>Feature sequence001 488 75 gene locus_tag LOCUS_00010 488 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1431 760 gene locus_tag LOCUS_00020 1431 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2636 1593 gene locus_tag LOCUS_00030 gene argC 2636 1593 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390174.1 protein_id gnl|my_center|LOCUS_00030 3236 3952 gene locus_tag LOCUS_00040 3236 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4616 3981 gene locus_tag LOCUS_00050 4616 3981 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 protein_id gnl|my_center|LOCUS_00050 6053 4785 gene locus_tag LOCUS_00060 6053 4785 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_00060 7542 6145 gene locus_tag LOCUS_00070 gene thrC 7542 6145 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_00070 7914 8906 gene locus_tag LOCUS_00080 7914 8906 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403656.1 protein_id gnl|my_center|LOCUS_00080 11309 9000 gene locus_tag LOCUS_00090 gene clpA 11309 9000 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_00090 11642 11316 gene locus_tag LOCUS_00100 gene clpS 11642 11316 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640501.1 protein_id gnl|my_center|LOCUS_00100 12764 12168 gene locus_tag LOCUS_00110 12764 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13343 14107 gene locus_tag LOCUS_00120 13343 14107 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_00120 15479 14802 gene locus_tag LOCUS_00130 15479 14802 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_00130 16691 15840 gene locus_tag LOCUS_00140 16691 15840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18739 16745 gene locus_tag LOCUS_00150 18739 16745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20313 18877 gene locus_tag LOCUS_00160 gene tldD 20313 18877 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_00160 24355 20588 gene locus_tag LOCUS_00170 24355 20588 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 protein_id gnl|my_center|LOCUS_00170 27032 25035 gene locus_tag LOCUS_00180 27032 25035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 29289 27592 gene locus_tag LOCUS_00190 29289 27592 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390812.1 protein_id gnl|my_center|LOCUS_00190 30939 29674 gene locus_tag LOCUS_00200 gene ccrA 30939 29674 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390811.1 protein_id gnl|my_center|LOCUS_00200 31350 33377 gene locus_tag LOCUS_00210 31350 33377 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_00210 34193 33432 gene locus_tag LOCUS_00220 34193 33432 CDS product purine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387822.1 protein_id gnl|my_center|LOCUS_00220 35226 34543 gene locus_tag LOCUS_00230 35226 34543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 36962 35868 gene locus_tag LOCUS_00240 36962 35868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 37853 39655 gene locus_tag LOCUS_00250 37853 39655 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268043.1 protein_id gnl|my_center|LOCUS_00250 39888 41780 gene locus_tag LOCUS_00260 39888 41780 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_00260 42446 42787 gene locus_tag LOCUS_00270 42446 42787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 43500 42985 gene locus_tag LOCUS_00280 43500 42985 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388365.1 protein_id gnl|my_center|LOCUS_00280 >Feature sequence002 509 2128 gene locus_tag LOCUS_00290 gene ppx 509 2128 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_00290 2757 2137 gene locus_tag LOCUS_00300 2757 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 2999 3304 gene locus_tag LOCUS_00310 2999 3304 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948422.1 protein_id gnl|my_center|LOCUS_00310 4228 3392 gene locus_tag LOCUS_00320 gene mazG 4228 3392 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_00320 5539 4325 gene locus_tag LOCUS_00330 5539 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 6601 5927 gene locus_tag LOCUS_00340 6601 5927 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389373.1 protein_id gnl|my_center|LOCUS_00340 7485 6601 gene locus_tag LOCUS_00350 7485 6601 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531497.1 protein_id gnl|my_center|LOCUS_00350 8984 7608 gene locus_tag LOCUS_00360 gene trkA 8984 7608 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_00360 10605 9109 gene locus_tag LOCUS_00370 10605 9109 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_00370 12881 10635 gene locus_tag LOCUS_00380 12881 10635 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_00380 14406 12964 gene locus_tag LOCUS_00390 gene ntrC 14406 12964 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_00390 15627 14476 gene locus_tag LOCUS_00400 15627 14476 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389367.1 protein_id gnl|my_center|LOCUS_00400 16638 15631 gene locus_tag LOCUS_00410 gene dusB 16638 15631 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014411626.1 protein_id gnl|my_center|LOCUS_00410 17517 16855 gene locus_tag LOCUS_00420 gene ccsA 17517 16855 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626222.1 protein_id gnl|my_center|LOCUS_00420 18125 19348 gene locus_tag LOCUS_00430 18125 19348 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_00430 19363 19926 gene locus_tag LOCUS_00440 gene pgpA 19363 19926 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704563.1 protein_id gnl|my_center|LOCUS_00440 20025 20531 gene locus_tag LOCUS_00450 20025 20531 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531490.1 protein_id gnl|my_center|LOCUS_00450 21022 20579 gene locus_tag LOCUS_00460 21022 20579 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_00460 22053 21115 gene locus_tag LOCUS_00470 gene lipA 22053 21115 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919603.1 protein_id gnl|my_center|LOCUS_00470 23648 22236 gene locus_tag LOCUS_00480 gene lpdA 23648 22236 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389631.1 protein_id gnl|my_center|LOCUS_00480 25128 23806 gene locus_tag LOCUS_00490 25128 23806 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_00490 26725 25346 gene locus_tag LOCUS_00500 26725 25346 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389633.1 protein_id gnl|my_center|LOCUS_00500 27910 26900 gene locus_tag LOCUS_00510 gene pdhA 27910 26900 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_00510 29559 28264 gene locus_tag LOCUS_00520 29559 28264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 30335 29985 gene locus_tag LOCUS_00530 30335 29985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 31950 30676 gene locus_tag LOCUS_00540 gene eno 31950 30676 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389638.1 protein_id gnl|my_center|LOCUS_00540 32882 32043 gene locus_tag LOCUS_00550 gene kdsA 32882 32043 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389639.1 protein_id gnl|my_center|LOCUS_00550 34561 32936 gene locus_tag LOCUS_00560 34561 32936 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389640.1 protein_id gnl|my_center|LOCUS_00560 35633 35040 gene locus_tag LOCUS_00570 35633 35040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 35668 36063 gene locus_tag LOCUS_00580 35668 36063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 36832 36041 gene locus_tag LOCUS_00590 gene tpiA 36832 36041 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337104.1 protein_id gnl|my_center|LOCUS_00590 37327 39225 gene locus_tag LOCUS_00600 37327 39225 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389643.1 protein_id gnl|my_center|LOCUS_00600 39361 40866 gene locus_tag LOCUS_00610 gene trpE 39361 40866 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_00610 41136 41858 gene locus_tag LOCUS_00620 41136 41858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 42571 42377 gene locus_tag LOCUS_00630 42571 42377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 42669 43244 gene locus_tag LOCUS_00640 42669 43244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 >Feature sequence003 2354 327 gene locus_tag LOCUS_00650 2354 327 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965916.1 protein_id gnl|my_center|LOCUS_00650 2845 3975 gene locus_tag LOCUS_00660 2845 3975 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390744.1 protein_id gnl|my_center|LOCUS_00660 5686 4019 gene locus_tag LOCUS_00670 5686 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 6460 7602 gene locus_tag LOCUS_00680 6460 7602 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_00680 8049 7612 gene locus_tag LOCUS_00690 8049 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 9028 8321 gene locus_tag LOCUS_00700 9028 8321 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388715.1 protein_id gnl|my_center|LOCUS_00700 9639 9037 gene locus_tag LOCUS_00710 9639 9037 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_00710 10134 9859 gene locus_tag LOCUS_00720 10134 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 10049 11836 gene locus_tag LOCUS_00730 10049 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 12002 13945 gene locus_tag LOCUS_00740 gene asnB 12002 13945 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957840.1 protein_id gnl|my_center|LOCUS_00740 14116 15414 gene locus_tag LOCUS_00750 14116 15414 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389963.1 protein_id gnl|my_center|LOCUS_00750 16703 15585 gene locus_tag LOCUS_00760 16703 15585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 17639 16824 gene locus_tag LOCUS_00770 gene hypB 17639 16824 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337682.1 protein_id gnl|my_center|LOCUS_00770 17980 17639 gene locus_tag LOCUS_00780 gene hypA 17980 17639 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_00780 19261 18038 gene locus_tag LOCUS_00790 19261 18038 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_00790 20250 19264 gene locus_tag LOCUS_00800 gene hybE 20250 19264 CDS product [NiFe]-hydrogenase assembly chaperone HybE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338272.1 protein_id gnl|my_center|LOCUS_00800 21131 20247 gene locus_tag LOCUS_00810 21131 20247 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089674.1 protein_id gnl|my_center|LOCUS_00810 21642 21208 gene locus_tag LOCUS_00820 21642 21208 CDS product hydrogenase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338270.1 protein_id gnl|my_center|LOCUS_00820 21985 21665 gene locus_tag LOCUS_00830 21985 21665 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089676.1 protein_id gnl|my_center|LOCUS_00830 22168 23274 gene locus_tag LOCUS_00840 gene cbiB 22168 23274 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972582.1 protein_id gnl|my_center|LOCUS_00840 24091 23264 gene locus_tag LOCUS_00850 24091 23264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 25046 24165 gene locus_tag LOCUS_00860 25046 24165 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390910.1 protein_id gnl|my_center|LOCUS_00860 25545 26207 gene locus_tag LOCUS_00870 25545 26207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 26980 28677 gene locus_tag LOCUS_00880 26980 28677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 30591 28786 gene locus_tag LOCUS_00890 30591 28786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 32789 30588 gene locus_tag LOCUS_00900 32789 30588 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_00900 33153 32824 gene locus_tag LOCUS_00910 33153 32824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 33574 33251 gene locus_tag LOCUS_00920 33574 33251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 34638 33634 gene locus_tag LOCUS_00930 34638 33634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 34956 39461 gene locus_tag LOCUS_00940 34956 39461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 40126 39473 gene locus_tag LOCUS_00950 40126 39473 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501624.1 protein_id gnl|my_center|LOCUS_00950 >Feature sequence004 1470 112 gene locus_tag LOCUS_00960 gene amt 1470 112 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 protein_id gnl|my_center|LOCUS_00960 1881 1543 gene locus_tag LOCUS_00970 1881 1543 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528889.1 protein_id gnl|my_center|LOCUS_00970 2904 4121 gene locus_tag LOCUS_00980 2904 4121 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_00980 4364 5143 gene locus_tag LOCUS_00990 4364 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 5647 5270 gene locus_tag LOCUS_01000 5647 5270 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_01000 6036 5818 gene locus_tag LOCUS_01010 6036 5818 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709672.1 protein_id gnl|my_center|LOCUS_01010 11044 6122 gene locus_tag LOCUS_01020 11044 6122 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_01020 11642 12157 gene locus_tag LOCUS_01030 11642 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 12760 13176 gene locus_tag LOCUS_01040 12760 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 13439 14629 gene locus_tag LOCUS_01050 13439 14629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 15374 14850 gene locus_tag LOCUS_01060 15374 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 15573 15944 gene locus_tag LOCUS_01070 15573 15944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 15941 16882 gene locus_tag LOCUS_01080 15941 16882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 17657 16992 gene locus_tag LOCUS_01090 17657 16992 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384515.1 protein_id gnl|my_center|LOCUS_01090 17717 18121 gene locus_tag LOCUS_01100 17717 18121 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_01100 18370 18660 gene locus_tag LOCUS_01110 18370 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 19184 20398 gene locus_tag LOCUS_01120 19184 20398 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946961.1 protein_id gnl|my_center|LOCUS_01120 22498 20426 gene locus_tag LOCUS_01130 22498 20426 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 protein_id gnl|my_center|LOCUS_01130 25651 22727 gene locus_tag LOCUS_01140 25651 22727 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387994.1 protein_id gnl|my_center|LOCUS_01140 28384 25802 gene locus_tag LOCUS_01150 28384 25802 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_01150 31136 30885 gene locus_tag LOCUS_01160 31136 30885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 32012 31290 gene locus_tag LOCUS_01170 32012 31290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 33249 32329 gene locus_tag LOCUS_01180 33249 32329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 33778 33311 gene locus_tag LOCUS_01190 33778 33311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 33955 34365 gene locus_tag LOCUS_01200 33955 34365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 34429 34644 gene locus_tag LOCUS_01210 34429 34644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 34756 35445 gene locus_tag LOCUS_01220 34756 35445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 35698 36189 gene locus_tag LOCUS_01230 35698 36189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 38228 36210 gene locus_tag LOCUS_01240 38228 36210 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989412.1 protein_id gnl|my_center|LOCUS_01240 38870 38796 gene locus_tag LOCUS_t00010 38870 38796 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 39314 39859 gene locus_tag LOCUS_01250 39314 39859 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence005 2284 44 gene locus_tag LOCUS_01260 2284 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 4900 4130 gene locus_tag LOCUS_01270 4900 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 5230 5069 gene locus_tag LOCUS_01280 5230 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 5483 6376 gene locus_tag LOCUS_01290 5483 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 6732 7859 gene locus_tag LOCUS_01300 gene vexE 6732 7859 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484214.1 protein_id gnl|my_center|LOCUS_01300 8012 11182 gene locus_tag LOCUS_01310 8012 11182 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_01310 12108 13742 gene locus_tag LOCUS_01320 12108 13742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 14715 13873 gene locus_tag LOCUS_01330 gene trpC 14715 13873 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314425.1 protein_id gnl|my_center|LOCUS_01330 15844 14807 gene locus_tag LOCUS_01340 gene trpD 15844 14807 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087577.1 protein_id gnl|my_center|LOCUS_01340 16567 15992 gene locus_tag LOCUS_01350 16567 15992 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_01350 17270 18409 gene locus_tag LOCUS_01360 17270 18409 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389646.1 protein_id gnl|my_center|LOCUS_01360 18893 19750 gene locus_tag LOCUS_01370 18893 19750 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 protein_id gnl|my_center|LOCUS_01370 20253 20690 gene locus_tag LOCUS_01380 gene infC 20253 20690 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_01380 20874 21317 gene locus_tag LOCUS_01390 20874 21317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 23416 21434 gene locus_tag LOCUS_01400 23416 21434 CDS product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057696.1 protein_id gnl|my_center|LOCUS_01400 23827 23492 gene locus_tag LOCUS_01410 23827 23492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 23983 24852 gene locus_tag LOCUS_01420 23983 24852 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038652.1 protein_id gnl|my_center|LOCUS_01420 24888 25916 gene locus_tag LOCUS_01430 24888 25916 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108007.1 protein_id gnl|my_center|LOCUS_01430 26002 27021 gene locus_tag LOCUS_01440 26002 27021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 27006 27494 gene locus_tag LOCUS_01450 27006 27494 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071958.1 protein_id gnl|my_center|LOCUS_01450 27633 29252 gene locus_tag LOCUS_01460 27633 29252 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385275.1 protein_id gnl|my_center|LOCUS_01460 29324 29962 gene locus_tag LOCUS_01470 29324 29962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 30588 29953 gene locus_tag LOCUS_01480 30588 29953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 30732 31868 gene locus_tag LOCUS_01490 30732 31868 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_01490 32115 32378 gene locus_tag LOCUS_01500 32115 32378 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970195.1 protein_id gnl|my_center|LOCUS_01500 33608 32499 gene locus_tag LOCUS_01510 33608 32499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 >Feature sequence006 <1 2537 gene locus_tag LOCUS_01520 <1 2537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389457.1:DNA polymerase III subunit alpha 2963 3772 gene locus_tag LOCUS_01530 gene rpsB 2963 3772 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389461.1 protein_id gnl|my_center|LOCUS_01530 4237 5163 gene locus_tag LOCUS_01540 gene tsf 4237 5163 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_01540 5528 6277 gene locus_tag LOCUS_01550 gene pyrH 5528 6277 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919787.1 protein_id gnl|my_center|LOCUS_01550 6278 6838 gene locus_tag LOCUS_01560 gene frr 6278 6838 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389464.1 protein_id gnl|my_center|LOCUS_01560 6843 7571 gene locus_tag LOCUS_01570 6843 7571 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389465.1 protein_id gnl|my_center|LOCUS_01570 7613 8527 gene locus_tag LOCUS_01580 7613 8527 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389466.1 protein_id gnl|my_center|LOCUS_01580 8518 9741 gene locus_tag LOCUS_01590 8518 9741 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_01590 9911 11029 gene locus_tag LOCUS_01600 gene rseP 9911 11029 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312540.1 protein_id gnl|my_center|LOCUS_01600 11158 13440 gene locus_tag LOCUS_01610 gene bamA 11158 13440 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440405.1 protein_id gnl|my_center|LOCUS_01610 13644 14246 gene locus_tag LOCUS_01620 13644 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 14267 15307 gene locus_tag LOCUS_01630 gene lpxD 14267 15307 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596698.1 protein_id gnl|my_center|LOCUS_01630 15300 15767 gene locus_tag LOCUS_01640 gene fabZ 15300 15767 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 protein_id gnl|my_center|LOCUS_01640 15767 16579 gene locus_tag LOCUS_01650 gene lpxA 15767 16579 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 protein_id gnl|my_center|LOCUS_01650 16782 17639 gene locus_tag LOCUS_01660 gene lpxI 16782 17639 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389473.1 protein_id gnl|my_center|LOCUS_01660 17626 18822 gene locus_tag LOCUS_01670 gene lpxB 17626 18822 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337682.1 protein_id gnl|my_center|LOCUS_01670 19198 18851 gene locus_tag LOCUS_01680 gene arsC 19198 18851 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208565.1 protein_id gnl|my_center|LOCUS_01680 20015 19236 gene locus_tag LOCUS_01690 20015 19236 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 protein_id gnl|my_center|LOCUS_01690 20495 20106 gene locus_tag LOCUS_01700 gene erpA 20495 20106 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389534.1 protein_id gnl|my_center|LOCUS_01700 20677 21864 gene locus_tag LOCUS_01710 20677 21864 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389533.1 protein_id gnl|my_center|LOCUS_01710 22153 23964 gene locus_tag LOCUS_01720 gene argS 22153 23964 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389532.1 protein_id gnl|my_center|LOCUS_01720 23964 25322 gene locus_tag LOCUS_01730 23964 25322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 25580 26611 gene locus_tag LOCUS_01740 gene nagZ 25580 26611 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_01740 26663 27748 gene locus_tag LOCUS_01750 26663 27748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 27771 28469 gene locus_tag LOCUS_01760 gene scpB 27771 28469 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389527.1 protein_id gnl|my_center|LOCUS_01760 29028 29273 gene locus_tag LOCUS_01770 29028 29273 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087519.1 protein_id gnl|my_center|LOCUS_01770 29410 29943 gene locus_tag LOCUS_01780 29410 29943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 29978 30826 gene locus_tag LOCUS_01790 gene tatC 29978 30826 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389524.1 protein_id gnl|my_center|LOCUS_01790 30887 32200 gene locus_tag LOCUS_01800 gene serS 30887 32200 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971811.1 protein_id gnl|my_center|LOCUS_01800 32193 33008 gene locus_tag LOCUS_01810 gene surE 32193 33008 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389522.1 protein_id gnl|my_center|LOCUS_01810 >Feature sequence007 2323 1478 gene locus_tag LOCUS_01820 2323 1478 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_01820 2752 3219 gene locus_tag LOCUS_01830 2752 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 4148 3216 gene locus_tag LOCUS_01840 4148 3216 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390908.1 protein_id gnl|my_center|LOCUS_01840 6297 4345 gene locus_tag LOCUS_01850 gene acs 6297 4345 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_01850 6824 7558 gene locus_tag LOCUS_01860 6824 7558 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390008.1 protein_id gnl|my_center|LOCUS_01860 8446 7619 gene locus_tag LOCUS_01870 8446 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 9248 8841 gene locus_tag LOCUS_01880 9248 8841 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_01880 9595 9245 gene locus_tag LOCUS_01890 9595 9245 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_01890 10443 9592 gene locus_tag LOCUS_01900 10443 9592 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_01900 11194 10460 gene locus_tag LOCUS_01910 11194 10460 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_01910 12253 13170 gene locus_tag LOCUS_01920 12253 13170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 13431 14594 gene locus_tag LOCUS_01930 gene rlmN 13431 14594 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 protein_id gnl|my_center|LOCUS_01930 14718 15833 gene locus_tag LOCUS_01940 gene ald 14718 15833 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477975.1 protein_id gnl|my_center|LOCUS_01940 16202 16020 gene locus_tag LOCUS_01950 16202 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 16460 16293 gene locus_tag LOCUS_01960 16460 16293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 18803 16470 gene locus_tag LOCUS_01970 18803 16470 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089908.1 protein_id gnl|my_center|LOCUS_01970 21893 19641 gene locus_tag LOCUS_01980 21893 19641 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337150.1 protein_id gnl|my_center|LOCUS_01980 22442 23377 gene locus_tag LOCUS_01990 22442 23377 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_01990 25046 23613 gene locus_tag LOCUS_02000 25046 23613 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266356.1 protein_id gnl|my_center|LOCUS_02000 26053 25094 gene locus_tag LOCUS_02010 26053 25094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 26616 26816 gene locus_tag LOCUS_02020 26616 26816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 26994 27173 gene locus_tag LOCUS_02030 26994 27173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 27166 27462 gene locus_tag LOCUS_02040 27166 27462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 27617 27841 gene locus_tag LOCUS_02050 27617 27841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 28379 29743 gene locus_tag LOCUS_02060 gene urtA 28379 29743 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_02060 29740 32607 gene locus_tag LOCUS_02070 29740 32607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 >Feature sequence008 1185 139 gene locus_tag LOCUS_02080 1185 139 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706078.1 protein_id gnl|my_center|LOCUS_02080 4567 1262 gene locus_tag LOCUS_02090 4567 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 5751 4630 gene locus_tag LOCUS_02100 5751 4630 CDS product autoinducer 2-binding periplasmic protein LuxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463467.1 protein_id gnl|my_center|LOCUS_02100 6396 7049 gene locus_tag LOCUS_02110 6396 7049 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694191.1 protein_id gnl|my_center|LOCUS_02110 7246 7785 gene locus_tag LOCUS_02120 7246 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 9253 8027 gene locus_tag LOCUS_02130 9253 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 10610 9570 gene locus_tag LOCUS_02140 10610 9570 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391186.1 protein_id gnl|my_center|LOCUS_02140 10834 11541 gene locus_tag LOCUS_02150 10834 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 11581 12129 gene locus_tag LOCUS_02160 gene tsaE 11581 12129 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 protein_id gnl|my_center|LOCUS_02160 12224 13291 gene locus_tag LOCUS_02170 12224 13291 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_02170 13377 15338 gene locus_tag LOCUS_02180 13377 15338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 15571 16410 gene locus_tag LOCUS_02190 15571 16410 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_02190 17206 16499 gene locus_tag LOCUS_02200 17206 16499 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_02200 19550 17865 gene locus_tag LOCUS_02210 19550 17865 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090030.1 protein_id gnl|my_center|LOCUS_02210 20149 21738 gene locus_tag LOCUS_02220 20149 21738 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388306.1 protein_id gnl|my_center|LOCUS_02220 21900 22568 gene locus_tag LOCUS_02230 21900 22568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 22794 25061 gene locus_tag LOCUS_02240 22794 25061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 25324 27648 gene locus_tag LOCUS_02250 25324 27648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 28128 28448 gene locus_tag LOCUS_02260 28128 28448 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 protein_id gnl|my_center|LOCUS_02260 29337 31067 gene locus_tag LOCUS_02270 gene fliF 29337 31067 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388303.1 protein_id gnl|my_center|LOCUS_02270 31334 31510 gene locus_tag LOCUS_02280 31334 31510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence009 591 133 gene locus_tag LOCUS_02290 gene ruvX 591 133 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384481.1 protein_id gnl|my_center|LOCUS_02290 1267 698 gene locus_tag LOCUS_02300 1267 698 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921584.1 protein_id gnl|my_center|LOCUS_02300 1539 2309 gene locus_tag LOCUS_02310 gene gloB 1539 2309 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 protein_id gnl|my_center|LOCUS_02310 2413 3027 gene locus_tag LOCUS_02320 2413 3027 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113265.1 protein_id gnl|my_center|LOCUS_02320 3265 3732 gene locus_tag LOCUS_02330 3265 3732 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310369.1 protein_id gnl|my_center|LOCUS_02330 3883 4293 gene locus_tag LOCUS_02340 3883 4293 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881117.1 protein_id gnl|my_center|LOCUS_02340 4911 4495 gene locus_tag LOCUS_02350 gene dksA 4911 4495 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390474.1 protein_id gnl|my_center|LOCUS_02350 5888 5472 gene locus_tag LOCUS_02360 gene fliX 5888 5472 CDS product flagellar assembly regulator FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920437.1 protein_id gnl|my_center|LOCUS_02360 7263 8366 gene locus_tag LOCUS_02370 7263 8366 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390476.1 protein_id gnl|my_center|LOCUS_02370 8366 9232 gene locus_tag LOCUS_02380 8366 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 9236 9682 gene locus_tag LOCUS_02390 9236 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 9915 12809 gene locus_tag LOCUS_02400 9915 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 12927 14135 gene locus_tag LOCUS_02410 12927 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 14651 15184 gene locus_tag LOCUS_02420 14651 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 16314 15499 gene locus_tag LOCUS_02430 16314 15499 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974679.1 protein_id gnl|my_center|LOCUS_02430 16557 17405 gene locus_tag LOCUS_02440 16557 17405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 17524 17438 gene locus_tag LOCUS_t00020 17524 17438 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17858 18628 gene locus_tag LOCUS_02450 gene lipB 17858 18628 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337049.1 protein_id gnl|my_center|LOCUS_02450 18695 19930 gene locus_tag LOCUS_02460 18695 19930 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626386.1 protein_id gnl|my_center|LOCUS_02460 20162 21538 gene locus_tag LOCUS_02470 20162 21538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 21631 23538 gene locus_tag LOCUS_02480 gene asnB 21631 23538 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_02480 23664 25151 gene locus_tag LOCUS_02490 23664 25151 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_02490 25247 26083 gene locus_tag LOCUS_02500 25247 26083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 26166 26921 gene locus_tag LOCUS_02510 26166 26921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 28737 28952 gene locus_tag LOCUS_02520 28737 28952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 29610 29443 gene locus_tag LOCUS_02530 29610 29443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 >Feature sequence010 861 2384 gene locus_tag LOCUS_02540 861 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 3088 4614 gene locus_tag LOCUS_02550 gene fliC 3088 4614 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112503.1 protein_id gnl|my_center|LOCUS_02550 4813 6156 gene locus_tag LOCUS_02560 4813 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 7432 6266 gene locus_tag LOCUS_02570 gene amrS 7432 6266 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_02570 7643 9001 gene locus_tag LOCUS_02580 gene amrB 7643 9001 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_02580 9297 9037 gene locus_tag LOCUS_02590 9297 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 10379 9312 gene locus_tag LOCUS_02600 10379 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 11185 10376 gene locus_tag LOCUS_02610 11185 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 11819 11313 gene locus_tag LOCUS_02620 11819 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 12605 11901 gene locus_tag LOCUS_02630 12605 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 12709 13629 gene locus_tag LOCUS_02640 12709 13629 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966596.1 protein_id gnl|my_center|LOCUS_02640 14580 13741 gene locus_tag LOCUS_02650 14580 13741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 15205 14621 gene locus_tag LOCUS_02660 15205 14621 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104740.1 protein_id gnl|my_center|LOCUS_02660 15683 16651 gene locus_tag LOCUS_02670 15683 16651 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625927.1 protein_id gnl|my_center|LOCUS_02670 16761 17789 gene locus_tag LOCUS_02680 16761 17789 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_02680 17789 20785 gene locus_tag LOCUS_02690 17789 20785 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388124.1 protein_id gnl|my_center|LOCUS_02690 20877 23150 gene locus_tag LOCUS_02700 20877 23150 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537861.1 protein_id gnl|my_center|LOCUS_02700 23711 24730 gene locus_tag LOCUS_02710 23711 24730 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441684.1 protein_id gnl|my_center|LOCUS_02710 24953 25831 gene locus_tag LOCUS_02720 24953 25831 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056735.1 protein_id gnl|my_center|LOCUS_02720 26084 26767 gene locus_tag LOCUS_02730 gene cmk 26084 26767 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388047.1 protein_id gnl|my_center|LOCUS_02730 27097 28812 gene locus_tag LOCUS_02740 gene rpsA 27097 28812 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388046.1 protein_id gnl|my_center|LOCUS_02740 >Feature sequence011 544 957 gene locus_tag LOCUS_02750 544 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 1354 974 gene locus_tag LOCUS_02760 1354 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 1753 1382 gene locus_tag LOCUS_02770 1753 1382 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067579.1 protein_id gnl|my_center|LOCUS_02770 2322 3113 gene locus_tag LOCUS_02780 2322 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4105 3272 gene locus_tag LOCUS_02790 gene recO 4105 3272 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722424.1 protein_id gnl|my_center|LOCUS_02790 4491 4949 gene locus_tag LOCUS_02800 4491 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 5828 5049 gene locus_tag LOCUS_02810 5828 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 7165 6035 gene locus_tag LOCUS_02820 gene hemB 7165 6035 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_02820 7492 8616 gene locus_tag LOCUS_02830 7492 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 9416 8841 gene locus_tag LOCUS_02840 9416 8841 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391245.1 protein_id gnl|my_center|LOCUS_02840 9953 9465 gene locus_tag LOCUS_02850 9953 9465 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391244.1 protein_id gnl|my_center|LOCUS_02850 10625 10044 gene locus_tag LOCUS_02860 10625 10044 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_02860 13200 10771 gene locus_tag LOCUS_02870 13200 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 13732 14166 gene locus_tag LOCUS_02880 13732 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02880 14340 14885 gene locus_tag LOCUS_02890 14340 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02890 14988 15449 gene locus_tag LOCUS_02900 14988 15449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 16419 16928 gene locus_tag LOCUS_02910 16419 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 17248 17847 gene locus_tag LOCUS_02920 17248 17847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 19202 17997 gene locus_tag LOCUS_02930 19202 17997 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440341.1 protein_id gnl|my_center|LOCUS_02930 20806 19424 gene locus_tag LOCUS_02940 20806 19424 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 protein_id gnl|my_center|LOCUS_02940 21261 21061 gene locus_tag LOCUS_02950 21261 21061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 22648 21428 gene locus_tag LOCUS_02960 22648 21428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 23584 22739 gene locus_tag LOCUS_02970 23584 22739 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_02970 23852 23595 gene locus_tag LOCUS_02980 gene grxC 23852 23595 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_02980 25078 24029 gene locus_tag LOCUS_02990 25078 24029 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384656.1 protein_id gnl|my_center|LOCUS_02990 25663 26856 gene locus_tag LOCUS_03000 25663 26856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 27376 28317 gene locus_tag LOCUS_03010 27376 28317 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388154.1 protein_id gnl|my_center|LOCUS_03010 >Feature sequence012 578 42 gene locus_tag LOCUS_03020 578 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 1844 738 gene locus_tag LOCUS_03030 1844 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 2852 1860 gene locus_tag LOCUS_03040 2852 1860 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_03040 3877 2999 gene locus_tag LOCUS_03050 3877 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 6661 4250 gene locus_tag LOCUS_03060 6661 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 7026 7760 gene locus_tag LOCUS_03070 7026 7760 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092229.1 protein_id gnl|my_center|LOCUS_03070 7792 8580 gene locus_tag LOCUS_03080 7792 8580 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814689.1 protein_id gnl|my_center|LOCUS_03080 8663 9955 gene locus_tag LOCUS_03090 8663 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 10778 9981 gene locus_tag LOCUS_03100 gene yaaA 10778 9981 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704335.1 protein_id gnl|my_center|LOCUS_03100 12148 11054 gene locus_tag LOCUS_03110 12148 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 13053 12586 gene locus_tag LOCUS_03120 13053 12586 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_03120 13755 14711 gene locus_tag LOCUS_03130 gene trxB 13755 14711 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_03130 15011 15904 gene locus_tag LOCUS_03140 15011 15904 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_03140 16220 17740 gene locus_tag LOCUS_03150 16220 17740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 21030 17863 gene locus_tag LOCUS_03160 21030 17863 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_03160 22568 21036 gene locus_tag LOCUS_03170 22568 21036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 23207 22719 gene locus_tag LOCUS_03180 23207 22719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 23887 24144 gene locus_tag LOCUS_03190 23887 24144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 25087 24275 gene locus_tag LOCUS_03200 25087 24275 CDS product manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338754.1 protein_id gnl|my_center|LOCUS_03200 25787 25332 gene locus_tag LOCUS_03210 25787 25332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 26444 26797 gene locus_tag LOCUS_03220 26444 26797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 28367 26967 gene locus_tag LOCUS_03230 28367 26967 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_03230 >Feature sequence013 1026 367 gene locus_tag LOCUS_03240 1026 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 1864 2853 gene locus_tag LOCUS_03250 1864 2853 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_03250 3432 2983 gene locus_tag LOCUS_03260 3432 2983 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391539.1 protein_id gnl|my_center|LOCUS_03260 4584 3589 gene locus_tag LOCUS_03270 4584 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 5073 5414 gene locus_tag LOCUS_03280 5073 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 5542 6489 gene locus_tag LOCUS_03290 gene xerD 5542 6489 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970125.1 protein_id gnl|my_center|LOCUS_03290 7960 6557 gene locus_tag LOCUS_03300 7960 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 10163 8064 gene locus_tag LOCUS_03310 10163 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 19782 10579 gene locus_tag LOCUS_03320 19782 10579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 21174 22349 gene locus_tag LOCUS_03330 21174 22349 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390308.1 protein_id gnl|my_center|LOCUS_03330 23900 22458 gene locus_tag LOCUS_03340 23900 22458 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_03340 24624 25403 gene locus_tag LOCUS_03350 24624 25403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532381.1 protein_id gnl|my_center|LOCUS_03350 25473 26435 gene locus_tag LOCUS_03360 25473 26435 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532380.1 protein_id gnl|my_center|LOCUS_03360 26437 27444 gene locus_tag LOCUS_03370 26437 27444 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532379.1 protein_id gnl|my_center|LOCUS_03370 >Feature sequence014 566 1267 gene locus_tag LOCUS_03380 566 1267 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216474.1 protein_id gnl|my_center|LOCUS_03380 1575 1937 gene locus_tag LOCUS_03390 1575 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 3641 2166 gene locus_tag LOCUS_03400 3641 2166 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103710.1 protein_id gnl|my_center|LOCUS_03400 4756 5541 gene locus_tag LOCUS_03410 4756 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 5661 6116 gene locus_tag LOCUS_03420 5661 6116 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090228.1 protein_id gnl|my_center|LOCUS_03420 6460 7515 gene locus_tag LOCUS_03430 6460 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7696 8613 gene locus_tag LOCUS_03440 7696 8613 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_03440 8610 9422 gene locus_tag LOCUS_03450 8610 9422 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440275.1 protein_id gnl|my_center|LOCUS_03450 9710 10240 gene locus_tag LOCUS_03460 9710 10240 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391279.1 protein_id gnl|my_center|LOCUS_03460 10378 10932 gene locus_tag LOCUS_03470 10378 10932 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_03470 11525 12139 gene locus_tag LOCUS_03480 11525 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 12243 13823 gene locus_tag LOCUS_03490 gene nusA 12243 13823 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_03490 13877 14704 gene locus_tag LOCUS_03500 13877 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 15030 18065 gene locus_tag LOCUS_03510 15030 18065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 18208 18618 gene locus_tag LOCUS_03520 gene rbfA 18208 18618 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083604.1 protein_id gnl|my_center|LOCUS_03520 18762 19703 gene locus_tag LOCUS_03530 gene truB 18762 19703 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391530.1 protein_id gnl|my_center|LOCUS_03530 19749 20195 gene locus_tag LOCUS_03540 19749 20195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 20972 23083 gene locus_tag LOCUS_03550 gene pnp 20972 23083 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391532.1 protein_id gnl|my_center|LOCUS_03550 23152 24027 gene locus_tag LOCUS_03560 23152 24027 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391533.1 protein_id gnl|my_center|LOCUS_03560 24183 24959 gene locus_tag LOCUS_03570 24183 24959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 25751 27148 gene locus_tag LOCUS_03580 25751 27148 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_03580 27600 28076 gene locus_tag LOCUS_03590 27600 28076 