300 gene rimI 8286 8729 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261268.1 protein_id gnl|my_center|LOCUS_36300 >Feature sequence116 939 1958 gene locus_tag LOCUS_36310 939 1958 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444337.1 protein_id gnl|my_center|LOCUS_36310 2676 1984 gene locus_tag LOCUS_36320 2676 1984 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103914.1 protein_id gnl|my_center|LOCUS_36320 4166 2673 gene locus_tag LOCUS_36330 4166 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 5619 4171 gene locus_tag LOCUS_36340 5619 4171 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421530.1 protein_id gnl|my_center|LOCUS_36340 6947 5868 gene locus_tag LOCUS_36350 6947 5868 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705234.1 protein_id gnl|my_center|LOCUS_36350 7672 6944 gene locus_tag LOCUS_36360 7672 6944 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705233.1 protein_id gnl|my_center|LOCUS_36360 7843 9000 gene locus_tag LOCUS_36370 7843 9000 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182976012.1 protein_id gnl|my_center|LOCUS_36370 >Feature sequence117 <1 2297 gene locus_tag LOCUS_36380 <1 2297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein 2406 4886 gene locus_tag LOCUS_36390 gene ladS 2406 4886 CDS product hybrid sensor histidine kinase/response regulator LadS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_36390 5282 4890 gene locus_tag LOCUS_36400 5282 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 5307 5558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5642 5875 gene locus_tag LOCUS_36410 5642 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 5872 6111 gene locus_tag LOCUS_36420 5872 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 6450 6187 gene locus_tag LOCUS_36430 6450 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 6459 6713 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8100 8363 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8594 8409 gene locus_tag LOCUS_36440 8594 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 >Feature sequence118 1056 373 gene locus_tag LOCUS_36450 1056 373 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_36450 1391 1053 gene locus_tag LOCUS_36460 1391 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 1495 1411 gene locus_tag LOCUS_t00470 1495 1411 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1611 2627 gene locus_tag LOCUS_36470 1611 2627 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_36470 2719 3417 gene locus_tag LOCUS_36480 2719 3417 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 protein_id gnl|my_center|LOCUS_36480 3445 4776 gene locus_tag LOCUS_36490 3445 4776 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074106.1 protein_id gnl|my_center|LOCUS_36490 4925 6187 gene locus_tag LOCUS_36500 4925 6187 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266374.1 protein_id gnl|my_center|LOCUS_36500 7092 6262 gene locus_tag LOCUS_36510 7092 6262 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707640.1 protein_id gnl|my_center|LOCUS_36510 <8886 7183 gene locus_tag LOCUS_36520 <8886 7183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096009.1:translational GTPase TypA >Feature sequence119 2911 128 gene locus_tag LOCUS_36530 2911 128 CDS product ImpA family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481876.1 protein_id gnl|my_center|LOCUS_36530 3258 2995 gene locus_tag LOCUS_36540 3258 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 3315 4379 gene locus_tag LOCUS_36550 3315 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262522.1 protein_id gnl|my_center|LOCUS_36550 4606 5014 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5037 5672 gene locus_tag LOCUS_36560 5037 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 6378 5776 gene locus_tag LOCUS_36570 6378 5776 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023187660.1 protein_id gnl|my_center|LOCUS_36570 6579 7490 gene locus_tag LOCUS_36580 gene puuE 6579 7490 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920459.1 protein_id gnl|my_center|LOCUS_36580 8121 7702 gene locus_tag LOCUS_36590 8121 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 >Feature sequence120 <1 2955 gene locus_tag LOCUS_36600 <1 2955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705231.1:multidrug efflux RND transporter permease subunit 4429 3236 gene locus_tag LOCUS_36610 4429 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 5060 4446 gene locus_tag LOCUS_36620 5060 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 5764 5075 gene locus_tag LOCUS_36630 5764 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 6288 5761 gene locus_tag LOCUS_36640 6288 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 6755 6306 gene locus_tag LOCUS_36650 6755 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 6924 7160 gene locus_tag LOCUS_36660 6924 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 7171 7449 gene locus_tag LOCUS_36670 7171 7449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 7564 7980 gene locus_tag LOCUS_36680 7564 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 >Feature sequence121 2996 279 gene locus_tag LOCUS_36690 gene acnA 2996 279 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391258.1 protein_id gnl|my_center|LOCUS_36690 3472 5883 gene locus_tag LOCUS_36700 3472 5883 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205278.1 protein_id gnl|my_center|LOCUS_36700 6076 7161 gene locus_tag LOCUS_36710 6076 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 >Feature sequence122 1019 630 gene locus_tag LOCUS_36720 1019 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 1814 1245 gene locus_tag LOCUS_36730 1814 1245 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105229.1 protein_id gnl|my_center|LOCUS_36730 2631 1990 gene locus_tag LOCUS_36740 gene ureG 2631 1990 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_36740 3509 2811 gene locus_tag LOCUS_36750 3509 2811 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 protein_id gnl|my_center|LOCUS_36750 4035 3499 gene locus_tag LOCUS_36760 gene ureE 4035 3499 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431764.1 protein_id gnl|my_center|LOCUS_36760 5784 4072 gene locus_tag LOCUS_36770 gene ureC 5784 4072 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 protein_id gnl|my_center|LOCUS_36770 6106 5795 gene locus_tag LOCUS_36780 6106 5795 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 protein_id gnl|my_center|LOCUS_36780 6468 6166 gene locus_tag LOCUS_36790 gene ureA 6468 6166 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 protein_id gnl|my_center|LOCUS_36790 7399 6515 gene locus_tag LOCUS_36800 7399 6515 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098766.1 protein_id gnl|my_center|LOCUS_36800 >Feature sequence123 456 154 gene locus_tag LOCUS_36810 456 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 1123 614 gene locus_tag LOCUS_36820 1123 614 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483274.1 protein_id gnl|my_center|LOCUS_36820 2642 1308 gene locus_tag LOCUS_36830 2642 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 2867 4036 gene locus_tag LOCUS_36840 2867 4036 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957780.1 protein_id gnl|my_center|LOCUS_36840 4033 4803 gene locus_tag LOCUS_36850 4033 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36850 4800 6017 gene locus_tag LOCUS_36860 4800 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36860 6026 7222 gene locus_tag LOCUS_36870 6026 7222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_36870 7400 7324 gene locus_tag LOCUS_t00480 7400 7324 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence124 <1 1261 gene locus_tag LOCUS_36880 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005074247.1:long-chain-acyl-CoA synthetase FadD6 3644 1293 gene locus_tag LOCUS_36890 3644 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 4009 3761 gene locus_tag LOCUS_36900 4009 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 4057 4551 gene locus_tag LOCUS_36910 gene purE 4057 4551 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394016.1 protein_id gnl|my_center|LOCUS_36910 4613 5683 gene locus_tag LOCUS_36920 4613 5683 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207670.1 protein_id gnl|my_center|LOCUS_36920 5863 6121 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7026 6583 gene locus_tag LOCUS_36930 7026 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 7197 7054 gene locus_tag LOCUS_36940 7197 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 7582 7280 gene locus_tag LOCUS_36950 7582 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence125 22 999 gene locus_tag LOCUS_36960 gene glyQ 22 999 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002044989.1 protein_id gnl|my_center|LOCUS_36960 999 3059 gene locus_tag LOCUS_36970 gene glyS 999 3059 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114646.1 protein_id gnl|my_center|LOCUS_36970 4801 3311 gene locus_tag LOCUS_36980 4801 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 6693 5017 gene locus_tag LOCUS_36990 6693 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071880.1 protein_id gnl|my_center|LOCUS_36990 >Feature sequence126 282 570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3841 719 gene locus_tag LOCUS_37000 3841 719 