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_03590 >Feature sequence015 1496 279 gene locus_tag LOCUS_03600 gene hemA 1496 279 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257975.1 protein_id gnl|my_center|LOCUS_03600 2192 4621 gene locus_tag LOCUS_03610 2192 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4757 5812 gene locus_tag LOCUS_03620 4757 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388512.1 protein_id gnl|my_center|LOCUS_03620 6551 6363 gene locus_tag LOCUS_03630 6551 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 6979 6815 gene locus_tag LOCUS_03640 6979 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 8419 7235 gene locus_tag LOCUS_03650 8419 7235 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 protein_id gnl|my_center|LOCUS_03650 9085 10770 gene locus_tag LOCUS_03660 9085 10770 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090030.1 protein_id gnl|my_center|LOCUS_03660 11387 11959 gene locus_tag LOCUS_03670 11387 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 13264 11981 gene locus_tag LOCUS_03680 13264 11981 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525489.1 protein_id gnl|my_center|LOCUS_03680 13615 14745 gene locus_tag LOCUS_03690 13615 14745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 15079 16650 gene locus_tag LOCUS_03700 15079 16650 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 protein_id gnl|my_center|LOCUS_03700 16647 17495 gene locus_tag LOCUS_03710 16647 17495 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390821.1 protein_id gnl|my_center|LOCUS_03710 17508 18233 gene locus_tag LOCUS_03720 17508 18233 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_03720 18291 20393 gene locus_tag LOCUS_03730 gene chvG 18291 20393 CDS product two-component system sensor histidine kinase ChvG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210431003.1 protein_id gnl|my_center|LOCUS_03730 20393 20929 gene locus_tag LOCUS_03740 20393 20929 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_03740 20939 21919 gene locus_tag LOCUS_03750 gene rapZ 20939 21919 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470669.1 protein_id gnl|my_center|LOCUS_03750 22250 22690 gene locus_tag LOCUS_03760 22250 22690 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_03760 22999 23328 gene locus_tag LOCUS_03770 22999 23328 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844956.1 protein_id gnl|my_center|LOCUS_03770 23318 25129 gene locus_tag LOCUS_03780 gene ptsP 23318 25129 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391192.1 protein_id gnl|my_center|LOCUS_03780 >Feature sequence016 2576 1209 gene locus_tag LOCUS_03790 gene gltX 2576 1209 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388446.1 protein_id gnl|my_center|LOCUS_03790 6057 2791 gene locus_tag LOCUS_03800 6057 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 6595 6717 gene locus_tag LOCUS_03810 6595 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 9012 6901 gene locus_tag LOCUS_03820 9012 6901 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390299.1 protein_id gnl|my_center|LOCUS_03820 10734 9436 gene locus_tag LOCUS_03830 10734 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 10896 11825 gene locus_tag LOCUS_03840 10896 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 12166 12567 gene locus_tag LOCUS_03850 12166 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 12636 15926 gene locus_tag LOCUS_03860 gene addB 12636 15926 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_03860 15923 19666 gene locus_tag LOCUS_03870 gene addA 15923 19666 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_03870 20005 20331 gene locus_tag LOCUS_03880 gene trxA 20005 20331 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 protein_id gnl|my_center|LOCUS_03880 20542 21822 gene locus_tag LOCUS_03890 20542 21822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 21822 25004 gene locus_tag LOCUS_03900 21822 25004 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_03900 25091 25477 gene locus_tag LOCUS_03910 25091 25477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence017 769 422 gene locus_tag LOCUS_03920 769 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1690 2862 gene locus_tag LOCUS_03930 1690 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 3475 4527 gene locus_tag LOCUS_03940 3475 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 4738 4920 gene locus_tag LOCUS_03950 4738 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 6699 4924 gene locus_tag LOCUS_03960 gene ngg 6699 4924 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969277.1 protein_id gnl|my_center|LOCUS_03960 8597 6807 gene locus_tag LOCUS_03970 8597 6807 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975341.1 protein_id gnl|my_center|LOCUS_03970 10295 8715 gene locus_tag LOCUS_03980 gene rpoN 10295 8715 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387771.1 protein_id gnl|my_center|LOCUS_03980 10515 10306 gene locus_tag LOCUS_03990 10515 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 11422 10469 gene locus_tag LOCUS_04000 gene lptB 11422 10469 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_04000 12910 11954 gene locus_tag LOCUS_04010 12910 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387773.1 protein_id gnl|my_center|LOCUS_04010 14251 12911 gene locus_tag LOCUS_04020 14251 12911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 15278 14241 gene locus_tag LOCUS_04030 15278 14241 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625856.1 protein_id gnl|my_center|LOCUS_04030 16014 15403 gene locus_tag LOCUS_04040 16014 15403 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538033.1 protein_id gnl|my_center|LOCUS_04040 17068 16208 gene locus_tag LOCUS_04050 17068 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 18207 17065 gene locus_tag LOCUS_04060 18207 17065 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028053720.1 protein_id gnl|my_center|LOCUS_04060 18547 18882 gene locus_tag LOCUS_04070 18547 18882 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530104.1 protein_id gnl|my_center|LOCUS_04070 19295 19774 gene locus_tag LOCUS_04080 19295 19774 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719468.1 protein_id gnl|my_center|LOCUS_04080 20123 21265 gene locus_tag LOCUS_04090 20123 21265 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003620.1 protein_id gnl|my_center|LOCUS_04090 21543 22403 gene locus_tag LOCUS_04100 21543 22403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_04100 22478 23437 gene locus_tag LOCUS_04110 22478 23437 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337787.1 protein_id gnl|my_center|LOCUS_04110 >Feature sequence018 1598 309 gene locus_tag LOCUS_04120 1598 309 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_04120 2012 1668 gene locus_tag LOCUS_04130 2012 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2117 3190 gene locus_tag LOCUS_04140 2117 3190 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_04140 3383 3697 gene locus_tag LOCUS_04150 3383 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6221 3906 gene locus_tag LOCUS_04160 6221 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 6542 6330 gene locus_tag LOCUS_04170 gene ccoS 6542 6330 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391070.1 protein_id gnl|my_center|LOCUS_04170 8982 6601 gene locus_tag LOCUS_04180 8982 6601 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_04180 9512 8979 gene locus_tag LOCUS_04190 9512 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 10990 9509 gene locus_tag LOCUS_04200 gene ccoG 10990 9509 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 protein_id gnl|my_center|LOCUS_04200 11141 11380 gene locus_tag LOCUS_04210 11141 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 12284 11409 gene locus_tag LOCUS_04220 gene ccoP 12284 11409 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316282.1 protein_id gnl|my_center|LOCUS_04220 13207 12482 gene locus_tag LOCUS_04230 gene ccoO 13207 12482 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967401.1 protein_id gnl|my_center|LOCUS_04230 14716 13220 gene locus_tag LOCUS_04240 gene ccoN 14716 13220 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391079.1 protein_id gnl|my_center|LOCUS_04240 15559 16347 gene locus_tag LOCUS_04250 15559 16347 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172853.1 protein_id gnl|my_center|LOCUS_04250 16531 16376 gene locus_tag LOCUS_04260 16531 16376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 16944 16573 gene locus_tag LOCUS_04270 16944 16573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 17436 18851 gene locus_tag LOCUS_04280 gene hpnO 17436 18851 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_04280 19183 19013 gene locus_tag LOCUS_04290 19183 19013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 19580 20338 gene locus_tag LOCUS_04300 19580 20338 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_04300 20328 21470 gene locus_tag LOCUS_04310 20328 21470 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638288.1 protein_id gnl|my_center|LOCUS_04310 21680 23923 gene locus_tag LOCUS_04320 21680 23923 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence019 347 1351 gene locus_tag LOCUS_04330 347 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 1523 2368 gene locus_tag LOCUS_04340 1523 2368 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227182.1 protein_id gnl|my_center|LOCUS_04340 3509 3856 gene locus_tag LOCUS_04350 3509 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 4516 4046 gene locus_tag LOCUS_04360 4516 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 5166 4885 gene locus_tag LOCUS_04370 5166 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5886 6359 gene locus_tag LOCUS_04380 5886 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 6451 7200 gene locus_tag LOCUS_04390 6451 7200 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173829.1 protein_id gnl|my_center|LOCUS_04390 7197 7841 gene locus_tag LOCUS_04400 7197 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086035.1 protein_id gnl|my_center|LOCUS_04400 8872 10017 gene locus_tag LOCUS_04410 8872 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 10276 11823 gene locus_tag LOCUS_04420 10276 11823 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389422.1 protein_id gnl|my_center|LOCUS_04420 11908 12129 gene locus_tag LOCUS_04430 11908 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 12543 12851 gene locus_tag LOCUS_04440 12543 12851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 13681 14076 gene locus_tag LOCUS_04450 13681 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 14632 14716 gene locus_tag LOCUS_t00030 14632 14716 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15301 16647 gene locus_tag LOCUS_04460 gene tig 15301 16647 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922580.1 protein_id gnl|my_center|LOCUS_04460 17546 18205 gene locus_tag LOCUS_04470 gene clpP 17546 18205 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389425.1 protein_id gnl|my_center|LOCUS_04470 18801 20066 gene locus_tag LOCUS_04480 gene clpX 18801 20066 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389426.1 protein_id gnl|my_center|LOCUS_04480 20645 23050 gene locus_tag LOCUS_04490 gene lon 20645 23050 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 protein_id gnl|my_center|LOCUS_04490 23360 23635 gene locus_tag LOCUS_04500 23360 23635 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence020 221 1420 gene locus_tag LOCUS_04510 221 1420 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387974.1 protein_id gnl|my_center|LOCUS_04510 1639 1565 gene locus_tag LOCUS_t00040 1639 1565 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2161 3450 gene locus_tag LOCUS_04520 gene murA 2161 3450 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390681.1 protein_id gnl|my_center|LOCUS_04520 3515 4027 gene locus_tag LOCUS_04530 3515 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4218 4922 gene locus_tag LOCUS_04540 gene hisG 4218 4922 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390582.1 protein_id gnl|my_center|LOCUS_04540 5338 5868 gene locus_tag LOCUS_04550 5338 5868 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390580.1 protein_id gnl|my_center|LOCUS_04550 6126 9461 gene locus_tag LOCUS_04560 6126 9461 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973386.1 protein_id gnl|my_center|LOCUS_04560 9522 13232 gene locus_tag LOCUS_04570 9522 13232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 13839 18125 gene locus_tag LOCUS_04580 13839 18125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 18366 18962 gene locus_tag LOCUS_04590 18366 18962 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390405.1 protein_id gnl|my_center|LOCUS_04590 19131 19316 gene locus_tag LOCUS_04600 19131 19316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 19322 19618 gene locus_tag LOCUS_04610 19322 19618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 20918 19755 gene locus_tag LOCUS_04620 20918 19755 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401993.1 protein_id gnl|my_center|LOCUS_04620 21808 20921 gene locus_tag LOCUS_04630 21808 20921 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390493.1 protein_id gnl|my_center|LOCUS_04630 22401 23747 gene locus_tag LOCUS_04640 22401 23747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 >Feature sequence021 113 1381 gene locus_tag LOCUS_04650 gene hisS 113 1381 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388506.1 protein_id gnl|my_center|LOCUS_04650 1583 3004 gene locus_tag LOCUS_04660 gene hemA 1583 3004 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626014.1 protein_id gnl|my_center|LOCUS_04660 3001 4104 gene locus_tag LOCUS_04670 gene prfA 3001 4104 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388508.1 protein_id gnl|my_center|LOCUS_04670 4425 4210 gene locus_tag LOCUS_04680 4425 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 6649 4718 gene locus_tag LOCUS_04690 6649 4718 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_04690 6741 6956 gene locus_tag LOCUS_04700 6741 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 8128 7223 gene locus_tag LOCUS_04710 8128 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 9000 10532 gene locus_tag LOCUS_04720 gene rfaE1 9000 10532 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_04720 10556 12109 gene locus_tag LOCUS_04730 10556 12109 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_04730 12994 12224 gene locus_tag LOCUS_04740 gene truA 12994 12224 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391099.1 protein_id gnl|my_center|LOCUS_04740 14109 13165 gene locus_tag LOCUS_04750 gene fmt 14109 13165 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383426.1 protein_id gnl|my_center|LOCUS_04750 14949 14434 gene locus_tag LOCUS_04760 gene def 14949 14434 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391097.1 protein_id gnl|my_center|LOCUS_04760 17320 15191 gene locus_tag LOCUS_04770 17320 15191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 17464 17538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17961 17659 gene locus_tag LOCUS_04780 17961 17659 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081714.1 protein_id gnl|my_center|LOCUS_04780 19538 18093 gene locus_tag LOCUS_04790 19538 18093 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089662.1 protein_id gnl|my_center|LOCUS_04790 21107 19611 gene locus_tag LOCUS_04800 21107 19611 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089663.1 protein_id gnl|my_center|LOCUS_04800 22171 21191 gene locus_tag LOCUS_04810 gene hypE 22171 21191 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_04810 23579 22470 gene locus_tag LOCUS_04820 gene hypD 23579 22470 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_04820 >Feature sequence022 1572 73 gene locus_tag LOCUS_04830 1572 73 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388213.1 protein_id gnl|my_center|LOCUS_04830 1990 3219 gene locus_tag LOCUS_04840 gene lptF 1990 3219 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390693.1 protein_id gnl|my_center|LOCUS_04840 3219 4307 gene locus_tag LOCUS_04850 gene lptG 3219 4307 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 protein_id gnl|my_center|LOCUS_04850 4308 6722 gene locus_tag LOCUS_04860 gene lptD 4308 6722 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 protein_id gnl|my_center|LOCUS_04860 7028 8338 gene locus_tag LOCUS_04870 7028 8338 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640302.1 protein_id gnl|my_center|LOCUS_04870 8335 9432 gene locus_tag LOCUS_04880 gene pdxA 8335 9432 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327835.1 protein_id gnl|my_center|LOCUS_04880 9617 10471 gene locus_tag LOCUS_04890 gene rsmA 9617 10471 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532511.1 protein_id gnl|my_center|LOCUS_04890 10742 10975 gene locus_tag LOCUS_04900 10742 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 11735 11223 gene locus_tag LOCUS_04910 11735 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 12700 12536 gene locus_tag LOCUS_04920 12700 12536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04920 13495 13085 gene locus_tag LOCUS_04930 13495 13085 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971252.1 protein_id gnl|my_center|LOCUS_04930 15726 13543 gene locus_tag LOCUS_04940 15726 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 17175 15901 gene locus_tag LOCUS_04950 17175 15901 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025547.1 protein_id gnl|my_center|LOCUS_04950 17520 17215 gene locus_tag LOCUS_04960 17520 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 18542 22792 gene locus_tag LOCUS_04970 18542 22792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence023 921 193 gene locus_tag LOCUS_04980 921 193 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103037.1 protein_id gnl|my_center|LOCUS_04980 1614 958 gene locus_tag LOCUS_04990 gene fsa 1614 958 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720727.1 protein_id gnl|my_center|LOCUS_04990 1970 4354 gene locus_tag LOCUS_05000 1970 4354 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918235.1 protein_id gnl|my_center|LOCUS_05000 5174 5734 gene locus_tag LOCUS_05010 5174 5734 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_05010 5734 7266 gene locus_tag LOCUS_05020 gene atpA 5734 7266 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530298.1 protein_id gnl|my_center|LOCUS_05020 7533 8426 gene locus_tag LOCUS_05030 7533 8426 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388980.1 protein_id gnl|my_center|LOCUS_05030 8579 10003 gene locus_tag LOCUS_05040 gene atpD 8579 10003 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388981.1 protein_id gnl|my_center|LOCUS_05040 10237 10659 gene locus_tag LOCUS_05050 10237 10659 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 protein_id gnl|my_center|LOCUS_05050 11545 12717 gene locus_tag LOCUS_05060 11545 12717 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900326.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05060 12948 14048 gene locus_tag LOCUS_05070 12948 14048 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407185.1 protein_id gnl|my_center|LOCUS_05070 14114 16270 gene locus_tag LOCUS_05080 14114 16270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 16543 17382 gene locus_tag LOCUS_05090 16543 17382 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_05090 17498 18871 gene locus_tag LOCUS_05100 17498 18871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 19204 19359 gene locus_tag LOCUS_05110 19204 19359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 19579 20058 gene locus_tag LOCUS_05120 gene speD 19579 20058 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389382.1 protein_id gnl|my_center|LOCUS_05120 20250 20528 gene locus_tag LOCUS_05130 20250 20528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 20932 20501 gene locus_tag LOCUS_05140 20932 20501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 21882 21052 gene locus_tag LOCUS_05150 21882 21052 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_05150 22948 21956 gene locus_tag LOCUS_05160 22948 21956 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence024 2270 621 gene locus_tag LOCUS_05170 2270 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 3595 2813 gene locus_tag LOCUS_05180 3595 2813 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814011.1 protein_id gnl|my_center|LOCUS_05180 4287 5678 gene locus_tag LOCUS_05190 4287 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 6781 5777 gene locus_tag LOCUS_05200 6781 5777 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_05200 6836 7435 gene locus_tag LOCUS_05210 6836 7435 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391179.1 protein_id gnl|my_center|LOCUS_05210 8499 7471 gene locus_tag LOCUS_05220 gene dusA 8499 7471 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 protein_id gnl|my_center|LOCUS_05220 14184 8596 gene locus_tag LOCUS_05230 gene pcs 14184 8596 CDS product propionyl-CoA synthase subunit Pcs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256509.1 protein_id gnl|my_center|LOCUS_05230 15709 14375 gene locus_tag LOCUS_05240 gene hisD 15709 14375 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530482.1 protein_id gnl|my_center|LOCUS_05240 16045 16218 gene locus_tag LOCUS_05250 16045 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 16218 16832 gene locus_tag LOCUS_05260 16218 16832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 17005 17772 gene locus_tag LOCUS_05270 17005 17772 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082451.1 protein_id gnl|my_center|LOCUS_05270 18761 17769 gene locus_tag LOCUS_05280 18761 17769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 19563 22514 gene locus_tag LOCUS_05290 19563 22514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence025 1936 2007 gene locus_tag LOCUS_t00050 1936 2007 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3002 3532 gene locus_tag LOCUS_05300 3002 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3726 5012 gene locus_tag LOCUS_05310 3726 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 5158 6159 gene locus_tag LOCUS_05320 5158 6159 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390694.1 protein_id gnl|my_center|LOCUS_05320 6351 6851 gene locus_tag LOCUS_05330 6351 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 6848 7816 gene locus_tag LOCUS_05340 gene rsmA 6848 7816 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876939.1 protein_id gnl|my_center|LOCUS_05340 8155 8550 gene locus_tag LOCUS_05350 8155 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 9535 8909 gene locus_tag LOCUS_05360 9535 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 10504 9716 gene locus_tag LOCUS_05370 10504 9716 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_05370 11621 10704 gene locus_tag LOCUS_05380 11621 10704 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391003.1 protein_id gnl|my_center|LOCUS_05380 12295 11621 gene locus_tag LOCUS_05390 gene ftsE 12295 11621 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626546.1 protein_id gnl|my_center|LOCUS_05390 13273 14193 gene locus_tag LOCUS_05400 13273 14193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 14863 15714 gene locus_tag LOCUS_05410 14863 15714 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096744.1 protein_id gnl|my_center|LOCUS_05410 16638 18101 gene locus_tag LOCUS_05420 gene tolB 16638 18101 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388849.1 protein_id gnl|my_center|LOCUS_05420 18334 18840 gene locus_tag LOCUS_05430 gene pal 18334 18840 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529149.1 protein_id gnl|my_center|LOCUS_05430 19356 19844 gene locus_tag LOCUS_05440 gene pal 19356 19844 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921062.1 protein_id gnl|my_center|LOCUS_05440 20225 21142 gene locus_tag LOCUS_05450 gene ybgF 20225 21142 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence026 303 812 gene locus_tag LOCUS_05460 303 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 918 1847 gene locus_tag LOCUS_05470 918 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 2681 2977 gene locus_tag LOCUS_05480 2681 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 2983 3348 gene locus_tag LOCUS_05490 2983 3348 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 protein_id gnl|my_center|LOCUS_05490 3470 5887 gene locus_tag LOCUS_05500 3470 5887 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650306.1 protein_id gnl|my_center|LOCUS_05500 6278 6856 gene locus_tag LOCUS_05510 6278 6856 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918322.1 protein_id gnl|my_center|LOCUS_05510 7220 9511 gene locus_tag LOCUS_05520 7220 9511 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072186.1 protein_id gnl|my_center|LOCUS_05520 10144 11082 gene locus_tag LOCUS_05530 gene cheR 10144 11082 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080859.1 protein_id gnl|my_center|LOCUS_05530 11148 11819 gene locus_tag LOCUS_05540 11148 11819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 11819 12874 gene locus_tag LOCUS_05550 11819 12874 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811913.1 protein_id gnl|my_center|LOCUS_05550 13423 14583 gene locus_tag LOCUS_05560 13423 14583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 14739 15044 gene locus_tag LOCUS_05570 gene hsbA 14739 15044 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_05570 15091 15813 gene locus_tag LOCUS_05580 15091 15813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 15810 17150 gene locus_tag LOCUS_05590 15810 17150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 17405 18904 gene locus_tag LOCUS_05600 17405 18904 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388169.1 protein_id gnl|my_center|LOCUS_05600 18897 20057 gene locus_tag LOCUS_05610 gene alr 18897 20057 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388168.1 protein_id gnl|my_center|LOCUS_05610 20547 21320 gene locus_tag LOCUS_05620 20547 21320 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_05620 21317 22105 gene locus_tag LOCUS_05630 21317 22105 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence027 733 56 gene locus_tag LOCUS_05640 gene bluB 733 56 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 protein_id gnl|my_center|LOCUS_05640 2720 792 gene locus_tag LOCUS_05650 gene cobT 2720 792 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_05650 3778 2759 gene locus_tag LOCUS_05660 gene cobS 3778 2759 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_05660 4710 4021 gene locus_tag LOCUS_05670 4710 4021 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_05670 5800 5054 gene locus_tag LOCUS_05680 5800 5054 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528783.1 protein_id gnl|my_center|LOCUS_05680 6254 7558 gene locus_tag LOCUS_05690 6254 7558 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532784.1 protein_id gnl|my_center|LOCUS_05690 7989 8603 gene locus_tag LOCUS_05700 7989 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390583.1 protein_id gnl|my_center|LOCUS_05700 8665 10362 gene locus_tag LOCUS_05710 8665 10362 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626633.1 protein_id gnl|my_center|LOCUS_05710 11174 10449 gene locus_tag LOCUS_05720 11174 10449 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072533.1 protein_id gnl|my_center|LOCUS_05720 11407 12003 gene locus_tag LOCUS_05730 11407 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 13152 12046 gene locus_tag LOCUS_05740 13152 12046 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_05740 13639 14544 gene locus_tag LOCUS_05750 13639 14544 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_05750 14655 15701 gene locus_tag LOCUS_05760 14655 15701 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 protein_id gnl|my_center|LOCUS_05760 16798 15818 gene locus_tag LOCUS_05770 16798 15818 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387970.1 protein_id gnl|my_center|LOCUS_05770 17540 17127 gene locus_tag LOCUS_05780 17540 17127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 18145 19338 gene locus_tag LOCUS_05790 18145 19338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391064.1 protein_id gnl|my_center|LOCUS_05790 19641 20126 gene locus_tag LOCUS_05800 gene gpt 19641 20126 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614148.1 protein_id gnl|my_center|LOCUS_05800 20819 20367 gene locus_tag LOCUS_05810 20819 20367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 21925 21332 gene locus_tag LOCUS_05820 gene recR 21925 21332 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090836.1 protein_id gnl|my_center|LOCUS_05820 >Feature sequence028 1609 17 gene locus_tag LOCUS_05830 1609 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 3216 1606 gene locus_tag LOCUS_05840 3216 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3745 5268 gene locus_tag LOCUS_05850 3745 5268 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_05850 5409 7364 gene locus_tag LOCUS_05860 5409 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 7485 8360 gene locus_tag LOCUS_05870 7485 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 8594 9937 gene locus_tag LOCUS_05880 8594 9937 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089709.1 protein_id gnl|my_center|LOCUS_05880 10596 10201 gene locus_tag LOCUS_05890 10596 10201 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972297.1 protein_id gnl|my_center|LOCUS_05890 11448 10642 gene locus_tag LOCUS_05900 11448 10642 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184793.1 protein_id gnl|my_center|LOCUS_05900 12822 11728 gene locus_tag LOCUS_05910 12822 11728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 13469 12822 gene locus_tag LOCUS_05920 13469 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 15165 13555 gene locus_tag LOCUS_05930 15165 13555 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223376.1 protein_id gnl|my_center|LOCUS_05930 16415 15234 gene locus_tag LOCUS_05940 16415 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 16923 17588 gene locus_tag LOCUS_05950 16923 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 18031 19929 gene locus_tag LOCUS_05960 18031 19929 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_05960 20097 20660 gene locus_tag LOCUS_05970 gene moaB 20097 20660 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388021.1 protein_id gnl|my_center|LOCUS_05970 20864 21565 gene locus_tag LOCUS_05980 20864 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence029 748 329 gene locus_tag LOCUS_05990 748 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 920 729 gene locus_tag LOCUS_06000 920 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 1630 1223 gene locus_tag LOCUS_06010 1630 1223 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071836.1 protein_id gnl|my_center|LOCUS_06010 3906 1876 gene locus_tag LOCUS_06020 3906 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4691 4344 gene locus_tag LOCUS_06030 4691 4344 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_06030 5066 5311 gene locus_tag LOCUS_06040 5066 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 6185 5391 gene locus_tag LOCUS_06050 6185 5391 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626547.1 protein_id gnl|my_center|LOCUS_06050 7221 6343 gene locus_tag LOCUS_06060 7221 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 9040 7442 gene locus_tag LOCUS_06070 gene mgtE 9040 7442 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389748.1 protein_id gnl|my_center|LOCUS_06070 11734 9446 gene locus_tag LOCUS_06080 11734 9446 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531890.1 protein_id gnl|my_center|LOCUS_06080 12412 13026 gene locus_tag LOCUS_06090 12412 13026 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 protein_id gnl|my_center|LOCUS_06090 13117 13407 gene locus_tag LOCUS_06100 13117 13407 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975509.1 protein_id gnl|my_center|LOCUS_06100 13471 14082 gene locus_tag LOCUS_06110 13471 14082 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_06110 15727 14195 gene locus_tag LOCUS_06120 15727 14195 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_06120 16347 17660 gene locus_tag LOCUS_06130 gene dosC 16347 17660 CDS product diguanylate cyclase DosC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776396.1 protein_id gnl|my_center|LOCUS_06130 17934 19193 gene locus_tag LOCUS_06140 17934 19193 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028287100.1 protein_id gnl|my_center|LOCUS_06140 19276 20655 gene locus_tag LOCUS_06150 19276 20655 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390721.1 protein_id gnl|my_center|LOCUS_06150 21683 20679 gene locus_tag LOCUS_06160 21683 20679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence030 385 1587 gene locus_tag LOCUS_06170 385 1587 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970052.1 protein_id gnl|my_center|LOCUS_06170 1645 2394 gene locus_tag LOCUS_06180 1645 2394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434161.1 protein_id gnl|my_center|LOCUS_06180 2387 3100 gene locus_tag LOCUS_06190 2387 3100 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970053.1 protein_id gnl|my_center|LOCUS_06190 3097 3987 gene locus_tag LOCUS_06200 3097 3987 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970223.1 protein_id gnl|my_center|LOCUS_06200 3984 5036 gene locus_tag LOCUS_06210 3984 5036 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970055.1 protein_id gnl|my_center|LOCUS_06210 5063 5737 gene locus_tag LOCUS_06220 5063 5737 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970056.1 protein_id gnl|my_center|LOCUS_06220 6388 5783 gene locus_tag LOCUS_06230 6388 5783 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067512.1 protein_id gnl|my_center|LOCUS_06230 7872 6766 gene locus_tag LOCUS_06240 gene leuB 7872 6766 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388946.1 protein_id gnl|my_center|LOCUS_06240 9661 8897 gene locus_tag LOCUS_06250 9661 8897 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_06250 9873 10538 gene locus_tag LOCUS_06260 gene pdxH 9873 10538 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532806.1 protein_id gnl|my_center|LOCUS_06260 10591 11589 gene locus_tag LOCUS_06270 10591 11589 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_06270 11798 12592 gene locus_tag LOCUS_06280 11798 12592 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390265.1 protein_id gnl|my_center|LOCUS_06280 12582 13283 gene locus_tag LOCUS_06290 12582 13283 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973183.1 protein_id gnl|my_center|LOCUS_06290 13670 14689 gene locus_tag LOCUS_06300 13670 14689 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538040.1 protein_id gnl|my_center|LOCUS_06300 14761 15291 gene locus_tag LOCUS_06310 14761 15291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 15291 16598 gene locus_tag LOCUS_06320 15291 16598 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_06320 16605 17006 gene locus_tag LOCUS_06330 16605 17006 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_06330 17281 17105 gene locus_tag LOCUS_06340 17281 17105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 17771 20677 gene locus_tag LOCUS_06350 17771 20677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence031 259 2262 gene locus_tag LOCUS_06360 259 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 2990 2400 gene locus_tag LOCUS_06370 2990 2400 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170957.1 protein_id gnl|my_center|LOCUS_06370 3970 3452 gene locus_tag LOCUS_06380 3970 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06380 4768 4079 gene locus_tag LOCUS_06390 4768 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06390 6668 4791 gene locus_tag LOCUS_06400 6668 4791 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387750.1 protein_id gnl|my_center|LOCUS_06400 7141 6848 gene locus_tag LOCUS_06410 7141 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 8057 7515 gene locus_tag LOCUS_06420 8057 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06420 10242 8038 gene locus_tag LOCUS_06430 10242 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06430 11137 10766 gene locus_tag LOCUS_06440 11137 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 11513 11127 gene locus_tag LOCUS_06450 11513 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 13084 11987 gene locus_tag LOCUS_06460 13084 11987 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_06460 15251 13077 gene locus_tag LOCUS_06470 15251 13077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 15957 16703 gene locus_tag LOCUS_06480 gene torR 15957 16703 CDS product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457237.1 protein_id gnl|my_center|LOCUS_06480 17219 19135 gene locus_tag LOCUS_06490 17219 19135 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073843.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence032 485 18 gene locus_tag LOCUS_06500 gene queF 485 18 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066516.1 protein_id gnl|my_center|LOCUS_06500 785 1144 gene locus_tag LOCUS_06510 785 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06510 1027 2385 gene locus_tag LOCUS_06520 gene pckA 1027 2385 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06520 2641 3981 gene locus_tag LOCUS_06530 gene glmU 2641 3981 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 protein_id gnl|my_center|LOCUS_06530 4065 5888 gene locus_tag LOCUS_06540 gene glmS 4065 5888 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390777.1 protein_id gnl|my_center|LOCUS_06540 5990 6646 gene locus_tag LOCUS_06550 5990 6646 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528615.1 protein_id gnl|my_center|LOCUS_06550 6773 8152 gene locus_tag LOCUS_06560 6773 8152 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_06560 8152 9705 gene locus_tag LOCUS_06570 8152 9705 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389832.1 protein_id gnl|my_center|LOCUS_06570 9898 11223 gene locus_tag LOCUS_06580 9898 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 11220 12362 gene locus_tag LOCUS_06590 11220 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 12721 13566 gene locus_tag LOCUS_06600 12721 13566 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215772.1 protein_id gnl|my_center|LOCUS_06600 14693 13626 gene locus_tag LOCUS_06610 14693 13626 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_06610 15706 14942 gene locus_tag LOCUS_06620 15706 14942 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 protein_id gnl|my_center|LOCUS_06620 16412 15924 gene locus_tag LOCUS_06630 16412 15924 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_06630 16517 17269 gene locus_tag LOCUS_06640 gene cobB 16517 17269 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391392.1 protein_id gnl|my_center|LOCUS_06640 17282 18067 gene locus_tag LOCUS_06650 17282 18067 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence033 380 1111 gene locus_tag LOCUS_06660 380 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 1720 2760 gene locus_tag LOCUS_06670 1720 2760 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 protein_id gnl|my_center|LOCUS_06670 2800 3732 gene locus_tag LOCUS_06680 gene mreC 2800 3732 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 protein_id gnl|my_center|LOCUS_06680 4146 4679 gene locus_tag LOCUS_06690 gene mreD 4146 4679 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388231.1 protein_id gnl|my_center|LOCUS_06690 4838 6715 gene locus_tag LOCUS_06700 gene mrdA 4838 6715 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_06700 6783 7940 gene locus_tag LOCUS_06710 gene rodA 6783 7940 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597348.1 protein_id gnl|my_center|LOCUS_06710 8391 8834 gene locus_tag LOCUS_06720 8391 8834 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_06720 8937 10649 gene locus_tag LOCUS_06730 8937 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 12006 10678 gene locus_tag LOCUS_06740 gene chrA 12006 10678 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_06740 12462 13232 gene locus_tag LOCUS_06750 12462 13232 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389607.1 protein_id gnl|my_center|LOCUS_06750 13310 13735 gene locus_tag LOCUS_06760 gene acpS 13310 13735 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971345.1 protein_id gnl|my_center|LOCUS_06760 14079 17798 gene locus_tag LOCUS_06770 14079 17798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 18326 18658 gene locus_tag LOCUS_06780 18326 18658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 18916 18737 gene locus_tag LOCUS_06790 18916 18737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 19610 20680 gene locus_tag LOCUS_06800 19610 20680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265509.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence034 <1 2099 gene locus_tag LOCUS_06810 <1 2099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792117.1:SulP family inorganic anion transporter 2214 3731 gene locus_tag LOCUS_06820 2214 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4746 3886 gene locus_tag LOCUS_06830 4746 3886 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_06830 5606 5028 gene locus_tag LOCUS_06840 5606 5028 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626398.1 protein_id gnl|my_center|LOCUS_06840 5772 5993 gene locus_tag LOCUS_06850 5772 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7345 6206 gene locus_tag LOCUS_06860 7345 6206 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_06860 7818 7402 gene locus_tag LOCUS_06870 7818 7402 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387810.1 protein_id gnl|my_center|LOCUS_06870 8392 7949 gene locus_tag LOCUS_06880 8392 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 8819 10417 gene locus_tag LOCUS_06890 8819 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 10414 11004 gene locus_tag LOCUS_06900 gene prrA 10414 11004 CDS product global response regulator transcription factor PrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722225.1 protein_id gnl|my_center|LOCUS_06900 13302 11950 gene locus_tag LOCUS_06910 13302 11950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 14724 13561 gene locus_tag LOCUS_06920 14724 13561 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025547.1 protein_id gnl|my_center|LOCUS_06920 16548 15574 gene locus_tag LOCUS_06930 16548 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 17912 18850 gene locus_tag LOCUS_06940 17912 18850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 19128 18952 gene locus_tag LOCUS_06950 19128 18952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 19581 20354 gene locus_tag LOCUS_06960 19581 20354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence035 594 220 gene locus_tag LOCUS_06970 594 220 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_06970 818 591 gene locus_tag LOCUS_06980 818 591 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387745.1 protein_id gnl|my_center|LOCUS_06980 2313 1006 gene locus_tag LOCUS_06990 2313 1006 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387751.1 protein_id gnl|my_center|LOCUS_06990 4040 2310 gene locus_tag LOCUS_07000 4040 2310 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533172.1 protein_id gnl|my_center|LOCUS_07000 5178 4492 gene locus_tag LOCUS_07010 5178 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 6107 5463 gene locus_tag LOCUS_07020 6107 5463 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529018.1 protein_id gnl|my_center|LOCUS_07020 7291 7881 gene locus_tag LOCUS_07030 7291 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 7875 8105 gene locus_tag LOCUS_07040 7875 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 8632 8195 gene locus_tag LOCUS_07050 8632 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 9186 9455 gene locus_tag LOCUS_07060 9186 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 9488 10723 gene locus_tag LOCUS_07070 9488 10723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 11116 11271 gene locus_tag LOCUS_07080 11116 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 13703 11487 gene locus_tag LOCUS_07090 13703 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 14311 15159 gene locus_tag LOCUS_07100 14311 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 15368 15284 gene locus_tag LOCUS_t00060 15368 15284 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15792 17000 gene locus_tag LOCUS_07110 15792 17000 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188250.1 protein_id gnl|my_center|LOCUS_07110 17280 18185 gene locus_tag LOCUS_07120 gene hpnD 17280 18185 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085786.1 protein_id gnl|my_center|LOCUS_07120 18196 19596 gene locus_tag LOCUS_07130 gene hpnE 18196 19596 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387824.