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 protein_id gnl|my_center|LOCUS_37000 5097 3859 gene locus_tag LOCUS_37010 5097 3859 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 protein_id gnl|my_center|LOCUS_37010 6499 5192 gene locus_tag LOCUS_37020 6499 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 6987 6496 gene locus_tag LOCUS_37030 6987 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 >Feature sequence127 <1 2192 gene locus_tag LOCUS_37040 <1 2192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005308531.1:phosphoenolpyruvate carboxylase 2398 3054 gene locus_tag LOCUS_37050 gene adk 2398 3054 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103583.1 protein_id gnl|my_center|LOCUS_37050 3690 3789 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4321 5178 gene locus_tag LOCUS_37060 4321 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 5280 6017 gene locus_tag LOCUS_37070 gene tsaB 5280 6017 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072535.1 protein_id gnl|my_center|LOCUS_37070 6038 6835 gene locus_tag LOCUS_37080 6038 6835 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_37080 >Feature sequence128 506 183 gene locus_tag LOCUS_37090 506 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 567 1229 gene locus_tag LOCUS_37100 gene queC 567 1229 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_37100 1229 1915 gene locus_tag LOCUS_37110 gene queE 1229 1915 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_37110 2931 1954 gene locus_tag LOCUS_37120 2931 1954 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 protein_id gnl|my_center|LOCUS_37120 3824 2928 gene locus_tag LOCUS_37130 gene hdfR 3824 2928 CDS product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 protein_id gnl|my_center|LOCUS_37130 3923 4270 gene locus_tag LOCUS_37140 3923 4270 CDS product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368901.1 protein_id gnl|my_center|LOCUS_37140 4263 4691 gene locus_tag LOCUS_37150 4263 4691 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_37150 4688 5593 gene locus_tag LOCUS_37160 gene rimK 4688 5593 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_37160 5909 5601 gene locus_tag LOCUS_37170 5909 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 6609 5947 gene locus_tag LOCUS_37180 6609 5947 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_37180 >Feature sequence129 559 818 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 855 995 gene locus_tag LOCUS_37190 855 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 1033 2331 gene locus_tag LOCUS_37200 1033 2331 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_37200 2767 3465 gene locus_tag LOCUS_37210 2767 3465 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_37210 3475 4218 gene locus_tag LOCUS_37220 3475 4218 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215772.1 protein_id gnl|my_center|LOCUS_37220 4867 4301 gene locus_tag LOCUS_37230 4867 4301 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_37230 4973 5548 gene locus_tag LOCUS_37240 4973 5548 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_37240 5652 6593 gene locus_tag LOCUS_37250 5652 6593 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_37250 >Feature sequence130 1093 170 gene locus_tag LOCUS_37260 1093 170 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 protein_id gnl|my_center|LOCUS_37260 2816 1122 gene locus_tag LOCUS_37270 gene betA 2816 1122 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477133.1 protein_id gnl|my_center|LOCUS_37270 4281 2827 gene locus_tag LOCUS_37280 gene betB 4281 2827 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477313.1 protein_id gnl|my_center|LOCUS_37280 4943 4293 gene locus_tag LOCUS_37290 gene betI 4943 4293 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199591.1 protein_id gnl|my_center|LOCUS_37290 6351 5236 gene locus_tag LOCUS_37300 gene zapE 6351 5236 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_37300 >Feature sequence131 584 1063 gene locus_tag LOCUS_37310 584 1063 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_37310 2109 1189 gene locus_tag LOCUS_37320 2109 1189 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_37320 2408 3349 gene locus_tag LOCUS_37330 2408 3349 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 protein_id gnl|my_center|LOCUS_37330 3353 3817 gene locus_tag LOCUS_37340 3353 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 4176 3874 gene locus_tag LOCUS_37350 4176 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 4692 4210 gene locus_tag LOCUS_37360 4692 4210 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311273.1 protein_id gnl|my_center|LOCUS_37360 4752 5099 gene locus_tag LOCUS_37370 4752 5099 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226697.1 protein_id gnl|my_center|LOCUS_37370 5096 5512 gene locus_tag LOCUS_37380 5096 5512 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039190.1 protein_id gnl|my_center|LOCUS_37380 6339 5584 gene locus_tag LOCUS_37390 6339 5584 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811624.1 protein_id gnl|my_center|LOCUS_37390 >Feature sequence132 376 107 gene locus_tag LOCUS_37400 376 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 615 376 gene locus_tag LOCUS_37410 615 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 693 835 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1604 2188 gene locus_tag LOCUS_37420 1604 2188 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551457.1 protein_id gnl|my_center|LOCUS_37420 2567 2229 gene locus_tag LOCUS_37430 2567 2229 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088126.1 protein_id gnl|my_center|LOCUS_37430 2678 3262 gene locus_tag LOCUS_37440 2678 3262 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_37440 3342 4880 gene locus_tag LOCUS_37450 3342 4880 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327689.1 protein_id gnl|my_center|LOCUS_37450 4892 6175 gene locus_tag LOCUS_37460 4892 6175 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_37460 >Feature sequence133 17 229 gene locus_tag LOCUS_37470 17 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 605 240 gene locus_tag LOCUS_37480 605 240 CDS product DUF6164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 protein_id gnl|my_center|LOCUS_37480 915 1718 gene locus_tag LOCUS_37490 915 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 3204 1702 gene locus_tag LOCUS_37500 gene lnt 3204 1702 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118259.1 protein_id gnl|my_center|LOCUS_37500 4090 3248 gene locus_tag LOCUS_37510 4090 3248 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_37510 4566 4087 gene locus_tag LOCUS_37520 gene ybeY 4566 4087 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071410.1 protein_id gnl|my_center|LOCUS_37520 5672 4563 gene locus_tag LOCUS_37530 5672 4563 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_37530 >Feature sequence134 358 1224 gene locus_tag LOCUS_37540 358 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 1351 1635 gene locus_tag LOCUS_37550 1351 1635 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_37550 1645 2904 gene locus_tag LOCUS_37560 1645 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 3162 2980 gene locus_tag LOCUS_37570 3162 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 4042 3128 gene locus_tag LOCUS_37580 4042 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 4333 4257 gene locus_tag LOCUS_t00490 4333 4257 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <5955 4469 gene locus_tag LOCUS_37590 <5955 4469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532230.1:D-(-)-3-hydroxybutyrate oligomer hydrolase >Feature sequence135 822 265 gene locus_tag LOCUS_37600 822 265 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705794.1 protein_id gnl|my_center|LOCUS_37600 3078 1120 gene locus_tag LOCUS_37610 3078 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 4077 3469 gene locus_tag LOCUS_37620 4077 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 4247 4864 gene locus_tag LOCUS_37630 4247 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531332.1 protein_id gnl|my_center|LOCUS_37630 4861 5280 gene locus_tag LOCUS_37640 4861 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 >Feature sequence136 133 387 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 441 908 gene locus_tag LOCUS_37650 441 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 1595 1011 gene locus_tag LOCUS_37660 1595 1011 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 protein_id gnl|my_center|LOCUS_37660 2608 1667 gene locus_tag LOCUS_37670 2608 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 3080 2598 gene locus_tag LOCUS_37680 3080 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 3309 5432 gene locus_tag LOCUS_37690 3309 5432 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_37690 >Feature sequence137 931 32 gene locus_tag LOCUS_37700 gene oxyR 931 32 CDS product oxidative stress transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096622.1 protein_id gnl|my_center|LOCUS_37700 1101 1952 gene locus_tag LOCUS_37710 1101 1952 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102980.1 protein_id gnl|my_center|LOCUS_37710 2398 2015 gene locus_tag LOCUS_37720 2398 2015 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_37720 4521 2407 gene locus_tag LOCUS_37730 gene spoT 4521 2407 