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence036 503 1048 gene locus_tag LOCUS_07140 503 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1201 2001 gene locus_tag LOCUS_07150 1201 2001 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_07150 3795 2167 gene locus_tag LOCUS_07160 3795 2167 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_07160 4839 4414 gene locus_tag LOCUS_07170 4839 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 5990 5322 gene locus_tag LOCUS_07180 gene pdeM 5990 5322 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533672.1 protein_id gnl|my_center|LOCUS_07180 6334 6179 gene locus_tag LOCUS_07190 6334 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 7343 6474 gene locus_tag LOCUS_07200 7343 6474 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 protein_id gnl|my_center|LOCUS_07200 8365 7490 gene locus_tag LOCUS_07210 8365 7490 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930668.1 protein_id gnl|my_center|LOCUS_07210 9713 8427 gene locus_tag LOCUS_07220 gene hflX 9713 8427 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389375.1 protein_id gnl|my_center|LOCUS_07220 10147 9896 gene locus_tag LOCUS_07230 gene hfq 10147 9896 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389374.1 protein_id gnl|my_center|LOCUS_07230 11534 10758 gene locus_tag LOCUS_07240 11534 10758 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 protein_id gnl|my_center|LOCUS_07240 12391 11555 gene locus_tag LOCUS_07250 12391 11555 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_07250 13959 12391 gene locus_tag LOCUS_07260 gene metG 13959 12391 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389391.1 protein_id gnl|my_center|LOCUS_07260 15309 14101 gene locus_tag LOCUS_07270 15309 14101 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 protein_id gnl|my_center|LOCUS_07270 15940 15281 gene locus_tag LOCUS_07280 gene tmk 15940 15281 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626229.1 protein_id gnl|my_center|LOCUS_07280 17250 16009 gene locus_tag LOCUS_07290 17250 16009 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_07290 18109 17579 gene locus_tag LOCUS_07300 18109 17579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 19093 18329 gene locus_tag LOCUS_07310 19093 18329 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_07310 19740 19183 gene locus_tag LOCUS_07320 gene def 19740 19183 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388799.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence037 245 1402 gene locus_tag LOCUS_07330 245 1402 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463826.1 protein_id gnl|my_center|LOCUS_07330 2300 1461 gene locus_tag LOCUS_07340 2300 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 3402 2386 gene locus_tag LOCUS_07350 3402 2386 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537406.1 protein_id gnl|my_center|LOCUS_07350 3843 3460 gene locus_tag LOCUS_07360 gene crcB 3843 3460 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971646.1 protein_id gnl|my_center|LOCUS_07360 5215 3917 gene locus_tag LOCUS_07370 5215 3917 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_07370 5385 6194 gene locus_tag LOCUS_07380 5385 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 6292 7350 gene locus_tag LOCUS_07390 6292 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 7874 7371 gene locus_tag LOCUS_07400 7874 7371 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974971.1 protein_id gnl|my_center|LOCUS_07400 10392 7984 gene locus_tag LOCUS_07410 10392 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 11187 12602 gene locus_tag LOCUS_07420 11187 12602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 12732 13430 gene locus_tag LOCUS_07430 gene folE 12732 13430 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388024.1 protein_id gnl|my_center|LOCUS_07430 13510 14385 gene locus_tag LOCUS_07440 gene cobA 13510 14385 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975884.1 protein_id gnl|my_center|LOCUS_07440 14382 15773 gene locus_tag LOCUS_07450 14382 15773 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391106.1 protein_id gnl|my_center|LOCUS_07450 15939 16781 gene locus_tag LOCUS_07460 gene torR 15939 16781 CDS product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457237.1 protein_id gnl|my_center|LOCUS_07460 16787 17860 gene locus_tag LOCUS_07470 16787 17860 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970085.1 protein_id gnl|my_center|LOCUS_07470 18125 17850 gene locus_tag LOCUS_07480 18125 17850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 19005 18139 gene locus_tag LOCUS_07490 19005 18139 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336996.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence038 203 673 gene locus_tag LOCUS_07500 203 673 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_07500 2153 777 gene locus_tag LOCUS_07510 2153 777 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073029.1 protein_id gnl|my_center|LOCUS_07510 2659 2150 gene locus_tag LOCUS_07520 2659 2150 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073028.1 protein_id gnl|my_center|LOCUS_07520 3773 2781 gene locus_tag LOCUS_07530 3773 2781 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073027.1 protein_id gnl|my_center|LOCUS_07530 5289 4402 gene locus_tag LOCUS_07540 5289 4402 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_07540 5670 5975 gene locus_tag LOCUS_07550 5670 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 6071 6724 gene locus_tag LOCUS_07560 6071 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 7613 6747 gene locus_tag LOCUS_07570 7613 6747 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402149.1 protein_id gnl|my_center|LOCUS_07570 8852 7623 gene locus_tag LOCUS_07580 8852 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 9370 9633 gene locus_tag LOCUS_07590 gene rpsT 9370 9633 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391549.1 protein_id gnl|my_center|LOCUS_07590 10715 9810 gene locus_tag LOCUS_07600 10715 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 11297 10848 gene locus_tag LOCUS_07610 11297 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 11699 13093 gene locus_tag LOCUS_07620 11699 13093 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_07620 14346 13180 gene locus_tag LOCUS_07630 gene aroC 14346 13180 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390373.1 protein_id gnl|my_center|LOCUS_07630 15348 14509 gene locus_tag LOCUS_07640 gene fabI 15348 14509 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390374.1 protein_id gnl|my_center|LOCUS_07640 15765 17048 gene locus_tag LOCUS_07650 15765 17048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 17681 19732 gene locus_tag LOCUS_07660 17681 19732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence039 9244 8984 gene locus_tag LOCUS_07670 9244 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 9589 11346 gene locus_tag LOCUS_07680 9589 11346 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388194.1 protein_id gnl|my_center|LOCUS_07680 11461 12012 gene locus_tag LOCUS_07690 11461 12012 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_07690 13354 12140 gene locus_tag LOCUS_07700 13354 12140 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_07700 13566 15092 gene locus_tag LOCUS_07710 13566 15092 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 protein_id gnl|my_center|LOCUS_07710 15702 17138 gene locus_tag LOCUS_07720 15702 17138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 17725 19677 gene locus_tag LOCUS_07730 17725 19677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence040 222 1037 gene locus_tag LOCUS_07740 222 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1986 1372 gene locus_tag LOCUS_07750 1986 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2537 4198 gene locus_tag LOCUS_07760 2537 4198 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205070.1 protein_id gnl|my_center|LOCUS_07760 4195 5820 gene locus_tag LOCUS_07770 4195 5820 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267350.1 protein_id gnl|my_center|LOCUS_07770 5823 7469 gene locus_tag LOCUS_07780 5823 7469 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 protein_id gnl|my_center|LOCUS_07780 7466 9157 gene locus_tag LOCUS_07790 7466 9157 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205070.1 protein_id gnl|my_center|LOCUS_07790 9907 11349 gene locus_tag LOCUS_07800 9907 11349 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_07800 12006 11916 gene locus_tag LOCUS_t00070 12006 11916 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14752 12146 gene locus_tag LOCUS_07810 14752 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 16287 15301 gene locus_tag LOCUS_07820 16287 15301 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921532.1 protein_id gnl|my_center|LOCUS_07820 17493 16438 gene locus_tag LOCUS_07830 17493 16438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 19067 17577 gene locus_tag LOCUS_07840 19067 17577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 19618 19178 gene locus_tag LOCUS_07850 19618 19178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence041 787 89 gene locus_tag LOCUS_07860 gene ccmA 787 89 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387801.1 protein_id gnl|my_center|LOCUS_07860 1455 1126 gene locus_tag LOCUS_07870 1455 1126 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_07870 3197 1452 gene locus_tag LOCUS_07880 3197 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3716 4165 gene locus_tag LOCUS_07890 3716 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 4398 4583 gene locus_tag LOCUS_07900 gene rpmF 4398 4583 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_07900 5181 6230 gene locus_tag LOCUS_07910 gene plsX 5181 6230 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389356.1 protein_id gnl|my_center|LOCUS_07910 6230 7204 gene locus_tag LOCUS_07920 6230 7204 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087781.1 protein_id gnl|my_center|LOCUS_07920 7643 7972 gene locus_tag LOCUS_07930 7643 7972 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389358.1 protein_id gnl|my_center|LOCUS_07930 8478 9068 gene locus_tag LOCUS_07940 8478 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 9138 9626 gene locus_tag LOCUS_07950 9138 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 10437 11360 gene locus_tag LOCUS_07960 10437 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 13258 11435 gene locus_tag LOCUS_07970 13258 11435 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884040.1 protein_id gnl|my_center|LOCUS_07970 13508 13287 gene locus_tag LOCUS_07980 13508 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 13576 14796 gene locus_tag LOCUS_07990 13576 14796 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391025.1 protein_id gnl|my_center|LOCUS_07990 14821 15738 gene locus_tag LOCUS_08000 gene argF 14821 15738 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470667.1 protein_id gnl|my_center|LOCUS_08000 16093 17178 gene locus_tag LOCUS_08010 16093 17178 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530168.1 protein_id gnl|my_center|LOCUS_08010 17175 17819 gene locus_tag LOCUS_08020 17175 17819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391022.1 protein_id gnl|my_center|LOCUS_08020 17842 18465 gene locus_tag LOCUS_08030 17842 18465 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388992.1 protein_id gnl|my_center|LOCUS_08030 18473 19009 gene locus_tag LOCUS_08040 18473 19009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 19039 19515 gene locus_tag LOCUS_08050 gene rlmH 19039 19515 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388990.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence042 530 1531 gene locus_tag LOCUS_08060 530 1531 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084368.1 protein_id gnl|my_center|LOCUS_08060 1588 3243 gene locus_tag LOCUS_08070 1588 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5001 3292 gene locus_tag LOCUS_08080 gene cydC 5001 3292 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205201.1 protein_id gnl|my_center|LOCUS_08080 6896 4998 gene locus_tag LOCUS_08090 gene cydD 6896 4998 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075764720.1 protein_id gnl|my_center|LOCUS_08090 9614 6948 gene locus_tag LOCUS_08100 gene alaS 9614 6948 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969477.1 protein_id gnl|my_center|LOCUS_08100 11143 10052 gene locus_tag LOCUS_08110 gene recA 11143 10052 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_08110 12210 11356 gene locus_tag LOCUS_08120 12210 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 12942 12289 gene locus_tag LOCUS_08130 12942 12289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 14751 13480 gene locus_tag LOCUS_08140 14751 13480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 15781 15194 gene locus_tag LOCUS_08150 15781 15194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 16924 16406 gene locus_tag LOCUS_08160 16924 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 18558 17128 gene locus_tag LOCUS_08170 18558 17128 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266800.1 protein_id gnl|my_center|LOCUS_08170 19233 18874 gene locus_tag LOCUS_08180 19233 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence043 887 75 gene locus_tag LOCUS_08190 887 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2057 1089 gene locus_tag LOCUS_08200 2057 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 3282 2128 gene locus_tag LOCUS_08210 3282 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 3412 4218 gene locus_tag LOCUS_08220 3412 4218 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_08220 4218 5609 gene locus_tag LOCUS_08230 4218 5609 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_08230 5686 6609 gene locus_tag LOCUS_08240 5686 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 7573 8835 gene locus_tag LOCUS_08250 7573 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 10458 8899 gene locus_tag LOCUS_08260 10458 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 11018 10611 gene locus_tag LOCUS_08270 11018 10611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 12665 11304 gene locus_tag LOCUS_08280 12665 11304 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_08280 13844 12795 gene locus_tag LOCUS_08290 gene accD 13844 12795 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626593.1 protein_id gnl|my_center|LOCUS_08290 14738 13863 gene locus_tag LOCUS_08300 gene trpA 14738 13863 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391175.1 protein_id gnl|my_center|LOCUS_08300 15997 14735 gene locus_tag LOCUS_08310 gene trpB 15997 14735 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391174.1 protein_id gnl|my_center|LOCUS_08310 16384 16590 gene locus_tag LOCUS_08320 16384 16590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 16782 16955 gene locus_tag LOCUS_08330 16782 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 17795 17055 gene locus_tag LOCUS_08340 17795 17055 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence044 3565 1643 gene locus_tag LOCUS_08350 3565 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 5575 3704 gene locus_tag LOCUS_08360 5575 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 5980 5786 gene locus_tag LOCUS_08370 5980 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7472 6327 gene locus_tag LOCUS_08380 7472 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 8110 7655 gene locus_tag LOCUS_08390 8110 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 8439 8161 gene locus_tag LOCUS_08400 8439 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 8777 8391 gene locus_tag LOCUS_08410 8777 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 11480 8889 gene locus_tag LOCUS_08420 11480 8889 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918488.1 protein_id gnl|my_center|LOCUS_08420 15643 11492 gene locus_tag LOCUS_08430 15643 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 17253 15697 gene locus_tag LOCUS_08440 17253 15697 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088867.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence045 1935 226 gene locus_tag LOCUS_08450 gene ureC 1935 226 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 protein_id gnl|my_center|LOCUS_08450 2250 1939 gene locus_tag LOCUS_08460 2250 1939 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 protein_id gnl|my_center|LOCUS_08460 2567 2265 gene locus_tag LOCUS_08470 2567 2265 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972301.1 protein_id gnl|my_center|LOCUS_08470 3626 2733 gene locus_tag LOCUS_08480 3626 2733 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084270.1 protein_id gnl|my_center|LOCUS_08480 4356 3658 gene locus_tag LOCUS_08490 gene urtE 4356 3658 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969815.1 protein_id gnl|my_center|LOCUS_08490 5155 4388 gene locus_tag LOCUS_08500 gene urtD 5155 4388 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976302.1 protein_id gnl|my_center|LOCUS_08500 6342 5152 gene locus_tag LOCUS_08510 gene urtC 6342 5152 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 protein_id gnl|my_center|LOCUS_08510 7961 6345 gene locus_tag LOCUS_08520 gene urtB 7961 6345 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398880.1 protein_id gnl|my_center|LOCUS_08520 9460 8171 gene locus_tag LOCUS_08530 gene urtA 9460 8171 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969811.1 protein_id gnl|my_center|LOCUS_08530 10877 10077 gene locus_tag LOCUS_08540 gene radC 10877 10077 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388490.1 protein_id gnl|my_center|LOCUS_08540 11806 10961 gene locus_tag LOCUS_08550 gene map 11806 10961 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388491.1 protein_id gnl|my_center|LOCUS_08550 12561 11857 gene locus_tag LOCUS_08560 gene sfsA 12561 11857 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188483638.1 protein_id gnl|my_center|LOCUS_08560 13137 13292 gene locus_tag LOCUS_08570 13137 13292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 13324 13725 gene locus_tag LOCUS_08580 13324 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 14076 14861 gene locus_tag LOCUS_08590 14076 14861 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_08590 15067 16155 gene locus_tag LOCUS_08600 15067 16155 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_08600 16748 17923 gene locus_tag LOCUS_08610 16748 17923 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870134.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence046 485 1234 gene locus_tag LOCUS_08620 485 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1456 2772 gene locus_tag LOCUS_08630 1456 2772 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 protein_id gnl|my_center|LOCUS_08630 2765 3529 gene locus_tag LOCUS_08640 2765 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 3713 4402 gene locus_tag LOCUS_08650 gene purQ 3713 4402 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088468.1 protein_id gnl|my_center|LOCUS_08650 4399 6627 gene locus_tag LOCUS_08660 gene purL 4399 6627 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_08660 7070 7300 gene locus_tag LOCUS_08670 7070 7300 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 protein_id gnl|my_center|LOCUS_08670 7390 7725 gene locus_tag LOCUS_08680 gene grxD 7390 7725 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548651.1 protein_id gnl|my_center|LOCUS_08680 8119 9240 gene locus_tag LOCUS_08690 gene dnaN 8119 9240 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_08690 9730 12381 gene locus_tag LOCUS_08700 9730 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 12455 13441 gene locus_tag LOCUS_08710 12455 13441 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_08710 14766 13843 gene locus_tag LOCUS_08720 14766 13843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 15410 15159 gene locus_tag LOCUS_08730 15410 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 16053 16337 gene locus_tag LOCUS_08740 16053 16337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 16285 16497 gene locus_tag LOCUS_08750 16285 16497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 <17898 16618 gene locus_tag LOCUS_08760 <17898 16618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387765.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence047 387 103 gene locus_tag LOCUS_08770 387 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08770 781 554 gene locus_tag LOCUS_08780 781 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1214 1065 gene locus_tag LOCUS_08790 1214 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1577 1813 gene locus_tag LOCUS_08800 1577 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2728 2375 gene locus_tag LOCUS_08810 2728 2375 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_08810 4006 3191 gene locus_tag LOCUS_08820 4006 3191 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_08820 5265 4003 gene locus_tag LOCUS_08830 5265 4003 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388281.1 protein_id gnl|my_center|LOCUS_08830 5747 5382 gene locus_tag LOCUS_08840 5747 5382 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388280.1 protein_id gnl|my_center|LOCUS_08840 6704 6213 gene locus_tag LOCUS_08850 6704 6213 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 protein_id gnl|my_center|LOCUS_08850 9421 6701 gene locus_tag LOCUS_08860 9421 6701 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388279.1 protein_id gnl|my_center|LOCUS_08860 10894 10142 gene locus_tag LOCUS_08870 gene chpT 10894 10142 CDS product histidine phosphotransferase ChpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923288.1 protein_id gnl|my_center|LOCUS_08870 12692 11283 gene locus_tag LOCUS_08880 gene glnA 12692 11283 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389839.1 protein_id gnl|my_center|LOCUS_08880 13375 13037 gene locus_tag LOCUS_08890 13375 13037 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_08890 14149 14225 gene locus_tag LOCUS_t00080 14149 14225 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 14597 14962 gene locus_tag LOCUS_08900 14597 14962 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388255.1 protein_id gnl|my_center|LOCUS_08900 15432 15674 gene locus_tag LOCUS_08910 15432 15674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 16336 17412 gene locus_tag LOCUS_08920 16336 17412 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence048 128 2779 gene locus_tag LOCUS_08930 128 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2912 4147 gene locus_tag LOCUS_08940 gene dprA 2912 4147 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_08940 4700 7546 gene locus_tag LOCUS_08950 gene topA 4700 7546 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390950.1 protein_id gnl|my_center|LOCUS_08950 7889 10285 gene locus_tag LOCUS_08960 gene rnr 7889 10285 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390951.1 protein_id gnl|my_center|LOCUS_08960 10467 10919 gene locus_tag LOCUS_08970 10467 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 11887 11090 gene locus_tag LOCUS_08980 11887 11090 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388807.1 protein_id gnl|my_center|LOCUS_08980 12780 14396 gene locus_tag LOCUS_08990 12780 14396 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470630.1 protein_id gnl|my_center|LOCUS_08990 15462 15629 gene locus_tag LOCUS_09000 gene rpmG 15462 15629 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390953.1 protein_id gnl|my_center|LOCUS_09000 15905 16828 gene locus_tag LOCUS_09010 15905 16828 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246325.1 protein_id gnl|my_center|LOCUS_09010 17475 16885 gene locus_tag LOCUS_09020 17475 16885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence049 590 333 gene locus_tag LOCUS_09030 590 333 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034798187.1 protein_id gnl|my_center|LOCUS_09030 2877 763 gene locus_tag LOCUS_09040 2877 763 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390299.1 protein_id gnl|my_center|LOCUS_09040 3787 3278 gene locus_tag LOCUS_09050 3787 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 4329 3856 gene locus_tag LOCUS_09060 4329 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 6204 4657 gene locus_tag LOCUS_09070 6204 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 6366 9689 gene locus_tag LOCUS_09080 6366 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 9712 10161 gene locus_tag LOCUS_09090 9712 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 12096 10240 gene locus_tag LOCUS_09100 12096 10240 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391308.1 protein_id gnl|my_center|LOCUS_09100 12259 14478 gene locus_tag LOCUS_09110 12259 14478 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_09110 14722 15750 gene locus_tag LOCUS_09120 14722 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 16128 17333 gene locus_tag LOCUS_09130 16128 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence050 243 1973 gene locus_tag LOCUS_09140 243 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2418 2792 gene locus_tag LOCUS_09150 2418 2792 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_09150 2783 3334 gene locus_tag LOCUS_09160 2783 3334 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389431.1 protein_id gnl|my_center|LOCUS_09160 3400 4041 gene locus_tag LOCUS_09170 3400 4041 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389432.1 protein_id gnl|my_center|LOCUS_09170 4041 5228 gene locus_tag LOCUS_09180 4041 5228 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975084.1 protein_id gnl|my_center|LOCUS_09180 5225 5833 gene locus_tag LOCUS_09190 5225 5833 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_09190 5943 7226 gene locus_tag LOCUS_09200 gene nuoF 5943 7226 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_09200 7335 9404 gene locus_tag LOCUS_09210 gene nuoG 7335 9404 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 protein_id gnl|my_center|LOCUS_09210 9397 10407 gene locus_tag LOCUS_09220 gene nuoH 9397 10407 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_09220 10523 11011 gene locus_tag LOCUS_09230 gene nuoI 10523 11011 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719675.1 protein_id gnl|my_center|LOCUS_09230 11119 11730 gene locus_tag LOCUS_09240 11119 11730 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311651.1 protein_id gnl|my_center|LOCUS_09240 11981 12292 gene locus_tag LOCUS_09250 gene nuoK 11981 12292 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_09250 12402 14330 gene locus_tag LOCUS_09260 gene nuoL 12402 14330 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389441.1 protein_id gnl|my_center|LOCUS_09260 14349 15878 gene locus_tag LOCUS_09270 14349 15878 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_09270 15954 17423 gene locus_tag LOCUS_09280 gene nuoN 15954 17423 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence051 <1 1051 gene locus_tag LOCUS_09290 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390531.1:2-oxoacid:acceptor oxidoreductase subunit alpha 1056 1880 gene locus_tag LOCUS_09300 1056 1880 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390532.1 protein_id gnl|my_center|LOCUS_09300 1877 2422 gene locus_tag LOCUS_09310 1877 2422 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390533.1 protein_id gnl|my_center|LOCUS_09310 5135 2550 gene locus_tag LOCUS_09320 5135 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 7928 6342 gene locus_tag LOCUS_09330 7928 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391232.1 protein_id gnl|my_center|LOCUS_09330 8652 10832 gene locus_tag LOCUS_09340 8652 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 11453 13414 gene locus_tag LOCUS_09350 11453 13414 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 protein_id gnl|my_center|LOCUS_09350 13714 15123 gene locus_tag LOCUS_09360 13714 15123 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389222.1 protein_id gnl|my_center|LOCUS_09360 15137 16324 gene locus_tag LOCUS_09370 15137 16324 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389221.1 protein_id gnl|my_center|LOCUS_09370 16534 17325 gene locus_tag LOCUS_09380 gene fabI 16534 17325 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390974.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence052 315 2375 gene locus_tag LOCUS_09390 315 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2852 2511 gene locus_tag LOCUS_09400 2852 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2859 3212 gene locus_tag LOCUS_09410 2859 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3464 4276 gene locus_tag LOCUS_09420 gene hisN 3464 4276 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_09420 4550 6418 gene locus_tag LOCUS_09430 4550 6418 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_09430 6565 7653 gene locus_tag LOCUS_09440 gene yejB 6565 7653 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390915.1 protein_id gnl|my_center|LOCUS_09440 7659 8765 gene locus_tag LOCUS_09450 7659 8765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162811019.1 protein_id gnl|my_center|LOCUS_09450 8872 10581 gene locus_tag LOCUS_09460 8872 10581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_09460 10654 11793 gene locus_tag LOCUS_09470 gene zapE 10654 11793 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388963.1 protein_id gnl|my_center|LOCUS_09470 12382 12876 gene locus_tag LOCUS_09480 12382 12876 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946477.1 protein_id gnl|my_center|LOCUS_09480 13132 14061 gene locus_tag LOCUS_09490 13132 14061 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967060.1 protein_id gnl|my_center|LOCUS_09490 14238 15659 gene locus_tag LOCUS_09500 14238 15659 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_09500 15775 17229 gene locus_tag LOCUS_09510 15775 17229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence053 724 302 gene locus_tag LOCUS_09520 724 302 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880044.1 protein_id gnl|my_center|LOCUS_09520 918 751 gene locus_tag LOCUS_09530 918 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1358 993 gene locus_tag LOCUS_09540 1358 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1983 1594 gene locus_tag LOCUS_09550 1983 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 2408 2142 gene locus_tag LOCUS_09560 2408 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 2787 3518 gene locus_tag LOCUS_09570 2787 3518 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_09570 5846 3696 gene locus_tag LOCUS_09580 gene recG 5846 3696 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_09580 6907 6050 gene locus_tag LOCUS_09590 6907 6050 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_09590 8747 7266 gene locus_tag LOCUS_09600 8747 7266 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_09600 9878 12559 gene locus_tag LOCUS_09610 9878 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 12714 13784 gene locus_tag LOCUS_09620 gene gmd 12714 13784 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088213.1 protein_id gnl|my_center|LOCUS_09620 14303 14788 gene locus_tag LOCUS_09630 14303 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 14970 15425 gene locus_tag LOCUS_09640 14970 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 15540 15668 gene locus_tag LOCUS_09650 15540 15668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 16017 16667 gene locus_tag LOCUS_09660 16017 16667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence054 797 2170 gene locus_tag LOCUS_09670 gene trmFO 797 2170 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087495.1 protein_id gnl|my_center|LOCUS_09670 2659 2204 gene locus_tag LOCUS_09680 2659 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 3624 2710 gene locus_tag LOCUS_09690 3624 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3872 4471 gene locus_tag LOCUS_09700 3872 4471 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_09700 4709 6064 gene locus_tag LOCUS_09710 4709 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 6091 6762 gene locus_tag LOCUS_09720 gene nudF 6091 6762 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262653.1 protein_id gnl|my_center|LOCUS_09720 6976 7980 gene locus_tag LOCUS_09730 6976 7980 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 protein_id gnl|my_center|LOCUS_09730 9771 8152 gene locus_tag LOCUS_09740 9771 8152 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_09740 10379 9816 gene locus_tag LOCUS_09750 10379 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 11044 10442 gene locus_tag LOCUS_09760 11044 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 11440 11213 gene locus_tag LOCUS_09770 11440 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 12190 11552 gene locus_tag LOCUS_09780 12190 11552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 13069 12212 gene locus_tag LOCUS_09790 13069 12212 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425211.1 protein_id gnl|my_center|LOCUS_09790 13719 13066 gene locus_tag LOCUS_09800 13719 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 15117 14398 gene locus_tag LOCUS_09810 15117 14398 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930705.1 protein_id gnl|my_center|LOCUS_09810 15643 15242 gene locus_tag LOCUS_09820 15643 15242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 16350 17114 gene locus_tag LOCUS_09830 16350 17114 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528216.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence055 333 2069 gene locus_tag LOCUS_09840 333 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2445 2356 gene locus_tag LOCUS_t00090 2445 2356 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2907 3788 gene locus_tag LOCUS_09850 gene rpoH 2907 3788 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_09850 4284 6449 gene locus_tag LOCUS_09860 4284 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 6645 7418 gene locus_tag LOCUS_09870 gene flgG 6645 7418 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554310.1 protein_id gnl|my_center|LOCUS_09870 8536 7550 gene locus_tag LOCUS_09880 8536 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09880 9501 8527 gene locus_tag LOCUS_09890 9501 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09890 10412 9501 gene locus_tag LOCUS_09900 gene cysD 10412 9501 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_09900 10905 10465 gene locus_tag LOCUS_09910 10905 10465 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_09910 13833 11101 gene locus_tag LOCUS_09920 gene secA 13833 11101 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387988.1 protein_id gnl|my_center|LOCUS_09920 14567 15922 gene locus_tag LOCUS_09930 14567 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 16218 16904 gene locus_tag LOCUS_09940 16218 16904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence056 1077 754 gene locus_tag LOCUS_09950 1077 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1748 2728 gene locus_tag LOCUS_09960 1748 2728 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 protein_id gnl|my_center|LOCUS_09960 3097 5232 gene locus_tag LOCUS_09970 3097 5232 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459237.1 protein_id gnl|my_center|LOCUS_09970 5798 5313 gene locus_tag LOCUS_09980 5798 5313 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_09980 6555 6094 gene locus_tag LOCUS_09990 6555 6094 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 protein_id gnl|my_center|LOCUS_09990 6686 7597 gene locus_tag LOCUS_10000 6686 7597 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_10000 7898 8950 gene locus_tag LOCUS_10010 7898 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 9460 10665 gene locus_tag LOCUS_10020 9460 10665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 11080 10823 gene locus_tag LOCUS_10030 11080 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 13082 11148 gene locus_tag LOCUS_10040 gene mutL 13082 11148 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390696.1 protein_id gnl|my_center|LOCUS_10040 14441 13101 gene locus_tag LOCUS_10050 14441 13101 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_10050 14724 14909 gene locus_tag LOCUS_10060 14724 14909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 14977 15558 gene locus_tag LOCUS_10070 14977 15558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 15730 16584 gene locus_tag LOCUS_10080 15730 16584 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence057 2219 261 gene locus_tag LOCUS_10090 gene menD 2219 261 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989780.1 protein_id gnl|my_center|LOCUS_10090 3289 4722 gene locus_tag LOCUS_10100 3289 4722 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109014.1 protein_id gnl|my_center|LOCUS_10100 4706 6205 gene locus_tag LOCUS_10110 4706 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 6335 7414 gene locus_tag LOCUS_10120 6335 7414 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_10120 7424 9973 gene locus_tag LOCUS_10130 7424 9973 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 protein_id gnl|my_center|LOCUS_10130 9970 11244 gene locus_tag LOCUS_10140 9970 11244 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_10140 12896 11298 gene locus_tag LOCUS_10150 12896 11298 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975808.1 protein_id gnl|my_center|LOCUS_10150 13120 14127 gene locus_tag LOCUS_10160 13120 14127 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565859.1 protein_id gnl|my_center|LOCUS_10160 14269 14784 gene locus_tag LOCUS_10170 14269 14784 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724859.1 protein_id gnl|my_center|LOCUS_10170 14814 16154 gene locus_tag LOCUS_10180 14814 16154 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331270.1 protein_id gnl|my_center|LOCUS_10180 16225 16710 gene locus_tag LOCUS_10190 16225 16710 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020220.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence058 <1 1263 gene locus_tag LOCUS_10200 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072339.1:glucosaminidase domain-containing protein 2309 1260 gene locus_tag LOCUS_10210 2309 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2862 2311 gene locus_tag LOCUS_10220 gene ddpX 2862 2311 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391509.1 protein_id gnl|my_center|LOCUS_10220 3112 3918 gene locus_tag LOCUS_10230 gene tsaB 3112 3918 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 protein_id gnl|my_center|LOCUS_10230 3912 4385 gene locus_tag LOCUS_10240 3912 4385 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391511.1 protein_id gnl|my_center|LOCUS_10240 4667 4422 gene locus_tag LOCUS_10250 4667 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4762 5184 gene locus_tag LOCUS_10260 4762 5184 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_10260 5657 6079 gene locus_tag LOCUS_10270 5657 6079 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_10270 6936 7799 gene locus_tag LOCUS_10280 6936 7799 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_10280 7936 8820 gene locus_tag LOCUS_10290 7936 8820 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391516.1 protein_id gnl|my_center|LOCUS_10290 9069 8920 gene locus_tag LOCUS_10300 9069 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 9143 10543 gene locus_tag LOCUS_10310 gene miaB 9143 10543 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391517.1 protein_id gnl|my_center|LOCUS_10310 10546 11625 gene locus_tag LOCUS_10320 10546 11625 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339444.1 protein_id gnl|my_center|LOCUS_10320 11622 12257 gene locus_tag LOCUS_10330 11622 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 12270 13544 gene locus_tag LOCUS_10340 12270 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 15024 13720 gene locus_tag LOCUS_10350 15024 13720 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958546.1 protein_id gnl|my_center|LOCUS_10350 16152 16451 gene locus_tag LOCUS_10360 16152 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence059 755 81 gene locus_tag LOCUS_10370 gene phaR 755 81 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_10370 1035 2147 gene locus_tag LOCUS_10380 1035 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 2062 3288 gene locus_tag LOCUS_10390 2062 3288 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 protein_id gnl|my_center|LOCUS_10390 3834 5009 gene locus_tag LOCUS_10400 3834 5009 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388027.1 protein_id gnl|my_center|LOCUS_10400 5764 6486 gene locus_tag LOCUS_10410 gene phbB 5764 6486 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_10410 6995 7750 gene locus_tag LOCUS_10420 6995 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 8438 7812 gene locus_tag LOCUS_10430 8438 7812 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942571.1 protein_id gnl|my_center|LOCUS_10430 10346 8484 gene locus_tag LOCUS_10440 10346 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 12376 10451 gene locus_tag LOCUS_10450 12376 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 14427 12532 gene locus_tag LOCUS_10460 14427 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 16088 14541 gene locus_tag LOCUS_10470 16088 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence060 802 68 gene locus_tag LOCUS_10480 802 68 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_10480 1576 884 gene locus_tag LOCUS_10490 1576 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 2732 1974 gene locus_tag LOCUS_10500 2732 1974 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_10500 4937 2844 gene locus_tag LOCUS_10510 gene rpoD 4937 2844 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390632.1 protein_id gnl|my_center|LOCUS_10510 7455 5461 gene locus_tag LOCUS_10520 7455 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 8213 7758 gene locus_tag LOCUS_10530 8213 7758 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_10530 8813 10000 gene locus_tag LOCUS_10540 gene carA 8813 10000 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 protein_id gnl|my_center|LOCUS_10540 10168 13443 gene locus_tag LOCUS_10550 gene carB 10168 13443 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390636.1 protein_id gnl|my_center|LOCUS_10550 13972 14445 gene locus_tag LOCUS_10560 gene greA 13972 14445 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722610.1 protein_id gnl|my_center|LOCUS_10560 14683 15225 gene locus_tag LOCUS_10570 14683 15225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 16132 15263 gene locus_tag LOCUS_10580 16132 15263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence061 832 107 gene locus_tag LOCUS_10590 832 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 2436 829 gene locus_tag LOCUS_10600 2436 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3022 2429 gene locus_tag LOCUS_10610 gene dcd 3022 2429 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390604.1 protein_id gnl|my_center|LOCUS_10610 3836 5359 gene locus_tag LOCUS_10620 3836 5359 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738493.1 protein_id gnl|my_center|LOCUS_10620 5713 6735 gene locus_tag LOCUS_10630 5713 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 6732 7826 gene locus_tag LOCUS_10640 6732 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 8304 7945 gene locus_tag LOCUS_10650 gene queD 8304 7945 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061848.1 protein_id gnl|my_center|LOCUS_10650 9014 8304 gene locus_tag LOCUS_10660 gene queC 9014 8304 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242065.1 protein_id gnl|my_center|LOCUS_10660 9402 10721 gene locus_tag LOCUS_10670 gene coaBC 9402 10721 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391543.1 protein_id gnl|my_center|LOCUS_10670 10933 11388 gene locus_tag LOCUS_10680 10933 11388 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_10680 11504 12478 gene locus_tag LOCUS_10690 gene cysK 11504 12478 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626663.1 protein_id gnl|my_center|LOCUS_10690 12750 13712 gene locus_tag LOCUS_10700 12750 13712 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265914.1 protein_id gnl|my_center|LOCUS_10700 14673 13777 gene locus_tag LOCUS_10710 14673 13777 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398389.1 protein_id gnl|my_center|LOCUS_10710 16338 14749 gene locus_tag LOCUS_10720 gene purH 16338 14749 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391402.