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_37730 4779 4549 gene locus_tag LOCUS_37740 4779 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 5487 4873 gene locus_tag LOCUS_37750 gene gmk 5487 4873 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_37750 >Feature sequence138 1253 261 gene locus_tag LOCUS_37760 gene trxA 1253 261 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_37760 1484 2197 gene locus_tag LOCUS_37770 1484 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 4269 2209 gene locus_tag LOCUS_37780 gene tgpA 4269 2209 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_37780 5264 4287 gene locus_tag LOCUS_37790 5264 4287 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_37790 >Feature sequence139 122 703 gene locus_tag LOCUS_37800 122 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 1021 1274 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1344 2237 gene locus_tag LOCUS_37810 1344 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 2246 3499 gene locus_tag LOCUS_37820 gene ubiH 2246 3499 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105379.1 protein_id gnl|my_center|LOCUS_37820 3496 4704 gene locus_tag LOCUS_37830 3496 4704 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_37830 <5397 4773 gene locus_tag LOCUS_37840 <5397 4773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090915.1:protease HtpX >Feature sequence140 2014 1451 gene locus_tag LOCUS_37850 2014 1451 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808116.1 protein_id gnl|my_center|LOCUS_37850 2214 2915 gene locus_tag LOCUS_37860 2214 2915 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207075.1 protein_id gnl|my_center|LOCUS_37860 3126 4352 gene locus_tag LOCUS_37870 3126 4352 CDS product phosphatidylinositol-specific phospholipase C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849249.1 protein_id gnl|my_center|LOCUS_37870 >Feature sequence141 <1 983 gene locus_tag LOCUS_37880 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917999.1:thioredoxin 1013 1615 gene locus_tag LOCUS_37890 1013 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905778.1 protein_id gnl|my_center|LOCUS_37890 1648 1898 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3886 3005 gene locus_tag LOCUS_37900 3886 3005 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_37900 4252 5286 gene locus_tag LOCUS_37910 4252 5286 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_37910 >Feature sequence142 1221 460 gene locus_tag LOCUS_37920 1221 460 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083022.1 protein_id gnl|my_center|LOCUS_37920 1291 2892 gene locus_tag LOCUS_37930 gene gcbA 1291 2892 CDS product diguanylate cyclase GcbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106227.1 protein_id gnl|my_center|LOCUS_37930 3027 3476 gene locus_tag LOCUS_37940 gene aroQ 3027 3476 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035767.1 protein_id gnl|my_center|LOCUS_37940 3478 4368 gene locus_tag LOCUS_37950 gene prmA 3478 4368 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_37950 >Feature sequence143 <1 686 gene locus_tag LOCUS_37960 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072297.1:MATE family efflux transporter 789 1619 gene locus_tag LOCUS_37970 789 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 1694 2998 gene locus_tag LOCUS_37980 1694 2998 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401262.1 protein_id gnl|my_center|LOCUS_37980 3111 4403 gene locus_tag LOCUS_37990 3111 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 4471 4644 gene locus_tag LOCUS_38000 4471 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 >Feature sequence144 786 118 gene locus_tag LOCUS_38010 786 118 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_38010 1601 876 gene locus_tag LOCUS_38020 1601 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 2632 1778 gene locus_tag LOCUS_38030 2632 1778 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_38030 3111 3380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3393 3524 gene locus_tag LOCUS_38040 3393 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 3613 4620 gene locus_tag LOCUS_38050 3613 4620 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186428.1 protein_id gnl|my_center|LOCUS_38050 >Feature sequence145 <1 1105 gene locus_tag LOCUS_38060 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463934.1:outer membrane protein transport protein 1183 1451 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1815 2366 gene locus_tag LOCUS_38070 1815 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 2544 2804 gene locus_tag LOCUS_38080 2544 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 4406 2943 gene locus_tag LOCUS_38090 4406 2943 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073458.1 protein_id gnl|my_center|LOCUS_38090 >Feature sequence146 45 1421 gene locus_tag LOCUS_38100 45 1421 CDS product KAP family NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481767.1 protein_id gnl|my_center|LOCUS_38100 1418 2452 gene locus_tag LOCUS_38110 1418 2452 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703846.1 protein_id gnl|my_center|LOCUS_38110 2475 3341 gene locus_tag LOCUS_38120 2475 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 4277 3351 gene locus_tag LOCUS_38130 4277 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 >Feature sequence147 <1 502 gene locus_tag LOCUS_38140 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389839.1:type I glutamate--ammonia ligase 623 1642 gene locus_tag LOCUS_38150 623 1642 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_38150 1744 2214 gene locus_tag LOCUS_38160 1744 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 2494 2216 gene locus_tag LOCUS_38170 2494 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 2966 2487 gene locus_tag LOCUS_38180 2966 2487 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_38180 3111 3236 gene locus_tag LOCUS_38190 3111 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 3819 3253 gene locus_tag LOCUS_38200 3819 3253 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132451.1 protein_id gnl|my_center|LOCUS_38200 4430 4116 gene locus_tag LOCUS_38210 4430 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 4635 4423 gene locus_tag LOCUS_38220 4635 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 >Feature sequence148 467 904 gene locus_tag LOCUS_38230 467 904 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373291.1 protein_id gnl|my_center|LOCUS_38230 1073 1495 gene locus_tag LOCUS_38240 1073 1495 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529046.1 protein_id gnl|my_center|LOCUS_38240 1603 2604 gene locus_tag LOCUS_38250 1603 2604 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_38250 2849 4147 gene locus_tag LOCUS_38260 2849 4147 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706576.1 protein_id gnl|my_center|LOCUS_38260 4488 4138 gene locus_tag LOCUS_38270 4488 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 >Feature sequence149 556 1002 gene locus_tag LOCUS_38280 556 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 1031 2854 gene locus_tag LOCUS_38290 gene nrdD 1031 2854 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_38290 >Feature sequence150 1651 752 gene locus_tag LOCUS_38300 1651 752 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 protein_id gnl|my_center|LOCUS_38300 2511 1666 gene locus_tag LOCUS_38310 2511 1666 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_38310 2986 3251 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3989 4079 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence151 1281 748 gene locus_tag LOCUS_38320 1281 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 1646 1293 gene locus_tag LOCUS_38330 1646 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 1668 1917 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3145 3819 gene locus_tag LOCUS_38340 3145 3819 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084488.1 protein_id gnl|my_center|LOCUS_38340 >Feature sequence152 1661 684 gene locus_tag LOCUS_38350 1661 684 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_38350 1677 1924 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3136 2360 gene locus_tag LOCUS_38360 gene moeB 3136 2360 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_38360 4006 3137 gene locus_tag LOCUS_38370 gene prmC 4006 3137 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481360.1 protein_id gnl|my_center|LOCUS_38370 >Feature sequence153 <1 1596 gene locus_tag LOCUS_38380 <1 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114341.1:class I adenylate cyclase 1673 1807 gene locus_tag LOCUS_38390 1673 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 1816 3069 gene locus_tag LOCUS_38400 gene lysA 1816 3069 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_38400 3082 3912 gene locus_tag LOCUS_38410 gene dapF 3082 3912 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_38410 >Feature sequence154 1391 2221 gene locus_tag LOCUS_38420 1391 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 2229 2792 gene locus_tag LOCUS_38430 gene rsmD 2229 2792 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704347.1 protein_id gnl|my_center|LOCUS_38430 2922 3728 gene locus_tag LOCUS_38440 2922 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 >Feature sequence155 1570 788 gene locus_tag LOCUS_38450 