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence062 1067 177 gene locus_tag LOCUS_10730 1067 177 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391011.1 protein_id gnl|my_center|LOCUS_10730 2193 1102 gene locus_tag LOCUS_10740 gene hisC 2193 1102 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391012.1 protein_id gnl|my_center|LOCUS_10740 3321 2461 gene locus_tag LOCUS_10750 3321 2461 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_10750 4129 5208 gene locus_tag LOCUS_10760 4129 5208 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_10760 5264 5911 gene locus_tag LOCUS_10770 gene metW 5264 5911 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_10770 6146 7132 gene locus_tag LOCUS_10780 6146 7132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_10780 7129 8535 gene locus_tag LOCUS_10790 7129 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 9663 8725 gene locus_tag LOCUS_10800 gene gcvA 9663 8725 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388543.1 protein_id gnl|my_center|LOCUS_10800 10561 11853 gene locus_tag LOCUS_10810 gene ahcY 10561 11853 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_10810 12072 14042 gene locus_tag LOCUS_10820 12072 14042 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 protein_id gnl|my_center|LOCUS_10820 14562 15014 gene locus_tag LOCUS_10830 14562 15014 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566035.1 protein_id gnl|my_center|LOCUS_10830 15905 15192 gene locus_tag LOCUS_10840 15905 15192 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390306.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence063 454 11 gene locus_tag LOCUS_10850 454 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1094 789 gene locus_tag LOCUS_10860 1094 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10860 1880 4609 gene locus_tag LOCUS_10870 1880 4609 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389549.1 protein_id gnl|my_center|LOCUS_10870 6216 4801 gene locus_tag LOCUS_10880 gene pyk 6216 4801 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390218.1 protein_id gnl|my_center|LOCUS_10880 7311 7790 gene locus_tag LOCUS_10890 7311 7790 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391031.1 protein_id gnl|my_center|LOCUS_10890 9057 8065 gene locus_tag LOCUS_10900 9057 8065 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104504.1 protein_id gnl|my_center|LOCUS_10900 10514 9288 gene locus_tag LOCUS_10910 10514 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 12237 10801 gene locus_tag LOCUS_10920 12237 10801 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_10920 12589 14334 gene locus_tag LOCUS_10930 12589 14334 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085661.1 protein_id gnl|my_center|LOCUS_10930 14589 15422 gene locus_tag LOCUS_10940 14589 15422 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_10940 15749 16300 gene locus_tag LOCUS_10950 15749 16300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence064 122 931 gene locus_tag LOCUS_10960 122 931 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_10960 1084 1479 gene locus_tag LOCUS_10970 1084 1479 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173552.1 protein_id gnl|my_center|LOCUS_10970 1591 2655 gene locus_tag LOCUS_10980 1591 2655 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_10980 2779 5295 gene locus_tag LOCUS_10990 gene copA1 2779 5295 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_10990 5572 6036 gene locus_tag LOCUS_11000 5572 6036 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709372.1 protein_id gnl|my_center|LOCUS_11000 6960 6127 gene locus_tag LOCUS_11010 6960 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 7385 6984 gene locus_tag LOCUS_11020 7385 6984 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965096.1 protein_id gnl|my_center|LOCUS_11020 7732 8622 gene locus_tag LOCUS_11030 7732 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 8678 10834 gene locus_tag LOCUS_11040 gene ligA 8678 10834 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388694.1 protein_id gnl|my_center|LOCUS_11040 11073 11879 gene locus_tag LOCUS_11050 11073 11879 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266520.1 protein_id gnl|my_center|LOCUS_11050 12262 11927 gene locus_tag LOCUS_11060 12262 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11060 12692 12309 gene locus_tag LOCUS_11070 12692 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11070 13830 13327 gene locus_tag LOCUS_11080 13830 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 15276 14233 gene locus_tag LOCUS_11090 15276 14233 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389350.1 protein_id gnl|my_center|LOCUS_11090 16108 15395 gene locus_tag LOCUS_11100 16108 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence065 1321 44 gene locus_tag LOCUS_11110 1321 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2324 1326 gene locus_tag LOCUS_11120 2324 1326 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391118.1 protein_id gnl|my_center|LOCUS_11120 2712 4148 gene locus_tag LOCUS_11130 2712 4148 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809405.1 protein_id gnl|my_center|LOCUS_11130 4319 5203 gene locus_tag LOCUS_11140 4319 5203 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103285.1 protein_id gnl|my_center|LOCUS_11140 5214 7007 gene locus_tag LOCUS_11150 5214 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 9775 7076 gene locus_tag LOCUS_11160 9775 7076 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975944.1 protein_id gnl|my_center|LOCUS_11160 10131 9775 gene locus_tag LOCUS_11170 gene nirD 10131 9775 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003519747.1 protein_id gnl|my_center|LOCUS_11170 12584 10128 gene locus_tag LOCUS_11180 gene nirB 12584 10128 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061458.1 protein_id gnl|my_center|LOCUS_11180 14452 12722 gene locus_tag LOCUS_11190 14452 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 15595 14498 gene locus_tag LOCUS_11200 15595 14498 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence066 3354 304 gene locus_tag LOCUS_11210 3354 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4832 3564 gene locus_tag LOCUS_11220 4832 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 7796 5103 gene locus_tag LOCUS_11230 7796 5103 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_11230 9854 8247 gene locus_tag LOCUS_11240 9854 8247 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216298.1 protein_id gnl|my_center|LOCUS_11240 11619 15392 gene locus_tag LOCUS_11250 11619 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence067 1004 12 gene locus_tag LOCUS_11260 1004 12 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_11260 2584 1070 gene locus_tag LOCUS_11270 2584 1070 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_11270 3463 2870 gene locus_tag LOCUS_11280 3463 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 4676 3615 gene locus_tag LOCUS_11290 4676 3615 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_11290 6153 4801 gene locus_tag LOCUS_11300 6153 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 6787 7674 gene locus_tag LOCUS_11310 gene dapF 6787 7674 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 protein_id gnl|my_center|LOCUS_11310 7763 9136 gene locus_tag LOCUS_11320 gene mtaB 7763 9136 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921511.1 protein_id gnl|my_center|LOCUS_11320 9315 10349 gene locus_tag LOCUS_11330 9315 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 10442 11242 gene locus_tag LOCUS_11340 10442 11242 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390736.1 protein_id gnl|my_center|LOCUS_11340 11619 11422 gene locus_tag LOCUS_11350 11619 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 13184 12258 gene locus_tag LOCUS_11360 13184 12258 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171746.1 protein_id gnl|my_center|LOCUS_11360 13519 15219 gene locus_tag LOCUS_11370 13519 15219 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109795256.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence068 1524 271 gene locus_tag LOCUS_11380 1524 271 CDS product depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389460.1 protein_id gnl|my_center|LOCUS_11380 3558 2491 gene locus_tag LOCUS_11390 gene proX 3558 2491 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390230.1 protein_id gnl|my_center|LOCUS_11390 4695 3817 gene locus_tag LOCUS_11400 4695 3817 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939572.1 protein_id gnl|my_center|LOCUS_11400 5571 4738 gene locus_tag LOCUS_11410 gene choW 5571 4738 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200833.1 protein_id gnl|my_center|LOCUS_11410 6933 5620 gene locus_tag LOCUS_11420 gene proV 6933 5620 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173037.1 protein_id gnl|my_center|LOCUS_11420 8634 7768 gene locus_tag LOCUS_11430 8634 7768 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_11430 8899 9243 gene locus_tag LOCUS_11440 8899 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 10908 9259 gene locus_tag LOCUS_11450 10908 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 11176 12039 gene locus_tag LOCUS_11460 11176 12039 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463734.1 protein_id gnl|my_center|LOCUS_11460 12099 12884 gene locus_tag LOCUS_11470 12099 12884 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969610.1 protein_id gnl|my_center|LOCUS_11470 13321 12980 gene locus_tag LOCUS_11480 13321 12980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 13663 15489 gene locus_tag LOCUS_11490 gene typA 13663 15489 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence069 2105 504 gene locus_tag LOCUS_11500 2105 504 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391128.1 protein_id gnl|my_center|LOCUS_11500 3072 2197 gene locus_tag LOCUS_11510 3072 2197 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978021.1 protein_id gnl|my_center|LOCUS_11510 3864 3529 gene locus_tag LOCUS_11520 3864 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4621 6360 gene locus_tag LOCUS_11530 4621 6360 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_11530 6960 6475 gene locus_tag LOCUS_11540 6960 6475 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388088.1 protein_id gnl|my_center|LOCUS_11540 7213 9024 gene locus_tag LOCUS_11550 7213 9024 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816939.1 protein_id gnl|my_center|LOCUS_11550 10464 9052 gene locus_tag LOCUS_11560 10464 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 15116 10548 gene locus_tag LOCUS_11570 15116 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence070 1151 33 gene locus_tag LOCUS_11580 1151 33 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084892.1 protein_id gnl|my_center|LOCUS_11580 2112 1093 gene locus_tag LOCUS_11590 gene bioB 2112 1093 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103330.1 protein_id gnl|my_center|LOCUS_11590 2835 3761 gene locus_tag LOCUS_11600 2835 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4326 3892 gene locus_tag LOCUS_11610 4326 3892 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168851.1 protein_id gnl|my_center|LOCUS_11610 5111 4764 gene locus_tag LOCUS_11620 5111 4764 CDS product DUF5368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390059.1 protein_id gnl|my_center|LOCUS_11620 6481 5123 gene locus_tag LOCUS_11630 6481 5123 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390060.1 protein_id gnl|my_center|LOCUS_11630 7378 7010 gene locus_tag LOCUS_11640 7378 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 8406 10337 gene locus_tag LOCUS_11650 gene htpG 8406 10337 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387833.1 protein_id gnl|my_center|LOCUS_11650 10826 11509 gene locus_tag LOCUS_11660 10826 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 11886 11686 gene locus_tag LOCUS_11670 11886 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 12615 13946 gene locus_tag LOCUS_11680 gene purB 12615 13946 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388474.1 protein_id gnl|my_center|LOCUS_11680 13949 15148 gene locus_tag LOCUS_11690 13949 15148 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388860.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence071 2249 93 gene locus_tag LOCUS_11700 2249 93 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390010.1 protein_id gnl|my_center|LOCUS_11700 2699 3253 gene locus_tag LOCUS_11710 2699 3253 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_11710 4497 3457 gene locus_tag LOCUS_11720 4497 3457 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356689.1 protein_id gnl|my_center|LOCUS_11720 6449 4626 gene locus_tag LOCUS_11730 gene aspS 6449 4626 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_11730 7330 8640 gene locus_tag LOCUS_11740 gene rnd 7330 8640 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_11740 9317 8745 gene locus_tag LOCUS_11750 9317 8745 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389277.1 protein_id gnl|my_center|LOCUS_11750 9860 10906 gene locus_tag LOCUS_11760 9860 10906 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206266.1 protein_id gnl|my_center|LOCUS_11760 12573 10795 gene locus_tag LOCUS_11770 12573 10795 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867421.1 protein_id gnl|my_center|LOCUS_11770 13277 12570 gene locus_tag LOCUS_11780 13277 12570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 14576 13488 gene locus_tag LOCUS_11790 14576 13488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 14928 14602 gene locus_tag LOCUS_11800 14928 14602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence072 1855 392 gene locus_tag LOCUS_11810 1855 392 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140137.1 protein_id gnl|my_center|LOCUS_11810 3072 1858 gene locus_tag LOCUS_11820 3072 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_11820 5546 3321 gene locus_tag LOCUS_11830 5546 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 6643 7776 gene locus_tag LOCUS_11840 6643 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 8051 8752 gene locus_tag LOCUS_11850 8051 8752 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855810.1 protein_id gnl|my_center|LOCUS_11850 12670 8834 gene locus_tag LOCUS_11860 gene cobN 12670 8834 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975897.1 protein_id gnl|my_center|LOCUS_11860 13061 12813 gene locus_tag LOCUS_11870 13061 12813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 13103 13264 gene locus_tag LOCUS_11880 13103 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence073 411 1712 gene locus_tag LOCUS_11890 gene recF 411 1712 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387764.1 protein_id gnl|my_center|LOCUS_11890 3055 1727 gene locus_tag LOCUS_11900 3055 1727 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 protein_id gnl|my_center|LOCUS_11900 3877 3206 gene locus_tag LOCUS_11910 3877 3206 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_11910 4676 4224 gene locus_tag LOCUS_11920 4676 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6260 4740 gene locus_tag LOCUS_11930 6260 4740 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_11930 6546 6800 gene locus_tag LOCUS_11940 6546 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 7374 8333 gene locus_tag LOCUS_11950 gene mdh 7374 8333 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528846.1 protein_id gnl|my_center|LOCUS_11950 8485 9681 gene locus_tag LOCUS_11960 gene sucC 8485 9681 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_11960 9681 10559 gene locus_tag LOCUS_11970 gene sucD 9681 10559 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_11970 11197 14127 gene locus_tag LOCUS_11980 11197 14127 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388968.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence074 <1 1008 gene locus_tag LOCUS_11990 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389598.1:arginyltransferase 1339 2820 gene locus_tag LOCUS_12000 1339 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2810 4564 gene locus_tag LOCUS_12010 2810 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 4908 5423 gene locus_tag LOCUS_12020 gene mobB 4908 5423 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039619.1 protein_id gnl|my_center|LOCUS_12020 6181 5495 gene locus_tag LOCUS_12030 6181 5495 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389613.1 protein_id gnl|my_center|LOCUS_12030 7227 6571 gene locus_tag LOCUS_12040 7227 6571 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_12040 7898 8431 gene locus_tag LOCUS_12050 gene folK 7898 8431 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391686.1 protein_id gnl|my_center|LOCUS_12050 8840 9166 gene locus_tag LOCUS_12060 gene rpoZ 8840 9166 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389610.1 protein_id gnl|my_center|LOCUS_12060 9265 11439 gene locus_tag LOCUS_12070 9265 11439 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385014.1 protein_id gnl|my_center|LOCUS_12070 11713 12270 gene locus_tag LOCUS_12080 11713 12270 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389608.1 protein_id gnl|my_center|LOCUS_12080 12643 14400 gene locus_tag LOCUS_12090 12643 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence075 343 1530 gene locus_tag LOCUS_12100 gene metC 343 1530 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_12100 1680 2117 gene locus_tag LOCUS_12110 gene hisI 1680 2117 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_12110 2188 2223 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2886 2260 gene locus_tag LOCUS_12120 2886 2260 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_12120 3394 2936 gene locus_tag LOCUS_12130 3394 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 4824 3475 gene locus_tag LOCUS_12140 gene fliI 4824 3475 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 protein_id gnl|my_center|LOCUS_12140 5741 6460 gene locus_tag LOCUS_12150 5741 6460 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_12150 8333 6708 gene locus_tag LOCUS_12160 8333 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 8503 8330 gene locus_tag LOCUS_12170 8503 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 10240 9059 gene locus_tag LOCUS_12180 10240 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 14022 10552 gene locus_tag LOCUS_12190 14022 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence076 1901 318 gene locus_tag LOCUS_12200 1901 318 CDS product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707269.1 protein_id gnl|my_center|LOCUS_12200 5533 2471 gene locus_tag LOCUS_12210 5533 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6681 5560 gene locus_tag LOCUS_12220 gene meaB 6681 5560 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_12220 8870 6681 gene locus_tag LOCUS_12230 gene scpA 8870 6681 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390232.1 protein_id gnl|my_center|LOCUS_12230 10966 8867 gene locus_tag LOCUS_12240 10966 8867 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 protein_id gnl|my_center|LOCUS_12240 11691 14057 gene locus_tag LOCUS_12250 11691 14057 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence077 1810 107 gene locus_tag LOCUS_12260 1810 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3215 2415 gene locus_tag LOCUS_12270 3215 2415 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_12270 4116 3550 gene locus_tag LOCUS_12280 gene efp 4116 3550 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529127.1 protein_id gnl|my_center|LOCUS_12280 5385 4339 gene locus_tag LOCUS_12290 5385 4339 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_12290 5828 7750 gene locus_tag LOCUS_12300 5828 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7792 8358 gene locus_tag LOCUS_12310 7792 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 8377 9159 gene locus_tag LOCUS_12320 gene tam 8377 9159 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816760.1 protein_id gnl|my_center|LOCUS_12320 12252 9166 gene locus_tag LOCUS_12330 12252 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 13785 12265 gene locus_tag LOCUS_12340 13785 12265 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence078 1313 42 gene locus_tag LOCUS_12350 gene ftsA 1313 42 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388700.1 protein_id gnl|my_center|LOCUS_12350 2689 1313 gene locus_tag LOCUS_12360 2689 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 3609 2677 gene locus_tag LOCUS_12370 3609 2677 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388702.1 protein_id gnl|my_center|LOCUS_12370 4566 3613 gene locus_tag LOCUS_12380 gene murB 4566 3613 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388703.1 protein_id gnl|my_center|LOCUS_12380 6050 4638 gene locus_tag LOCUS_12390 gene murC 6050 4638 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388704.1 protein_id gnl|my_center|LOCUS_12390 7672 6485 gene locus_tag LOCUS_12400 gene murG 7672 6485 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089342.1 protein_id gnl|my_center|LOCUS_12400 9745 8597 gene locus_tag LOCUS_12410 9745 8597 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_12410 11199 9763 gene locus_tag LOCUS_12420 gene murD 11199 9763 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388707.1 protein_id gnl|my_center|LOCUS_12420 12371 11283 gene locus_tag LOCUS_12430 gene mraY 12371 11283 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388708.1 protein_id gnl|my_center|LOCUS_12430 13864 12422 gene locus_tag LOCUS_12440 gene murF 13864 12422 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence079 1354 323 gene locus_tag LOCUS_12450 1354 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2319 1585 gene locus_tag LOCUS_12460 2319 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 3286 2483 gene locus_tag LOCUS_12470 3286 2483 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_12470 3880 4161 gene locus_tag LOCUS_12480 3880 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 4486 4773 gene locus_tag LOCUS_12490 4486 4773 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971859.1 protein_id gnl|my_center|LOCUS_12490 4840 8406 gene locus_tag LOCUS_12500 gene mfd 4840 8406 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389416.1 protein_id gnl|my_center|LOCUS_12500 9154 8501 gene locus_tag LOCUS_12510 9154 8501 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389675.1 protein_id gnl|my_center|LOCUS_12510 9597 11471 gene locus_tag LOCUS_12520 9597 11471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 11948 13195 gene locus_tag LOCUS_12530 11948 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence080 319 1186 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttacccgccgagcaggcggctcagaag 1763 2032 gene locus_tag LOCUS_12540 1763 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2315 3895 gene locus_tag LOCUS_12550 2315 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3892 5004 gene locus_tag LOCUS_12560 3892 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 5139 6278 gene locus_tag LOCUS_12570 gene csy3 5139 6278 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957412.1 protein_id gnl|my_center|LOCUS_12570 6282 7103 gene locus_tag LOCUS_12580 6282 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 7660 7418 gene locus_tag LOCUS_12590 7660 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 8257 10293 gene locus_tag LOCUS_12600 8257 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 11101 13467 gene locus_tag LOCUS_12610 11101 13467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence081 862 2619 gene locus_tag LOCUS_12620 862 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2603 3142 gene locus_tag LOCUS_12630 2603 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 4561 3218 gene locus_tag LOCUS_12640 4561 3218 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090247.1 protein_id gnl|my_center|LOCUS_12640 4816 5181 gene locus_tag LOCUS_12650 4816 5181 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388255.1 protein_id gnl|my_center|LOCUS_12650 5830 5261 gene locus_tag LOCUS_12660 5830 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 6165 7496 gene locus_tag LOCUS_12670 gene mnmA 6165 7496 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265643.1 protein_id gnl|my_center|LOCUS_12670 7577 7653 gene locus_tag LOCUS_t00100 7577 7653 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8021 7698 gene locus_tag LOCUS_12680 8021 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 8994 8218 gene locus_tag LOCUS_12690 8994 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 9238 9026 gene locus_tag LOCUS_12700 9238 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 9611 9225 gene locus_tag LOCUS_12710 9611 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 10630 9608 gene locus_tag LOCUS_12720 10630 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 11603 10632 gene locus_tag LOCUS_12730 11603 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 12248 11709 gene locus_tag LOCUS_12740 12248 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 12582 12259 gene locus_tag LOCUS_12750 12582 12259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 13302 12793 gene locus_tag LOCUS_12760 13302 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence082 1040 3802 gene locus_tag LOCUS_12770 1040 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 5371 4121 gene locus_tag LOCUS_12780 5371 4121 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391251.1 protein_id gnl|my_center|LOCUS_12780 6265 5417 gene locus_tag LOCUS_12790 6265 5417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 protein_id gnl|my_center|LOCUS_12790 7697 6357 gene locus_tag LOCUS_12800 7697 6357 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 protein_id gnl|my_center|LOCUS_12800 9047 7947 gene locus_tag LOCUS_12810 9047 7947 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 protein_id gnl|my_center|LOCUS_12810 9988 9053 gene locus_tag LOCUS_12820 9988 9053 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104319.1 protein_id gnl|my_center|LOCUS_12820 10919 10092 gene locus_tag LOCUS_12830 10919 10092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 protein_id gnl|my_center|LOCUS_12830 12946 10982 gene locus_tag LOCUS_12840 12946 10982 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337373.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence083 1130 333 gene locus_tag LOCUS_12850 gene pgeF 1130 333 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388401.1 protein_id gnl|my_center|LOCUS_12850 2445 1177 gene locus_tag LOCUS_12860 2445 1177 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140038.1 protein_id gnl|my_center|LOCUS_12860 3321 2452 gene locus_tag LOCUS_12870 gene lgt 3321 2452 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_12870 4382 3396 gene locus_tag LOCUS_12880 gene rfaD 4382 3396 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391026.1 protein_id gnl|my_center|LOCUS_12880 5227 4667 gene locus_tag LOCUS_12890 5227 4667 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597571.1 protein_id gnl|my_center|LOCUS_12890 7170 5263 gene locus_tag LOCUS_12900 7170 5263 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_12900 7443 9248 gene locus_tag LOCUS_12910 7443 9248 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_12910 9570 9352 gene locus_tag LOCUS_12920 9570 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 10939 10184 gene locus_tag LOCUS_12930 10939 10184 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_12930 13604 11949 gene locus_tag LOCUS_12940 13604 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence084 39 1115 gene locus_tag LOCUS_12950 gene cobT 39 1115 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975751.1 protein_id gnl|my_center|LOCUS_12950 1258 1938 gene locus_tag LOCUS_12960 1258 1938 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_12960 2010 2621 gene locus_tag LOCUS_12970 2010 2621 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_12970 3615 2710 gene locus_tag LOCUS_12980 3615 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4184 4933 gene locus_tag LOCUS_12990 4184 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 6278 5007 gene locus_tag LOCUS_13000 6278 5007 CDS product DUF4857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939655.1 protein_id gnl|my_center|LOCUS_13000 6943 6275 gene locus_tag LOCUS_13010 6943 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939654.1 protein_id gnl|my_center|LOCUS_13010 7933 7022 gene locus_tag LOCUS_13020 7933 7022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789207.1 protein_id gnl|my_center|LOCUS_13020 8206 7946 gene locus_tag LOCUS_13030 8206 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 10862 8310 gene locus_tag LOCUS_13040 gene feoB 10862 8310 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939841.1 protein_id gnl|my_center|LOCUS_13040 11073 10855 gene locus_tag LOCUS_13050 11073 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13050 11339 11070 gene locus_tag LOCUS_13060 11339 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 12155 11352 gene locus_tag LOCUS_13070 12155 11352 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679851.1 protein_id gnl|my_center|LOCUS_13070 12561 12235 gene locus_tag LOCUS_13080 12561 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674683.1 protein_id gnl|my_center|LOCUS_13080 13800 12868 gene locus_tag LOCUS_13090 13800 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence085 2084 18 gene locus_tag LOCUS_13100 2084 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3763 4719 gene locus_tag LOCUS_13110 3763 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5184 4822 gene locus_tag LOCUS_13120 5184 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5754 6872 gene locus_tag LOCUS_13130 5754 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 7812 6904 gene locus_tag LOCUS_13140 7812 6904 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388273.1 protein_id gnl|my_center|LOCUS_13140 8298 9143 gene locus_tag LOCUS_13150 8298 9143 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_13150 9264 10637 gene locus_tag LOCUS_13160 9264 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 10774 13560 gene locus_tag LOCUS_13170 10774 13560 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence086 1648 143 gene locus_tag LOCUS_13180 1648 143 CDS product FAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020815.1 protein_id gnl|my_center|LOCUS_13180 1950 1711 gene locus_tag LOCUS_13190 1950 1711 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023560.1 protein_id gnl|my_center|LOCUS_13190 2663 1947 gene locus_tag LOCUS_13200 2663 1947 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028258.1 protein_id gnl|my_center|LOCUS_13200 3648 2656 gene locus_tag LOCUS_13210 3648 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 4076 3645 gene locus_tag LOCUS_13220 4076 3645 CDS product DUF3429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019821.1 protein_id gnl|my_center|LOCUS_13220 4491 4763 gene locus_tag LOCUS_13230 4491 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 5070 6452 gene locus_tag LOCUS_13240 gene purB 5070 6452 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496668.1 protein_id gnl|my_center|LOCUS_13240 6879 7133 gene locus_tag LOCUS_13250 6879 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 7114 7281 gene locus_tag LOCUS_13260 7114 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 7665 7345 gene locus_tag LOCUS_13270 7665 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 8908 7727 gene locus_tag LOCUS_13280 8908 7727 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525235.1 protein_id gnl|my_center|LOCUS_13280 9431 11314 gene locus_tag LOCUS_13290 9431 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 11301 11711 gene locus_tag LOCUS_13300 11301 11711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 12078 11911 gene locus_tag LOCUS_13310 12078 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13310 13140 13322 gene locus_tag LOCUS_13320 13140 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence087 796 560 gene locus_tag LOCUS_13330 796 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1947 1261 gene locus_tag LOCUS_13340 1947 1261 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338060.1 protein_id gnl|my_center|LOCUS_13340 3635 1947 gene locus_tag LOCUS_13350 3635 1947 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217807779.1 protein_id gnl|my_center|LOCUS_13350 4647 3895 gene locus_tag LOCUS_13360 4647 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 5509 6636 gene locus_tag LOCUS_13370 5509 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 7130 8257 gene locus_tag LOCUS_13380 7130 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 8287 10065 gene locus_tag LOCUS_13390 gene asnB 8287 10065 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_13390 10797 10099 gene locus_tag LOCUS_13400 10797 10099 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208197.1 protein_id gnl|my_center|LOCUS_13400 11552 10896 gene locus_tag LOCUS_13410 gene rpe 11552 10896 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085374.1 protein_id gnl|my_center|LOCUS_13410 12253 11747 gene locus_tag LOCUS_13420 12253 11747 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388985.1 protein_id gnl|my_center|LOCUS_13420 <13346 12407 gene locus_tag LOCUS_13430 <13346 12407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388969.1:2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase >Feature sequence088 1317 157 gene locus_tag LOCUS_13440 gene ccmI 1317 157 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387793.1 protein_id gnl|my_center|LOCUS_13440 1969 2328 gene locus_tag LOCUS_13450 1969 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2846 3994 gene locus_tag LOCUS_13460 gene torC 2846 3994 CDS product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389038.1 protein_id gnl|my_center|LOCUS_13460 4323 6683 gene locus_tag LOCUS_13470 gene extM 4323 6683 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_13470 7197 7505 gene locus_tag LOCUS_13480 7197 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 7982 8290 gene locus_tag LOCUS_13490 7982 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 8455 9165 gene locus_tag LOCUS_13500 8455 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 10045 9377 gene locus_tag LOCUS_13510 10045 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 10476 11210 gene locus_tag LOCUS_13520 10476 11210 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_13520 11290 13161 gene locus_tag LOCUS_13530 11290 13161 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence089 650 1078 gene locus_tag LOCUS_13540 650 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1774 1292 gene locus_tag LOCUS_13550 1774 1292 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986776.1 protein_id gnl|my_center|LOCUS_13550 3434 2208 gene locus_tag LOCUS_13560 3434 2208 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707147.1 protein_id gnl|my_center|LOCUS_13560 4159 3434 gene locus_tag LOCUS_13570 4159 3434 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261527.1 protein_id gnl|my_center|LOCUS_13570 4607 4152 gene locus_tag LOCUS_13580 4607 4152 CDS product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346295.1 protein_id gnl|my_center|LOCUS_13580 5797 4604 gene locus_tag LOCUS_13590 5797 4604 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 protein_id gnl|my_center|LOCUS_13590 6345 5794 gene locus_tag LOCUS_13600 6345 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 7652 6414 gene locus_tag LOCUS_13610 7652 6414 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 protein_id gnl|my_center|LOCUS_13610 10341 8032 gene locus_tag LOCUS_13620 10341 8032 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700192.1 protein_id gnl|my_center|LOCUS_13620 11006 10344 gene locus_tag LOCUS_13630 11006 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 11410 10991 gene locus_tag LOCUS_13640 11410 10991 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707154.1 protein_id gnl|my_center|LOCUS_13640 12975 11416 gene locus_tag LOCUS_13650 12975 11416 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396014.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence090 131 343 gene locus_tag LOCUS_13660 131 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 2538 460 gene locus_tag LOCUS_13670 2538 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3270 2752 gene locus_tag LOCUS_13680 3270 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 4634 3453 gene locus_tag LOCUS_13690 4634 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 6827 4689 gene locus_tag LOCUS_13700 6827 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 7870 6920 gene locus_tag LOCUS_13710 7870 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 10782 8626 gene locus_tag LOCUS_13720 10782 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 12073 12495 gene locus_tag LOCUS_13730 12073 12495 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038704.1 protein_id gnl|my_center|LOCUS_13730 12627 12962 gene locus_tag LOCUS_13740 12627 12962 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820087.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence091 72 1325 gene locus_tag LOCUS_13750 72 1325 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969038.1 protein_id gnl|my_center|LOCUS_13750 1503 1820 gene locus_tag LOCUS_13760 1503 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2207 1872 gene locus_tag LOCUS_13770 2207 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2520 4325 gene locus_tag LOCUS_13780 gene lepA 2520 4325 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970755.1 protein_id gnl|my_center|LOCUS_13780 5476 4418 gene locus_tag LOCUS_13790 5476 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 5674 6741 gene locus_tag LOCUS_13800 5674 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 6843 8060 gene locus_tag LOCUS_13810 6843 8060 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941380.1 protein_id gnl|my_center|LOCUS_13810 9413 8139 gene locus_tag LOCUS_13820 9413 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 10224 9745 gene locus_tag LOCUS_13830 10224 9745 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 protein_id gnl|my_center|LOCUS_13830 11383 10889 gene locus_tag LOCUS_13840 11383 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 12885 11497 gene locus_tag LOCUS_13850 gene cysS 12885 11497 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388447.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence092 2 613 gene locus_tag LOCUS_13860 2 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 885 1142 gene locus_tag LOCUS_13870 885 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2131 3327 gene locus_tag LOCUS_13880 2131 3327 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 protein_id gnl|my_center|LOCUS_13880 3814 4065 gene locus_tag LOCUS_13890 3814 4065 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512149.1 protein_id gnl|my_center|LOCUS_13890 4300 4142 gene locus_tag LOCUS_13900 4300 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 4392 5723 gene locus_tag LOCUS_13910 4392 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 5945 5739 gene locus_tag LOCUS_13920 5945 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 6645 5938 gene locus_tag LOCUS_13930 gene mobA 6645 5938 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921607.1 protein_id gnl|my_center|LOCUS_13930 6876 8561 gene locus_tag LOCUS_13940 6876 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10278 8662 gene locus_tag LOCUS_13950 10278 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 10853 12820 gene locus_tag LOCUS_13960 10853 12820 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence093 1500 88 gene locus_tag LOCUS_13970 1500 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 2699 1506 gene locus_tag LOCUS_13980 2699 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3464 4570 gene locus_tag LOCUS_13990 gene ychF 3464 4570 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391495.1 protein_id gnl|my_center|LOCUS_13990 4855 5745 gene locus_tag LOCUS_14000 4855 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 5924 6688 gene locus_tag LOCUS_14010 5924 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 7374 6760 gene locus_tag LOCUS_14020 gene rpsD 7374 6760 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388459.1 protein_id gnl|my_center|LOCUS_14020 8055 9131 gene locus_tag LOCUS_14030 8055 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 10533 9643 gene locus_tag LOCUS_14040 10533 9643 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388617.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence094 121 196 gene locus_tag LOCUS_t00110 121 196 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 373 573 gene locus_tag LOCUS_14050 gene secE 373 573 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390511.1 protein_id gnl|my_center|LOCUS_14050 581 1111 gene locus_tag LOCUS_14060 gene nusG 581 1111 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_14060 1424 1852 gene locus_tag LOCUS_14070 gene rplK 1424 1852 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390509.1 protein_id gnl|my_center|LOCUS_14070 1859 2563 gene locus_tag LOCUS_14080 gene rplA 1859 2563 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088163.1 protein_id gnl|my_center|LOCUS_14080 3013 3531 gene locus_tag LOCUS_14090 gene rplJ 3013 3531 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390507.1 protein_id gnl|my_center|LOCUS_14090 3588 3965 gene locus_tag LOCUS_14100 gene rplL 3588 3965 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707747.1 protein_id gnl|my_center|LOCUS_14100 4498 8670 gene locus_tag LOCUS_14110 gene rpoB 4498 8670 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390505.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence095 1114 254 gene locus_tag LOCUS_14120 1114 254 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521366.1 protein_id gnl|my_center|LOCUS_14120 1482 1820 gene locus_tag LOCUS_14130 1482 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2208 2531 gene locus_tag LOCUS_14140 2208 2531 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198610.1 protein_id gnl|my_center|LOCUS_14140 2825 3775 gene locus_tag LOCUS_14150 2825 3775 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389282.1 protein_id gnl|my_center|LOCUS_14150 3999 4916 gene locus_tag LOCUS_14160 gene metF 3999 4916 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389283.1 protein_id gnl|my_center|LOCUS_14160 4989 6050 gene locus_tag LOCUS_14170 4989 6050 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083947.1 protein_id gnl|my_center|LOCUS_14170 6133 9651 gene locus_tag LOCUS_14180 gene metH 6133 9651 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389284.1 protein_id gnl|my_center|LOCUS_14180 10737 9802 gene locus_tag LOCUS_14190 10737 9802 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_14190 12218 11043 gene locus_tag LOCUS_14200 12218 11043 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence096 1368 2645 gene locus_tag LOCUS_14210 gene purD 1368 2645 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532813.1 protein_id gnl|my_center|LOCUS_14210 2920 2768 gene locus_tag LOCUS_14220 2920 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3245 2898 gene locus_tag LOCUS_14230 3245 2898 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388255.1 protein_id gnl|my_center|LOCUS_14230 5059 3863 gene locus_tag LOCUS_14240 5059 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 7143 5173 gene locus_tag LOCUS_14250 7143 5173 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114912.1 protein_id gnl|my_center|LOCUS_14250 7968 7234 gene locus_tag LOCUS_14260 7968 7234 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_14260 8993 8028 gene locus_tag LOCUS_14270 8993 8028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_14270 9541 10923 gene locus_tag LOCUS_14280 9541 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 12140 11004 gene locus_tag LOCUS_14290 12140 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence097 1575 37 gene locus_tag LOCUS_14300 1575 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 3386 2667 gene locus_tag LOCUS_14310 3386 2667 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017276633.1 protein_id gnl|my_center|LOCUS_14310 3978 3904 gene locus_tag LOCUS_t00120 3978 3904 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4086 4967 gene locus_tag LOCUS_14320 4086 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 5127 6602 gene locus_tag LOCUS_14330 gene gabD 5127 6602 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772831.1 protein_id gnl|my_center|LOCUS_14330 6735 7364 gene locus_tag LOCUS_14340 6735 7364 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626073.1 protein_id gnl|my_center|LOCUS_14340 8056 7367 gene locus_tag LOCUS_14350 8056 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 8394 8164 gene locus_tag LOCUS_14360 8394 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 8861 10261 gene locus_tag LOCUS_14370 8861 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 11239 10400 gene locus_tag LOCUS_14380 gene panB 11239 10400 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533319.1 protein_id gnl|my_center|LOCUS_14380 12251 11307 gene locus_tag LOCUS_14390 12251 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence098 993 19 gene locus_tag LOCUS_14400 gene speB 993 19 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_14400 1818 1012 gene locus_tag LOCUS_14410 1818 1012 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_14410 2779 1820 gene locus_tag LOCUS_14420 2779 1820 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388771.1 protein_id gnl|my_center|LOCUS_14420 3906 2776 gene locus_tag LOCUS_14430 gene potA 3906 2776 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388772.1 protein_id gnl|my_center|LOCUS_14430 5172 4081 gene locus_tag LOCUS_14440 gene potF 5172 4081 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208762.1 protein_id gnl|my_center|LOCUS_14440 6525 5224 gene locus_tag LOCUS_14450 6525 5224 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310035.1 protein_id gnl|my_center|LOCUS_14450 7873 6527 gene locus_tag LOCUS_14460 7873 6527 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532930.1 protein_id gnl|my_center|LOCUS_14460 8252 8953 gene locus_tag LOCUS_14470 8252 8953 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389010.1 protein_id gnl|my_center|LOCUS_14470 9122 10621 gene locus_tag LOCUS_14480 9122 10621 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388051.1 protein_id gnl|my_center|LOCUS_14480 10690 11958 gene locus_tag LOCUS_14490 10690 11958 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527918.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence099 508 221 gene locus_tag LOCUS_14500 508 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 791 1852 gene locus_tag LOCUS_14510 791 1852 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_14510 1845 2612 gene locus_tag LOCUS_14520 1845 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 5191 2657 gene locus_tag LOCUS_14530 5191 2657 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942659.1 protein_id gnl|my_center|LOCUS_14530 6678 9224 gene locus_tag LOCUS_14540 6678 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 9441 10151 gene locus_tag LOCUS_14550 9441 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 10540 11889 gene locus_tag LOCUS_14560 10540 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence100 <1 1300 gene locus_tag LOCUS_14570 <1 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945973.1:deoxyribodipyrimidine photo-lyase 2487 1474 gene locus_tag LOCUS_14580 2487 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4093 2477 gene locus_tag LOCUS_14590 4093 2477 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122388.1 protein_id gnl|my_center|LOCUS_14590 4226 5233 gene locus_tag LOCUS_14600 gene add 4226 5233 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256408.1 protein_id gnl|my_center|LOCUS_14600 5329 5982 gene locus_tag LOCUS_14610 5329 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 6297 7139 gene locus_tag LOCUS_14620 6297 7139 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036011.1 protein_id gnl|my_center|LOCUS_14620 7147 8175 gene locus_tag LOCUS_14630 7147 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 8172 9047 gene locus_tag LOCUS_14640 8172 9047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 9081 11147 gene locus_tag LOCUS_14650 9081 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 11157 11759 gene locus_tag LOCUS_14660 11157 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence101 33 509 gene locus_tag LOCUS_14670 gene smpB 33 509 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087830.1 protein_id gnl|my_center|LOCUS_14670 877 2097 gene locus_tag LOCUS_14680 877 2097 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086606.1 protein_id gnl|my_center|LOCUS_14680 2197 4077 gene locus_tag LOCUS_14690 2197 4077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086607.1 protein_id gnl|my_center|LOCUS_14690 4080 4859 gene locus_tag LOCUS_14700 4080 4859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086608.1 protein_id gnl|my_center|LOCUS_14700 4987 5436 gene locus_tag LOCUS_14710 4987 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5423 6169 gene locus_tag LOCUS_14720 5423 6169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 protein_id gnl|my_center|LOCUS_14720 6388 8448 gene locus_tag LOCUS_14730 6388 8448 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528563.1 protein_id gnl|my_center|LOCUS_14730 8641 10488 gene locus_tag LOCUS_14740 8641 10488 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_14740 11604 10543 gene locus_tag LOCUS_14750 11604 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence102 121 2748 gene locus_tag LOCUS_14760 121 2748 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_14760 2752 4029 gene locus_tag LOCUS_14770 2752 4029 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_14770 4279 5142 gene locus_tag LOCUS_14780 gene motA 4279 5142 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_14780 5335 6384 gene locus_tag LOCUS_14790 5335 6384 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389596.1 protein_id gnl|my_center|LOCUS_14790 6577 7056 gene locus_tag LOCUS_14800 6577 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 7745 7254 gene locus_tag LOCUS_14810 7745 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 8548 7748 gene locus_tag LOCUS_14820 8548 7748 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_14820 9213 8638 gene locus_tag LOCUS_14830 9213 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 9857 10291 gene locus_tag LOCUS_14840 9857 10291 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087727.1 protein_id gnl|my_center|LOCUS_14840 10666 11130 gene locus_tag LOCUS_14850 gene rplM 10666 11130 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312738.1 protein_id gnl|my_center|LOCUS_14850 11134 11625 gene locus_tag LOCUS_14860 gene rpsI 11134 11625 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720163.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence103 398 2458 gene locus_tag LOCUS_14870 398 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 3254 3877 gene locus_tag LOCUS_14880 3254 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 4215 5414 gene locus_tag LOCUS_14890 4215 5414 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 protein_id gnl|my_center|LOCUS_14890 5528 8641 gene locus_tag LOCUS_14900 5528 8641 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_14900 9659 8760 gene locus_tag LOCUS_14910 gene folD 9659 8760 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_14910 10159 9776 gene locus_tag LOCUS_14920 10159 9776 CDS product DUF167 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391273.1 protein_id gnl|my_center|LOCUS_14920 10479 10168 gene locus_tag LOCUS_14930 10479 10168 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_14930 10809 10884 gene locus_tag LOCUS_t00130 10809 10884 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11260 11015 gene locus_tag LOCUS_14940 11260 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 11382 11543 gene locus_tag LOCUS_14950 11382 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence104 877 629 gene locus_tag LOCUS_14960 877 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2494 1244 gene locus_tag LOCUS_14970 2494 1244 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787406.1 protein_id gnl|my_center|LOCUS_14970 3264 4112 gene locus_tag LOCUS_14980 3264 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 4637 4197 gene locus_tag LOCUS_14990 4637 4197 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036347.1 protein_id gnl|my_center|LOCUS_14990 5210 6577 gene locus_tag LOCUS_15000 5210 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 7884 6712 gene locus_tag LOCUS_15010 7884 6712 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640215.1 protein_id gnl|my_center|LOCUS_15010 <11665 8171 gene locus_tag LOCUS_15020 <11665 8171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968589.1:DUF11 domain-containing protein >Feature sequence105 387 1124 gene locus_tag LOCUS_15030 387 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1287 4610 gene locus_tag LOCUS_15040 1287 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 4979 5584 gene locus_tag LOCUS_15050 4979 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 6156 6992 gene locus_tag LOCUS_15060 6156 6992 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096744.1 protein_id gnl|my_center|LOCUS_15060 7262 9229 gene locus_tag LOCUS_15070 7262 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 9913 9353 gene locus_tag LOCUS_15080 9913 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 10364 10002 gene locus_tag LOCUS_15090 10364 10002 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390365.1 protein_id gnl|my_center|LOCUS_15090 11014 10514 gene locus_tag LOCUS_15100 gene coaD 11014 10514 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389496.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence106 1919 198 gene locus_tag LOCUS_15110 gene recN 1919 198 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388695.1 protein_id gnl|my_center|LOCUS_15110 2753 1986 gene locus_tag LOCUS_15120 2753 1986 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 protein_id gnl|my_center|LOCUS_15120 4064 3069 gene locus_tag LOCUS_15130 gene lpxC 4064 3069 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388698.1 protein_id gnl|my_center|LOCUS_15130 5202 4468 gene locus_tag LOCUS_15140 5202 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 6525 6818 gene locus_tag LOCUS_15150 gene gatC 6525 6818 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533050.1 protein_id gnl|my_center|LOCUS_15150 6824 8323 gene locus_tag LOCUS_15160 gene gatA 6824 8323 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390924.1 protein_id gnl|my_center|LOCUS_15160 8352 9818 gene locus_tag LOCUS_15170 gene gatB 8352 9818 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390923.1 protein_id gnl|my_center|LOCUS_15170 10531 10127 gene locus_tag LOCUS_15180 10531 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15180 11000 10419 gene locus_tag LOCUS_15190 11000 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15190 11261 11551 gene locus_tag LOCUS_15200 11261 11551 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921421.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence107 675 526 gene locus_tag LOCUS_15210 675 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 874 656 gene locus_tag LOCUS_15220 874 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 2080 1247 gene locus_tag LOCUS_15230 gene flgH 2080 1247 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390472.1 protein_id gnl|my_center|LOCUS_15230 3293 2235 gene locus_tag LOCUS_15240 gene flgA 3293 2235 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390471.1 protein_id gnl|my_center|LOCUS_15240 4372 3587 gene locus_tag LOCUS_15250 gene flgG 4372 3587 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919925.1 protein_id gnl|my_center|LOCUS_15250 5362 4595 gene locus_tag LOCUS_15260 gene flgF 5362 4595 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390469.1 protein_id gnl|my_center|LOCUS_15260 6581 7165 gene locus_tag LOCUS_15270 6581 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 7507 8574 gene locus_tag LOCUS_15280 gene fliM 7507 8574 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390467.1 protein_id gnl|my_center|LOCUS_15280 8576 9094 gene locus_tag LOCUS_15290 8576 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 9302 10075 gene locus_tag LOCUS_15300 9302 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390465.1 protein_id gnl|my_center|LOCUS_15300 10933 11319 gene locus_tag LOCUS_15310 10933 11319 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence108 608 2395 gene locus_tag LOCUS_15320 608 2395 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 protein_id gnl|my_center|LOCUS_15320 2564 3517 gene locus_tag LOCUS_15330 2564 3517 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971024.1 protein_id gnl|my_center|LOCUS_15330 3926 4261 gene locus_tag LOCUS_15340 3926 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 5149 4574 gene locus_tag LOCUS_15350 5149 4574 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 protein_id gnl|my_center|LOCUS_15350 5511 5945 gene locus_tag LOCUS_15360 5511 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 6157 7005 gene locus_tag LOCUS_15370 6157 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 8384 7170 gene locus_tag LOCUS_15380 8384 7170 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387885.1 protein_id gnl|my_center|LOCUS_15380 9324 8437 gene locus_tag LOCUS_15390 9324 8437 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence109 <1 2548 gene locus_tag LOCUS_15400 <1 2548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104263.1:autotransporter domain-containing protein 2761 3483 gene locus_tag LOCUS_15410 2761 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 4063 3488 gene locus_tag LOCUS_15420 4063 3488 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_15420 5087 4323 gene locus_tag LOCUS_15430 5087 4323 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688976.1 protein_id gnl|my_center|LOCUS_15430 5607 5233 gene locus_tag LOCUS_15440 5607 5233 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_15440 6592 5645 gene locus_tag LOCUS_15450 6592 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 8386 6734 gene locus_tag LOCUS_15460 gene secD 8386 6734 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087503.1 protein_id gnl|my_center|LOCUS_15460 9163 8795 gene locus_tag LOCUS_15470 gene yajC 9163 8795 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087504.1 protein_id gnl|my_center|LOCUS_15470 9958 10830 gene locus_tag LOCUS_15480 9958 10830 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389519.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence110 1106 627 gene locus_tag LOCUS_15490 gene rplO 1106 627 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328073.1 protein_id gnl|my_center|LOCUS_15490 1342 1160 gene locus_tag LOCUS_15500 gene rpmD 1342 1160 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390420.1 protein_id gnl|my_center|LOCUS_15500 1906 1349 gene locus_tag LOCUS_15510 gene rpsE 1906 1349 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390421.1 protein_id gnl|my_center|LOCUS_15510 2297 1935 gene locus_tag LOCUS_15520 gene rplR 2297 1935 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603036.1 protein_id gnl|my_center|LOCUS_15520 2845 2312 gene locus_tag LOCUS_15530 gene rplF 2845 2312 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975182.1 protein_id gnl|my_center|LOCUS_15530 3324 2926 gene locus_tag LOCUS_15540 gene rpsH 3324 2926 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390424.1 protein_id gnl|my_center|LOCUS_15540 3643 3338 gene locus_tag LOCUS_15550 gene rpsN 3643 3338 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707764.1 protein_id gnl|my_center|LOCUS_15550 4220 3681 gene locus_tag LOCUS_15560 gene rplE 4220 3681 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390426.1 protein_id gnl|my_center|LOCUS_15560 4558 4241 gene locus_tag LOCUS_15570 gene rplX 4558 4241 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_15570 4926 4558 gene locus_tag LOCUS_15580 gene rplN 4926 4558 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390428.1 protein_id gnl|my_center|LOCUS_15580 5274 5038 gene locus_tag LOCUS_15590 gene rpsQ 5274 5038 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390429.1 protein_id gnl|my_center|LOCUS_15590 5552 5304 gene locus_tag LOCUS_15600 5552 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 5997 5584 gene locus_tag LOCUS_15610 gene rplP 5997 5584 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 protein_id gnl|my_center|LOCUS_15610 6775 6068 gene locus_tag LOCUS_15620 gene rpsC 6775 6068 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_15620 7158 6775 gene locus_tag LOCUS_15630 gene rplV 7158 6775 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538011.1 protein_id gnl|my_center|LOCUS_15630 7443 7165 gene locus_tag LOCUS_15640 gene rpsS 7443 7165 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390434.1 protein_id gnl|my_center|LOCUS_15640 8282 7455 gene locus_tag LOCUS_15650 gene rplB 8282 7455 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538013.1 protein_id gnl|my_center|LOCUS_15650 8664 8332 gene locus_tag LOCUS_15660 8664 8332 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440457.1 protein_id gnl|my_center|LOCUS_15660 9281 8661 gene locus_tag LOCUS_15670 gene rplD 9281 8661 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390437.1 protein_id gnl|my_center|LOCUS_15670 10017 9286 gene locus_tag LOCUS_15680 gene rplC 10017 9286 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390498.1 protein_id gnl|my_center|LOCUS_15680 11058 10750 gene locus_tag LOCUS_15690 gene rpsJ 11058 10750 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence111 775 197 gene locus_tag LOCUS_15700 775 197 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918171.1 protein_id gnl|my_center|LOCUS_15700 1638 3464 gene locus_tag LOCUS_15710 1638 3464 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389349.1 protein_id gnl|my_center|LOCUS_15710 4438 3581 gene locus_tag LOCUS_15720 4438 3581 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389967.1 protein_id gnl|my_center|LOCUS_15720 6496 4973 gene locus_tag LOCUS_15730 6496 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15730 7097 6441 gene locus_tag LOCUS_15740 7097 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15740 7970 7275 gene locus_tag LOCUS_15750 gene trmB 7970 7275 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 protein_id gnl|my_center|LOCUS_15750 9556 8390 gene locus_tag LOCUS_15760 gene metK 9556 8390 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 protein_id gnl|my_center|LOCUS_15760 10368 9877 gene locus_tag LOCUS_15770 10368 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence112 2203 3318 gene locus_tag LOCUS_15780 2203 3318 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970138.1 protein_id gnl|my_center|LOCUS_15780 4013 8218 gene locus_tag LOCUS_15790 4013 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 8336 8884 gene locus_tag LOCUS_15800 8336 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 8960 10492 gene locus_tag LOCUS_15810 8960 10492 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388332.1 protein_id gnl|my_center|LOCUS_15810 10594 10749 gene locus_tag LOCUS_15820 10594 10749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence113 2190 16 gene locus_tag LOCUS_15830 2190 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3768 2713 gene locus_tag LOCUS_15840 3768 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 4327 4052 gene locus_tag LOCUS_15850 4327 4052 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550171.1 protein_id gnl|my_center|LOCUS_15850 4613 4320 gene locus_tag LOCUS_15860 4613 4320 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067437.1 protein_id gnl|my_center|LOCUS_15860 7054 4781 gene locus_tag LOCUS_15870 gene parC 7054 4781 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_15870 8260 7244 gene locus_tag LOCUS_15880 8260 7244 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_15880 8576 9928 gene locus_tag LOCUS_15890 8576 9928 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390686.1 protein_id gnl|my_center|LOCUS_15890 9965 10786 gene locus_tag LOCUS_15900 9965 10786 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence114 <1 1702 gene locus_tag LOCUS_15910 <1 1702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807086.1:asparagine synthase (glutamine-hydrolyzing) 1838 2488 gene locus_tag LOCUS_15920 1838 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3176 2637 gene locus_tag LOCUS_15930 3176 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4306 4716 gene locus_tag LOCUS_15940 4306 4716 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460588.1 protein_id gnl|my_center|LOCUS_15940 4730 5464 gene locus_tag LOCUS_15950 4730 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 5850 6245 gene locus_tag LOCUS_15960 5850 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 6202 6504 gene locus_tag LOCUS_15970 6202 6504 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436544.1 protein_id gnl|my_center|LOCUS_15970 6504 6782 gene locus_tag LOCUS_15980 6504 6782 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173115.1 protein_id gnl|my_center|LOCUS_15980 6937 7512 gene locus_tag LOCUS_15990 6937 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815691.1 protein_id gnl|my_center|LOCUS_15990 7509 9248 gene locus_tag LOCUS_16000 7509 9248 CDS product acyl-CoA synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765442.1 protein_id gnl|my_center|LOCUS_16000 9245 10915 gene locus_tag LOCUS_16010 9245 10915 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460598.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence115 101 1045 gene locus_tag LOCUS_16020 101 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1140 1751 gene locus_tag LOCUS_16030 gene leuD 1140 1751 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388945.1 protein_id gnl|my_center|LOCUS_16030 2610 1870 gene locus_tag LOCUS_16040 2610 1870 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626425.1 protein_id gnl|my_center|LOCUS_16040 3382 2594 gene locus_tag LOCUS_16050 gene cbiQ 3382 2594 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626426.1 protein_id gnl|my_center|LOCUS_16050 4059 3379 gene locus_tag LOCUS_16060 4059 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545984.1 protein_id gnl|my_center|LOCUS_16060 4799 4131 gene locus_tag LOCUS_16070 gene cbiM 4799 4131 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938357.1 protein_id gnl|my_center|LOCUS_16070 5926 5003 gene locus_tag LOCUS_16080 5926 5003 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679851.1 protein_id gnl|my_center|LOCUS_16080 7270 6473 gene locus_tag LOCUS_16090 gene cysQ 7270 6473 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_16090 8948 7806 gene locus_tag LOCUS_16100 gene hpnH 8948 7806 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085790.1 protein_id gnl|my_center|LOCUS_16100 10758 9775 gene locus_tag LOCUS_16110 10758 9775 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence116 752 525 gene locus_tag LOCUS_16120 752 525 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_16120 1087 950 gene locus_tag LOCUS_16130 1087 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1670 2284 gene locus_tag LOCUS_16140 1670 2284 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 protein_id gnl|my_center|LOCUS_16140 2346 3554 gene locus_tag LOCUS_16150 gene aroB 2346 3554 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391488.1 protein_id gnl|my_center|LOCUS_16150 3889 5151 gene locus_tag LOCUS_16160 3889 5151 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640633.1 protein_id gnl|my_center|LOCUS_16160 5912 5193 gene locus_tag LOCUS_16170 5912 5193 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705440.1 protein_id gnl|my_center|LOCUS_16170 7122 6076 gene locus_tag LOCUS_16180 7122 6076 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217007.1 protein_id gnl|my_center|LOCUS_16180 8380 7355 gene locus_tag LOCUS_16190 8380 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980499.1 protein_id gnl|my_center|LOCUS_16190 8973 9962 gene locus_tag LOCUS_16200 gene paaX 8973 9962 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041177.1 protein_id gnl|my_center|LOCUS_16200 10648 10049 gene locus_tag LOCUS_16210 10648 10049 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329392.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence117 1137 184 gene locus_tag LOCUS_16220 1137 184 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_16220 1498 1301 gene locus_tag LOCUS_16230 1498 1301 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085116.1 protein_id gnl|my_center|LOCUS_16230 3161 1545 gene locus_tag LOCUS_16240 3161 1545 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085117.1 protein_id gnl|my_center|LOCUS_16240 4290 3259 gene locus_tag LOCUS_16250 4290 3259 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454824.1 protein_id gnl|my_center|LOCUS_16250 4889 4338 gene locus_tag LOCUS_16260 4889 4338 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_16260 5496 5963 gene locus_tag LOCUS_16270 5496 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 5968 6615 gene locus_tag LOCUS_16280 gene maiA 5968 6615 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 protein_id gnl|my_center|LOCUS_16280 7820 6597 gene locus_tag LOCUS_16290 7820 6597 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359221.1 protein_id gnl|my_center|LOCUS_16290 8293 9774 gene locus_tag LOCUS_16300 8293 9774 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994007.1 protein_id gnl|my_center|LOCUS_16300 10528 9833 gene locus_tag LOCUS_16310 10528 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence118 468 1703 gene locus_tag LOCUS_16320 468 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4078 2024 gene locus_tag LOCUS_16330 4078 2024 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965394.1 protein_id gnl|my_center|LOCUS_16330 4404 4189 gene locus_tag LOCUS_16340 4404 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 5825 5151 gene locus_tag LOCUS_16350 5825 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 6311 7906 gene locus_tag LOCUS_16360 6311 7906 CDS product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258464.1 protein_id gnl|my_center|LOCUS_16360 8292 8107 gene locus_tag LOCUS_16370 8292 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 9466 8588 gene locus_tag LOCUS_16380 9466 8588 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945817.1 protein_id gnl|my_center|LOCUS_16380 9566 10198 gene locus_tag LOCUS_16390 9566 10198 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920810.1 protein_id gnl|my_center|LOCUS_16390 10195 10587 gene locus_tag LOCUS_16400 10195 10587 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083764.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence119 196 489 gene locus_tag LOCUS_16410 196 489 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390404.1 protein_id gnl|my_center|LOCUS_16410 1198 509 gene locus_tag LOCUS_16420 1198 509 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_16420 2955 1198 gene locus_tag LOCUS_16430 2955 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 3734 3465 gene locus_tag LOCUS_16440 3734 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4133 4220 gene locus_tag LOCUS_t00140 4133 4220 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5355 4501 gene locus_tag LOCUS_16450 5355 4501 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703507.1 protein_id gnl|my_center|LOCUS_16450 6003 5557 gene locus_tag LOCUS_16460 6003 5557 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389404.1 protein_id gnl|my_center|LOCUS_16460 6403 7815 gene locus_tag LOCUS_16470 gene lpdA 6403 7815 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_16470 7921 8268 gene locus_tag LOCUS_16480 7921 8268 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703145.1 protein_id gnl|my_center|LOCUS_16480 9240 8905 gene locus_tag LOCUS_16490 9240 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 9143 10381 gene locus_tag LOCUS_16500 9143 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence120 150 1376 gene locus_tag LOCUS_16510 150 1376 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626653.1 protein_id gnl|my_center|LOCUS_16510 2219 1488 gene locus_tag LOCUS_16520 2219 1488 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495223.1 protein_id gnl|my_center|LOCUS_16520 3294 2527 gene locus_tag LOCUS_16530 gene cobM 3294 2527 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086055.1 protein_id gnl|my_center|LOCUS_16530 5192 3291 gene locus_tag LOCUS_16540 gene cobJ 5192 3291 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147855.1 protein_id gnl|my_center|LOCUS_16540 6067 5243 gene locus_tag LOCUS_16550 6067 5243 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526969.1 protein_id gnl|my_center|LOCUS_16550 7386 6013 gene locus_tag LOCUS_16560 gene cbiE 7386 6013 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114023.1 protein_id gnl|my_center|LOCUS_16560 8084 7383 gene locus_tag LOCUS_16570 8084 7383 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_16570 9152 8094 gene locus_tag LOCUS_16580 9152 8094 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_16580 9403 9942 gene locus_tag LOCUS_16590 gene cobU 9403 9942 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence121 225 698 gene locus_tag LOCUS_16600 225 698 CDS product superoxide dismutase [Ni] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814912.1 protein_id gnl|my_center|LOCUS_16600 1302 895 gene locus_tag LOCUS_16610 1302 895 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_16610 2492 1419 gene locus_tag LOCUS_16620 gene modC 2492 1419 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925958.1 protein_id gnl|my_center|LOCUS_16620 3154 2489 gene locus_tag LOCUS_16630 gene modB 3154 2489 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089690.1 protein_id gnl|my_center|LOCUS_16630 4071 3268 gene locus_tag LOCUS_16640 gene modA 4071 3268 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089689.1 protein_id gnl|my_center|LOCUS_16640 5485 4214 gene locus_tag LOCUS_16650 5485 4214 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398095.1 protein_id gnl|my_center|LOCUS_16650 6667 5567 gene locus_tag LOCUS_16660 6667 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 7303 6767 gene locus_tag LOCUS_16670 7303 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 8196 7426 gene locus_tag LOCUS_16680 8196 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 9767 8364 gene locus_tag LOCUS_16690 gene leuC 9767 8364 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence122 1004 264 gene locus_tag LOCUS_16700 1004 264 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338508.1 protein_id gnl|my_center|LOCUS_16700 1815 2810 gene locus_tag LOCUS_16710 1815 2810 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528052.1 protein_id gnl|my_center|LOCUS_16710 3130 4554 gene locus_tag LOCUS_16720 3130 4554 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_16720 4707 5231 gene locus_tag LOCUS_16730 gene ppa 4707 5231 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310823.1 protein_id gnl|my_center|LOCUS_16730 7463 5358 gene locus_tag LOCUS_16740 7463 5358 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389571.1 protein_id gnl|my_center|LOCUS_16740 8425 10431 gene locus_tag LOCUS_16750 8425 10431 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391243.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence123 1570 47 gene locus_tag LOCUS_16760 1570 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1931 1674 gene locus_tag LOCUS_16770 1931 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2420 2995 gene locus_tag LOCUS_16780 2420 2995 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_16780 2992 3486 gene locus_tag LOCUS_16790 2992 3486 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390402.1 protein_id gnl|my_center|LOCUS_16790 3536 3841 gene locus_tag LOCUS_16800 3536 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 4052 5278 gene locus_tag LOCUS_16810 4052 5278 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123170.1 protein_id gnl|my_center|LOCUS_16810 6828 5275 gene locus_tag LOCUS_16820 gene ubiB 6828 5275 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391544.1 protein_id gnl|my_center|LOCUS_16820 7734 6934 gene locus_tag LOCUS_16830 gene ubiE 7734 6934 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626664.1 protein_id gnl|my_center|LOCUS_16830 7915 8814 gene locus_tag LOCUS_16840 gene mutM 7915 8814 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385127.1 protein_id gnl|my_center|LOCUS_16840 9004 9429 gene locus_tag LOCUS_16850 9004 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 9541 10317 gene locus_tag LOCUS_16860 9541 10317 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence124 546 79 gene locus_tag LOCUS_16870 546 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1700 744 gene locus_tag LOCUS_16880 1700 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2405 2121 gene locus_tag LOCUS_16890 2405 2121 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391319.1 protein_id gnl|my_center|LOCUS_16890 3179 2544 gene locus_tag LOCUS_16900 3179 2544 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384970.1 protein_id gnl|my_center|LOCUS_16900 4298 3267 gene locus_tag LOCUS_16910 4298 3267 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391318.1 protein_id gnl|my_center|LOCUS_16910 5216 4443 gene locus_tag LOCUS_16920 gene queE 5216 4443 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172402078.1 protein_id gnl|my_center|LOCUS_16920 6253 7032 gene locus_tag LOCUS_16930 6253 7032 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_16930 7133 8326 gene locus_tag LOCUS_16940 7133 8326 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_16940 8593 9138 gene locus_tag LOCUS_16950 8593 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 9219 10307 gene locus_tag LOCUS_16960 9219 10307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence125 <1 2814 gene locus_tag LOCUS_16970 <1 2814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482627.1:CusA/CzcA family heavy metal efflux RND transporter 3256 2999 gene locus_tag LOCUS_16980 3256 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 3662 3498 gene locus_tag LOCUS_16990 3662 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 4695 4904 gene locus_tag LOCUS_17000 4695 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 5152 5538 gene locus_tag LOCUS_17010 gene sdhC 5152 5538 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_17010 5562 5942 gene locus_tag LOCUS_17020 gene sdhD 5562 5942 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388958.1 protein_id gnl|my_center|LOCUS_17020 5946 7739 gene locus_tag LOCUS_17030 gene sdhA 5946 7739 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083345.1 protein_id gnl|my_center|LOCUS_17030 7932 8708 gene locus_tag LOCUS_17040 7932 8708 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709621.1 protein_id gnl|my_center|LOCUS_17040 9396 8812 gene locus_tag LOCUS_17050 9396 8812 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528179.1 protein_id gnl|my_center|LOCUS_17050 10368 9463 gene locus_tag LOCUS_17060 10368 9463 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626403.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence126 1200 244 gene locus_tag LOCUS_17070 1200 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2752 1721 gene locus_tag LOCUS_17080 gene holA 2752 1721 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310932.1 protein_id gnl|my_center|LOCUS_17080 3323 2757 gene locus_tag LOCUS_17090 gene lptE 3323 2757 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391377.1 protein_id gnl|my_center|LOCUS_17090 6133 3503 gene locus_tag LOCUS_17100 gene leuS 6133 3503 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391378.1 protein_id gnl|my_center|LOCUS_17100 7157 6561 gene locus_tag LOCUS_17110 7157 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 8140 9384 gene locus_tag LOCUS_17120 8140 9384 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626331.1 protein_id gnl|my_center|LOCUS_17120 9538 10200 gene locus_tag LOCUS_17130 9538 10200 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626629.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence127 1636 236 gene locus_tag LOCUS_17140 1636 236 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626309.1 protein_id gnl|my_center|LOCUS_17140 2070 2936 gene locus_tag LOCUS_17150 2070 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2963 3406 gene locus_tag LOCUS_17160 gene msrB 2963 3406 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230813.1 protein_id gnl|my_center|LOCUS_17160 3630 4025 gene locus_tag LOCUS_17170 3630 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 4293 4108 gene locus_tag LOCUS_17180 4293 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 4555 4755 gene locus_tag LOCUS_17190 gene rpmI 4555 4755 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722593.1 protein_id gnl|my_center|LOCUS_17190 4874 5230 gene locus_tag LOCUS_17200 gene rplT 4874 5230 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528310.1 protein_id gnl|my_center|LOCUS_17200 5891 6973 gene locus_tag LOCUS_17210 gene pheS 5891 6973 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391270.1 protein_id gnl|my_center|LOCUS_17210 7107 9509 gene locus_tag LOCUS_17220 gene pheT 7107 9509 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083531.1 protein_id gnl|my_center|LOCUS_17220 9660 10211 gene locus_tag LOCUS_17230 9660 10211 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171659.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence128 2069 1773 gene locus_tag LOCUS_17240 2069 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 3729 2575 gene locus_tag LOCUS_17250 3729 2575 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227931.1 protein_id gnl|my_center|LOCUS_17250 3948 4451 gene locus_tag LOCUS_17260 3948 4451 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327054.1 protein_id gnl|my_center|LOCUS_17260 5551 4550 gene locus_tag LOCUS_17270 5551 4550 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389332.1 protein_id gnl|my_center|LOCUS_17270 6434 5628 gene locus_tag LOCUS_17280 6434 5628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389333.1 protein_id gnl|my_center|LOCUS_17280 7284 6427 gene locus_tag LOCUS_17290 7284 6427 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389334.1 protein_id gnl|my_center|LOCUS_17290 7820 7488 gene locus_tag LOCUS_17300 7820 7488 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 protein_id gnl|my_center|LOCUS_17300 8046 8489 gene locus_tag LOCUS_17310 8046 8489 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763493.1 protein_id gnl|my_center|LOCUS_17310 9922 8495 gene locus_tag LOCUS_17320 9922 8495 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958618.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence129 276 2252 gene locus_tag LOCUS_17330 276 2252 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209877314.1 protein_id gnl|my_center|LOCUS_17330 2301 3059 gene locus_tag LOCUS_17340 2301 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086035.1 protein_id gnl|my_center|LOCUS_17340 3104 4129 gene locus_tag LOCUS_17350 3104 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 6485 4191 gene locus_tag LOCUS_17360 6485 4191 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072227.1 protein_id gnl|my_center|LOCUS_17360 8266 6551 gene locus_tag LOCUS_17370 8266 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 9049 8456 gene locus_tag LOCUS_17380 9049 8456 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921763.1 protein_id gnl|my_center|LOCUS_17380 9353 9823 gene locus_tag LOCUS_17390 9353 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17390 >Feature sequence130 59 871 gene locus_tag LOCUS_17400 59 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 954 1838 gene locus_tag LOCUS_17410 954 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1953 2129 gene locus_tag LOCUS_17420 1953 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2126 3610 gene locus_tag LOCUS_17430 2126 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 3610 4203 gene locus_tag LOCUS_17440 3610 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 4324 6366 gene locus_tag LOCUS_17450 4324 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 6366 6833 gene locus_tag LOCUS_17460 6366 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 6833 8710 gene locus_tag LOCUS_17470 6833 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 9003 8863 gene locus_tag LOCUS_17480 9003 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 9104 9685 gene locus_tag LOCUS_17490 9104 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence131 388 1254 gene locus_tag LOCUS_17500 388 1254 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_17500 1258 2202 gene locus_tag LOCUS_17510 1258 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2340 3296 gene locus_tag LOCUS_17520 2340 3296 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_17520 3310 4236 gene locus_tag LOCUS_17530 3310 4236 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_17530 4332 6086 gene locus_tag LOCUS_17540 4332 6086 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247367.1 protein_id gnl|my_center|LOCUS_17540 6083 6811 gene locus_tag LOCUS_17550 6083 6811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545450.1 protein_id gnl|my_center|LOCUS_17550 6881 7546 gene locus_tag LOCUS_17560 6881 7546 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390260.1 protein_id gnl|my_center|LOCUS_17560 8412 7612 gene locus_tag LOCUS_17570 gene hutG 8412 7612 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105403.1 protein_id gnl|my_center|LOCUS_17570 8780 9322 gene locus_tag LOCUS_17580 8780 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 9549 9716 gene locus_tag LOCUS_17590 9549 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence132 143 1441 gene locus_tag LOCUS_17600 143 1441 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397364.1 protein_id gnl|my_center|LOCUS_17600 1530 3047 gene locus_tag LOCUS_17610 1530 3047 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336822.1 protein_id gnl|my_center|LOCUS_17610 3016 4206 gene locus_tag LOCUS_17620 3016 4206 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064172.1 protein_id gnl|my_center|LOCUS_17620 4211 5365 gene locus_tag LOCUS_17630 4211 5365 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970793.1 protein_id gnl|my_center|LOCUS_17630 5539 6303 gene locus_tag LOCUS_17640 5539 6303 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_17640 6497 7549 gene locus_tag LOCUS_17650 gene lpxK 6497 7549 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388340.1 protein_id gnl|my_center|LOCUS_17650 7549 8463 gene locus_tag LOCUS_17660 7549 8463 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_17660 8648 9343 gene locus_tag LOCUS_17670 8648 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence133 143 1633 gene locus_tag LOCUS_17680 gene pap 143 1633 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_17680 2575 1766 gene locus_tag LOCUS_17690 2575 1766 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387778.1 protein_id gnl|my_center|LOCUS_17690 3528 4970 gene locus_tag LOCUS_17700 3528 4970 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387779.1 protein_id gnl|my_center|LOCUS_17700 5104 9678 gene locus_tag LOCUS_17710 gene gltB 5104 9678 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence134 787 2355 gene locus_tag LOCUS_17720 787 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 3027 2455 gene locus_tag LOCUS_17730 3027 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3644 3156 gene locus_tag LOCUS_17740 3644 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 4764 3688 gene locus_tag LOCUS_17750 4764 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 4957 5640 gene locus_tag LOCUS_17760 4957 5640 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975816.1 protein_id gnl|my_center|LOCUS_17760 6531 7028 gene locus_tag LOCUS_17770 6531 7028 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387840.1 protein_id gnl|my_center|LOCUS_17770 7217 7293 gene locus_tag LOCUS_t00150 7217 7293 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7905 7375 gene locus_tag LOCUS_17780 7905 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 8152 8427 gene locus_tag LOCUS_17790 8152 8427 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_17790 9059 9454 gene locus_tag LOCUS_17800 9059 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence135 829 104 gene locus_tag LOCUS_17810 829 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1228 2220 gene locus_tag LOCUS_17820 1228 2220 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704193.1 protein_id gnl|my_center|LOCUS_17820 3030 2341 gene locus_tag LOCUS_17830 gene phoB 3030 2341 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_17830 4034 3255 gene locus_tag LOCUS_17840 gene phoU 4034 3255 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_17840 5095 4331 gene locus_tag LOCUS_17850 gene pstB 5095 4331 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 protein_id gnl|my_center|LOCUS_17850 6561 5236 gene locus_tag LOCUS_17860 gene pstA 6561 5236 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_17860 7804 6554 gene locus_tag LOCUS_17870 gene pstC 7804 6554 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_17870 9337 8300 gene locus_tag LOCUS_17880 9337 8300 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence136 238 672 gene locus_tag LOCUS_17890 gene creA 238 672 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875811.1 protein_id gnl|my_center|LOCUS_17890 1666 716 gene locus_tag LOCUS_17900 1666 716 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140150.1 protein_id gnl|my_center|LOCUS_17900 1844 2815 gene locus_tag LOCUS_17910 1844 2815 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859283.1 protein_id gnl|my_center|LOCUS_17910 3717 2863 gene locus_tag LOCUS_17920 gene bla 3717 2863 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261730.1 protein_id gnl|my_center|LOCUS_17920 4010 3934 gene locus_tag LOCUS_t00160 4010 3934 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4352 4873 gene locus_tag LOCUS_17930 4352 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 5105 5590 gene locus_tag LOCUS_17940 5105 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5724 6056 gene locus_tag LOCUS_17950 5724 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 6797 6474 gene locus_tag LOCUS_17960 6797 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 6992 8326 gene locus_tag LOCUS_17970 6992 8326 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450547.1 protein_id gnl|my_center|LOCUS_17970 8307 8984 gene locus_tag LOCUS_17980 8307 8984 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528748.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence137 533 171 gene locus_tag LOCUS_17990 533 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2113 1166 gene locus_tag LOCUS_18000 2113 1166 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387897.1 protein_id gnl|my_center|LOCUS_18000 2511 3302 gene locus_tag LOCUS_18010 2511 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3826 3380 gene locus_tag LOCUS_18020 3826 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3990 7439 gene locus_tag LOCUS_18030 3990 7439 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085112.1 protein_id gnl|my_center|LOCUS_18030 8397 7498 gene locus_tag LOCUS_18040 8397 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence138 385 1350 gene locus_tag LOCUS_18050 385 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1584 2063 gene locus_tag LOCUS_18060 1584 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2621 3979 gene locus_tag LOCUS_18070 2621 3979 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388298.1 protein_id gnl|my_center|LOCUS_18070 4075 6294 gene locus_tag LOCUS_18080 gene flhA 4075 6294 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388297.1 protein_id gnl|my_center|LOCUS_18080 7086 9473 gene locus_tag LOCUS_18090 7086 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence139 153 782 gene locus_tag LOCUS_18100 gene rdgB 153 782 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391387.1 protein_id gnl|my_center|LOCUS_18100 835 2052 gene locus_tag LOCUS_18110 gene hemW 835 2052 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338802.1 protein_id gnl|my_center|LOCUS_18110 3521 2112 gene locus_tag LOCUS_18120 3521 2112 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626639.1 protein_id gnl|my_center|LOCUS_18120 3867 4766 gene locus_tag LOCUS_18130 gene rsmI 3867 4766 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337001.1 protein_id gnl|my_center|LOCUS_18130 4763 5137 gene locus_tag LOCUS_18140 4763 5137 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391439.1 protein_id gnl|my_center|LOCUS_18140 6136 5198 gene locus_tag LOCUS_18150 gene gshB 6136 5198 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 protein_id gnl|my_center|LOCUS_18150 7129 6197 gene locus_tag LOCUS_18160 7129 6197 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918031.1 protein_id gnl|my_center|LOCUS_18160 7993 7355 gene locus_tag LOCUS_18170 7993 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 8275 9378 gene locus_tag LOCUS_18180 8275 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence140 689 198 gene locus_tag LOCUS_18190 689 198 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139978.1 protein_id gnl|my_center|LOCUS_18190 1389 712 gene locus_tag LOCUS_18200 1389 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2004 1780 gene locus_tag LOCUS_18210 2004 1780 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390993.1 protein_id gnl|my_center|LOCUS_18210 2880 2092 gene locus_tag LOCUS_18220 2880 2092 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390994.1 protein_id gnl|my_center|LOCUS_18220 3385 3032 gene locus_tag LOCUS_18230 3385 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 7437 3964 gene locus_tag LOCUS_18240 7437 3964 CDS product chromosome segregation SMC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971158.1 protein_id gnl|my_center|LOCUS_18240 8054 8539 gene locus_tag LOCUS_18250 8054 8539 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_18250 8822 9364 gene locus_tag LOCUS_18260 8822 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence141 <1 557 gene locus_tag LOCUS_18270 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816844.1:ABC transporter ATP-binding protein/permease 785 2152 gene locus_tag LOCUS_18280 785 2152 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971977.1 protein_id gnl|my_center|LOCUS_18280 2130 2942 gene locus_tag LOCUS_18290 2130 2942 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_18290 2939 4180 gene locus_tag LOCUS_18300 2939 4180 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388483.1 protein_id gnl|my_center|LOCUS_18300 4146 5462 gene locus_tag LOCUS_18310 4146 5462 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_18310 5550 6191 gene locus_tag LOCUS_18320 5550 6191 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388485.1 protein_id gnl|my_center|LOCUS_18320 6606 6163 gene locus_tag LOCUS_18330 6606 6163 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_18330 7337 6603 gene locus_tag LOCUS_18340 7337 6603 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_18340 8029 7334 gene locus_tag LOCUS_18350 8029 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 8087 8278 gene locus_tag LOCUS_18360 8087 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 8470 8778 gene locus_tag LOCUS_18370 8470 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence142 1000 155 gene locus_tag LOCUS_18380 1000 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1245 3317 gene locus_tag LOCUS_18390 1245 3317 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_18390 3824 4156 gene locus_tag LOCUS_18400 3824 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 4882 4184 gene locus_tag LOCUS_18410 4882 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5348 6262 gene locus_tag LOCUS_18420 5348 6262 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816010.1 protein_id gnl|my_center|LOCUS_18420 8040 6373 gene locus_tag LOCUS_18430 8040 6373 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965432.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence143 139 672 gene locus_tag LOCUS_18440 139 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1638 952 gene locus_tag LOCUS_18450 1638 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1903 1736 gene locus_tag LOCUS_18460 1903 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2947 2102 gene locus_tag LOCUS_18470 2947 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 3435 3133 gene locus_tag LOCUS_18480 3435 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 4002 3460 gene locus_tag LOCUS_18490 4002 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 7032 4123 gene locus_tag LOCUS_18500 7032 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 7513 8265 gene locus_tag LOCUS_18510 gene moeB 7513 8265 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_18510 8559 9038 gene locus_tag LOCUS_18520 8559 9038 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454539.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence144 39 755 gene locus_tag LOCUS_18530 39 755 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_18530 849 1304 gene locus_tag LOCUS_18540 849 1304 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719774.1 protein_id gnl|my_center|LOCUS_18540 1307 2101 gene locus_tag LOCUS_18550 1307 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2723 2142 gene locus_tag LOCUS_18560 2723 2142 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_18560 3433 2930 gene locus_tag LOCUS_18570 gene lspA 3433 2930 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390715.1 protein_id gnl|my_center|LOCUS_18570 6382 3539 gene locus_tag LOCUS_18580 gene ileS 6382 3539 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390714.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence145 1126 38 gene locus_tag LOCUS_18590 gene ada 1126 38 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_18590 1630 1385 gene locus_tag LOCUS_18600 1630 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2680 1958 gene locus_tag LOCUS_18610 2680 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 3520 2945 gene locus_tag LOCUS_18620 3520 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4791 3631 gene locus_tag LOCUS_18630 4791 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 5824 4937 gene locus_tag LOCUS_18640 5824 4937 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524197.1 protein_id gnl|my_center|LOCUS_18640 6109 6567 gene locus_tag LOCUS_18650 6109 6567 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398951.1 protein_id gnl|my_center|LOCUS_18650 6571 8781 gene locus_tag LOCUS_18660 6571 8781 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969413.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence146 1965 406 gene locus_tag LOCUS_18670 gene gcvPB 1965 406 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390796.1 protein_id gnl|my_center|LOCUS_18670 3308 1965 gene locus_tag LOCUS_18680 gene gcvPA 3308 1965 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921182.1 protein_id gnl|my_center|LOCUS_18680 3827 3456 gene locus_tag LOCUS_18690 gene gcvH 3827 3456 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390798.1 protein_id gnl|my_center|LOCUS_18690 5050 3896 gene locus_tag LOCUS_18700 gene gcvT 5050 3896 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975353.1 protein_id gnl|my_center|LOCUS_18700 6288 5791 gene locus_tag LOCUS_18710 6288 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 6691 7665 gene locus_tag LOCUS_18720 gene ispH 6691 7665 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722409.1 protein_id gnl|my_center|LOCUS_18720 8526 8284 gene locus_tag LOCUS_18730 8526 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence147 164 682 gene locus_tag LOCUS_18740 164 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 675 1073 gene locus_tag LOCUS_18750 675 1073 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140365.1 protein_id gnl|my_center|LOCUS_18750 1070 1297 gene locus_tag LOCUS_18760 1070 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1299 2261 gene locus_tag LOCUS_18770 1299 2261 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038112.1 protein_id gnl|my_center|LOCUS_18770 2478 2714 gene locus_tag LOCUS_18780 2478 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2768 2693 gene locus_tag LOCUS_t00170 2768 2693 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3055 2786 gene locus_tag LOCUS_18790 3055 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 3357 4307 gene locus_tag LOCUS_18800 gene prfB 3357 4307 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148265477.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18800 4779 6176 gene locus_tag LOCUS_18810 gene cysG 4779 6176 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256894.1 protein_id gnl|my_center|LOCUS_18810 6462 6277 gene locus_tag LOCUS_18820 6462 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 6892 8700 gene locus_tag LOCUS_18830 6892 8700 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence148 442 137 gene locus_tag LOCUS_18840 gene cowN 442 137 CDS product N(2)-fixation sustaining protein CowN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391263.1 protein_id gnl|my_center|LOCUS_18840 1295 597 gene locus_tag LOCUS_18850 1295 597 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391262.1 protein_id gnl|my_center|LOCUS_18850 2541 1339 gene locus_tag LOCUS_18860 2541 1339 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388806.1 protein_id gnl|my_center|LOCUS_18860 3256 2762 gene locus_tag LOCUS_18870 gene purE 3256 2762 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536030.1 protein_id gnl|my_center|LOCUS_18870 4268 3645 gene locus_tag LOCUS_18880 4268 3645 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314066.1 protein_id gnl|my_center|LOCUS_18880 4925 4347 gene locus_tag LOCUS_18890 4925 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 8645 5100 gene locus_tag LOCUS_18900 8645 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence149 1067 120 gene locus_tag LOCUS_18910 gene argB 1067 120 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391088.1 protein_id gnl|my_center|LOCUS_18910 1929 1225 gene locus_tag LOCUS_18920 gene yihA 1929 1225 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391087.1 protein_id gnl|my_center|LOCUS_18920 4035 2170 gene locus_tag LOCUS_18930 gene yidC 4035 2170 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391086.1 protein_id gnl|my_center|LOCUS_18930 4833 4417 gene locus_tag LOCUS_18940 4833 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 5305 4817 gene locus_tag LOCUS_18950 5305 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 5581 5447 gene locus_tag LOCUS_18960 gene rpmH 5581 5447 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391083.1 protein_id gnl|my_center|LOCUS_18960 6371 8317 gene locus_tag LOCUS_18970 6371 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence150 2392 176 gene locus_tag LOCUS_18980 2392 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2740 3066 gene locus_tag LOCUS_18990 2740 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 3827 3126 gene locus_tag LOCUS_19000 3827 3126 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_19000 4281 5087 gene locus_tag LOCUS_19010 gene lepB 4281 5087 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974883.1 protein_id gnl|my_center|LOCUS_19010 5092 5904 gene locus_tag LOCUS_19020 gene rnc 5092 5904 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389605.1 protein_id gnl|my_center|LOCUS_19020 5961 6974 gene locus_tag LOCUS_19030 gene era 5961 6974 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844236.1 protein_id gnl|my_center|LOCUS_19030 7453 8034 gene locus_tag LOCUS_19040 7453 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 8513 8136 gene locus_tag LOCUS_19050 8513 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence151 493 1374 gene locus_tag LOCUS_19060 gene nifH 493 1374 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388765.1 protein_id gnl|my_center|LOCUS_19060 1553 2995 gene locus_tag LOCUS_19070 gene nifD 1553 2995 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_19070 3105 4649 gene locus_tag LOCUS_19080 gene nifK 3105 4649 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_19080 5200 6612 gene locus_tag LOCUS_19090 gene nifE 5200 6612 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_19090 6645 8030 gene locus_tag LOCUS_19100 gene nifN 6645 8030 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084555.1 protein_id gnl|my_center|LOCUS_19100 8014 8529 gene locus_tag LOCUS_19110 gene nifX 8014 8529 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084556.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence152 3216 1849 gene locus_tag LOCUS_19120 3216 1849 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_19120 3933 3223 gene locus_tag LOCUS_19130 3933 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 5268 4213 gene locus_tag LOCUS_19140 5268 4213 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970762.1 protein_id gnl|my_center|LOCUS_19140 6050 6850 gene locus_tag LOCUS_19150 6050 6850 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721367.1 protein_id gnl|my_center|LOCUS_19150 7010 7507 gene locus_tag LOCUS_19160 7010 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 8349 7717 gene locus_tag LOCUS_19170 8349 7717 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218182.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence153 469 2187 gene locus_tag LOCUS_19180 469 2187 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_19180 3271 2324 gene locus_tag LOCUS_19190 3271 2324 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258637.1 protein_id gnl|my_center|LOCUS_19190 3778 3308 gene locus_tag LOCUS_19200 3778 3308 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_19200 4338 3775 gene locus_tag LOCUS_19210 4338 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 5171 4416 gene locus_tag LOCUS_19220 5171 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 6173 5490 gene locus_tag LOCUS_19230 6173 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 7015 6536 gene locus_tag LOCUS_19240 7015 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 7853 7413 gene locus_tag LOCUS_19250 7853 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 8241 7933 gene locus_tag LOCUS_19260 8241 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence154 991 164 gene locus_tag LOCUS_19270 991 164 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120276.1 protein_id gnl|my_center|LOCUS_19270 1884 991 gene locus_tag LOCUS_19280 1884 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2533 3111 gene locus_tag LOCUS_19290 2533 3111 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721985.1 protein_id gnl|my_center|LOCUS_19290 4435 3233 gene locus_tag LOCUS_19300 4435 3233 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388890.1 protein_id gnl|my_center|LOCUS_19300 4750 5175 gene locus_tag LOCUS_19310 4750 5175 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_19310 5365 5958 gene locus_tag LOCUS_19320 5365 5958 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_19320 6501 6037 gene locus_tag LOCUS_19330 gene ptsN 6501 6037 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_19330 7778 7179 gene locus_tag LOCUS_19340 gene raiA 7778 7179 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence155 2172 88 gene locus_tag LOCUS_19350 2172 88 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390299.1 protein_id gnl|my_center|LOCUS_19350 3330 2407 gene locus_tag LOCUS_19360 3330 2407 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 protein_id gnl|my_center|LOCUS_19360 5224 3656 gene locus_tag LOCUS_19370 5224 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 6895 5348 gene locus_tag LOCUS_19380 6895 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 <8368 7315 gene locus_tag LOCUS_19390 <8368 7315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973989.1:aldo/keto reductase >Feature sequence156 1716 37 gene locus_tag LOCUS_19400 gene ettA 1716 37 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_19400 2218 2418 gene locus_tag LOCUS_19410 2218 2418 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_19410 3719 2616 gene locus_tag LOCUS_19420 gene tsaD 3719 2616 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626621.1 protein_id gnl|my_center|LOCUS_19420 4284 3913 gene locus_tag LOCUS_19430 4284 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 5028 5960 gene locus_tag LOCUS_19440 gene hemC 5028 5960 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391315.1 protein_id gnl|my_center|LOCUS_19440 6946 6071 gene locus_tag LOCUS_19450 gene speE 6946 6071 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371548.1 protein_id gnl|my_center|LOCUS_19450 7423 8145 gene locus_tag LOCUS_19460 7423 8145 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067283.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence157 527 60 gene locus_tag LOCUS_19470 527 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1377 652 gene locus_tag LOCUS_19480 1377 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1589 2332 gene locus_tag LOCUS_19490 1589 2332 CDS product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389886.1 protein_id gnl|my_center|LOCUS_19490 2410 4020 gene locus_tag LOCUS_19500 2410 4020 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626330.1 protein_id gnl|my_center|LOCUS_19500 4698 4180 gene locus_tag LOCUS_19510 4698 4180 CDS product DUF5706 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021572.1 protein_id gnl|my_center|LOCUS_19510 6472 4739 gene locus_tag LOCUS_19520 6472 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 7081 6524 gene locus_tag LOCUS_19530 7081 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence158 2300 18 gene locus_tag LOCUS_19540 2300 18 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327060.1 protein_id gnl|my_center|LOCUS_19540 3051 3881 gene locus_tag LOCUS_19550 3051 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 4102 5583 gene locus_tag LOCUS_19560 4102 5583 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_19560 5567 8113 gene locus_tag LOCUS_19570 5567 8113 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence159 1814 558 gene locus_tag LOCUS_19580 1814 558 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390164.1 protein_id gnl|my_center|LOCUS_19580 2598 3593 gene locus_tag LOCUS_19590 2598 3593 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_19590 3777 4337 gene locus_tag LOCUS_19600 3777 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390263.1 protein_id gnl|my_center|LOCUS_19600 5522 4545 gene locus_tag LOCUS_19610 5522 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 5811 6911 gene locus_tag LOCUS_19620 5811 6911 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390938.1 protein_id gnl|my_center|LOCUS_19620 6908 8242 gene locus_tag LOCUS_19630 gene pyrC 6908 8242 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390939.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence160 1420 98 gene locus_tag LOCUS_19640 1420 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_19640 2259 1417 gene locus_tag LOCUS_19650 2259 1417 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_19650 4834 2426 gene locus_tag LOCUS_19660 4834 2426 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_19660 5143 5895 gene locus_tag LOCUS_19670 gene mexL 5143 5895 CDS product efflux system transcriptional repressor MexL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_19670 6445 6663 gene locus_tag LOCUS_19680 6445 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 6911 6678 gene locus_tag LOCUS_19690 6911 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19690 7467 6949 gene locus_tag LOCUS_19700 7467 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19700 8083 7454 gene locus_tag LOCUS_19710 8083 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence161 179 1033 gene locus_tag LOCUS_19720 gene purU 179 1033 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068880351.1 protein_id gnl|my_center|LOCUS_19720 1140 2021 gene locus_tag LOCUS_19730 gene panC 1140 2021 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626566.1 protein_id gnl|my_center|LOCUS_19730 6012 2248 gene locus_tag LOCUS_19740 6012 2248 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932819.1 protein_id gnl|my_center|LOCUS_19740 7460 6228 gene locus_tag LOCUS_19750 7460 6228 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_19750 7793 7584 gene locus_tag LOCUS_19760 7793 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence162 886 89 gene locus_tag LOCUS_19770 886 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1584 1865 gene locus_tag LOCUS_19780 1584 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2305 2562 gene locus_tag LOCUS_19790 2305 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 3190 2771 gene locus_tag LOCUS_19800 3190 2771 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390786.1 protein_id gnl|my_center|LOCUS_19800 3644 4183 gene locus_tag LOCUS_19810 3644 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 4702 6816 gene locus_tag LOCUS_19820 4702 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 8022 6898 gene locus_tag LOCUS_19830 8022 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence163 1441 146 gene locus_tag LOCUS_19840 1441 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2683 3525 gene locus_tag LOCUS_19850 2683 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3883 5964 gene locus_tag LOCUS_19860 3883 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 6086 7984 gene locus_tag LOCUS_19870 6086 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence164 826 50 gene locus_tag LOCUS_19880 826 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1691 1014 gene locus_tag LOCUS_19890 1691 1014 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705515.1 protein_id gnl|my_center|LOCUS_19890 2390 2878 gene locus_tag LOCUS_19900 2390 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 3387 2917 gene locus_tag LOCUS_19910 3387 2917 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313921.1 protein_id gnl|my_center|LOCUS_19910 3574 7107 gene locus_tag LOCUS_19920 gene putA 3574 7107 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643744.1 protein_id gnl|my_center|LOCUS_19920 7930 7142 gene locus_tag LOCUS_19930 7930 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence165 713 949 gene locus_tag LOCUS_19940 713 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19940 2638 1118 gene locus_tag LOCUS_19950 2638 1118 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067317.1 protein_id gnl|my_center|LOCUS_19950 3158 3083 gene locus_tag LOCUS_t00180 3158 3083 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3279 3204 gene locus_tag LOCUS_t00190 3279 3204 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5515 3656 gene locus_tag LOCUS_19960 gene recJ 5515 3656 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_19960 6864 5866 gene locus_tag LOCUS_19970 gene glpX 6864 5866 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022558.1 protein_id gnl|my_center|LOCUS_19970 <7947 6949 gene locus_tag LOCUS_19980 <7947 6949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390163.1:homoserine dehydrogenase >Feature sequence166 2037 3002 gene locus_tag LOCUS_19990 2037 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4266 3118 gene locus_tag LOCUS_20000 4266 3118 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089975.1 protein_id gnl|my_center|LOCUS_20000 4894 4433 gene locus_tag LOCUS_20010 4894 4433 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639987.1 protein_id gnl|my_center|LOCUS_20010 5183 5740 gene locus_tag LOCUS_20020 gene petA 5183 5740 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388117.1 protein_id gnl|my_center|LOCUS_20020 5752 6990 gene locus_tag LOCUS_20030 5752 6990 CDS product cytochrome b/b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388116.1 protein_id gnl|my_center|LOCUS_20030 6994 7791 gene locus_tag LOCUS_20040 6994 7791 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599373.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence167 417 52 gene locus_tag LOCUS_20050 417 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 596 2161 gene locus_tag LOCUS_20060 596 2161 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970575.1 protein_id gnl|my_center|LOCUS_20060 2550 4340 gene locus_tag LOCUS_20070 2550 4340 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_20070 4441 5517 gene locus_tag LOCUS_20080 4441 5517 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_20080 5607 7679 gene locus_tag LOCUS_20090 5607 7679 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence168 507 211 gene locus_tag LOCUS_20100 507 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 599 2167 gene locus_tag LOCUS_20110 599 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2374 3780 gene locus_tag LOCUS_20120 2374 3780 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038844.1 protein_id gnl|my_center|LOCUS_20120 5317 3866 gene locus_tag LOCUS_20130 gene purF 5317 3866 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388163.1 protein_id gnl|my_center|LOCUS_20130 6006 5401 gene locus_tag LOCUS_20140 6006 5401 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388164.1 protein_id gnl|my_center|LOCUS_20140 7713 6322 gene locus_tag LOCUS_20150 gene radA 7713 6322 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence169 2806 101 gene locus_tag LOCUS_20160 2806 101 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390447.1 protein_id gnl|my_center|LOCUS_20160 3981 3214 gene locus_tag LOCUS_20170 3981 3214 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965197.1 protein_id gnl|my_center|LOCUS_20170 5710 4286 gene locus_tag LOCUS_20180 5710 4286 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_20180 5870 7510 gene locus_tag LOCUS_20190 gene aceB 5870 7510 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258821.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence170 330 1322 gene locus_tag LOCUS_20200 330 1322 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_20200 1485 2525 gene locus_tag LOCUS_20210 1485 2525 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 protein_id gnl|my_center|LOCUS_20210 3178 2522 gene locus_tag LOCUS_20220 3178 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 3763 5298 gene locus_tag LOCUS_20230 3763 5298 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528581.1 protein_id gnl|my_center|LOCUS_20230 5449 6948 gene locus_tag LOCUS_20240 5449 6948 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808822.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence171 20 1519 gene locus_tag LOCUS_20250 gene xsc 20 1519 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975814.1 protein_id gnl|my_center|LOCUS_20250 1913 2938 gene locus_tag LOCUS_20260 gene pta 1913 2938 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061785.1 protein_id gnl|my_center|LOCUS_20260 2970 4004 gene locus_tag LOCUS_20270 2970 4004 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986861.1 protein_id gnl|my_center|LOCUS_20270 4109 5284 gene locus_tag LOCUS_20280 4109 5284 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390164.1 protein_id gnl|my_center|LOCUS_20280 5335 7587 gene locus_tag LOCUS_20290 5335 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence172 559 750 gene locus_tag LOCUS_20300 559 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 2241 844 gene locus_tag LOCUS_20310 gene gorA 2241 844 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463388.1 protein_id gnl|my_center|LOCUS_20310 2665 3966 gene locus_tag LOCUS_20320 2665 3966 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_20320 4042 5313 gene locus_tag LOCUS_20330 4042 5313 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957839.1 protein_id gnl|my_center|LOCUS_20330 5335 5514 gene locus_tag LOCUS_20340 5335 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 6847 5846 gene locus_tag LOCUS_20350 6847 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 7599 6943 gene locus_tag LOCUS_20360 7599 6943 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254123.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence173 1828 119 gene locus_tag LOCUS_20370 1828 119 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088867.1 protein_id gnl|my_center|LOCUS_20370 4762 2063 gene locus_tag LOCUS_20380 4762 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 5865 4906 gene locus_tag LOCUS_20390 5865 4906 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_20390 6147 7616 gene locus_tag LOCUS_20400 6147 7616 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence174 1587 2243 gene locus_tag LOCUS_20410 1587 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2816 3316 gene locus_tag LOCUS_20420 2816 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 3394 3639 gene locus_tag LOCUS_20430 3394 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4830 3952 gene locus_tag LOCUS_20440 4830 3952 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202665.1 protein_id gnl|my_center|LOCUS_20440 5052 6017 gene locus_tag LOCUS_20450 5052 6017 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704435.1 protein_id gnl|my_center|LOCUS_20450 6296 6039 gene locus_tag LOCUS_20460 6296 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 6180 7358 gene locus_tag LOCUS_20470 6180 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence175 <1 1598 gene locus_tag LOCUS_20480 <1 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042440436.1:ATP-dependent helicase HrpB 2337 1648 gene locus_tag LOCUS_20490 2337 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2640 3362 gene locus_tag LOCUS_20500 2640 3362 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 protein_id gnl|my_center|LOCUS_20500 3355 3681 gene locus_tag LOCUS_20510 gene brnE 3355 3681 CDS product branched-chain amino acid exporter BrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013513.1 protein_id gnl|my_center|LOCUS_20510 4923 3763 gene locus_tag LOCUS_20520 4923 3763 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470668.1 protein_id gnl|my_center|LOCUS_20520 5171 5320 gene locus_tag LOCUS_20530 5171 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 5450 6229 gene locus_tag LOCUS_20540 5450 6229 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_20540 6245 7447 gene locus_tag LOCUS_20550 6245 7447 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence176 765 136 gene locus_tag LOCUS_20560 765 136 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_20560 2008 857 gene locus_tag LOCUS_20570 2008 857 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_20570 2884 2276 gene locus_tag LOCUS_20580 2884 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 3799 2996 gene locus_tag LOCUS_20590 3799 2996 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208285.1 protein_id gnl|my_center|LOCUS_20590 5280 4078 gene locus_tag LOCUS_20600 5280 4078 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_20600 6658 5486 gene locus_tag LOCUS_20610 6658 5486 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_20610 7231 6758 gene locus_tag LOCUS_20620 7231 6758 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350830.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence177 627 1721 gene locus_tag LOCUS_20630 627 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2333 1839 gene locus_tag LOCUS_20640 2333 1839 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337742.1 protein_id gnl|my_center|LOCUS_20640 2473 2925 gene locus_tag LOCUS_20650 2473 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3234 4079 gene locus_tag LOCUS_20660 gene murI 3234 4079 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396527.1 protein_id gnl|my_center|LOCUS_20660 4631 4200 gene locus_tag LOCUS_20670 4631 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 5622 5134 gene locus_tag LOCUS_20680 5622 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 6150 6785 gene locus_tag LOCUS_20690 6150 6785 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357053.1 protein_id gnl|my_center|LOCUS_20690 6962 7456 gene locus_tag LOCUS_20700 6962 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence178 151 1158 gene locus_tag LOCUS_20710 151 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1155 3572 gene locus_tag LOCUS_20720 1155 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3569 4579 gene locus_tag LOCUS_20730 3569 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 5548 4652 gene locus_tag LOCUS_20740 5548 4652 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067318.1 protein_id gnl|my_center|LOCUS_20740 6598 7491 gene locus_tag LOCUS_20750 6598 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence179 84 389 gene locus_tag LOCUS_20760 84 389 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_20760 504 580 gene locus_tag LOCUS_t00200 504 580 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 854 1201 gene locus_tag LOCUS_20770 854 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1288 2943 gene locus_tag LOCUS_20780 1288 2943 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244652.1 protein_id gnl|my_center|LOCUS_20780 2930 3439 gene locus_tag LOCUS_20790 2930 3439 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_20790 3439 4182 gene locus_tag LOCUS_20800 3439 4182 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084297.1 protein_id gnl|my_center|LOCUS_20800 4416 4877 gene locus_tag LOCUS_20810 4416 4877 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085887.1 protein_id gnl|my_center|LOCUS_20810 6294 5041 gene locus_tag LOCUS_20820 6294 5041 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_20820 7039 6686 gene locus_tag LOCUS_20830 7039 6686 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence180 1826 156 gene locus_tag LOCUS_20840 1826 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2657 2860 gene locus_tag LOCUS_20850 2657 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3483 3956 gene locus_tag LOCUS_20860 3483 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 4609 7389 gene locus_tag LOCUS_20870 4609 7389 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence181 1 132 gene locus_tag LOCUS_20880 1 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 157 2925 gene locus_tag LOCUS_20890 157 2925 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 protein_id gnl|my_center|LOCUS_20890 3461 4177 gene locus_tag LOCUS_20900 3461 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 4561 6237 gene locus_tag LOCUS_20910 gene murJ 4561 6237 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_20910 6503 7501 gene locus_tag LOCUS_20920 gene trpS 6503 7501 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391282.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence182 964 188 gene locus_tag LOCUS_20930 964 188 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625959.1 protein_id gnl|my_center|LOCUS_20930 2172 1117 gene locus_tag LOCUS_20940 gene moaA 2172 1117 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531699.1 protein_id gnl|my_center|LOCUS_20940 2536 3000 gene locus_tag LOCUS_20950 2536 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2993 3808 gene locus_tag LOCUS_20960 2993 3808 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975631.1 protein_id gnl|my_center|LOCUS_20960 4240 3833 gene locus_tag LOCUS_20970 4240 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 7294 4364 gene locus_tag LOCUS_20980 7294 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence183 580 2514 gene locus_tag LOCUS_20990 580 2514 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_20990 2514 3857 gene locus_tag LOCUS_21000 2514 3857 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089709.1 protein_id gnl|my_center|LOCUS_21000 4032 5267 gene locus_tag LOCUS_21010 4032 5267 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_21010 5469 5978 gene locus_tag LOCUS_21020 5469 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 7189 5981 gene locus_tag LOCUS_21030 7189 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence184 185 1072 gene locus_tag LOCUS_21040 185 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1402 2208 gene locus_tag LOCUS_21050 1402 2208 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389559.1 protein_id gnl|my_center|LOCUS_21050 2514 3281 gene locus_tag LOCUS_21060 2514 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 3326 5794 gene locus_tag LOCUS_21070 3326 5794 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171190.1 protein_id gnl|my_center|LOCUS_21070 6920 5970 gene locus_tag LOCUS_21080 6920 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence185 146 886 gene locus_tag LOCUS_21090 146 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 1228 3108 gene locus_tag LOCUS_21100 1228 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 6914 3234 gene locus_tag LOCUS_21110 6914 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence186 194 907 gene locus_tag LOCUS_21120 194 907 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240527.1 protein_id gnl|my_center|LOCUS_21120 918 1751 gene locus_tag LOCUS_21130 gene znuB 918 1751 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975837.1 protein_id gnl|my_center|LOCUS_21130 1748 2215 gene locus_tag LOCUS_21140 1748 2215 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328657.1 protein_id gnl|my_center|LOCUS_21140 2726 3235 gene locus_tag LOCUS_21150 2726 3235 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_21150 3432 4286 gene locus_tag LOCUS_21160 gene proC 3432 4286 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391029.1 protein_id gnl|my_center|LOCUS_21160 5062 4451 gene locus_tag LOCUS_21170 5062 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 6912 5152 gene locus_tag LOCUS_21180 6912 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence187 3520 74 gene locus_tag LOCUS_21190 3520 74 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388876.1 protein_id gnl|my_center|LOCUS_21190 4547 4104 gene locus_tag LOCUS_21200 4547 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 5120 4674 gene locus_tag LOCUS_21210 gene mlaD 5120 4674 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545373.1 protein_id gnl|my_center|LOCUS_21210 5712 5242 gene locus_tag LOCUS_21220 5712 5242 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390191.1 protein_id gnl|my_center|LOCUS_21220 6454 6083 gene locus_tag LOCUS_21230 6454 6083 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087052.1 protein_id gnl|my_center|LOCUS_21230 6910 7152 gene locus_tag LOCUS_21240 6910 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence188 55 846 gene locus_tag LOCUS_21250 55 846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687942.1 protein_id gnl|my_center|LOCUS_21250 846 1619 gene locus_tag LOCUS_21260 846 1619 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 protein_id gnl|my_center|LOCUS_21260 3298 1709 gene locus_tag LOCUS_21270 3298 1709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030658.1 protein_id gnl|my_center|LOCUS_21270 4119 3295 gene locus_tag LOCUS_21280 4119 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 5126 4131 gene locus_tag LOCUS_21290 5126 4131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460922.1 protein_id gnl|my_center|LOCUS_21290 6760 5198 gene locus_tag LOCUS_21300 6760 5198 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_21300 7293 6805 gene locus_tag LOCUS_21310 gene tsaA 7293 6805 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082829.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence189 <1 877 gene locus_tag LOCUS_21320 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529363.1:alpha/beta hydrolase 1232 2515 gene locus_tag LOCUS_21330 1232 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 3653 2595 gene locus_tag LOCUS_21340 3653 2595 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_21340 5429 3897 gene locus_tag LOCUS_21350 5429 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 5648 6757 gene locus_tag LOCUS_21360 5648 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 7193 6879 gene locus_tag LOCUS_21370 7193 6879 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083363.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence190 899 990 gene locus_tag LOCUS_t00210 899 990 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1385 1026 gene locus_tag LOCUS_21380 1385 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2093 1839 gene locus_tag LOCUS_21390 2093 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2693 3187 gene locus_tag LOCUS_21400 2693 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 3319 3570 gene locus_tag LOCUS_21410 3319 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21410 3791 3549 gene locus_tag LOCUS_21420 3791 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 3899 4102 gene locus_tag LOCUS_21430 3899 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 4318 4154 gene locus_tag LOCUS_21440 4318 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 4578 4315 gene locus_tag LOCUS_21450 4578 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 4863 4579 gene locus_tag LOCUS_21460 4863 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 5126 5332 gene locus_tag LOCUS_21470 5126 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 5864 6853 gene locus_tag LOCUS_21480 5864 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21480 7059 7358 gene locus_tag LOCUS_21490 7059 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence191 1560 148 gene locus_tag LOCUS_21500 1560 148 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_21500 3330 1873 gene locus_tag LOCUS_21510 3330 1873 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691388.1 protein_id gnl|my_center|LOCUS_21510 4661 3342 gene locus_tag LOCUS_21520 4661 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 5460 5260 gene locus_tag LOCUS_21530 5460 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 6072 6377 gene locus_tag LOCUS_21540 6072 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 6409 7188 gene locus_tag LOCUS_21550 6409 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence192 2111 1104 gene locus_tag LOCUS_21560 2111 1104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966002.1 protein_id gnl|my_center|LOCUS_21560 3985 2297 gene locus_tag LOCUS_21570 3985 2297 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228821.1 protein_id gnl|my_center|LOCUS_21570 7252 4901 gene locus_tag LOCUS_21580 7252 4901 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089908.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence193 997 2028 gene locus_tag LOCUS_21590 997 2028 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531877.1 protein_id gnl|my_center|LOCUS_21590 2028 2351 gene locus_tag LOCUS_21600 2028 2351 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312579.1 protein_id gnl|my_center|LOCUS_21600 2568 3941 gene locus_tag LOCUS_21610 2568 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 4278 6131 gene locus_tag LOCUS_21620 4278 6131 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_21620 6241 6519 gene locus_tag LOCUS_21630 6241 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 6577 6804 gene locus_tag LOCUS_21640 6577 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence194 2223 118 gene locus_tag LOCUS_21650 2223 118 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388862.1 protein_id gnl|my_center|LOCUS_21650 6584 3123 gene locus_tag LOCUS_21660 6584 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence195 1454 171 gene locus_tag LOCUS_21670 1454 171 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071664104.1 protein_id gnl|my_center|LOCUS_21670 1665 1429 gene locus_tag LOCUS_21680 1665 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2115 1810 gene locus_tag LOCUS_21690 2115 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2296 2105 gene locus_tag LOCUS_21700 2296 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 4372 2387 gene locus_tag LOCUS_21710 4372 2387 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_21710 5993 4461 gene locus_tag LOCUS_21720 5993 4461 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_21720 7097 6384 gene locus_tag LOCUS_21730 7097 6384 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence196 578 1402 gene locus_tag LOCUS_21740 578 1402 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330817.1 protein_id gnl|my_center|LOCUS_21740 1628 2185 gene locus_tag LOCUS_21750 gene ybcL 1628 2185 CDS product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306955.1 protein_id gnl|my_center|LOCUS_21750 3365 2430 gene locus_tag LOCUS_21760 3365 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 3706 3981 gene locus_tag LOCUS_21770 3706 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 4146 3991 gene locus_tag LOCUS_21780 4146 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 5656 4127 gene locus_tag LOCUS_21790 5656 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21790 6972 5794 gene locus_tag LOCUS_21800 6972 5794 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence197 <1 826 gene locus_tag LOCUS_21810 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390418.1:preprotein translocase subunit SecY 823 1470 gene locus_tag LOCUS_21820 823 1470 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561944.1 protein_id gnl|my_center|LOCUS_21820 1970 2338 gene locus_tag LOCUS_21830 gene rpsM 1970 2338 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531437.1 protein_id gnl|my_center|LOCUS_21830 2570 2962 gene locus_tag LOCUS_21840 gene rpsK 2570 2962 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919150.1 protein_id gnl|my_center|LOCUS_21840 3116 4132 gene locus_tag LOCUS_21850 3116 4132 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626433.1 protein_id gnl|my_center|LOCUS_21850 4274 4696 gene locus_tag LOCUS_21860 gene rplQ 4274 4696 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390413.1 protein_id gnl|my_center|LOCUS_21860 5055 6470 gene locus_tag LOCUS_21870 5055 6470 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence198 1637 108 gene locus_tag LOCUS_21880 1637 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1900 1718 gene locus_tag LOCUS_21890 1900 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3011 2046 gene locus_tag LOCUS_21900 gene ubiA 3011 2046 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388330.1 protein_id gnl|my_center|LOCUS_21900 4573 3227 gene locus_tag LOCUS_21910 4573 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence199 117 692 gene locus_tag LOCUS_21920 117 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 689 1159 gene locus_tag LOCUS_21930 689 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1455 1303 gene locus_tag LOCUS_21940 1455 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1782 2555 gene locus_tag LOCUS_21950 1782 2555 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_21950 2848 3651 gene locus_tag LOCUS_21960 2848 3651 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008974302.1 protein_id gnl|my_center|LOCUS_21960 3712 3954 gene locus_tag LOCUS_21970 gene purS 3712 3954 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_21970 4028 4720 gene locus_tag LOCUS_21980 4028 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 4789 5493 gene locus_tag LOCUS_21990 4789 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 5865 5641 gene locus_tag LOCUS_22000 5865 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 6799 6005 gene locus_tag LOCUS_22010 6799 6005 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088410.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence200 1651 59 gene locus_tag LOCUS_22020 1651 59 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388710.1 protein_id gnl|my_center|LOCUS_22020 4006 1799 gene locus_tag LOCUS_22030 4006 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 4410 4006 gene locus_tag LOCUS_22040 4410 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 5626 4502 gene locus_tag LOCUS_22050 gene rsmH 5626 4502 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388713.1 protein_id gnl|my_center|LOCUS_22050 6840 5953 gene locus_tag LOCUS_22060 6840 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence201 <1 1034 gene locus_tag LOCUS_22070 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387796.1:heme lyase CcmF/NrfE family subunit 1162 1698 gene locus_tag LOCUS_22080 1162 1698 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946598.1 protein_id gnl|my_center|LOCUS_22080 1724 2317 gene locus_tag LOCUS_22090 1724 2317 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974838.1 protein_id gnl|my_center|LOCUS_22090 2321 3835 gene locus_tag LOCUS_22100 2321 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 5161 3860 gene locus_tag LOCUS_22110 5161 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 5778 5557 gene locus_tag LOCUS_22120 5778 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 6835 6431 gene locus_tag LOCUS_22130 6835 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence202 1297 536 gene locus_tag LOCUS_22140 1297 536 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327132.1 protein_id gnl|my_center|LOCUS_22140 2472 2975 gene locus_tag LOCUS_22150 2472 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3989 2994 gene locus_tag LOCUS_22160 3989 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 4781 4002 gene locus_tag LOCUS_22170 4781 4002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_22170 5782 4778 gene locus_tag LOCUS_22180 5782 4778 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388249.1 protein_id gnl|my_center|LOCUS_22180 6672 5782 gene locus_tag LOCUS_22190 6672 5782 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence203 260 946 gene locus_tag LOCUS_22200 260 946 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444701.1 protein_id gnl|my_center|LOCUS_22200 2184 967 gene locus_tag LOCUS_22210 2184 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2580 3212 gene locus_tag LOCUS_22220 2580 3212 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534438.1 protein_id gnl|my_center|LOCUS_22220 3295 4362 gene locus_tag LOCUS_22230 3295 4362 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037962.1 protein_id gnl|my_center|LOCUS_22230 4778 6340 gene locus_tag LOCUS_22240 4778 6340 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence204 800 537 gene locus_tag LOCUS_22250 800 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 1455 1258 gene locus_tag LOCUS_22260 1455 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 3523 1697 gene locus_tag LOCUS_22270 gene phaC 3523 1697 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_22270 4873 6696 gene locus_tag LOCUS_22280 4873 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence205 387 112 gene locus_tag LOCUS_22290 387 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 412 588 gene locus_tag LOCUS_22300 412 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22300 605 958 gene locus_tag LOCUS_22310 605 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 1917 1252 gene locus_tag LOCUS_22320 1917 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3521 2712 gene locus_tag LOCUS_22330 3521 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 4277 6118 gene locus_tag LOCUS_22340 4277 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence206 407 201 gene locus_tag LOCUS_22350 407 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1096 611 gene locus_tag LOCUS_22360 1096 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1639 2409 gene locus_tag LOCUS_22370 1639 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2466 3851 gene locus_tag LOCUS_22380 2466 3851 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_22380 3960 3817 gene locus_tag LOCUS_22390 3960 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 3953 4591 gene locus_tag LOCUS_22400 3953 4591 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113440.1 protein_id gnl|my_center|LOCUS_22400 5462 4545 gene locus_tag LOCUS_22410 5462 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 5983 5810 gene locus_tag LOCUS_22420 5983 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 6017 6649 gene locus_tag LOCUS_22430 6017 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence207 91 1599 gene locus_tag LOCUS_22440 91 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1842 3350 gene locus_tag LOCUS_22450 1842 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3350 3715 gene locus_tag LOCUS_22460 3350 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 3715 4518 gene locus_tag LOCUS_22470 3715 4518 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 protein_id gnl|my_center|LOCUS_22470 5080 4604 gene locus_tag LOCUS_22480 5080 4604 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525048.1 protein_id gnl|my_center|LOCUS_22480 6497 5175 gene locus_tag LOCUS_22490 6497 5175 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947032.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence208 262 1734 gene locus_tag LOCUS_22500 262 1734 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204581.1 protein_id gnl|my_center|LOCUS_22500 2382 3143 gene locus_tag LOCUS_22510 2382 3143 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_22510 3143 4081 gene locus_tag LOCUS_22520 3143 4081 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_22520 4454 4633 gene locus_tag LOCUS_22530 4454 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 4757 5662 gene locus_tag LOCUS_22540 4757 5662 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_22540 6043 6390 gene locus_tag LOCUS_22550 6043 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence209 512 1198 gene locus_tag LOCUS_22560 512 1198 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090590.1 protein_id gnl|my_center|LOCUS_22560 1854 1222 gene locus_tag LOCUS_22570 1854 1222 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_22570 2187 3854 gene locus_tag LOCUS_22580 2187 3854 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445679.1 protein_id gnl|my_center|LOCUS_22580 5029 3785 gene locus_tag LOCUS_22590 5029 3785 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_22590 6056 5082 gene locus_tag LOCUS_22600 6056 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence210 3957 145 gene locus_tag LOCUS_22610 3957 145 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_22610 4448 4978 gene locus_tag LOCUS_22620 4448 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 6006 6380 gene locus_tag LOCUS_22630 6006 6380 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence211 528 452 gene locus_tag LOCUS_t00220 528 452 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1175 771 gene locus_tag LOCUS_22640 1175 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 1246 2871 gene locus_tag LOCUS_22650 1246 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 3132 3578 gene locus_tag LOCUS_22660 3132 3578 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_22660 4879 4142 gene locus_tag LOCUS_22670 4879 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 5265 4942 gene locus_tag LOCUS_22680 5265 4942 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909394.1 protein_id gnl|my_center|LOCUS_22680 5376 5780 gene locus_tag LOCUS_22690 5376 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 5777 6382 gene locus_tag LOCUS_22700 5777 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence212 1002 604 gene locus_tag LOCUS_22710 1002 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2194 1091 gene locus_tag LOCUS_22720 gene mutY 2194 1091 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 protein_id gnl|my_center|LOCUS_22720 2332 2865 gene locus_tag LOCUS_22730 2332 2865 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085285.1 protein_id gnl|my_center|LOCUS_22730 3228 3449 gene locus_tag LOCUS_22740 3228 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 3561 3725 gene locus_tag LOCUS_22750 3561 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 3999 4832 gene locus_tag LOCUS_22760 3999 4832 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968926.1 protein_id gnl|my_center|LOCUS_22760 5634 4921 gene locus_tag LOCUS_22770 5634 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 5893 5820 gene locus_tag LOCUS_t00230 5893 5820 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence213 84 605 gene locus_tag LOCUS_22780 84 605 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112642.1 protein_id gnl|my_center|LOCUS_22780 602 1603 gene locus_tag LOCUS_22790 602 1603 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112643.1 protein_id gnl|my_center|LOCUS_22790 2617 2231 gene locus_tag LOCUS_22800 2617 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 3082 2627 gene locus_tag LOCUS_22810 3082 2627 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387847.1 protein_id gnl|my_center|LOCUS_22810 3524 3363 gene locus_tag LOCUS_22820 3524 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 4861 3557 gene locus_tag LOCUS_22830 4861 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 5683 6297 gene locus_tag LOCUS_22840 5683 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence214 4383 3538 gene locus_tag LOCUS_22850 4383 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 5061 4582 gene locus_tag LOCUS_22860 5061 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 5602 5078 gene locus_tag LOCUS_22870 5602 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence215 311 3124 gene locus_tag LOCUS_22880 311 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 3757 3230 gene locus_tag LOCUS_22890 3757 3230 CDS product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083725.1 protein_id gnl|my_center|LOCUS_22890 4553 3789 gene locus_tag LOCUS_22900 4553 3789 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_22900 4916 5257 gene locus_tag LOCUS_22910 4916 5257 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709747.1 protein_id gnl|my_center|LOCUS_22910 5335 5742 gene locus_tag LOCUS_22920 5335 5742 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225795.1 protein_id gnl|my_center|LOCUS_22920 5702 6019 gene locus_tag LOCUS_22930 5702 6019 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969960.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence216 616 2571 gene locus_tag LOCUS_22940 616 2571 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388826.1 protein_id gnl|my_center|LOCUS_22940 2891 3613 gene locus_tag LOCUS_22950 2891 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3654 5504 gene locus_tag LOCUS_22960 3654 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 6406 6155 gene locus_tag LOCUS_22970 6406 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence217 535 188 gene locus_tag LOCUS_22980 535 188 CDS product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038031.1 protein_id gnl|my_center|LOCUS_22980 1020 679 gene locus_tag LOCUS_22990 1020 679 CDS product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038031.1 protein_id gnl|my_center|LOCUS_22990 1399 1079 gene locus_tag LOCUS_23000 1399 1079 CDS product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038031.1 protein_id gnl|my_center|LOCUS_23000 2579 1827 gene locus_tag LOCUS_23010 2579 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3096 2557 gene locus_tag LOCUS_23020 3096 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 4334 3489 gene locus_tag LOCUS_23030 4334 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 4629 4366 gene locus_tag LOCUS_23040 4629 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 4982 4689 gene locus_tag LOCUS_23050 4982 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 5256 4936 gene locus_tag LOCUS_23060 5256 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 6299 5340 gene locus_tag LOCUS_23070 6299 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence218 1943 3616 gene locus_tag LOCUS_23080 1943 3616 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390119.1 protein_id gnl|my_center|LOCUS_23080 3856 4683 gene locus_tag LOCUS_23090 3856 4683 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388329.1 protein_id gnl|my_center|LOCUS_23090 4776 6167 gene locus_tag LOCUS_23100 4776 6167 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence219 1088 63 gene locus_tag LOCUS_23110 1088 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2025 1123 gene locus_tag LOCUS_23120 2025 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 2659 6228 gene locus_tag LOCUS_23130 2659 6228 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104408.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence220 206 859 gene locus_tag LOCUS_23140 206 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2304 874 gene locus_tag LOCUS_23150 2304 874 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_23150 3188 4093 gene locus_tag LOCUS_23160 3188 4093 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_23160 4658 6250 gene locus_tag LOCUS_23170 gene cimA 4658 6250 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388453.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence221 1070 228 gene locus_tag LOCUS_23180 1070 228 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720965.1 protein_id gnl|my_center|LOCUS_23180 2239 1067 gene locus_tag LOCUS_23190 2239 1067 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390013.1 protein_id gnl|my_center|LOCUS_23190 3246 2497 gene locus_tag LOCUS_23200 3246 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 4119 3361 gene locus_tag LOCUS_23210 4119 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 4436 4663 gene locus_tag LOCUS_23220 4436 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 6110 4611 gene locus_tag LOCUS_23230 6110 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence222 160 885 gene locus_tag LOCUS_23240 160 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 854 2680 gene locus_tag LOCUS_23250 gene hcuC 854 2680 CDS product hydrophobic compound transporter HcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 protein_id gnl|my_center|LOCUS_23250 2780 3187 gene locus_tag LOCUS_23260 2780 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3342 4448 gene locus_tag LOCUS_23270 3342 4448 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_23270 4532 5293 gene locus_tag LOCUS_23280 gene fghA 4532 5293 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464966.1 protein_id gnl|my_center|LOCUS_23280 5484 6263 gene locus_tag LOCUS_23290 5484 6263 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090612.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence223 1692 196 gene locus_tag LOCUS_23300 1692 196 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089681.1 protein_id gnl|my_center|LOCUS_23300 2633 1689 gene locus_tag LOCUS_23310 2633 1689 CDS product HupU protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089682.1 protein_id gnl|my_center|LOCUS_23310 2893 4098 gene locus_tag LOCUS_23320 2893 4098 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337632.1 protein_id gnl|my_center|LOCUS_23320 4435 4938 gene locus_tag LOCUS_23330 4435 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 5494 6075 gene locus_tag LOCUS_23340 5494 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence224 321 1238 gene locus_tag LOCUS_23350 321 1238 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389504.1 protein_id gnl|my_center|LOCUS_23350 1243 2655 gene locus_tag LOCUS_23360 gene livM 1243 2655 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389503.1 protein_id gnl|my_center|LOCUS_23360 2652 3542 gene locus_tag LOCUS_23370 2652 3542 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389502.1 protein_id gnl|my_center|LOCUS_23370 3535 4245 gene locus_tag LOCUS_23380 3535 4245 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389501.1 protein_id gnl|my_center|LOCUS_23380 4314 4667 gene locus_tag LOCUS_23390 4314 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389500.1 protein_id gnl|my_center|LOCUS_23390 4807 5916 gene locus_tag LOCUS_23400 4807 5916 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence225 98 961 gene locus_tag LOCUS_23410 gene mepA 98 961 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706180.1 protein_id gnl|my_center|LOCUS_23410 1202 2494 gene locus_tag LOCUS_23420 1202 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 4371 2617 gene locus_tag LOCUS_23430 gene kefB 4371 2617 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112454.1 protein_id gnl|my_center|LOCUS_23430 5179 6159 gene locus_tag LOCUS_23440 5179 6159 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence226 155 784 gene locus_tag LOCUS_23450 155 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23450 812 1270 gene locus_tag LOCUS_23460 812 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23460 2108 1311 gene locus_tag LOCUS_23470 2108 1311 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974679.1 protein_id gnl|my_center|LOCUS_23470 2335 3030 gene locus_tag LOCUS_23480 2335 3030 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401395.1 protein_id gnl|my_center|LOCUS_23480 3027 4310 gene locus_tag LOCUS_23490 3027 4310 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975844.1 protein_id gnl|my_center|LOCUS_23490 5795 4461 gene locus_tag LOCUS_23500 5795 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence227 2081 45 gene locus_tag LOCUS_23510 2081 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2544 2362 gene locus_tag LOCUS_23520 2544 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 3892 2546 gene locus_tag LOCUS_23530 3892 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 4992 3889 gene locus_tag LOCUS_23540 4992 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 5454 6098 gene locus_tag LOCUS_23550 5454 6098 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387714.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence228 236 1519 gene locus_tag LOCUS_23560 236 1519 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389580.1 protein_id gnl|my_center|LOCUS_23560 1689 2201 gene locus_tag LOCUS_23570 gene nrdR 1689 2201 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389579.1 protein_id gnl|my_center|LOCUS_23570 2205 3353 gene locus_tag LOCUS_23580 gene ribD 2205 3353 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_23580 3614 4237 gene locus_tag LOCUS_23590 3614 4237 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 protein_id gnl|my_center|LOCUS_23590 4373 5506 gene locus_tag LOCUS_23600 gene ribB 4373 5506 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_23600 5596 6051 gene locus_tag LOCUS_23610 5596 6051 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312824.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence229 149 709 gene locus_tag LOCUS_23620 149 709 CDS product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 protein_id gnl|my_center|LOCUS_23620 821 1405 gene locus_tag LOCUS_23630 821 1405 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327907.1 protein_id gnl|my_center|LOCUS_23630 1813 3144 gene locus_tag LOCUS_23640 gene phaZ 1813 3144 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391103.1 protein_id gnl|my_center|LOCUS_23640 4147 3239 gene locus_tag LOCUS_23650 4147 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4337 5311 gene locus_tag LOCUS_23660 4337 5311 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091135.1 protein_id gnl|my_center|LOCUS_23660 5656 6021 gene locus_tag LOCUS_23670 5656 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence230 1871 579 gene locus_tag LOCUS_23680 gene gltA 1871 579 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 protein_id gnl|my_center|LOCUS_23680 3471 2053 gene locus_tag LOCUS_23690 gene gltX 3471 2053 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389476.1 protein_id gnl|my_center|LOCUS_23690 3853 5979 gene locus_tag LOCUS_23700 3853 5979 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence231 802 1005 gene locus_tag LOCUS_23710 gene rpsU 802 1005 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388798.1 protein_id gnl|my_center|LOCUS_23710 1786 1622 gene locus_tag LOCUS_23720 1786 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 1850 2776 gene locus_tag LOCUS_23730 1850 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 3131 3394 gene locus_tag LOCUS_23740 3131 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 4275 3472 gene locus_tag LOCUS_23750 4275 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 4979 4302 gene locus_tag LOCUS_23760 gene gmk 4979 4302 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388188.1 protein_id gnl|my_center|LOCUS_23760 5685 4972 gene locus_tag LOCUS_23770 5685 4972 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence232 <1 812 gene locus_tag LOCUS_23780 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770073.1:zinc-binding alcohol dehydrogenase family protein 883 929 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1508 969 gene locus_tag LOCUS_23790 1508 969 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096572.1 protein_id gnl|my_center|LOCUS_23790 2833 1538 gene locus_tag LOCUS_23800 2833 1538 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039976.1 protein_id gnl|my_center|LOCUS_23800 3414 2833 gene locus_tag LOCUS_23810 3414 2833 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930615.1 protein_id gnl|my_center|LOCUS_23810 4573 3596 gene locus_tag LOCUS_23820 4573 3596 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811098.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence233 1170 400 gene locus_tag LOCUS_23830 1170 400 CDS product DUF2497 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389550.1 protein_id gnl|my_center|LOCUS_23830 2762 1338 gene locus_tag LOCUS_23840 2762 1338 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_23840 3743 3057 gene locus_tag LOCUS_23850 3743 3057 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969269.1 protein_id gnl|my_center|LOCUS_23850 4194 4267 gene locus_tag LOCUS_t00240 4194 4267 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4409 4484 gene locus_tag LOCUS_t00250 4409 4484 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4535 4610 gene locus_tag LOCUS_t00260 4535 4610 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5503 4766 gene locus_tag LOCUS_23860 5503 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23860 5801 5487 gene locus_tag LOCUS_23870 5801 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence234 1000 113 gene locus_tag LOCUS_23880 1000 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1193 1477 gene locus_tag LOCUS_23890 1193 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1520 1861 gene locus_tag LOCUS_23900 1520 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 1963 2187 gene locus_tag LOCUS_23910 1963 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2191 2418 gene locus_tag LOCUS_23920 2191 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2484 3038 gene locus_tag LOCUS_23930 2484 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 3183 4454 gene locus_tag LOCUS_23940 3183 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 4642 4893 gene locus_tag LOCUS_23950 4642 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 4890 5357 gene locus_tag LOCUS_23960 4890 5357 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 protein_id gnl|my_center|LOCUS_23960 <6022 5431 gene locus_tag LOCUS_23970 <6022 5431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074378.1:tyrosine-type recombinase/integrase >Feature sequence235 1290 79 gene locus_tag LOCUS_23980 1290 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256189.1 protein_id gnl|my_center|LOCUS_23980 1439 2326 gene locus_tag LOCUS_23990 1439 2326 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 protein_id gnl|my_center|LOCUS_23990 2459 3070 gene locus_tag LOCUS_24000 gene wrbA 2459 3070 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970175.1 protein_id gnl|my_center|LOCUS_24000 3142 3993 gene locus_tag LOCUS_24010 3142 3993 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058717.1 protein_id gnl|my_center|LOCUS_24010 4352 5920 gene locus_tag LOCUS_24020 4352 5920 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478744.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence236 1448 552 gene locus_tag LOCUS_24030 1448 552 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275314.1 protein_id gnl|my_center|LOCUS_24030 2891 1521 gene locus_tag LOCUS_24040 2891 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 4855 2906 gene locus_tag LOCUS_24050 4855 2906 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528761.1 protein_id gnl|my_center|LOCUS_24050 5574 5086 gene locus_tag LOCUS_24060 5574 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence237 440 1675 gene locus_tag LOCUS_24070 440 1675 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626642.1 protein_id gnl|my_center|LOCUS_24070 1883 5692 gene locus_tag LOCUS_24080 1883 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence238 1103 39 gene locus_tag LOCUS_24090 1103 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2135 1653 gene locus_tag LOCUS_24100 2135 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2456 2890 gene locus_tag LOCUS_24110 2456 2890 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176702.1 protein_id gnl|my_center|LOCUS_24110 3633 5807 gene locus_tag LOCUS_24120 3633 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence239 183 425 gene locus_tag LOCUS_24130 183 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2105 558 gene locus_tag LOCUS_24140 2105 558 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502938.1 protein_id gnl|my_center|LOCUS_24140 3058 2102 gene locus_tag LOCUS_24150 3058 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 4065 3133 gene locus_tag LOCUS_24160 4065 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence240 1360 2265 gene locus_tag LOCUS_24170 1360 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2286 2564 gene locus_tag LOCUS_24180 2286 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2720 2902 gene locus_tag LOCUS_24190 2720 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 3015 4010 gene locus_tag LOCUS_24200 3015 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence241 70 657 gene locus_tag LOCUS_24210 gene coaE 70 657 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391359.1 protein_id gnl|my_center|LOCUS_24210 730 1413 gene locus_tag LOCUS_24220 gene dnaQ 730 1413 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_24220 2043 1552 gene locus_tag LOCUS_24230 gene secB 2043 1552 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067419.1 protein_id gnl|my_center|LOCUS_24230 2900 2316 gene locus_tag LOCUS_24240 2900 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 3236 3982 gene locus_tag LOCUS_24250 3236 3982 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 protein_id gnl|my_center|LOCUS_24250 4195 5595 gene locus_tag LOCUS_24260 4195 5595 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947710.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence242 255 404 gene locus_tag LOCUS_24270 255 404 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_24270 611 2458 gene locus_tag LOCUS_24280 611 2458 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_24280 3355 2702 gene locus_tag LOCUS_24290 gene folE 3355 2702 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202069.1 protein_id gnl|my_center|LOCUS_24290 3929 3537 gene locus_tag LOCUS_24300 gene apaG 3929 3537 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706741.1 protein_id gnl|my_center|LOCUS_24300 5042 4221 gene locus_tag LOCUS_24310 5042 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence243 843 2003 gene locus_tag LOCUS_24320 843 2003 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_24320 2229 3806 gene locus_tag LOCUS_24330 gene serA 2229 3806 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529159.1 protein_id gnl|my_center|LOCUS_24330 3919 4584 gene locus_tag LOCUS_24340 3919 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 4782 5366 gene locus_tag LOCUS_24350 4782 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence244 458 1366 gene locus_tag LOCUS_24360 458 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 1583 4537 gene locus_tag LOCUS_24370 1583 4537 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190795.1 protein_id gnl|my_center|LOCUS_24370 4634 5656 gene locus_tag LOCUS_24380 4634 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence245 2283 121 gene locus_tag LOCUS_24390 2283 121 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137396889.1 protein_id gnl|my_center|LOCUS_24390 2620 3366 gene locus_tag LOCUS_24400 2620 3366 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766786.1 protein_id gnl|my_center|LOCUS_24400 3595 3505 gene locus_tag LOCUS_t00270 3595 3505 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3909 4388 gene locus_tag LOCUS_24410 gene moaC 3909 4388 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_24410 4385 5644 gene locus_tag LOCUS_24420 4385 5644 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971802.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence246 482 93 gene locus_tag LOCUS_24430 482 93 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389509.1 protein_id gnl|my_center|LOCUS_24430 1397 828 gene locus_tag LOCUS_24440 1397 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2528 1545 gene locus_tag LOCUS_24450 gene pip 2528 1545 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_24450 3558 2833 gene locus_tag LOCUS_24460 3558 2833 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244755.1 protein_id gnl|my_center|LOCUS_24460 4461 3715 gene locus_tag LOCUS_24470 4461 3715 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_24470 4447 5622 gene locus_tag LOCUS_24480 gene queG 4447 5622 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence247 541 80 gene locus_tag LOCUS_24490 541 80 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_24490 720 1892 gene locus_tag LOCUS_24500 gene argE 720 1892 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973005.1 protein_id gnl|my_center|LOCUS_24500 2015 3910 gene locus_tag LOCUS_24510 2015 3910 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038771.1 protein_id gnl|my_center|LOCUS_24510 4615 3989 gene locus_tag LOCUS_24520 4615 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 5287 4721 gene locus_tag LOCUS_24530 5287 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence248 2409 139 gene locus_tag LOCUS_24540 gene ptsP 2409 139 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388503.1 protein_id gnl|my_center|LOCUS_24540 3506 2412 gene locus_tag LOCUS_24550 3506 2412 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_24550 4916 3696 gene locus_tag LOCUS_24560 4916 3696 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388501.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence249 525 73 gene locus_tag LOCUS_24570 525 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24570 949 506 gene locus_tag LOCUS_24580 949 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24580 3467 1017 gene locus_tag LOCUS_24590 gene torA 3467 1017 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389042.1 protein_id gnl|my_center|LOCUS_24590 4342 3704 gene locus_tag LOCUS_24600 gene torD 4342 3704 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983166.1 protein_id gnl|my_center|LOCUS_24600 5504 4335 gene locus_tag LOCUS_24610 gene torC 5504 4335 CDS product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389038.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence250 942 19 gene locus_tag LOCUS_24620 942 19 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391362.1 protein_id gnl|my_center|LOCUS_24620 1496 2560 gene locus_tag LOCUS_24630 gene hemE 1496 2560 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391363.1 protein_id gnl|my_center|LOCUS_24630 2887 3942 gene locus_tag LOCUS_24640 gene hemH 2887 3942 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391364.1 protein_id gnl|my_center|LOCUS_24640 3968 4423 gene locus_tag LOCUS_24650 gene hemJ 3968 4423 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_24650 5182 4478 gene locus_tag LOCUS_24660 5182 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 5174 5386 gene locus_tag LOCUS_24670 5174 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence251 696 70 gene locus_tag LOCUS_24680 696 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1135 803 gene locus_tag LOCUS_24690 1135 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 2028 1606 gene locus_tag LOCUS_24700 2028 1606 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 protein_id gnl|my_center|LOCUS_24700 4043 2817 gene locus_tag LOCUS_24710 gene dapE 4043 2817 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391227.1 protein_id gnl|my_center|LOCUS_24710 5233 4373 gene locus_tag LOCUS_24720 gene dapD 5233 4373 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493576.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence252 186 758 gene locus_tag LOCUS_24730 gene hslV 186 758 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391346.1 protein_id gnl|my_center|LOCUS_24730 755 2065 gene locus_tag LOCUS_24740 gene hslU 755 2065 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083473.1 protein_id gnl|my_center|LOCUS_24740 2543 4267 gene locus_tag LOCUS_24750 2543 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 5140 4418 gene locus_tag LOCUS_24760 gene nth 5140 4418 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625878.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence253 351 800 gene locus_tag LOCUS_24770 351 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1310 942 gene locus_tag LOCUS_24780 1310 942 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389889.1 protein_id gnl|my_center|LOCUS_24780 4109 1386 gene locus_tag LOCUS_24790 4109 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24790 4471 4812 gene locus_tag LOCUS_24800 4471 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 5002 5346 gene locus_tag LOCUS_24810 5002 5346 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390836.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence254 610 239 gene locus_tag LOCUS_24820 610 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 1164 844 gene locus_tag LOCUS_24830 1164 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 1751 1164 gene locus_tag LOCUS_24840 1751 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4240 1748 gene locus_tag LOCUS_24850 4240 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 4642 4484 gene locus_tag LOCUS_24860 4642 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 5247 4681 gene locus_tag LOCUS_24870 5247 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence255 <1 2109 gene locus_tag LOCUS_24880 <1 2109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391400.1:ABC transporter permease 2752 2270 gene locus_tag LOCUS_24890 gene bfrB 2752 2270 CDS product bacterioferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092078.1 protein_id gnl|my_center|LOCUS_24890 3473 2997 gene locus_tag LOCUS_24900 3473 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 4142 4217 gene locus_tag LOCUS_t00280 4142 4217 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5361 4282 gene locus_tag LOCUS_24910 5361 4282 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331975.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence256 884 54 gene locus_tag LOCUS_24920 884 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 1489 3216 gene locus_tag LOCUS_24930 gene ilvD 1489 3216 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087531.1 protein_id gnl|my_center|LOCUS_24930 3534 4364 gene locus_tag LOCUS_24940 3534 4364 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 protein_id gnl|my_center|LOCUS_24940 4676 5074 gene locus_tag LOCUS_24950 4676 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence257 122 673 gene locus_tag LOCUS_24960 122 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 975 1436 gene locus_tag LOCUS_24970 975 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1585 2367 gene locus_tag LOCUS_24980 1585 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 3491 2421 gene locus_tag LOCUS_24990 3491 2421 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389542.1 protein_id gnl|my_center|LOCUS_24990 4133 4348 gene locus_tag LOCUS_25000 4133 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391238.1 protein_id gnl|my_center|LOCUS_25000 4800 4426 gene locus_tag LOCUS_25010 4800 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence258 408 1277 gene locus_tag LOCUS_25020 408 1277 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970816.1 protein_id gnl|my_center|LOCUS_25020 5208 1477 gene locus_tag LOCUS_25030 5208 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence259 156 1457 gene locus_tag LOCUS_25040 156 1457 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388984.1 protein_id gnl|my_center|LOCUS_25040 1720 2592 gene locus_tag LOCUS_25050 1720 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2867 4333 gene locus_tag LOCUS_25060 2867 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 4971 4384 gene locus_tag LOCUS_25070 4971 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence260 859 32 gene locus_tag LOCUS_25080 859 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 1673 1026 gene locus_tag LOCUS_25090 1673 1026 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530075.1 protein_id gnl|my_center|LOCUS_25090 2353 1709 gene locus_tag LOCUS_25100 gene msrA 2353 1709 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_25100 2489 2647 gene locus_tag LOCUS_25110 2489 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2672 3274 gene locus_tag LOCUS_25120 2672 3274 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_25120 3534 4235 gene locus_tag LOCUS_25130 3534 4235 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090105.1 protein_id gnl|my_center|LOCUS_25130 4361 5050 gene locus_tag LOCUS_25140 4361 5050 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222956.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence261 31 840 gene locus_tag LOCUS_25150 31 840 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626396.1 protein_id gnl|my_center|LOCUS_25150 912 1292 gene locus_tag LOCUS_25160 912 1292 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390179.1 protein_id gnl|my_center|LOCUS_25160 1285 2013 gene locus_tag LOCUS_25170 1285 2013 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_25170 2682 2008 gene locus_tag LOCUS_25180 2682 2008 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_25180 3506 2772 gene locus_tag LOCUS_25190 gene pyrF 3506 2772 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_25190 4712 3615 gene locus_tag LOCUS_25200 4712 3615 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625873.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence262 1401 187 gene locus_tag LOCUS_25210 1401 187 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388109.1 protein_id gnl|my_center|LOCUS_25210 1836 2171 gene locus_tag LOCUS_25220 1836 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2881 3660 gene locus_tag LOCUS_25230 2881 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25230 4022 5008 gene locus_tag LOCUS_25240 4022 5008 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence263 236 1003 gene locus_tag LOCUS_25250 236 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 1867 1115 gene locus_tag LOCUS_25260 1867 1115 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 protein_id gnl|my_center|LOCUS_25260 2135 2542 gene locus_tag LOCUS_25270 2135 2542 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_25270 3031 3525 gene locus_tag LOCUS_25280 3031 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence264 523 191 gene locus_tag LOCUS_25290 523 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 1322 858 gene locus_tag LOCUS_25300 1322 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 1946 1761 gene locus_tag LOCUS_25310 1946 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 2185 3243 gene locus_tag LOCUS_25320 2185 3243 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030991.1 protein_id gnl|my_center|LOCUS_25320 3244 5055 gene locus_tag LOCUS_25330 3244 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030992.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence265 1282 329 gene locus_tag LOCUS_25340 1282 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2998 1589 gene locus_tag LOCUS_25350 2998 1589 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_25350 4744 3404 gene locus_tag LOCUS_25360 4744 3404 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence266 145 819 gene locus_tag LOCUS_25370 145 819 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337693.1 protein_id gnl|my_center|LOCUS_25370 982 1677 gene locus_tag LOCUS_25380 982 1677 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390534.1 protein_id gnl|my_center|LOCUS_25380 1755 2369 gene locus_tag LOCUS_25390 1755 2369 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968514.1 protein_id gnl|my_center|LOCUS_25390 2816 4618 gene locus_tag LOCUS_25400 gene thiC 2816 4618 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976311.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence267 316 645 gene locus_tag LOCUS_25410 316 645 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573822.1 protein_id gnl|my_center|LOCUS_25410 715 1047 gene locus_tag LOCUS_25420 715 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 1100 2332 gene locus_tag LOCUS_25430 gene nifV 1100 2332 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_25430 2549 2881 gene locus_tag LOCUS_25440 2549 2881 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_25440 3776 2895 gene locus_tag LOCUS_25450 3776 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 4238 4322 gene locus_tag LOCUS_t00290 4238 4322 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4592 4665 gene locus_tag LOCUS_t00300 4592 4665 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence268 183 545 gene locus_tag LOCUS_25460 183 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 640 1539 gene locus_tag LOCUS_25470 640 1539 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965612.1 protein_id gnl|my_center|LOCUS_25470 1885 2763 gene locus_tag LOCUS_25480 1885 2763 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145268175.1 protein_id gnl|my_center|LOCUS_25480 3033 3824 gene locus_tag LOCUS_25490 3033 3824 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786554.1 protein_id gnl|my_center|LOCUS_25490 3834 4208 gene locus_tag LOCUS_25500 3834 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 4308 4790 gene locus_tag LOCUS_25510 4308 4790 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233857.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence269 1317 2429 gene locus_tag LOCUS_25520 1317 2429 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389784.1 protein_id gnl|my_center|LOCUS_25520 2540 3535 gene locus_tag LOCUS_25530 2540 3535 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_25530 4533 3532 gene locus_tag LOCUS_25540 4533 3532 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337926.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence270 3317 246 gene locus_tag LOCUS_25550 gene vexK 3317 246 CDS product efflux RND transporter permease subunit VexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625968.1 protein_id gnl|my_center|LOCUS_25550 4553 3477 gene locus_tag LOCUS_25560 4553 3477 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261803.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence271 538 951 gene locus_tag LOCUS_25570 538 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 4652 1110 gene locus_tag LOCUS_25580 4652 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence272 119 934 gene locus_tag LOCUS_25590 119 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 1395 1030 gene locus_tag LOCUS_25600 gene uraH 1395 1030 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061425.1 protein_id gnl|my_center|LOCUS_25600 1606 3042 gene locus_tag LOCUS_25610 gene puuE 1606 3042 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975644.1 protein_id gnl|my_center|LOCUS_25610 3112 4128 gene locus_tag LOCUS_25620 gene alc 3112 4128 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975643.1 protein_id gnl|my_center|LOCUS_25620 4134 4631 gene locus_tag LOCUS_25630 4134 4631 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336828.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence273 507 1007 gene locus_tag LOCUS_25640 507 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2491 1253 gene locus_tag LOCUS_25650 2491 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 3931 2750 gene locus_tag LOCUS_25660 3931 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217407.1 protein_id gnl|my_center|LOCUS_25660 4565 3936 gene locus_tag LOCUS_25670 4565 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence274 905 2578 gene locus_tag LOCUS_25680 905 2578 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599662.1 protein_id gnl|my_center|LOCUS_25680 4650 2761 gene locus_tag LOCUS_25690 4650 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence275 1110 61 gene locus_tag LOCUS_25700 gene obgE 1110 61 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083257.1 protein_id gnl|my_center|LOCUS_25700 1615 1343 gene locus_tag LOCUS_25710 gene rpmA 1615 1343 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067214.1 protein_id gnl|my_center|LOCUS_25710 2042 1728 gene locus_tag LOCUS_25720 gene rplU 2042 1728 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003516451.1 protein_id gnl|my_center|LOCUS_25720 3625 2414 gene locus_tag LOCUS_25730 3625 2414 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626572.1 protein_id gnl|my_center|LOCUS_25730 4553 3807 gene locus_tag LOCUS_25740 4553 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence276 1315 26 gene locus_tag LOCUS_25750 1315 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 1531 3099 gene locus_tag LOCUS_25760 1531 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3122 4582 gene locus_tag LOCUS_25770 gene scfB 3122 4582 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence277 1801 125 gene locus_tag LOCUS_25780 1801 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 2101 3795 gene locus_tag LOCUS_25790 2101 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 4490 3879 gene locus_tag LOCUS_25800 4490 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence278 1128 241 gene locus_tag LOCUS_25810 1128 241 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_25810 1605 1327 gene locus_tag LOCUS_25820 1605 1327 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919931.1 protein_id gnl|my_center|LOCUS_25820 2841 1888 gene locus_tag LOCUS_25830 2841 1888 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_25830 3560 3339 gene locus_tag LOCUS_25840 3560 3339 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690730.1 protein_id gnl|my_center|LOCUS_25840 4305 4670 gene locus_tag LOCUS_25850 4305 4670 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053149.1 protein_id gnl|my_center|LOCUS_25850 >Feature sequence279 146 1783 gene locus_tag LOCUS_25860 146 1783 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917973.1 protein_id gnl|my_center|LOCUS_25860 1878 2255 gene locus_tag LOCUS_25870 1878 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2669 3343 gene locus_tag LOCUS_25880 2669 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 4317 3391 gene locus_tag LOCUS_25890 4317 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence280 1562 552 gene locus_tag LOCUS_25900 1562 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2899 1664 gene locus_tag LOCUS_25910 2899 1664 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_25910 3612 2896 gene locus_tag LOCUS_25920 3612 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 4195 3890 gene locus_tag LOCUS_25930 4195 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence281 369 37 gene locus_tag LOCUS_25940 369 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25940 641 333 gene locus_tag LOCUS_25950 641 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 1308 634 gene locus_tag LOCUS_25960 1308 634 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969827.1 protein_id gnl|my_center|LOCUS_25960 1697 2077 gene locus_tag LOCUS_25970 1697 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 3127 2132 gene locus_tag LOCUS_25980 3127 2132 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389652.1 protein_id gnl|my_center|LOCUS_25980 3736 3134 gene locus_tag LOCUS_25990 3736 3134 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919721.1 protein_id gnl|my_center|LOCUS_25990 4040 4543 gene locus_tag LOCUS_26000 4040 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence282 1008 49 gene locus_tag LOCUS_26010 1008 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 1804 1181 gene locus_tag LOCUS_26020 gene pth 1804 1181 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338521.1 protein_id gnl|my_center|LOCUS_26020 2356 3273 gene locus_tag LOCUS_26030 2356 3273 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 protein_id gnl|my_center|LOCUS_26030 3670 4317 gene locus_tag LOCUS_26040 3670 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 >Feature sequence283 1030 1149 gene locus_tag LOCUS_26050 1030 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 1233 3041 gene locus_tag LOCUS_26060 1233 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26060 3156 3944 gene locus_tag LOCUS_26070 3156 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26070 >Feature sequence284 2158 11 gene locus_tag LOCUS_26080 2158 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 4305 2251 gene locus_tag LOCUS_26090 gene recQ 4305 2251 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence285 789 139 gene locus_tag LOCUS_26100 789 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1505 1909 gene locus_tag LOCUS_26110 gene cueR 1505 1909 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939394.1 protein_id gnl|my_center|LOCUS_26110 2288 2130 gene locus_tag LOCUS_26120 2288 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2799 4127 gene locus_tag LOCUS_26130 2799 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence286 1484 54 gene locus_tag LOCUS_26140 1484 54 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811314.1 protein_id gnl|my_center|LOCUS_26140 2472 1675 gene locus_tag LOCUS_26150 2472 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3338 3414 gene locus_tag LOCUS_t00310 3338 3414 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4448 3564 gene locus_tag LOCUS_26160 4448 3564 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393019.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence287 2789 2259 gene locus_tag LOCUS_26170 2789 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 2941 3237 gene locus_tag LOCUS_26180 2941 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 3267 3464 gene locus_tag LOCUS_26190 3267 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 3540 3965 gene locus_tag LOCUS_26200 3540 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence288 1038 13 gene locus_tag LOCUS_26210 1038 13 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_26210 3079 1304 gene locus_tag LOCUS_26220 3079 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 4222 3155 gene locus_tag LOCUS_26230 4222 3155 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735487.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence289 837 109 gene locus_tag LOCUS_26240 837 109 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530651.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26240 1141 1869 gene locus_tag LOCUS_26250 1141 1869 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198766.1 protein_id gnl|my_center|LOCUS_26250 2344 3999 gene locus_tag LOCUS_26260 2344 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 >Feature sequence290 183 1259 gene locus_tag LOCUS_26270 183 1259 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087731.1 protein_id gnl|my_center|LOCUS_26270 1555 1271 gene locus_tag LOCUS_26280 1555 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 2006 2752 gene locus_tag LOCUS_26290 2006 2752 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_26290 2846 3214 gene locus_tag LOCUS_26300 2846 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3699 4301 gene locus_tag LOCUS_26310 3699 4301 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391493.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence291 614 1990 gene locus_tag LOCUS_26320 614 1990 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099324.1 protein_id gnl|my_center|LOCUS_26320 2663 2941 gene locus_tag LOCUS_26330 2663 2941 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946406.1 protein_id gnl|my_center|LOCUS_26330 3118 4080 gene locus_tag LOCUS_26340 3118 4080 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975388.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence292 1446 448 gene locus_tag LOCUS_26350 1446 448 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937476.1 protein_id gnl|my_center|LOCUS_26350 2426 1443 gene locus_tag LOCUS_26360 2426 1443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937477.1 protein_id gnl|my_center|LOCUS_26360 3361 2432 gene locus_tag LOCUS_26370 3361 2432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455202.1 protein_id gnl|my_center|LOCUS_26370 <4392 3361 gene locus_tag LOCUS_26380 <4392 3361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000490818.1:ABC transporter permease >Feature sequence293 654 13 gene locus_tag LOCUS_26390 654 13 CDS product SspB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531016.1 protein_id gnl|my_center|LOCUS_26390 2046 1765 gene locus_tag LOCUS_26400 2046 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2654 3040 gene locus_tag LOCUS_26410 2654 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 4063 3137 gene locus_tag LOCUS_26420 gene serB 4063 3137 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388224.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence294 <1 886 gene locus_tag LOCUS_26430 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005464586.1:TAXI family TRAP transporter solute-binding subunit 1649 4288 gene locus_tag LOCUS_26440 1649 4288 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067553987.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence295 527 1231 gene locus_tag LOCUS_26450 527 1231 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_26450 1609 2451 gene locus_tag LOCUS_26460 1609 2451 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_26460 3408 2581 gene locus_tag LOCUS_26470 3408 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 3824 3405 gene locus_tag LOCUS_26480 3824 3405 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463606.1 protein_id gnl|my_center|LOCUS_26480 4188 3784 gene locus_tag LOCUS_26490 4188 3784 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087349.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence296 349 1683 gene locus_tag LOCUS_26500 349 1683 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971520.1 protein_id gnl|my_center|LOCUS_26500 1688 2941 gene locus_tag LOCUS_26510 1688 2941 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531108.1 protein_id gnl|my_center|LOCUS_26510 2960 4066 gene locus_tag LOCUS_26520 2960 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence297 1356 466 gene locus_tag LOCUS_26530 1356 466 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 protein_id gnl|my_center|LOCUS_26530 2658 1489 gene locus_tag LOCUS_26540 2658 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 3329 4084 gene locus_tag LOCUS_26550 3329 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence298 2257 227 gene locus_tag LOCUS_26560 2257 227 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921416.1 protein_id gnl|my_center|LOCUS_26560 3331 2351 gene locus_tag LOCUS_26570 gene yiaO 3331 2351 CDS product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776928.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence299 230 1450 gene locus_tag LOCUS_26580 230 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence300 2018 408 gene locus_tag LOCUS_26590 2018 408 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085184.1 protein_id gnl|my_center|LOCUS_26590 2201 3433 gene locus_tag LOCUS_26600 2201 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence301 105 854 gene locus_tag LOCUS_26610 105 854 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108548.1 protein_id gnl|my_center|LOCUS_26610 894 1622 gene locus_tag LOCUS_26620 894 1622 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336948.1 protein_id gnl|my_center|LOCUS_26620 2029 1619 gene locus_tag LOCUS_26630 2029 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2644 2060 gene locus_tag LOCUS_26640 2644 2060 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921763.1 protein_id gnl|my_center|LOCUS_26640 4135 2954 gene locus_tag LOCUS_26650 4135 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence302 1657 1839 gene locus_tag LOCUS_26660 1657 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 3557 2091 gene locus_tag LOCUS_26670 3557 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 4091 3972 gene locus_tag LOCUS_26680 4091 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence303 639 118 gene locus_tag LOCUS_26690 639 118 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_26690 900 3275 gene locus_tag LOCUS_26700 900 3275 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389032.1 protein_id gnl|my_center|LOCUS_26700 3981 3259 gene locus_tag LOCUS_26710 3981 3259 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626143.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence304 860 189 gene locus_tag LOCUS_26720 860 189 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390957.1 protein_id gnl|my_center|LOCUS_26720 1110 1778 gene locus_tag LOCUS_26730 1110 1778 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 protein_id gnl|my_center|LOCUS_26730 1969 2844 gene locus_tag LOCUS_26740 gene gluQRS 1969 2844 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_26740 3331 2978 gene locus_tag LOCUS_26750 3331 2978 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388031.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence305 140 595 gene locus_tag LOCUS_26760 140 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2239 683 gene locus_tag LOCUS_26770 gene dnaA 2239 683 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_26770 3911 3318 gene locus_tag LOCUS_26780 3911 3318 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084308.1 protein_id gnl|my_center|LOCUS_26780 >Feature sequence306 729 79 gene locus_tag LOCUS_26790 729 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1957 698 gene locus_tag LOCUS_26800 1957 698 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084894.1 protein_id gnl|my_center|LOCUS_26800 2592 1954 gene locus_tag LOCUS_26810 gene bioD 2592 1954 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973493.1 protein_id gnl|my_center|LOCUS_26810 3544 2744 gene locus_tag LOCUS_26820 3544 2744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388398.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence307 105 1217 gene locus_tag LOCUS_26830 gene arsB 105 1217 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339061.1 protein_id gnl|my_center|LOCUS_26830 1956 1339 gene locus_tag LOCUS_26840 1956 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 2771 2535 gene locus_tag LOCUS_26850 2771 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 3442 3993 gene locus_tag LOCUS_26860 3442 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence308 148 1686 gene locus_tag LOCUS_26870 148 1686 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440399.1 protein_id gnl|my_center|LOCUS_26870 1770 2321 gene locus_tag LOCUS_26880 1770 2321 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_26880 3865 2405 gene locus_tag LOCUS_26890 3865 2405 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388740.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence309 906 31 gene locus_tag LOCUS_26900 906 31 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040241.1 protein_id gnl|my_center|LOCUS_26900 2748 1861 gene locus_tag LOCUS_26910 2748 1861 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504141.1 protein_id gnl|my_center|LOCUS_26910 2852 3562 gene locus_tag LOCUS_26920 2852 3562 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170061.1 protein_id gnl|my_center|LOCUS_26920 3886 3671 gene locus_tag LOCUS_26930 3886 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence310 746 120 gene locus_tag LOCUS_26940 746 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3672 1810 gene locus_tag LOCUS_26950 3672 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence311 1439 1032 gene locus_tag LOCUS_26960 1439 1032 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546608.1 protein_id gnl|my_center|LOCUS_26960 2066 3805 gene locus_tag LOCUS_26970 2066 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence312 513 157 gene locus_tag LOCUS_26980 513 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 933 631 gene locus_tag LOCUS_26990 933 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 2691 946 gene locus_tag LOCUS_27000 2691 946 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928419.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence313 562 1458 gene locus_tag LOCUS_27010 562 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1694 3871 gene locus_tag LOCUS_27020 1694 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388856.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence314 606 175 gene locus_tag LOCUS_27030 606 175 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 protein_id gnl|my_center|LOCUS_27030 1773 760 gene locus_tag LOCUS_27040 1773 760 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_27040 3054 3503 gene locus_tag LOCUS_27050 3054 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence315 40 957 gene locus_tag LOCUS_27060 40 957 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 protein_id gnl|my_center|LOCUS_27060 1311 2696 gene locus_tag LOCUS_27070 gene egtB 1311 2696 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_27070 2755 3834 gene locus_tag LOCUS_27080 gene egtD 2755 3834 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205453.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence316 3227 204 gene locus_tag LOCUS_27090 3227 204 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389791.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence317 2931 22 gene locus_tag LOCUS_27100 gene uvrA 2931 22 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_27100 3335 3838 gene locus_tag LOCUS_27110 3335 3838 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992289.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence318 368 1213 gene locus_tag LOCUS_27120 368 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 1305 2156 gene locus_tag LOCUS_27130 1305 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 2294 3127 gene locus_tag LOCUS_27140 2294 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 3284 3787 gene locus_tag LOCUS_27150 3284 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence319 1008 217 gene locus_tag LOCUS_27160 1008 217 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722701.1 protein_id gnl|my_center|LOCUS_27160 1745 1161 gene locus_tag LOCUS_27170 1745 1161 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974724.1 protein_id gnl|my_center|LOCUS_27170 3461 1839 gene locus_tag LOCUS_27180 gene ctaD 3461 1839 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083990.1 protein_id gnl|my_center|LOCUS_27180 >Feature sequence320 488 48 gene locus_tag LOCUS_27190 488 48 CDS product DUF1489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087921.1 protein_id gnl|my_center|LOCUS_27190 1396 485 gene locus_tag LOCUS_27200 1396 485 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104166.1 protein_id gnl|my_center|LOCUS_27200 3447 1393 gene locus_tag LOCUS_27210 3447 1393 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815954.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence321 61 3024 gene locus_tag LOCUS_27220 61 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3246 3713 gene locus_tag LOCUS_27230 3246 3713 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942521.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence322 1329 52 gene locus_tag LOCUS_27240 1329 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 2239 3747 gene locus_tag LOCUS_27250 2239 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence323 1760 93 gene locus_tag LOCUS_27260 1760 93 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528784.1 protein_id gnl|my_center|LOCUS_27260 2531 1818 gene locus_tag LOCUS_27270 2531 1818 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_27270 3617 2673 gene locus_tag LOCUS_27280 3617 2673 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391458.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence324 227 2503 gene locus_tag LOCUS_27290 227 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 2577 3161 gene locus_tag LOCUS_27300 2577 3161 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564839.1 protein_id gnl|my_center|LOCUS_27300 3327 3533 gene locus_tag LOCUS_27310 3327 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence325 824 129 gene locus_tag LOCUS_27320 824 129 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_27320 1246 935 gene locus_tag LOCUS_27330 1246 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 2241 2008 gene locus_tag LOCUS_27340 2241 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2972 3658 gene locus_tag LOCUS_27350 2972 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 >Feature sequence326 1245 205 gene locus_tag LOCUS_27360 1245 205 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971356.1 protein_id gnl|my_center|LOCUS_27360 2609 1359 gene locus_tag LOCUS_27370 gene puuD 2609 1359 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972222.1 protein_id gnl|my_center|LOCUS_27370 2730 3653 gene locus_tag LOCUS_27380 2730 3653 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975651.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence327 2262 22 gene locus_tag LOCUS_27390 gene plpD 2262 22 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_27390 2690 3346 gene locus_tag LOCUS_27400 2690 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence328 3 158 gene locus_tag LOCUS_27410 3 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 601 972 gene locus_tag LOCUS_27420 gene rpsL 601 972 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_27420 984 1454 gene locus_tag LOCUS_27430 gene rpsG 984 1454 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390502.1 protein_id gnl|my_center|LOCUS_27430 1562 3670 gene locus_tag LOCUS_27440 gene fusA 1562 3670 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390501.1 protein_id gnl|my_center|LOCUS_27440 >Feature sequence329 738 217 gene locus_tag LOCUS_27450 gene ilvN 738 217 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_27450 2877 1051 gene locus_tag LOCUS_27460 2877 1051 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388226.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence330 981 148 gene locus_tag LOCUS_27470 981 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 3069 1114 gene locus_tag LOCUS_27480 3069 1114 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389619.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence331 696 73 gene locus_tag LOCUS_27490 696 73 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974526.1 protein_id gnl|my_center|LOCUS_27490 2101 731 gene locus_tag LOCUS_27500 2101 731 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974525.1 protein_id gnl|my_center|LOCUS_27500 2379 3491 gene locus_tag LOCUS_27510 2379 3491 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence332 1022 87 gene locus_tag LOCUS_27520 1022 87 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 protein_id gnl|my_center|LOCUS_27520 1295 1891 gene locus_tag LOCUS_27530 1295 1891 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_27530 1891 3072 gene locus_tag LOCUS_27540 1891 3072 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984073.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence333 627 1079 gene locus_tag LOCUS_27550 gene aroQ 627 1079 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_27550 1401 1907 gene locus_tag LOCUS_27560 gene accB 1401 1907 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971548.1 protein_id gnl|my_center|LOCUS_27560 2135 3484 gene locus_tag LOCUS_27570 gene accC 2135 3484 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390188.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence334 358 47 gene locus_tag LOCUS_27580 358 47 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337479.1 protein_id gnl|my_center|LOCUS_27580 3392 456 gene locus_tag LOCUS_27590 3392 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence335 197 1990 gene locus_tag LOCUS_27600 197 1990 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525224.1 protein_id gnl|my_center|LOCUS_27600 2563 2021 gene locus_tag LOCUS_27610 gene rnhA 2563 2021 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974731.1 protein_id gnl|my_center|LOCUS_27610 <3517 2589 gene locus_tag LOCUS_27620 <3517 2589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390801.1:homoserine kinase >Feature sequence336 1131 223 gene locus_tag LOCUS_27630 1131 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 1990 1121 gene locus_tag LOCUS_27640 1990 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27640 2819 1938 gene locus_tag LOCUS_27650 2819 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27650 >Feature sequence337 1782 736 gene locus_tag LOCUS_27660 1782 736 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_27660 2918 3373 gene locus_tag LOCUS_27670 2918 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence338 464 1540 gene locus_tag LOCUS_27680 464 1540 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_27680 2423 1650 gene locus_tag LOCUS_27690 2423 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 3270 2485 gene locus_tag LOCUS_27700 3270 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence339 847 3171 gene locus_tag LOCUS_27710 847 3171 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390806.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence340 1055 1495 gene locus_tag LOCUS_27720 1055 1495 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947599.1 protein_id gnl|my_center|LOCUS_27720 3249 1567 gene locus_tag LOCUS_27730 gene leuA 3249 1567 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389681.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence341 1602 16 gene locus_tag LOCUS_27740 1602 16 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387919.1 protein_id gnl|my_center|LOCUS_27740 2335 3393 gene locus_tag LOCUS_27750 2335 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence342 1601 477 gene locus_tag LOCUS_27760 1601 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2307 3296 gene locus_tag LOCUS_27770 gene msrP 2307 3296 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence343 1557 3194 gene locus_tag LOCUS_27780 gene lnt 1557 3194 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence344 498 878 gene locus_tag LOCUS_27790 gene rpsP 498 878 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388940.1 protein_id gnl|my_center|LOCUS_27790 1051 1743 gene locus_tag LOCUS_27800 gene rimM 1051 1743 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388941.1 protein_id gnl|my_center|LOCUS_27800 1740 2495 gene locus_tag LOCUS_27810 gene trmD 1740 2495 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528859.1 protein_id gnl|my_center|LOCUS_27810 2743 3270 gene locus_tag LOCUS_27820 2743 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence345 546 3326 gene locus_tag LOCUS_27830 gene gyrA 546 3326 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389497.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence346 359 2137 gene locus_tag LOCUS_27840 359 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 2306 2178 gene locus_tag LOCUS_27850 2306 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 2648 3298 gene locus_tag LOCUS_27860 2648 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence347 1032 85 gene locus_tag LOCUS_27870 1032 85 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_27870 2569 1088 gene locus_tag LOCUS_27880 2569 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 <3238 2724 gene locus_tag LOCUS_27890 <3238 2724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391331.1:CDP-diacylglycerol--serine O-phosphatidyltransferase >Feature sequence348 411 2993 gene locus_tag LOCUS_27900 411 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence349 1451 57 gene locus_tag LOCUS_27910 1451 57 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390030.1 protein_id gnl|my_center|LOCUS_27910 1916 1464 gene locus_tag LOCUS_27920 1916 1464 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390031.1 protein_id gnl|my_center|LOCUS_27920 3066 1918 gene locus_tag LOCUS_27930 3066 1918 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390032.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence350 <1 388 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttctgagccgcctacgcggcggtaaac 1609 731 gene locus_tag LOCUS_27940 1609 731 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093500.1 protein_id gnl|my_center|LOCUS_27940 1841 2134 gene locus_tag LOCUS_27950 1841 2134 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 protein_id gnl|my_center|LOCUS_27950 2254 2649 gene locus_tag LOCUS_27960 2254 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27960 2650 3117 gene locus_tag LOCUS_27970 2650 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27970 >Feature sequence351 1072 878 gene locus_tag LOCUS_27980 1072 878 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390530.1 protein_id gnl|my_center|LOCUS_27980 3063 1486 gene locus_tag LOCUS_27990 gene nifB 3063 1486 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence352 2014 479 gene locus_tag LOCUS_28000 2014 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 2841 2362 gene locus_tag LOCUS_28010 2841 2362 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088271.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence353 111 629 gene locus_tag LOCUS_28020 111 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 696 1073 gene locus_tag LOCUS_28030 696 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1262 2086 gene locus_tag LOCUS_28040 1262 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2210 3061 gene locus_tag LOCUS_28050 2210 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence354 1483 14 gene locus_tag LOCUS_28060 gene guaB 1483 14 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387997.1 protein_id gnl|my_center|LOCUS_28060 2846 1986 gene locus_tag LOCUS_28070 2846 1986 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532288.1 protein_id gnl|my_center|LOCUS_28070 >Feature sequence355 917 1153 gene locus_tag LOCUS_28080 917 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28080 1187 1831 gene locus_tag LOCUS_28090 1187 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence356 2408 141 gene locus_tag LOCUS_28100 2408 141 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399174.1 protein_id gnl|my_center|LOCUS_28100 2494 2940 gene locus_tag LOCUS_28110 2494 2940 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388781.1 protein_id gnl|my_center|LOCUS_28110 >Feature sequence357 151 858 gene locus_tag LOCUS_28120 151 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 1774 2958 gene locus_tag LOCUS_28130 1774 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence358 111 1058 gene locus_tag LOCUS_28140 gene mak 111 1058 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219342.1 protein_id gnl|my_center|LOCUS_28140 1237 2355 gene locus_tag LOCUS_28150 1237 2355 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252179.1 protein_id gnl|my_center|LOCUS_28150 2608 2489 gene locus_tag LOCUS_28160 2608 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence359 820 86 gene locus_tag LOCUS_28170 820 86 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 protein_id gnl|my_center|LOCUS_28170 1703 813 gene locus_tag LOCUS_28180 1703 813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 protein_id gnl|my_center|LOCUS_28180 1878 1666 gene locus_tag LOCUS_28190 1878 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28190 2650 1937 gene locus_tag LOCUS_28200 2650 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28200 >Feature sequence360 641 1429 gene locus_tag LOCUS_28210 gene cysE 641 1429 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389782.1 protein_id gnl|my_center|LOCUS_28210 1602 2120 gene locus_tag LOCUS_28220 1602 2120 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence361 631 101 gene locus_tag LOCUS_28230 631 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 1939 2862 gene locus_tag LOCUS_28240 gene coxB 1939 2862 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886286.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence362 1933 341 gene locus_tag LOCUS_28250 1933 341 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390250.1 protein_id gnl|my_center|LOCUS_28250 <2883 2092 gene locus_tag LOCUS_28260 <2883 2092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022007.1:PAS domain-containing protein >Feature sequence363 414 857 gene locus_tag LOCUS_28270 414 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2089 875 gene locus_tag LOCUS_28280 2089 875 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence364 863 99 gene locus_tag LOCUS_28290 863 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 1255 2184 gene locus_tag LOCUS_28300 1255 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2309 2806 gene locus_tag LOCUS_28310 2309 2806 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388720.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence365 2489 90 gene locus_tag LOCUS_28320 2489 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence366 1315 425 gene locus_tag LOCUS_28330 1315 425 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812150.1 protein_id gnl|my_center|LOCUS_28330 2689 1328 gene locus_tag LOCUS_28340 2689 1328 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810594.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence367 37 783 gene locus_tag LOCUS_28350 37 783 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389880.1 protein_id gnl|my_center|LOCUS_28350 764 2167 gene locus_tag LOCUS_28360 764 2167 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence368 476 712 gene locus_tag LOCUS_28370 476 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 1582 956 gene locus_tag LOCUS_28380 1582 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1868 1596 gene locus_tag LOCUS_28390 gene rpsR 1868 1596 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615089.1 protein_id gnl|my_center|LOCUS_28390 2299 1868 gene locus_tag LOCUS_28400 2299 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence369 253 1137 gene locus_tag LOCUS_28410 253 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1643 1206 gene locus_tag LOCUS_28420 1643 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2217 2642 gene locus_tag LOCUS_28430 2217 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence370 366 43 gene locus_tag LOCUS_28440 366 43 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391219.1 protein_id gnl|my_center|LOCUS_28440 2572 578 gene locus_tag LOCUS_28450 2572 578 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391220.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence371 60 2675 gene locus_tag LOCUS_28460 60 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence372 1159 290 gene locus_tag LOCUS_28470 1159 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 2182 1199 gene locus_tag LOCUS_28480 2182 1199 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957843.1 protein_id gnl|my_center|LOCUS_28480 2639 2439 gene locus_tag LOCUS_28490 2639 2439 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence373 440 246 gene locus_tag LOCUS_28500 440 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1372 1692 gene locus_tag LOCUS_28510 1372 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1936 2613 gene locus_tag LOCUS_28520 1936 2613 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792222.1 protein_id gnl|my_center|LOCUS_28520 >Feature sequence374 393 1034 gene locus_tag LOCUS_28530 393 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 2424 1081 gene locus_tag LOCUS_28540 2424 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence375 2432 900 gene locus_tag LOCUS_28550 gene glpD 2432 900 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448129.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence376 808 17 gene locus_tag LOCUS_28560 808 17 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 protein_id gnl|my_center|LOCUS_28560 2513 906 gene locus_tag LOCUS_28570 2513 906 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389696.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence377 170 550 gene locus_tag LOCUS_28580 170 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2467 734 gene locus_tag LOCUS_28590 gene ggt 2467 734 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480939.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence378 361 1377 gene locus_tag LOCUS_28600 361 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 1714 2610 gene locus_tag LOCUS_28610 gene galU 1714 2610 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence379 141 659 gene locus_tag LOCUS_28620 141 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 663 1943 gene locus_tag LOCUS_28630 663 1943 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113810.1 protein_id gnl|my_center|LOCUS_28630 >Feature sequence380 265 2328 gene locus_tag LOCUS_28640 gene pabB 265 2328 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence381 1309 176 gene locus_tag LOCUS_28650 gene tgt 1309 176 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388033.1 protein_id gnl|my_center|LOCUS_28650 2432 1395 gene locus_tag LOCUS_28660 gene queA 2432 1395 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388034.1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence382 2174 87 gene locus_tag LOCUS_28670 gene shc 2174 87 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 protein_id gnl|my_center|LOCUS_28670