1570 788 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104991.1 protein_id gnl|my_center|LOCUS_38450 3187 1595 gene locus_tag LOCUS_38460 3187 1595 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_38460 >Feature sequence156 1078 149 gene locus_tag LOCUS_38470 1078 149 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_38470 2039 1071 gene locus_tag LOCUS_38480 gene rfaD 2039 1071 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 protein_id gnl|my_center|LOCUS_38480 2129 2385 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence157 770 1375 gene locus_tag LOCUS_38490 770 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 1400 2599 gene locus_tag LOCUS_38500 1400 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 2700 3563 gene locus_tag LOCUS_38510 2700 3563 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256670.1 protein_id gnl|my_center|LOCUS_38510 >Feature sequence158 817 1515 gene locus_tag LOCUS_38520 gene tsaA 817 1515 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766043.1 protein_id gnl|my_center|LOCUS_38520 2216 1542 gene locus_tag LOCUS_38530 2216 1542 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036586.1 protein_id gnl|my_center|LOCUS_38530 2684 2328 gene locus_tag LOCUS_38540 2684 2328 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705537.1 protein_id gnl|my_center|LOCUS_38540 3371 2802 gene locus_tag LOCUS_38550 3371 2802 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence159 2134 2387 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2592 3083 gene locus_tag LOCUS_38560 2592 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 >Feature sequence160 <1 879 gene locus_tag LOCUS_38570 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704428.1:ATP-dependent helicase HrpB 1031 1594 gene locus_tag LOCUS_38580 1031 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 2873 3089 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence161 1073 213 gene locus_tag LOCUS_38590 1073 213 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 protein_id gnl|my_center|LOCUS_38590 1175 2104 gene locus_tag LOCUS_38600 1175 2104 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083971.1 protein_id gnl|my_center|LOCUS_38600 2434 2117 gene locus_tag LOCUS_38610 2434 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 3105 2479 gene locus_tag LOCUS_38620 3105 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 >Feature sequence162 2088 442 gene locus_tag LOCUS_38630 2088 442 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_38630 2261 3103 gene locus_tag LOCUS_38640 gene rsmI 2261 3103 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 protein_id gnl|my_center|LOCUS_38640 >Feature sequence163 293 2521 gene locus_tag LOCUS_38650 293 2521 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072240.1 protein_id gnl|my_center|LOCUS_38650 2721 2524 gene locus_tag LOCUS_38660 2721 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 >Feature sequence164 <1 835 gene locus_tag LOCUS_38670 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000555736.1:copper/silver sensor histidine kinase SilS 1816 1268 gene locus_tag LOCUS_38680 1816 1268 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533080.1 protein_id gnl|my_center|LOCUS_38680 >Feature sequence165 591 193 gene locus_tag LOCUS_38690 gene hslR 591 193 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654696.1 protein_id gnl|my_center|LOCUS_38690 1251 595 gene locus_tag LOCUS_38700 gene yrfG 1251 595 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769873.1 protein_id gnl|my_center|LOCUS_38700 1296 1862 gene locus_tag LOCUS_38710 gene nudE 1296 1862 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017765235.1 protein_id gnl|my_center|LOCUS_38710 <2923 1870 gene locus_tag LOCUS_38720 <2923 1870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005490914.1:ATP-binding protein >Feature sequence166 130 486 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 721 1938 gene locus_tag LOCUS_38730 721 1938 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207514.1 protein_id gnl|my_center|LOCUS_38730 2023 2271 gene locus_tag LOCUS_38740 gene tusA 2023 2271 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371482.1 protein_id gnl|my_center|LOCUS_38740 2264 2461 gene locus_tag LOCUS_38750 2264 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 >Feature sequence167 694 62 gene locus_tag LOCUS_38760 694 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 <2719 796 gene locus_tag LOCUS_38770 <2719 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114322.1:ATP-dependent helicase HrpB note possible pseudo, frameshifted 923 940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends