>Feature sequence001 1104 391 gene locus_tag LOCUS_00010 1104 391 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_00010 1412 1101 gene locus_tag LOCUS_00020 1412 1101 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406082.1 protein_id gnl|my_center|LOCUS_00020 1505 1948 gene locus_tag LOCUS_00030 1505 1948 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_00030 2117 1959 gene locus_tag LOCUS_00040 2117 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2147 2198 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2240 3946 gene locus_tag LOCUS_00050 gene typA 2240 3946 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_00050 4032 5006 gene locus_tag LOCUS_00060 gene mshB 4032 5006 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229758.1 protein_id gnl|my_center|LOCUS_00060 5003 5515 gene locus_tag LOCUS_00070 5003 5515 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035270.1 protein_id gnl|my_center|LOCUS_00070 5534 7210 gene locus_tag LOCUS_00080 5534 7210 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015435.1 protein_id gnl|my_center|LOCUS_00080 8204 7215 gene locus_tag LOCUS_00090 8204 7215 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030076.1 protein_id gnl|my_center|LOCUS_00090 8495 8634 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8700 9950 gene locus_tag LOCUS_00100 8700 9950 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_00100 10061 11356 gene locus_tag LOCUS_00110 10061 11356 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 protein_id gnl|my_center|LOCUS_00110 12372 11566 gene locus_tag LOCUS_00120 12372 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804736.1 protein_id gnl|my_center|LOCUS_00120 13333 12437 gene locus_tag LOCUS_00130 gene dapD 13333 12437 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222940.1 protein_id gnl|my_center|LOCUS_00130 13437 14534 gene locus_tag LOCUS_00140 gene dapE 13437 14534 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_00140 14544 15299 gene locus_tag LOCUS_00150 14544 15299 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973837.1 protein_id gnl|my_center|LOCUS_00150 16272 15382 gene locus_tag LOCUS_00160 gene folP 16272 15382 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_00160 16287 16634 gene locus_tag LOCUS_00170 16287 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 16649 17251 gene locus_tag LOCUS_00180 16649 17251 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222967.1 protein_id gnl|my_center|LOCUS_00180 18094 17252 gene locus_tag LOCUS_00190 18094 17252 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030081.1 protein_id gnl|my_center|LOCUS_00190 18320 18493 gene locus_tag LOCUS_00200 18320 18493 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406247.1 protein_id gnl|my_center|LOCUS_00200 19270 18638 gene locus_tag LOCUS_00210 19270 18638 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 protein_id gnl|my_center|LOCUS_00210 19269 20063 gene locus_tag LOCUS_00220 19269 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20097 21410 gene locus_tag LOCUS_00230 20097 21410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 21453 21827 gene locus_tag LOCUS_00240 21453 21827 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804744.1 protein_id gnl|my_center|LOCUS_00240 23026 21893 gene locus_tag LOCUS_00250 23026 21893 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_00250 23605 23036 gene locus_tag LOCUS_00260 23605 23036 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_00260 24875 23595 gene locus_tag LOCUS_00270 24875 23595 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_00270 25401 24895 gene locus_tag LOCUS_00280 25401 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973821.1 protein_id gnl|my_center|LOCUS_00280 25502 26482 gene locus_tag LOCUS_00290 25502 26482 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_00290 26885 26583 gene locus_tag LOCUS_00300 26885 26583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 27231 28430 gene locus_tag LOCUS_00310 27231 28430 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_00310 28480 29001 gene locus_tag LOCUS_00320 28480 29001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 30581 29055 gene locus_tag LOCUS_00330 30581 29055 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930178.1 protein_id gnl|my_center|LOCUS_00330 30678 32093 gene locus_tag LOCUS_00340 30678 32093 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230391.1 protein_id gnl|my_center|LOCUS_00340 32162 32689 gene locus_tag LOCUS_00350 32162 32689 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030945.1 protein_id gnl|my_center|LOCUS_00350 32737 33582 gene locus_tag LOCUS_00360 32737 33582 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804749.1 protein_id gnl|my_center|LOCUS_00360 33579 34031 gene locus_tag LOCUS_00370 33579 34031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 34041 34901 gene locus_tag LOCUS_00380 34041 34901 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286316.1 protein_id gnl|my_center|LOCUS_00380 34943 35701 gene locus_tag LOCUS_00390 34943 35701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_00390 35694 36401 gene locus_tag LOCUS_00400 35694 36401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552530.1 protein_id gnl|my_center|LOCUS_00400 36501 37739 gene locus_tag LOCUS_00410 36501 37739 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931548.1 protein_id gnl|my_center|LOCUS_00410 37840 38709 gene locus_tag LOCUS_00420 37840 38709 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 protein_id gnl|my_center|LOCUS_00420 38706 39767 gene locus_tag LOCUS_00430 38706 39767 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243001.1 protein_id gnl|my_center|LOCUS_00430 41744 39777 gene locus_tag LOCUS_00440 41744 39777 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227746.1 protein_id gnl|my_center|LOCUS_00440 42573 41800 gene locus_tag LOCUS_00450 42573 41800 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027518.1 protein_id gnl|my_center|LOCUS_00450 42775 43545 gene locus_tag LOCUS_00460 42775 43545 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098387.1 protein_id gnl|my_center|LOCUS_00460 45193 43592 gene locus_tag LOCUS_00470 45193 43592 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804750.1 protein_id gnl|my_center|LOCUS_00470 45380 46141 gene locus_tag LOCUS_00480 45380 46141 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_00480 46402 46178 gene locus_tag LOCUS_00490 46402 46178 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907944.1 protein_id gnl|my_center|LOCUS_00490 47225 46557 gene locus_tag LOCUS_00500 47225 46557 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_00500 47326 48600 gene locus_tag LOCUS_00510 gene moeZ 47326 48600 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_00510 48604 48972 gene locus_tag LOCUS_00520 48604 48972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 49167 49370 gene locus_tag LOCUS_00530 49167 49370 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_00530 49603 52884 gene locus_tag LOCUS_00540 49603 52884 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_00540 52884 56378 gene locus_tag LOCUS_00550 52884 56378 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223039.1 protein_id gnl|my_center|LOCUS_00550 56417 56467 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57389 56502 gene locus_tag LOCUS_00560 57389 56502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 57450 57629 gene locus_tag LOCUS_00570 57450 57629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 57647 58543 gene locus_tag LOCUS_00580 gene nudC 57647 58543 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_00580 58543 59076 gene locus_tag LOCUS_00590 58543 59076 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406060.1 protein_id gnl|my_center|LOCUS_00590 59374 59111 gene locus_tag LOCUS_00600 59374 59111 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_00600 59482 61707 gene locus_tag LOCUS_00610 59482 61707 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_00610 61851 62147 gene locus_tag LOCUS_00620 61851 62147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 62168 62311 gene locus_tag LOCUS_00630 62168 62311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 62710 64260 gene locus_tag LOCUS_00640 62710 64260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 64293 64449 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66300 64975 gene locus_tag LOCUS_00650 66300 64975 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_00650 67319 66297 gene locus_tag LOCUS_00660 67319 66297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 67694 67521 gene locus_tag LOCUS_00670 67694 67521 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_00670 67782 68663 gene locus_tag LOCUS_00680 67782 68663 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505733.1 protein_id gnl|my_center|LOCUS_00680 68856 69428 gene locus_tag LOCUS_00690 68856 69428 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_00690 70934 69489 gene locus_tag LOCUS_00700 70934 69489 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_00700 70989 72053 gene locus_tag LOCUS_00710 70989 72053 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_00710 72056 72517 gene locus_tag LOCUS_00720 72056 72517 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_00720 72499 73608 gene locus_tag LOCUS_00730 72499 73608 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_00730 73634 73709 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 74274 73744 gene locus_tag LOCUS_00740 74274 73744 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526720.1 protein_id gnl|my_center|LOCUS_00740 74342 77491 gene locus_tag LOCUS_00750 74342 77491 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_00750 77565 77641 gene locus_tag LOCUS_t00010 77565 77641 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 78458 77976 gene locus_tag LOCUS_00760 78458 77976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 79257 78538 gene locus_tag LOCUS_00770 79257 78538 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031453.1 protein_id gnl|my_center|LOCUS_00770 79844 79296 gene locus_tag LOCUS_00780 79844 79296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 79917 80459 gene locus_tag LOCUS_00790 79917 80459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 >Feature sequence002 <1 717 gene locus_tag LOCUS_00800 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224732.1:ABC transporter ATP-binding protein 1549 680 gene locus_tag LOCUS_00810 1549 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 1635 2618 gene locus_tag LOCUS_00820 gene moaA 1635 2618 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_00820 2904 2659 gene locus_tag LOCUS_00830 2904 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 3242 2901 gene locus_tag LOCUS_00840 3242 2901 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486044.1 protein_id gnl|my_center|LOCUS_00840 3372 4085 gene locus_tag LOCUS_00850 gene fabG 3372 4085 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_00850 4152 4907 gene locus_tag LOCUS_00860 gene fabI 4152 4907 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_00860 4995 7172 gene locus_tag LOCUS_00870 4995 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 9788 7191 gene locus_tag LOCUS_00880 gene cphA 9788 7191 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207603497.1 protein_id gnl|my_center|LOCUS_00880 10944 10039 gene locus_tag LOCUS_00890 10944 10039 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_00890 12184 10961 gene locus_tag LOCUS_00900 gene serB 12184 10961 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_00900 12856 12194 gene locus_tag LOCUS_00910 12856 12194 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224195.1 protein_id gnl|my_center|LOCUS_00910 14271 13018 gene locus_tag LOCUS_00920 gene glgC 14271 13018 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 protein_id gnl|my_center|LOCUS_00920 14326 15534 gene locus_tag LOCUS_00930 gene glgA 14326 15534 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_00930 16319 15513 gene locus_tag LOCUS_00940 16319 15513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 16352 17185 gene locus_tag LOCUS_00950 16352 17185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_00950 17205 17672 gene locus_tag LOCUS_00960 17205 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 18213 18330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18337 18714 gene locus_tag LOCUS_00970 18337 18714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 18761 19522 gene locus_tag LOCUS_00980 18761 19522 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729298.1 protein_id gnl|my_center|LOCUS_00980 19554 20423 gene locus_tag LOCUS_00990 19554 20423 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930212.1 protein_id gnl|my_center|LOCUS_00990 20441 21199 gene locus_tag LOCUS_01000 20441 21199 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977745.1 protein_id gnl|my_center|LOCUS_01000 21206 22939 gene locus_tag LOCUS_01010 21206 22939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_01010 22996 24942 gene locus_tag LOCUS_01020 22996 24942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_01020 25011 27155 gene locus_tag LOCUS_01030 25011 27155 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030473.1 protein_id gnl|my_center|LOCUS_01030 27985 27164 gene locus_tag LOCUS_01040 gene phaZ 27985 27164 CDS product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739559.1 protein_id gnl|my_center|LOCUS_01040 29703 27982 gene locus_tag LOCUS_01050 gene phaC 29703 27982 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389569.1 protein_id gnl|my_center|LOCUS_01050 30130 29741 gene locus_tag LOCUS_01060 30130 29741 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062114.1 protein_id gnl|my_center|LOCUS_01060 30504 30172 gene locus_tag LOCUS_01070 30504 30172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 31447 30611 gene locus_tag LOCUS_01080 gene fabG 31447 30611 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257346.1 protein_id gnl|my_center|LOCUS_01080 31950 33905 gene locus_tag LOCUS_01090 31950 33905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 36359 33960 gene locus_tag LOCUS_01100 36359 33960 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030101.1 protein_id gnl|my_center|LOCUS_01100 41975 36474 gene locus_tag LOCUS_01110 41975 36474 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_01110 42235 42062 gene locus_tag LOCUS_01120 42235 42062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 43235 42312 gene locus_tag LOCUS_01130 43235 42312 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029384.1 protein_id gnl|my_center|LOCUS_01130 44032 43334 gene locus_tag LOCUS_01140 44032 43334 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_01140 44272 44730 gene locus_tag LOCUS_01150 44272 44730 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223540.1 protein_id gnl|my_center|LOCUS_01150 44769 45329 gene locus_tag LOCUS_01160 44769 45329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 46018 46380 gene locus_tag LOCUS_01170 46018 46380 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_01170 46390 46812 gene locus_tag LOCUS_01180 46390 46812 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227562.1 protein_id gnl|my_center|LOCUS_01180 47267 46761 gene locus_tag LOCUS_01190 47267 46761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 48142 47264 gene locus_tag LOCUS_01200 gene qqlR 48142 47264 CDS product N-acyl homoserine lactonase QqlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886818.1 protein_id gnl|my_center|LOCUS_01200 48326 48700 gene locus_tag LOCUS_01210 48326 48700 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_01210 48697 49131 gene locus_tag LOCUS_01220 48697 49131 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_01220 49174 49953 gene locus_tag LOCUS_01230 49174 49953 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222671.1 protein_id gnl|my_center|LOCUS_01230 50037 50483 gene locus_tag LOCUS_01240 gene arsD 50037 50483 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540111.1 protein_id gnl|my_center|LOCUS_01240 50712 51509 gene locus_tag LOCUS_01250 50712 51509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 51569 51970 gene locus_tag LOCUS_01260 51569 51970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01260 51952 52152 gene locus_tag LOCUS_01270 51952 52152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 53905 52220 gene locus_tag LOCUS_01280 53905 52220 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776880.1 protein_id gnl|my_center|LOCUS_01280 55186 54128 gene locus_tag LOCUS_01290 55186 54128 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_01290 55914 55183 gene locus_tag LOCUS_01300 55914 55183 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466681.1 protein_id gnl|my_center|LOCUS_01300 55995 56483 gene locus_tag LOCUS_01310 gene soxR 55995 56483 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820813.1 protein_id gnl|my_center|LOCUS_01310 57228 56518 gene locus_tag LOCUS_01320 57228 56518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 58025 57279 gene locus_tag LOCUS_01330 gene ureG 58025 57279 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803979.1 protein_id gnl|my_center|LOCUS_01330 58719 58018 gene locus_tag LOCUS_01340 58719 58018 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729212.1 protein_id gnl|my_center|LOCUS_01340 60428 58725 gene locus_tag LOCUS_01350 60428 58725 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230175.1 protein_id gnl|my_center|LOCUS_01350 60762 60421 gene locus_tag LOCUS_01360 60762 60421 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729213.1 protein_id gnl|my_center|LOCUS_01360 61087 60785 gene locus_tag LOCUS_01370 61087 60785 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862556.1 protein_id gnl|my_center|LOCUS_01370 61733 61089 gene locus_tag LOCUS_01380 gene urtE 61733 61089 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894358.1 protein_id gnl|my_center|LOCUS_01380 62578 61781 gene locus_tag LOCUS_01390 gene urtD 62578 61781 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894359.1 protein_id gnl|my_center|LOCUS_01390 63699 62575 gene locus_tag LOCUS_01400 gene urtC 63699 62575 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728737.1 protein_id gnl|my_center|LOCUS_01400 64580 63696 gene locus_tag LOCUS_01410 gene urtB 64580 63696 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 protein_id gnl|my_center|LOCUS_01410 65833 64583 gene locus_tag LOCUS_01420 gene urtA 65833 64583 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860043.1 protein_id gnl|my_center|LOCUS_01420 66518 67042 gene locus_tag LOCUS_01430 66518 67042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 67130 67327 gene locus_tag LOCUS_01440 67130 67327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 67347 67580 gene locus_tag LOCUS_01450 67347 67580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 67644 68807 gene locus_tag LOCUS_01460 67644 68807 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_01460 69157 70890 gene locus_tag LOCUS_01470 69157 70890 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209441393.1 protein_id gnl|my_center|LOCUS_01470 71266 70892 gene locus_tag LOCUS_01480 71266 70892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_01480 71487 71729 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence003 1368 649 gene locus_tag LOCUS_01490 1368 649 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_01490 1919 1365 gene locus_tag LOCUS_01500 1919 1365 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061196.1 protein_id gnl|my_center|LOCUS_01500 2099 2171 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3950 2535 gene locus_tag LOCUS_01510 3950 2535 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_01510 4818 4093 gene locus_tag LOCUS_01520 4818 4093 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_01520 4972 6213 gene locus_tag LOCUS_01530 4972 6213 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_01530 6563 7021 gene locus_tag LOCUS_01540 6563 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01540 7867 7241 gene locus_tag LOCUS_01550 7867 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 8550 9809 gene locus_tag LOCUS_01560 8550 9809 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028461.1 protein_id gnl|my_center|LOCUS_01560 11569 9806 gene locus_tag LOCUS_01570 gene menD 11569 9806 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_01570 12478 11648 gene locus_tag LOCUS_01580 gene rbsK 12478 11648 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_01580 13464 12478 gene locus_tag LOCUS_01590 13464 12478 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975162.1 protein_id gnl|my_center|LOCUS_01590 14507 13461 gene locus_tag LOCUS_01600 gene tsaD 14507 13461 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_01600 14986 14504 gene locus_tag LOCUS_01610 gene rimI 14986 14504 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_01610 15660 14983 gene locus_tag LOCUS_01620 gene tsaB 15660 14983 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_01620 16195 15665 gene locus_tag LOCUS_01630 16195 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 17369 16185 gene locus_tag LOCUS_01640 17369 16185 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_01640 18568 17366 gene locus_tag LOCUS_01650 gene alr 18568 17366 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_01650 20095 18581 gene locus_tag LOCUS_01660 20095 18581 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_01660 20453 20103 gene locus_tag LOCUS_01670 20453 20103 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_01670 22249 20450 gene locus_tag LOCUS_01680 gene glmS 22249 20450 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776318.1 protein_id gnl|my_center|LOCUS_01680 22375 23331 gene locus_tag LOCUS_01690 gene coaA 22375 23331 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776319.1 protein_id gnl|my_center|LOCUS_01690 23428 24795 gene locus_tag LOCUS_01700 23428 24795 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_01700 25604 24798 gene locus_tag LOCUS_01710 25604 24798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 26968 25892 gene locus_tag LOCUS_01720 26968 25892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 28017 27256 gene locus_tag LOCUS_01730 28017 27256 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_01730 28147 28872 gene locus_tag LOCUS_01740 28147 28872 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_01740 29317 28919 gene locus_tag LOCUS_01750 29317 28919 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 protein_id gnl|my_center|LOCUS_01750 29570 29364 gene locus_tag LOCUS_01760 29570 29364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 30526 29567 gene locus_tag LOCUS_01770 gene mca 30526 29567 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_01770 30044 30081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30619 31041 gene locus_tag LOCUS_01780 30619 31041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 31208 31702 gene locus_tag LOCUS_01790 gene greA 31208 31702 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_01790 32175 31738 gene locus_tag LOCUS_01800 32175 31738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 32186 32207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33414 32437 gene locus_tag LOCUS_01810 33414 32437 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_01810 34729 33497 gene locus_tag LOCUS_01820 gene ilvA 34729 33497 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_01820 36117 34822 gene locus_tag LOCUS_01830 36117 34822 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_01830 37112 36078 gene locus_tag LOCUS_01840 37112 36078 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405541.1 protein_id gnl|my_center|LOCUS_01840 37249 37947 gene locus_tag LOCUS_01850 gene msrA 37249 37947 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_01850 37961 39154 gene locus_tag LOCUS_01860 37961 39154 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776338.1 protein_id gnl|my_center|LOCUS_01860 40553 39159 gene locus_tag LOCUS_01870 40553 39159 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084259.1 protein_id gnl|my_center|LOCUS_01870 40708 41862 gene locus_tag LOCUS_01880 40708 41862 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_01880 41960 43183 gene locus_tag LOCUS_01890 41960 43183 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_01890 43383 43503 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44575 43718 gene locus_tag LOCUS_01900 44575 43718 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405719.1 protein_id gnl|my_center|LOCUS_01900 44734 44661 gene locus_tag LOCUS_t00020 44734 44661 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45266 44745 gene locus_tag LOCUS_01910 gene def 45266 44745 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_01910 45822 45298 gene locus_tag LOCUS_01920 45822 45298 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_01920 46673 45843 gene locus_tag LOCUS_01930 46673 45843 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730268.1 protein_id gnl|my_center|LOCUS_01930 47517 46675 gene locus_tag LOCUS_01940 47517 46675 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_01940 47596 47792 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48624 48217 gene locus_tag LOCUS_01950 48624 48217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 49067 48807 gene locus_tag LOCUS_01960 49067 48807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 49118 49234 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51167 50172 gene locus_tag LOCUS_01970 51167 50172 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_01970 51721 51164 gene locus_tag LOCUS_01980 51721 51164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 55446 51826 gene locus_tag LOCUS_01990 gene mfd 55446 51826 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_01990 56196 55597 gene locus_tag LOCUS_02000 gene pth 56196 55597 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_02000 56988 56329 gene locus_tag LOCUS_02010 56988 56329 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405254.1 protein_id gnl|my_center|LOCUS_02010 58318 57317 gene locus_tag LOCUS_02020 58318 57317 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804951.1 protein_id gnl|my_center|LOCUS_02020 57587 57623 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59584 58394 gene locus_tag LOCUS_02030 59584 58394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 58593 58631 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59816 59735 gene locus_tag LOCUS_t00030 59816 59735 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 59955 60953 gene locus_tag LOCUS_02040 59955 60953 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_02040 60994 61647 gene locus_tag LOCUS_02050 60994 61647 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_02050 62308 61652 gene locus_tag LOCUS_02060 62308 61652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 62633 62325 gene locus_tag LOCUS_02070 62633 62325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 62810 63310 gene locus_tag LOCUS_02080 gene tamR 62810 63310 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_02080 65268 63436 gene locus_tag LOCUS_02090 65268 63436 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_02090 66293 65274 gene locus_tag LOCUS_02100 66293 65274 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045756603.1 protein_id gnl|my_center|LOCUS_02100 67162 66290 gene locus_tag LOCUS_02110 gene rsmA 67162 66290 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_02110 68322 67186 gene locus_tag LOCUS_02120 68322 67186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 69679 68570 gene locus_tag LOCUS_02130 69679 68570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence004 863 366 gene locus_tag LOCUS_02140 863 366 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467800.1 protein_id gnl|my_center|LOCUS_02140 1713 895 gene locus_tag LOCUS_02150 1713 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 3463 2081 gene locus_tag LOCUS_02160 3463 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 3580 3858 gene locus_tag LOCUS_02170 3580 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 3768 4490 gene locus_tag LOCUS_02180 3768 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 5876 4512 gene locus_tag LOCUS_02190 5876 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 7416 6619 gene locus_tag LOCUS_02200 7416 6619 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804816.1 protein_id gnl|my_center|LOCUS_02200 7564 9378 gene locus_tag LOCUS_02210 7564 9378 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731564.1 protein_id gnl|my_center|LOCUS_02210 9384 10115 gene locus_tag LOCUS_02220 9384 10115 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 protein_id gnl|my_center|LOCUS_02220 10112 11662 gene locus_tag LOCUS_02230 10112 11662 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_02230 11659 12315 gene locus_tag LOCUS_02240 11659 12315 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888544.1 protein_id gnl|my_center|LOCUS_02240 12429 13688 gene locus_tag LOCUS_02250 gene egtA 12429 13688 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226794.1 protein_id gnl|my_center|LOCUS_02250 13685 15025 gene locus_tag LOCUS_02260 gene egtB 13685 15025 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_02260 15029 15859 gene locus_tag LOCUS_02270 gene egtC 15029 15859 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226792.1 protein_id gnl|my_center|LOCUS_02270 15856 16827 gene locus_tag LOCUS_02280 gene egtD 15856 16827 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 protein_id gnl|my_center|LOCUS_02280 16994 17064 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17204 17707 gene locus_tag LOCUS_02290 17204 17707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 17738 20029 gene locus_tag LOCUS_02300 17738 20029 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_02300 20147 21394 gene locus_tag LOCUS_02310 gene rocD 20147 21394 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112056.1 protein_id gnl|my_center|LOCUS_02310 21750 22496 gene locus_tag LOCUS_02320 21750 22496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 22596 23666 gene locus_tag LOCUS_02330 22596 23666 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028280.1 protein_id gnl|my_center|LOCUS_02330 23663 25279 gene locus_tag LOCUS_02340 23663 25279 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028281.1 protein_id gnl|my_center|LOCUS_02340 25276 26106 gene locus_tag LOCUS_02350 25276 26106 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_02350 26135 26554 gene locus_tag LOCUS_02360 26135 26554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 26555 27364 gene locus_tag LOCUS_02370 26555 27364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224225.1 protein_id gnl|my_center|LOCUS_02370 27361 29313 gene locus_tag LOCUS_02380 27361 29313 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_02380 29310 30065 gene locus_tag LOCUS_02390 29310 30065 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973872.1 protein_id gnl|my_center|LOCUS_02390 30211 31473 gene locus_tag LOCUS_02400 30211 31473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 31537 32613 gene locus_tag LOCUS_02410 31537 32613 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_02410 32610 33515 gene locus_tag LOCUS_02420 32610 33515 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_02420 33512 33982 gene locus_tag LOCUS_02430 33512 33982 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728698.1 protein_id gnl|my_center|LOCUS_02430 34066 34142 gene locus_tag LOCUS_t00040 34066 34142 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 34187 34564 gene locus_tag LOCUS_02440 34187 34564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 34551 36686 gene locus_tag LOCUS_02450 gene thrS 34551 36686 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804992.1 protein_id gnl|my_center|LOCUS_02450 36698 37453 gene locus_tag LOCUS_02460 36698 37453 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_02460 37478 38044 gene locus_tag LOCUS_02470 37478 38044 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804993.1 protein_id gnl|my_center|LOCUS_02470 38057 38482 gene locus_tag LOCUS_02480 38057 38482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 40613 38508 gene locus_tag LOCUS_02490 40613 38508 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400860.1 protein_id gnl|my_center|LOCUS_02490 40682 41293 gene locus_tag LOCUS_02500 40682 41293 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_02500 41410 42297 gene locus_tag LOCUS_02510 41410 42297 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_02510 42294 43484 gene locus_tag LOCUS_02520 42294 43484 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_02520 43484 44035 gene locus_tag LOCUS_02530 43484 44035 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_02530 44052 45014 gene locus_tag LOCUS_02540 gene pdxS 44052 45014 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_02540 45176 45805 gene locus_tag LOCUS_02550 gene pdxT 45176 45805 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_02550 45905 46663 gene locus_tag LOCUS_02560 45905 46663 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_02560 47362 47472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47599 48117 gene locus_tag LOCUS_02570 47599 48117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 48114 49277 gene locus_tag LOCUS_02580 gene ruvB 48114 49277 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_02580 49446 49811 gene locus_tag LOCUS_02590 49446 49811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 49821 51617 gene locus_tag LOCUS_02600 gene secD 49821 51617 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_02600 51614 52780 gene locus_tag LOCUS_02610 gene secF 51614 52780 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805001.1 protein_id gnl|my_center|LOCUS_02610 52780 53367 gene locus_tag LOCUS_02620 52780 53367 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_02620 53386 54063 gene locus_tag LOCUS_02630 53386 54063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02630 54002 54220 gene locus_tag LOCUS_02640 54002 54220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02640 54332 54565 gene locus_tag LOCUS_02650 54332 54565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02650 54751 55776 gene locus_tag LOCUS_02660 54751 55776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02660 57239 55773 gene locus_tag LOCUS_02670 57239 55773 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_02670 58042 57242 gene locus_tag LOCUS_02680 58042 57242 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977316.1 protein_id gnl|my_center|LOCUS_02680 58181 58885 gene locus_tag LOCUS_02690 58181 58885 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_02690 58882 60228 gene locus_tag LOCUS_02700 gene hisS 58882 60228 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_02700 60413 61528 gene locus_tag LOCUS_02710 gene ald 60413 61528 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_02710 61542 62465 gene locus_tag LOCUS_02720 gene xerD 61542 62465 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_02720 62553 63548 gene locus_tag LOCUS_02730 62553 63548 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805130.1 protein_id gnl|my_center|LOCUS_02730 63554 64564 gene locus_tag LOCUS_02740 63554 64564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 64803 65020 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65242 66165 gene locus_tag LOCUS_02750 65242 66165 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408439.1 protein_id gnl|my_center|LOCUS_02750 66218 66589 gene locus_tag LOCUS_02760 gene aroH 66218 66589 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_02760 66586 67698 gene locus_tag LOCUS_02770 66586 67698 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805132.1 protein_id gnl|my_center|LOCUS_02770 <68352 67750 gene locus_tag LOCUS_02780 <68352 67750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272333.1:peptidoglycan-binding protein >Feature sequence005 273 908 gene locus_tag LOCUS_02790 273 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02790 955 4221 gene locus_tag LOCUS_02800 gene hrpA 955 4221 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02800 4139 4196 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4977 4279 gene locus_tag LOCUS_02810 4977 4279 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776667.1 protein_id gnl|my_center|LOCUS_02810 6714 5050 gene locus_tag LOCUS_02820 6714 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 7073 7378 gene locus_tag LOCUS_02830 7073 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 8490 9029 gene locus_tag LOCUS_02840 8490 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02840 10889 9147 gene locus_tag LOCUS_02850 10889 9147 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930206.1 protein_id gnl|my_center|LOCUS_02850 11433 10882 gene locus_tag LOCUS_02860 11433 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 11847 12467 gene locus_tag LOCUS_02870 11847 12467 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328048.1 protein_id gnl|my_center|LOCUS_02870 12661 13560 gene locus_tag LOCUS_02880 12661 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 15267 13654 gene locus_tag LOCUS_02890 15267 13654 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027650.1 protein_id gnl|my_center|LOCUS_02890 15346 16074 gene locus_tag LOCUS_02900 15346 16074 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775745.1 protein_id gnl|my_center|LOCUS_02900 16124 16492 gene locus_tag LOCUS_02910 16124 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 16630 17697 gene locus_tag LOCUS_02920 16630 17697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 18110 19180 gene locus_tag LOCUS_02930 18110 19180 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_02930 19258 19665 gene locus_tag LOCUS_02940 19258 19665 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 protein_id gnl|my_center|LOCUS_02940 19941 21686 gene locus_tag LOCUS_02950 19941 21686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 23294 21834 gene locus_tag LOCUS_02960 23294 21834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 24292 23288 gene locus_tag LOCUS_02970 24292 23288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 27115 24695 gene locus_tag LOCUS_02980 27115 24695 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_02980 28377 27112 gene locus_tag LOCUS_02990 28377 27112 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_02990 29512 28490 gene locus_tag LOCUS_03000 29512 28490 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_03000 29793 30242 gene locus_tag LOCUS_03010 gene mraZ 29793 30242 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_03010 30460 31497 gene locus_tag LOCUS_03020 gene rsmH 30460 31497 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_03020 31494 32120 gene locus_tag LOCUS_03030 31494 32120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 32467 34254 gene locus_tag LOCUS_03040 gene ftsI 32467 34254 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_03040 34276 35985 gene locus_tag LOCUS_03050 34276 35985 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_03050 35982 37391 gene locus_tag LOCUS_03060 35982 37391 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_03060 37388 38470 gene locus_tag LOCUS_03070 gene mraY 37388 38470 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_03070 38478 39995 gene locus_tag LOCUS_03080 gene murD 38478 39995 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_03080 40097 41284 gene locus_tag LOCUS_03090 gene ftsW 40097 41284 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804701.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03090 41281 42393 gene locus_tag LOCUS_03100 gene murG 41281 42393 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_03100 42668 42438 gene locus_tag LOCUS_03110 42668 42438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 42549 43991 gene locus_tag LOCUS_03120 gene murC 42549 43991 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_03120 44126 44767 gene locus_tag LOCUS_03130 44126 44767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 44958 46238 gene locus_tag LOCUS_03140 gene ftsZ 44958 46238 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_03140 46530 47273 gene locus_tag LOCUS_03150 gene pgeF 46530 47273 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_03150 47270 48001 gene locus_tag LOCUS_03160 47270 48001 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_03160 48127 48618 gene locus_tag LOCUS_03170 gene sepF 48127 48618 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_03170 48667 48960 gene locus_tag LOCUS_03180 48667 48960 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054068.1 protein_id gnl|my_center|LOCUS_03180 49051 50064 gene locus_tag LOCUS_03190 49051 50064 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080209.1 protein_id gnl|my_center|LOCUS_03190 50372 51034 gene locus_tag LOCUS_03200 50372 51034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 51103 51696 gene locus_tag LOCUS_03210 gene lspA 51103 51696 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495573.1 protein_id gnl|my_center|LOCUS_03210 51689 52618 gene locus_tag LOCUS_03220 51689 52618 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_03220 54427 54642 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54676 56343 gene locus_tag LOCUS_03230 54676 56343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 56474 58609 gene locus_tag LOCUS_03240 56474 58609 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803998.1 protein_id gnl|my_center|LOCUS_03240 58786 59058 gene locus_tag LOCUS_03250 58786 59058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 >Feature sequence006 3164 1830 gene locus_tag LOCUS_03260 3164 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 4618 3161 gene locus_tag LOCUS_03270 4618 3161 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_03270 5997 4615 gene locus_tag LOCUS_03280 5997 4615 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_03280 7280 5994 gene locus_tag LOCUS_03290 7280 5994 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 protein_id gnl|my_center|LOCUS_03290 7824 7288 gene locus_tag LOCUS_03300 gene fhaB 7824 7288 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_03300 8596 7811 gene locus_tag LOCUS_03310 gene fhaA 8596 7811 CDS product antibiotic biosynthesis regulator FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975091.1 protein_id gnl|my_center|LOCUS_03310 8762 8890 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9007 10188 gene locus_tag LOCUS_03320 9007 10188 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 protein_id gnl|my_center|LOCUS_03320 10617 10327 gene locus_tag LOCUS_03330 10617 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 11217 10654 gene locus_tag LOCUS_03340 11217 10654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03340 11804 11226 gene locus_tag LOCUS_03350 11804 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 13103 11943 gene locus_tag LOCUS_03360 13103 11943 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_03360 14222 13104 gene locus_tag LOCUS_03370 14222 13104 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_03370 15448 14354 gene locus_tag LOCUS_03380 15448 14354 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976251.1 protein_id gnl|my_center|LOCUS_03380 15512 16561 gene locus_tag LOCUS_03390 15512 16561 CDS product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014988.1 protein_id gnl|my_center|LOCUS_03390 18033 16633 gene locus_tag LOCUS_03400 18033 16633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_03400 18203 19063 gene locus_tag LOCUS_03410 18203 19063 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_03410 19273 20490 gene locus_tag LOCUS_03420 19273 20490 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_03420 20535 21053 gene locus_tag LOCUS_03430 20535 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 21250 22806 gene locus_tag LOCUS_03440 21250 22806 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223445.1 protein_id gnl|my_center|LOCUS_03440 23876 22809 gene locus_tag LOCUS_03450 23876 22809 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908874.1 protein_id gnl|my_center|LOCUS_03450 24589 23930 gene locus_tag LOCUS_03460 24589 23930 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729729.1 protein_id gnl|my_center|LOCUS_03460 25091 24591 gene locus_tag LOCUS_03470 25091 24591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 25256 26068 gene locus_tag LOCUS_03480 25256 26068 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_03480 26136 26543 gene locus_tag LOCUS_03490 26136 26543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 26592 27500 gene locus_tag LOCUS_03500 26592 27500 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_03500 27512 28366 gene locus_tag LOCUS_03510 27512 28366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 28389 29981 gene locus_tag LOCUS_03520 28389 29981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 32022 29905 gene locus_tag LOCUS_03530 32022 29905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804311.1 protein_id gnl|my_center|LOCUS_03530 32794 32177 gene locus_tag LOCUS_03540 32794 32177 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222112.1 protein_id gnl|my_center|LOCUS_03540 32946 33491 gene locus_tag LOCUS_03550 32946 33491 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208613322.1 protein_id gnl|my_center|LOCUS_03550 33641 34579 gene locus_tag LOCUS_03560 gene pheA 33641 34579 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_03560 35135 34686 gene locus_tag LOCUS_03570 35135 34686 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027835.1 protein_id gnl|my_center|LOCUS_03570 36239 35139 gene locus_tag LOCUS_03580 36239 35139 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_03580 36369 37649 gene locus_tag LOCUS_03590 gene serS 36369 37649 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831496.1 protein_id gnl|my_center|LOCUS_03590 37657 38463 gene locus_tag LOCUS_03600 37657 38463 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_03600 39622 38444 gene locus_tag LOCUS_03610 gene cobC 39622 38444 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228814.1 protein_id gnl|my_center|LOCUS_03610 40667 39570 gene locus_tag LOCUS_03620 40667 39570 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028014.1 protein_id gnl|my_center|LOCUS_03620 41302 40664 gene locus_tag LOCUS_03630 41302 40664 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_03630 42384 41299 gene locus_tag LOCUS_03640 42384 41299 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467826.1 protein_id gnl|my_center|LOCUS_03640 42728 42381 gene locus_tag LOCUS_03650 42728 42381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 44323 42662 gene locus_tag LOCUS_03660 gene cobJ 44323 42662 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483898.1 protein_id gnl|my_center|LOCUS_03660 45675 44371 gene locus_tag LOCUS_03670 45675 44371 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868658.1 protein_id gnl|my_center|LOCUS_03670 46913 45708 gene locus_tag LOCUS_03680 46913 45708 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145958.1 protein_id gnl|my_center|LOCUS_03680 47806 46910 gene locus_tag LOCUS_03690 gene cobM 47806 46910 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976965.1 protein_id gnl|my_center|LOCUS_03690 48534 47803 gene locus_tag LOCUS_03700 gene cobI 48534 47803 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028010.1 protein_id gnl|my_center|LOCUS_03700 49931 48531 gene locus_tag LOCUS_03710 49931 48531 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228815.1 protein_id gnl|my_center|LOCUS_03710 50539 49925 gene locus_tag LOCUS_03720 gene cobO 50539 49925 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228816.1 protein_id gnl|my_center|LOCUS_03720 52794 50539 gene locus_tag LOCUS_03730 52794 50539 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976970.1 protein_id gnl|my_center|LOCUS_03730 53160 53582 gene locus_tag LOCUS_03740 53160 53582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 54304 56115 gene locus_tag LOCUS_03750 54304 56115 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228230.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03750 56016 56381 gene locus_tag LOCUS_03760 56016 56381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03760 57564 56389 gene locus_tag LOCUS_03770 57564 56389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965136.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence007 6476 3030 gene locus_tag LOCUS_03780 6476 3030 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_03780 6949 6584 gene locus_tag LOCUS_03790 6949 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053174.1 protein_id gnl|my_center|LOCUS_03790 7448 7107 gene locus_tag LOCUS_03800 7448 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 7969 7511 gene locus_tag LOCUS_03810 7969 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 8762 7959 gene locus_tag LOCUS_03820 8762 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 10392 9235 gene locus_tag LOCUS_03830 10392 9235 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022386.1 protein_id gnl|my_center|LOCUS_03830 12047 10389 gene locus_tag LOCUS_03840 12047 10389 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_03840 12403 12104 gene locus_tag LOCUS_03850 12403 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 12377 12452 gene locus_tag LOCUS_t00050 12377 12452 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13117 12572 gene locus_tag LOCUS_03860 13117 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 13083 13316 gene locus_tag LOCUS_03870 13083 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 14382 13684 gene locus_tag LOCUS_03880 14382 13684 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_03880 14474 15169 gene locus_tag LOCUS_03890 14474 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_03890 15226 15879 gene locus_tag LOCUS_03900 15226 15879 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015571.1 protein_id gnl|my_center|LOCUS_03900 16853 16173 gene locus_tag LOCUS_03910 gene pdxH 16853 16173 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_03910 16901 17278 gene locus_tag LOCUS_03920 16901 17278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 17391 18494 gene locus_tag LOCUS_03930 17391 18494 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_03930 18627 19772 gene locus_tag LOCUS_03940 gene serC 18627 19772 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_03940 20792 19815 gene locus_tag LOCUS_03950 20792 19815 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_03950 20883 20930 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21196 22716 gene locus_tag LOCUS_03960 21196 22716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 22416 22481 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24208 22922 gene locus_tag LOCUS_03970 24208 22922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_03970 24576 24205 gene locus_tag LOCUS_03980 24576 24205 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908731.1 protein_id gnl|my_center|LOCUS_03980 25442 24774 gene locus_tag LOCUS_03990 25442 24774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 26271 25435 gene locus_tag LOCUS_04000 26271 25435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04000 27380 26646 gene locus_tag LOCUS_04010 27380 26646 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776598.1 protein_id gnl|my_center|LOCUS_04010 27786 27385 gene locus_tag LOCUS_04020 27786 27385 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_04020 28596 27874 gene locus_tag LOCUS_04030 28596 27874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 30298 28706 gene locus_tag LOCUS_04040 30298 28706 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_04040 30447 32738 gene locus_tag LOCUS_04050 30447 32738 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_04050 33128 32757 gene locus_tag LOCUS_04060 33128 32757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 34065 33112 gene locus_tag LOCUS_04070 34065 33112 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223361.1 protein_id gnl|my_center|LOCUS_04070 34149 34835 gene locus_tag LOCUS_04080 34149 34835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 34931 36631 gene locus_tag LOCUS_04090 34931 36631 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_04090 35863 35992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36692 37399 gene locus_tag LOCUS_04100 36692 37399 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_04100 37512 38897 gene locus_tag LOCUS_04110 37512 38897 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804419.1 protein_id gnl|my_center|LOCUS_04110 38942 40294 gene locus_tag LOCUS_04120 38942 40294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 40451 42253 gene locus_tag LOCUS_04130 40451 42253 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_04130 42266 42922 gene locus_tag LOCUS_04140 42266 42922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_04140 43715 42903 gene locus_tag LOCUS_04150 43715 42903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 44581 44712 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45216 45331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46277 45933 gene locus_tag LOCUS_04160 46277 45933 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892262.1 protein_id gnl|my_center|LOCUS_04160 47657 46296 gene locus_tag LOCUS_04170 47657 46296 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 protein_id gnl|my_center|LOCUS_04170 47700 48380 gene locus_tag LOCUS_04180 47700 48380 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_04180 48905 48465 gene locus_tag LOCUS_04190 48905 48465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 49645 48902 gene locus_tag LOCUS_04200 49645 48902 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325632.1 protein_id gnl|my_center|LOCUS_04200 49727 50860 gene locus_tag LOCUS_04210 49727 50860 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230156.1 protein_id gnl|my_center|LOCUS_04210 50884 51648 gene locus_tag LOCUS_04220 50884 51648 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225704.1 protein_id gnl|my_center|LOCUS_04220 52033 53205 gene locus_tag LOCUS_04230 52033 53205 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083368598.1 protein_id gnl|my_center|LOCUS_04230 52210 52233 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53284 54498 gene locus_tag LOCUS_04240 53284 54498 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728068.1 protein_id gnl|my_center|LOCUS_04240 54006 54057 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 55122 55358 gene locus_tag LOCUS_04250 55122 55358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 55516 55295 gene locus_tag LOCUS_04260 55516 55295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 56051 56947 gene locus_tag LOCUS_04270 56051 56947 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020646525.1 protein_id gnl|my_center|LOCUS_04270 57078 56878 gene locus_tag LOCUS_04280 57078 56878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 >Feature sequence008 147 1565 gene locus_tag LOCUS_04290 147 1565 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_04290 2041 2307 gene locus_tag LOCUS_04300 2041 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 3337 2396 gene locus_tag LOCUS_04310 3337 2396 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088347.1 protein_id gnl|my_center|LOCUS_04310 3514 4572 gene locus_tag LOCUS_04320 gene exoA 3514 4572 CDS product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061866.1 protein_id gnl|my_center|LOCUS_04320 6214 4586 gene locus_tag LOCUS_04330 6214 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 6346 7374 gene locus_tag LOCUS_04340 6346 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 7539 8522 gene locus_tag LOCUS_04350 gene pseB 7539 8522 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867763.1 protein_id gnl|my_center|LOCUS_04350 8530 9513 gene locus_tag LOCUS_04360 8530 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 9610 9825 gene locus_tag LOCUS_04370 9610 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 9822 11054 gene locus_tag LOCUS_04380 9822 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 11047 11796 gene locus_tag LOCUS_04390 11047 11796 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089028.1 protein_id gnl|my_center|LOCUS_04390 11797 12306 gene locus_tag LOCUS_04400 11797 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 14156 12258 gene locus_tag LOCUS_04410 14156 12258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 14357 15196 gene locus_tag LOCUS_04420 14357 15196 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_04420 15223 16239 gene locus_tag LOCUS_04430 15223 16239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 16278 17171 gene locus_tag LOCUS_04440 16278 17171 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_04440 17158 17973 gene locus_tag LOCUS_04450 17158 17973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_04450 18105 18935 gene locus_tag LOCUS_04460 18105 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 20223 19048 gene locus_tag LOCUS_04470 gene dprA 20223 19048 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_04470 20807 20220 gene locus_tag LOCUS_04480 20807 20220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 21649 20738 gene locus_tag LOCUS_04490 21649 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 20843 20873 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22122 21646 gene locus_tag LOCUS_04500 22122 21646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 22708 22391 gene locus_tag LOCUS_04510 22708 22391 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_04510 23493 22705 gene locus_tag LOCUS_04520 23493 22705 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_04520 24164 23490 gene locus_tag LOCUS_04530 24164 23490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 24994 24227 gene locus_tag LOCUS_04540 24994 24227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 25920 25276 gene locus_tag LOCUS_04550 25920 25276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04550 26180 26046 gene locus_tag LOCUS_04560 26180 26046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 26194 26595 gene locus_tag LOCUS_04570 26194 26595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 26996 26754 gene locus_tag LOCUS_04580 26996 26754 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_04580 27081 27202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27892 28554 gene locus_tag LOCUS_04590 27892 28554 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222957.1 protein_id gnl|my_center|LOCUS_04590 29212 28646 gene locus_tag LOCUS_04600 29212 28646 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868963.1 protein_id gnl|my_center|LOCUS_04600 30248 29226 gene locus_tag LOCUS_04610 30248 29226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223442.1 protein_id gnl|my_center|LOCUS_04610 31005 30238 gene locus_tag LOCUS_04620 31005 30238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_04620 31065 31152 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32214 31174 gene locus_tag LOCUS_04630 32214 31174 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_04630 33698 32610 gene locus_tag LOCUS_04640 33698 32610 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_04640 34503 33775 gene locus_tag LOCUS_04650 34503 33775 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_04650 36272 34575 gene locus_tag LOCUS_04660 gene ffh 36272 34575 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_04660 38681 36279 gene locus_tag LOCUS_04670 38681 36279 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899539.1 protein_id gnl|my_center|LOCUS_04670 39036 38698 gene locus_tag LOCUS_04680 39036 38698 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051565.1 protein_id gnl|my_center|LOCUS_04680 40424 39033 gene locus_tag LOCUS_04690 40424 39033 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 protein_id gnl|my_center|LOCUS_04690 40598 41632 gene locus_tag LOCUS_04700 40598 41632 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522101.1 protein_id gnl|my_center|LOCUS_04700 42708 41527 gene locus_tag LOCUS_04710 gene ftsY 42708 41527 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_04710 43087 42845 gene locus_tag LOCUS_04720 43087 42845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 46788 43171 gene locus_tag LOCUS_04730 gene smc 46788 43171 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_04730 47239 46970 gene locus_tag LOCUS_04740 47239 46970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 47586 47311 gene locus_tag LOCUS_04750 47586 47311 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223794.1 protein_id gnl|my_center|LOCUS_04750 48098 47613 gene locus_tag LOCUS_04760 48098 47613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 48129 48221 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49487 48651 gene locus_tag LOCUS_04770 gene rnc 49487 48651 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_04770 49699 49505 gene locus_tag LOCUS_04780 gene rpmF 49699 49505 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811892.1 protein_id gnl|my_center|LOCUS_04780 50312 49701 gene locus_tag LOCUS_04790 50312 49701 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_04790 51031 50429 gene locus_tag LOCUS_04800 51031 50429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 51470 51036 gene locus_tag LOCUS_04810 gene coaD 51470 51036 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_04810 52206 51622 gene locus_tag LOCUS_04820 gene rsmD 52206 51622 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_04820 54469 52214 gene locus_tag LOCUS_04830 gene recG 54469 52214 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_04830 55367 54471 gene locus_tag LOCUS_04840 55367 54471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 56454 55318 gene locus_tag LOCUS_04850 56454 55318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 55439 55491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56633 56827 gene locus_tag LOCUS_04860 gene rpmB 56633 56827 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence009 987 61 gene locus_tag LOCUS_04870 987 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 1114 1213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2953 1943 gene locus_tag LOCUS_04880 2953 1943 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_04880 4125 2965 gene locus_tag LOCUS_04890 4125 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4307 5113 gene locus_tag LOCUS_04900 4307 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 6413 5151 gene locus_tag LOCUS_04910 6413 5151 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_04910 6570 6685 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8338 6761 gene locus_tag LOCUS_04920 8338 6761 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467505.1 protein_id gnl|my_center|LOCUS_04920 8398 9756 gene locus_tag LOCUS_04930 8398 9756 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728155.1 protein_id gnl|my_center|LOCUS_04930 10428 9772 gene locus_tag LOCUS_04940 10428 9772 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816035.1 protein_id gnl|my_center|LOCUS_04940 13016 10509 gene locus_tag LOCUS_04950 13016 10509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04950 12687 12774 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14190 13021 gene locus_tag LOCUS_04960 14190 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04960 14343 15197 gene locus_tag LOCUS_04970 gene parJ 14343 15197 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_04970 16510 15221 gene locus_tag LOCUS_04980 gene mshC 16510 15221 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_04980 17391 16561 gene locus_tag LOCUS_04990 17391 16561 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226501.1 protein_id gnl|my_center|LOCUS_04990 17963 17409 gene locus_tag LOCUS_05000 17963 17409 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 protein_id gnl|my_center|LOCUS_05000 18753 17974 gene locus_tag LOCUS_05010 18753 17974 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_05010 18747 19784 gene locus_tag LOCUS_05020 gene corA 18747 19784 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_05020 20683 19829 gene locus_tag LOCUS_05030 20683 19829 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972097.1 protein_id gnl|my_center|LOCUS_05030 21184 20711 gene locus_tag LOCUS_05040 21184 20711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05040 21233 21343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21880 22779 gene locus_tag LOCUS_05050 21880 22779 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_05050 23165 22824 gene locus_tag LOCUS_05060 23165 22824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775662.1 protein_id gnl|my_center|LOCUS_05060 24593 23268 gene locus_tag LOCUS_05070 24593 23268 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804006.1 protein_id gnl|my_center|LOCUS_05070 24691 24775 gene locus_tag LOCUS_t00060 24691 24775 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26402 24756 gene locus_tag LOCUS_05080 26402 24756 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296512.1 protein_id gnl|my_center|LOCUS_05080 26572 26399 gene locus_tag LOCUS_05090 26572 26399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 26864 30100 gene locus_tag LOCUS_05100 26864 30100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 30106 32679 gene locus_tag LOCUS_05110 30106 32679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 32679 33599 gene locus_tag LOCUS_05120 32679 33599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 33592 36633 gene locus_tag LOCUS_05130 33592 36633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 36630 37298 gene locus_tag LOCUS_05140 36630 37298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 37295 41776 gene locus_tag LOCUS_05150 37295 41776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 41773 42291 gene locus_tag LOCUS_05160 41773 42291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 42273 44309 gene locus_tag LOCUS_05170 42273 44309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 45531 44386 gene locus_tag LOCUS_05180 45531 44386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 46765 45524 gene locus_tag LOCUS_05190 46765 45524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 47895 46762 gene locus_tag LOCUS_05200 47895 46762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 48620 47892 gene locus_tag LOCUS_05210 48620 47892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 48900 49589 gene locus_tag LOCUS_05220 gene queC 48900 49589 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_05220 49586 50227 gene locus_tag LOCUS_05230 gene queE 49586 50227 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_05230 50224 50604 gene locus_tag LOCUS_05240 gene queD 50224 50604 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090505.1 protein_id gnl|my_center|LOCUS_05240 50597 51364 gene locus_tag LOCUS_05250 gene folE2 50597 51364 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687811.1 protein_id gnl|my_center|LOCUS_05250 52272 51676 gene locus_tag LOCUS_05260 52272 51676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence010 351 1019 gene locus_tag LOCUS_05270 351 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1145 1194 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1226 1969 gene locus_tag LOCUS_05280 gene rsmG 1226 1969 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_05280 2319 3314 gene locus_tag LOCUS_05290 2319 3314 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_05290 3437 4516 gene locus_tag LOCUS_05300 3437 4516 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863476.1 protein_id gnl|my_center|LOCUS_05300 5777 4653 gene locus_tag LOCUS_05310 5777 4653 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_05310 7029 5710 gene locus_tag LOCUS_05320 7029 5710 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_05320 7232 7852 gene locus_tag LOCUS_05330 7232 7852 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_05330 9176 8007 gene locus_tag LOCUS_05340 9176 8007 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898354.1 protein_id gnl|my_center|LOCUS_05340 9625 9299 gene locus_tag LOCUS_05350 gene trxA 9625 9299 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_05350 10768 9746 gene locus_tag LOCUS_05360 gene trxB 10768 9746 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_05360 11740 10904 gene locus_tag LOCUS_05370 11740 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 12407 11805 gene locus_tag LOCUS_05380 gene sigM 12407 11805 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_05380 14268 12418 gene locus_tag LOCUS_05390 14268 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 16008 14341 gene locus_tag LOCUS_05400 16008 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 17980 16001 gene locus_tag LOCUS_05410 17980 16001 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930082.1 protein_id gnl|my_center|LOCUS_05410 17994 18242 gene locus_tag LOCUS_05420 17994 18242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 18717 18283 gene locus_tag LOCUS_05430 18717 18283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 18856 20340 gene locus_tag LOCUS_05440 18856 20340 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_05440 20488 21531 gene locus_tag LOCUS_05450 20488 21531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 21614 22105 gene locus_tag LOCUS_05460 21614 22105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776161.1 protein_id gnl|my_center|LOCUS_05460 22102 22692 gene locus_tag LOCUS_05470 22102 22692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 22866 23576 gene locus_tag LOCUS_05480 22866 23576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776164.1 protein_id gnl|my_center|LOCUS_05480 23573 28075 gene locus_tag LOCUS_05490 23573 28075 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776163.1 protein_id gnl|my_center|LOCUS_05490 28235 28525 gene locus_tag LOCUS_05500 28235 28525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 28670 28942 gene locus_tag LOCUS_05510 28670 28942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 29646 29161 gene locus_tag LOCUS_05520 29646 29161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 29692 29826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31120 30476 gene locus_tag LOCUS_05530 31120 30476 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_05530 31385 33571 gene locus_tag LOCUS_05540 31385 33571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 33603 35036 gene locus_tag LOCUS_05550 33603 35036 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_05550 35258 35545 gene locus_tag LOCUS_05560 gene rpsF 35258 35545 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072064.1 protein_id gnl|my_center|LOCUS_05560 35580 36164 gene locus_tag LOCUS_05570 35580 36164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 36326 36482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36538 36984 gene locus_tag LOCUS_05580 gene rplI 36538 36984 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_05580 37908 37171 gene locus_tag LOCUS_05590 37908 37171 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896033.1 protein_id gnl|my_center|LOCUS_05590 38263 37982 gene locus_tag LOCUS_05600 38263 37982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 38165 39046 gene locus_tag LOCUS_05610 38165 39046 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742135.1 protein_id gnl|my_center|LOCUS_05610 39043 40068 gene locus_tag LOCUS_05620 39043 40068 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729986.1 protein_id gnl|my_center|LOCUS_05620 39885 39966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40093 41112 gene locus_tag LOCUS_05630 gene iolC 40093 41112 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729991.1 protein_id gnl|my_center|LOCUS_05630 41331 42212 gene locus_tag LOCUS_05640 gene iolB 41331 42212 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_05640 42209 44140 gene locus_tag LOCUS_05650 gene iolD 42209 44140 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_05650 45596 44163 gene locus_tag LOCUS_05660 45596 44163 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_05660 45647 46972 gene locus_tag LOCUS_05670 45647 46972 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_05670 47298 51089 gene locus_tag LOCUS_05680 47298 51089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 50825 51004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence011 395 207 gene locus_tag LOCUS_05690 395 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 560 1213 gene locus_tag LOCUS_05700 560 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 1215 2351 gene locus_tag LOCUS_05710 1215 2351 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_05710 2650 2387 gene locus_tag LOCUS_05720 2650 2387 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_05720 5341 2819 gene locus_tag LOCUS_05730 5341 2819 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029648.1 protein_id gnl|my_center|LOCUS_05730 5875 5408 gene locus_tag LOCUS_05740 gene ribH 5875 5408 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 protein_id gnl|my_center|LOCUS_05740 7089 5872 gene locus_tag LOCUS_05750 7089 5872 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_05750 7712 7098 gene locus_tag LOCUS_05760 7712 7098 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_05760 8863 7712 gene locus_tag LOCUS_05770 gene ribD 8863 7712 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104448.1 protein_id gnl|my_center|LOCUS_05770 9886 9197 gene locus_tag LOCUS_05780 gene rpe 9886 9197 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_05780 10594 9896 gene locus_tag LOCUS_05790 10594 9896 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367926.1 protein_id gnl|my_center|LOCUS_05790 10657 12096 gene locus_tag LOCUS_05800 10657 12096 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727370.1 protein_id gnl|my_center|LOCUS_05800 13632 12103 gene locus_tag LOCUS_05810 13632 12103 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805210.1 protein_id gnl|my_center|LOCUS_05810 14594 13629 gene locus_tag LOCUS_05820 gene fmt 14594 13629 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_05820 15144 14599 gene locus_tag LOCUS_05830 gene def 15144 14599 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_05830 15921 15187 gene locus_tag LOCUS_05840 15921 15187 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974744.1 protein_id gnl|my_center|LOCUS_05840 18163 15983 gene locus_tag LOCUS_05850 18163 15983 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_05850 19429 18299 gene locus_tag LOCUS_05860 gene metK 19429 18299 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057696.1 protein_id gnl|my_center|LOCUS_05860 20906 19434 gene locus_tag LOCUS_05870 gene coaBC 20906 19434 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014475.1 protein_id gnl|my_center|LOCUS_05870 19487 19602 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21226 20963 gene locus_tag LOCUS_05880 gene rpoZ 21226 20963 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_05880 21886 21305 gene locus_tag LOCUS_05890 gene gmk 21886 21305 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805082.1 protein_id gnl|my_center|LOCUS_05890 22210 21893 gene locus_tag LOCUS_05900 22210 21893 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_05900 23219 22335 gene locus_tag LOCUS_05910 gene pyrF 23219 22335 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_05910 23893 23216 gene locus_tag LOCUS_05920 23893 23216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05920 24212 23850 gene locus_tag LOCUS_05930 24212 23850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05930 25201 24212 gene locus_tag LOCUS_05940 25201 24212 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_05940 28515 25198 gene locus_tag LOCUS_05950 gene carB 28515 25198 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_05950 29552 28515 gene locus_tag LOCUS_05960 gene carA 29552 28515 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_05960 29583 29674 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31581 30280 gene locus_tag LOCUS_05970 31581 30280 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_05970 32513 31578 gene locus_tag LOCUS_05980 32513 31578 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057676.1 protein_id gnl|my_center|LOCUS_05980 33097 32510 gene locus_tag LOCUS_05990 gene pyrR 33097 32510 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_05990 33697 33284 gene locus_tag LOCUS_06000 gene nusB 33697 33284 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 protein_id gnl|my_center|LOCUS_06000 34268 33699 gene locus_tag LOCUS_06010 gene efp 34268 33699 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_06010 35114 34656 gene locus_tag LOCUS_06020 gene aroQ 35114 34656 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816942.1 protein_id gnl|my_center|LOCUS_06020 36280 35156 gene locus_tag LOCUS_06030 gene aroB 36280 35156 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_06030 36828 36277 gene locus_tag LOCUS_06040 36828 36277 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742170.1 protein_id gnl|my_center|LOCUS_06040 38054 36822 gene locus_tag LOCUS_06050 gene aroC 38054 36822 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_06050 38793 38089 gene locus_tag LOCUS_06060 38793 38089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 39719 38790 gene locus_tag LOCUS_06070 39719 38790 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728765.1 protein_id gnl|my_center|LOCUS_06070 40774 39713 gene locus_tag LOCUS_06080 gene mltG 40774 39713 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 protein_id gnl|my_center|LOCUS_06080 41277 40771 gene locus_tag LOCUS_06090 gene ruvX 41277 40771 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_06090 43568 41280 gene locus_tag LOCUS_06100 gene alaS 43568 41280 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06100 44406 44101 gene locus_tag LOCUS_06110 44406 44101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 44825 44412 gene locus_tag LOCUS_06120 44825 44412 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977323.1 protein_id gnl|my_center|LOCUS_06120 46340 44934 gene locus_tag LOCUS_06130 46340 44934 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_06130 48230 46428 gene locus_tag LOCUS_06140 gene aspS 48230 46428 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082377.1 protein_id gnl|my_center|LOCUS_06140 49013 48348 gene locus_tag LOCUS_06150 49013 48348 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_06150 <50640 49114 gene locus_tag LOCUS_06160 <50640 49114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063606961.1:CTP synthase >Feature sequence012 1545 475 gene locus_tag LOCUS_06170 1545 475 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_06170 2918 1542 gene locus_tag LOCUS_06180 2918 1542 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_06180 4569 2953 gene locus_tag LOCUS_06190 4569 2953 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_06190 4790 5725 gene locus_tag LOCUS_06200 4790 5725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776808.1 protein_id gnl|my_center|LOCUS_06200 5722 6939 gene locus_tag LOCUS_06210 5722 6939 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776809.1 protein_id gnl|my_center|LOCUS_06210 7554 7000 gene locus_tag LOCUS_06220 7554 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 8134 7547 gene locus_tag LOCUS_06230 gene recR 8134 7547 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_06230 10257 8266 gene locus_tag LOCUS_06240 10257 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 10554 10641 gene locus_tag LOCUS_t00070 10554 10641 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10735 11031 gene locus_tag LOCUS_06250 10735 11031 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_06250 11084 11641 gene locus_tag LOCUS_06260 11084 11641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 12914 11742 gene locus_tag LOCUS_06270 12914 11742 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_06270 14368 13001 gene locus_tag LOCUS_06280 14368 13001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 15047 14406 gene locus_tag LOCUS_06290 15047 14406 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_06290 15265 15918 gene locus_tag LOCUS_06300 15265 15918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 16196 16429 gene locus_tag LOCUS_06310 16196 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 16469 17260 gene locus_tag LOCUS_06320 16469 17260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 17799 17335 gene locus_tag LOCUS_06330 17799 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 18718 18104 gene locus_tag LOCUS_06340 18718 18104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 19401 20243 gene locus_tag LOCUS_06350 19401 20243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 20240 22195 gene locus_tag LOCUS_06360 20240 22195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 22359 24704 gene locus_tag LOCUS_06370 22359 24704 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026895.1 protein_id gnl|my_center|LOCUS_06370 24763 25053 gene locus_tag LOCUS_06380 24763 25053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 26135 25065 gene locus_tag LOCUS_06390 26135 25065 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_06390 26222 26272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26334 27731 gene locus_tag LOCUS_06400 26334 27731 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222025.1 protein_id gnl|my_center|LOCUS_06400 28595 27831 gene locus_tag LOCUS_06410 28595 27831 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080998.1 protein_id gnl|my_center|LOCUS_06410 29710 28592 gene locus_tag LOCUS_06420 29710 28592 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223031.1 protein_id gnl|my_center|LOCUS_06420 30096 29707 gene locus_tag LOCUS_06430 gene nirD 30096 29707 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_06430 32660 30093 gene locus_tag LOCUS_06440 gene nirB 32660 30093 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111865.1 protein_id gnl|my_center|LOCUS_06440 34244 32775 gene locus_tag LOCUS_06450 34244 32775 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_06450 36343 34241 gene locus_tag LOCUS_06460 36343 34241 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_06460 37792 36377 gene locus_tag LOCUS_06470 37792 36377 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085590.1 protein_id gnl|my_center|LOCUS_06470 37941 38059 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38459 38109 gene locus_tag LOCUS_06480 38459 38109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 39579 38635 gene locus_tag LOCUS_06490 39579 38635 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031548.1 protein_id gnl|my_center|LOCUS_06490 39812 40486 gene locus_tag LOCUS_06500 39812 40486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 41687 40530 gene locus_tag LOCUS_06510 41687 40530 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761873.1 protein_id gnl|my_center|LOCUS_06510 43141 41687 gene locus_tag LOCUS_06520 gene hemY 43141 41687 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228080.1 protein_id gnl|my_center|LOCUS_06520 43456 43980 gene locus_tag LOCUS_06530 gene crcB 43456 43980 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031398.1 protein_id gnl|my_center|LOCUS_06530 43977 44366 gene locus_tag LOCUS_06540 43977 44366 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972099.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence013 326 428 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1163 1328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2559 2089 gene locus_tag LOCUS_06550 2559 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 3263 2661 gene locus_tag LOCUS_06560 3263 2661 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 protein_id gnl|my_center|LOCUS_06560 4592 3288 gene locus_tag LOCUS_06570 4592 3288 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_06570 5014 4589 gene locus_tag LOCUS_06580 5014 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5155 5817 gene locus_tag LOCUS_06590 5155 5817 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_06590 5862 5941 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5947 6600 gene locus_tag LOCUS_06600 5947 6600 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_06600 7000 6692 gene locus_tag LOCUS_06610 7000 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 7001 7077 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7864 7466 gene locus_tag LOCUS_06620 7864 7466 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_06620 8825 7911 gene locus_tag LOCUS_06630 8825 7911 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_06630 9338 8832 gene locus_tag LOCUS_06640 gene dut 9338 8832 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_06640 9690 9391 gene locus_tag LOCUS_06650 9690 9391 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057245.1 protein_id gnl|my_center|LOCUS_06650 10716 9853 gene locus_tag LOCUS_06660 10716 9853 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093703.1 protein_id gnl|my_center|LOCUS_06660 11861 10716 gene locus_tag LOCUS_06670 11861 10716 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_06670 12015 13181 gene locus_tag LOCUS_06680 gene sepH 12015 13181 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805049.1 protein_id gnl|my_center|LOCUS_06680 14378 13188 gene locus_tag LOCUS_06690 14378 13188 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_06690 15018 14389 gene locus_tag LOCUS_06700 15018 14389 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_06700 17796 15097 gene locus_tag LOCUS_06710 17796 15097 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_06710 17891 19669 gene locus_tag LOCUS_06720 17891 19669 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226824.1 protein_id gnl|my_center|LOCUS_06720 20571 19732 gene locus_tag LOCUS_06730 20571 19732 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193046641.1 protein_id gnl|my_center|LOCUS_06730 20614 21258 gene locus_tag LOCUS_06740 20614 21258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 21520 22281 gene locus_tag LOCUS_06750 21520 22281 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226344.1 protein_id gnl|my_center|LOCUS_06750 22278 23228 gene locus_tag LOCUS_06760 gene pfkB 22278 23228 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226343.1 protein_id gnl|my_center|LOCUS_06760 23257 23706 gene locus_tag LOCUS_06770 23257 23706 CDS product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226342.1 protein_id gnl|my_center|LOCUS_06770 23703 25226 gene locus_tag LOCUS_06780 23703 25226 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226341.1 protein_id gnl|my_center|LOCUS_06780 25033 25067 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25199 25345 gene locus_tag LOCUS_06790 25199 25345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 25351 27033 gene locus_tag LOCUS_06800 gene ptsP 25351 27033 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_06800 27242 29797 gene locus_tag LOCUS_06810 27242 29797 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929932.1 protein_id gnl|my_center|LOCUS_06810 29848 30780 gene locus_tag LOCUS_06820 29848 30780 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_06820 31492 30761 gene locus_tag LOCUS_06830 31492 30761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 33762 31576 gene locus_tag LOCUS_06840 33762 31576 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805040.1 protein_id gnl|my_center|LOCUS_06840 34104 34328 gene locus_tag LOCUS_06850 34104 34328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_06850 34353 34835 gene locus_tag LOCUS_06860 34353 34835 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726666.1 protein_id gnl|my_center|LOCUS_06860 35307 34882 gene locus_tag LOCUS_06870 35307 34882 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_06870 36704 35445 gene locus_tag LOCUS_06880 gene dinB 36704 35445 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_06880 36913 36701 gene locus_tag LOCUS_06890 36913 36701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 37427 36927 gene locus_tag LOCUS_06900 37427 36927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 37392 37646 gene locus_tag LOCUS_06910 37392 37646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 39293 37788 gene locus_tag LOCUS_06920 39293 37788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06920 39192 39278 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39523 39819 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence014 1410 451 gene locus_tag LOCUS_06930 1410 451 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_06930 2406 1426 gene locus_tag LOCUS_06940 2406 1426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_06940 2992 2453 gene locus_tag LOCUS_06950 2992 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2999 3157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4640 3621 gene locus_tag LOCUS_06960 4640 3621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_06960 6456 4648 gene locus_tag LOCUS_06970 6456 4648 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729909.1 protein_id gnl|my_center|LOCUS_06970 6705 7868 gene locus_tag LOCUS_06980 gene coaE 6705 7868 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286284.1 protein_id gnl|my_center|LOCUS_06980 8227 8451 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9349 10155 gene locus_tag LOCUS_06990 9349 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06990 10360 11364 gene locus_tag LOCUS_07000 10360 11364 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113122.1 protein_id gnl|my_center|LOCUS_07000 12333 11392 gene locus_tag LOCUS_07010 12333 11392 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 protein_id gnl|my_center|LOCUS_07010 12691 12293 gene locus_tag LOCUS_07020 12691 12293 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222358.1 protein_id gnl|my_center|LOCUS_07020 12909 12688 gene locus_tag LOCUS_07030 12909 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 12963 13039 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13157 13669 gene locus_tag LOCUS_07040 13157 13669 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222357.1 protein_id gnl|my_center|LOCUS_07040 14342 13680 gene locus_tag LOCUS_07050 14342 13680 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_07050 14729 14971 gene locus_tag LOCUS_07060 14729 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 15026 15871 gene locus_tag LOCUS_07070 15026 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 16478 15771 gene locus_tag LOCUS_07080 16478 15771 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222689.1 protein_id gnl|my_center|LOCUS_07080 18289 16478 gene locus_tag LOCUS_07090 18289 16478 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186147.1 protein_id gnl|my_center|LOCUS_07090 18329 18427 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18439 21561 gene locus_tag LOCUS_07100 gene uvrA 18439 21561 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_07100 22403 21690 gene locus_tag LOCUS_07110 22403 21690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028095.1 protein_id gnl|my_center|LOCUS_07110 23233 22400 gene locus_tag LOCUS_07120 23233 22400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976806.1 protein_id gnl|my_center|LOCUS_07120 24927 23230 gene locus_tag LOCUS_07130 24927 23230 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028094.1 protein_id gnl|my_center|LOCUS_07130 25886 24924 gene locus_tag LOCUS_07140 25886 24924 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028093.1 protein_id gnl|my_center|LOCUS_07140 25778 25701 gene locus_tag LOCUS_t00080 25778 25701 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27309 25993 gene locus_tag LOCUS_07150 27309 25993 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_07150 27410 27877 gene locus_tag LOCUS_07160 27410 27877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 27934 29922 gene locus_tag LOCUS_07170 gene uvrC 27934 29922 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_07170 29938 30831 gene locus_tag LOCUS_07180 gene rapZ 29938 30831 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_07180 30828 31766 gene locus_tag LOCUS_07190 gene yvcK 30828 31766 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_07190 31806 32786 gene locus_tag LOCUS_07200 gene whiA 31806 32786 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_07200 32919 33923 gene locus_tag LOCUS_07210 gene gap 32919 33923 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_07210 33931 35142 gene locus_tag LOCUS_07220 33931 35142 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028057.1 protein_id gnl|my_center|LOCUS_07220 35148 35981 gene locus_tag LOCUS_07230 gene tpiA 35148 35981 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_07230 36087 36168 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36514 36864 gene locus_tag LOCUS_07240 36514 36864 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284344.1 protein_id gnl|my_center|LOCUS_07240 37671 36892 gene locus_tag LOCUS_07250 gene pgl 37671 36892 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_07250 38609 37668 gene locus_tag LOCUS_07260 gene opcA 38609 37668 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224673.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence015 918 1463 gene locus_tag LOCUS_07270 918 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07270 1567 2166 gene locus_tag LOCUS_07280 1567 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07280 2909 2631 gene locus_tag LOCUS_07290 gene relE 2909 2631 CDS product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898789.1 protein_id gnl|my_center|LOCUS_07290 3196 2906 gene locus_tag LOCUS_07300 3196 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 4049 3417 gene locus_tag LOCUS_07310 4049 3417 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393500.1 protein_id gnl|my_center|LOCUS_07310 5342 4050 gene locus_tag LOCUS_07320 5342 4050 CDS product MSMEG_0565 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876802.1 protein_id gnl|my_center|LOCUS_07320 6904 5339 gene locus_tag LOCUS_07330 gene fdrA 6904 5339 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_07330 7929 6901 gene locus_tag LOCUS_07340 gene arcC 7929 6901 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_07340 8021 8344 gene locus_tag LOCUS_07350 8021 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 8414 9679 gene locus_tag LOCUS_07360 8414 9679 CDS product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 protein_id gnl|my_center|LOCUS_07360 9779 10279 gene locus_tag LOCUS_07370 9779 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 11379 10318 gene locus_tag LOCUS_07380 11379 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 11486 12256 gene locus_tag LOCUS_07390 11486 12256 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_07390 12253 13197 gene locus_tag LOCUS_07400 12253 13197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 13182 14393 gene locus_tag LOCUS_07410 13182 14393 CDS product adenylosuccinate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018348301.1 protein_id gnl|my_center|LOCUS_07410 14408 15382 gene locus_tag LOCUS_07420 gene dcyD 14408 15382 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128192.1 protein_id gnl|my_center|LOCUS_07420 15379 16887 gene locus_tag LOCUS_07430 gene argH 15379 16887 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 protein_id gnl|my_center|LOCUS_07430 16904 18319 gene locus_tag LOCUS_07440 16904 18319 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_07440 18324 18725 gene locus_tag LOCUS_07450 18324 18725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 18739 19632 gene locus_tag LOCUS_07460 18739 19632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 19829 21169 gene locus_tag LOCUS_07470 19829 21169 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876966.1 protein_id gnl|my_center|LOCUS_07470 21389 22006 gene locus_tag LOCUS_07480 21389 22006 CDS product MSMEG_0572 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891993.1 protein_id gnl|my_center|LOCUS_07480 22129 22992 gene locus_tag LOCUS_07490 22129 22992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 23848 23315 gene locus_tag LOCUS_07500 23848 23315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 24754 23936 gene locus_tag LOCUS_07510 24754 23936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 26536 25004 gene locus_tag LOCUS_07520 26536 25004 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727554.1 protein_id gnl|my_center|LOCUS_07520 27501 26533 gene locus_tag LOCUS_07530 27501 26533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 27564 28310 gene locus_tag LOCUS_07540 27564 28310 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727552.1 protein_id gnl|my_center|LOCUS_07540 28622 28464 gene locus_tag LOCUS_07550 28622 28464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 29301 28615 gene locus_tag LOCUS_07560 29301 28615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 29825 29499 gene locus_tag LOCUS_07570 29825 29499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 30134 29877 gene locus_tag LOCUS_07580 30134 29877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 30777 30211 gene locus_tag LOCUS_07590 30777 30211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 31044 31445 gene locus_tag LOCUS_07600 31044 31445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 32741 31455 gene locus_tag LOCUS_07610 32741 31455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 33124 32816 gene locus_tag LOCUS_07620 33124 32816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 34079 33237 gene locus_tag LOCUS_07630 34079 33237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 35092 35253 gene locus_tag LOCUS_07640 35092 35253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 35393 35782 gene locus_tag LOCUS_07650 35393 35782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 35782 37545 gene locus_tag LOCUS_07660 35782 37545 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705581.1 protein_id gnl|my_center|LOCUS_07660 37705 38082 gene locus_tag LOCUS_07670 gene trxA 37705 38082 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093515.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence016 1023 292 gene locus_tag LOCUS_07680 1023 292 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031214.1 protein_id gnl|my_center|LOCUS_07680 1084 2256 gene locus_tag LOCUS_07690 gene menE 1084 2256 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098433.1 protein_id gnl|my_center|LOCUS_07690 2346 2609 gene locus_tag LOCUS_07700 2346 2609 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776417.1 protein_id gnl|my_center|LOCUS_07700 3166 3582 gene locus_tag LOCUS_07710 3166 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07710 3921 3589 gene locus_tag LOCUS_07720 3921 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 4919 3924 gene locus_tag LOCUS_07730 gene ccsB 4919 3924 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_07730 6553 4916 gene locus_tag LOCUS_07740 6553 4916 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_07740 7393 6638 gene locus_tag LOCUS_07750 7393 6638 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222432.1 protein_id gnl|my_center|LOCUS_07750 8001 7390 gene locus_tag LOCUS_07760 8001 7390 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776421.1 protein_id gnl|my_center|LOCUS_07760 8657 7998 gene locus_tag LOCUS_07770 8657 7998 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_07770 10015 8654 gene locus_tag LOCUS_07780 gene hemL 10015 8654 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_07780 10617 10084 gene locus_tag LOCUS_07790 10617 10084 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227147.1 protein_id gnl|my_center|LOCUS_07790 10746 11276 gene locus_tag LOCUS_07800 10746 11276 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776424.1 protein_id gnl|my_center|LOCUS_07800 11465 11857 gene locus_tag LOCUS_07810 11465 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 11860 12486 gene locus_tag LOCUS_07820 11860 12486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07820 13511 12534 gene locus_tag LOCUS_07830 gene hemB 13511 12534 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_07830 15175 13511 gene locus_tag LOCUS_07840 15175 13511 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_07840 16206 15172 gene locus_tag LOCUS_07850 gene hemC 16206 15172 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061881.1 protein_id gnl|my_center|LOCUS_07850 17534 16203 gene locus_tag LOCUS_07860 17534 16203 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402699.1 protein_id gnl|my_center|LOCUS_07860 18217 17531 gene locus_tag LOCUS_07870 18217 17531 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141850309.1 protein_id gnl|my_center|LOCUS_07870 18662 18384 gene locus_tag LOCUS_07880 18662 18384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 20097 18691 gene locus_tag LOCUS_07890 20097 18691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 21146 20097 gene locus_tag LOCUS_07900 21146 20097 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_07900 21713 21513 gene locus_tag LOCUS_07910 21713 21513 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_07910 22999 21803 gene locus_tag LOCUS_07920 22999 21803 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_07920 23068 23736 gene locus_tag LOCUS_07930 23068 23736 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_07930 24392 23856 gene locus_tag LOCUS_07940 24392 23856 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064492.1 protein_id gnl|my_center|LOCUS_07940 25279 24449 gene locus_tag LOCUS_07950 gene proC 25279 24449 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_07950 26245 25292 gene locus_tag LOCUS_07960 26245 25292 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_07960 27036 26302 gene locus_tag LOCUS_07970 27036 26302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028918.1 protein_id gnl|my_center|LOCUS_07970 27761 27033 gene locus_tag LOCUS_07980 27761 27033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028919.1 protein_id gnl|my_center|LOCUS_07980 28622 27789 gene locus_tag LOCUS_07990 28622 27789 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_07990 29551 28619 gene locus_tag LOCUS_08000 29551 28619 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_08000 29605 30450 gene locus_tag LOCUS_08010 29605 30450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_08010 30447 31148 gene locus_tag LOCUS_08020 30447 31148 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223868.1 protein_id gnl|my_center|LOCUS_08020 31182 31571 gene locus_tag LOCUS_08030 31182 31571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 31751 31904 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31965 32924 gene locus_tag LOCUS_08040 31965 32924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 33108 34163 gene locus_tag LOCUS_08050 gene disA 33108 34163 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_08050 34649 34326 gene locus_tag LOCUS_08060 34649 34326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 35201 34701 gene locus_tag LOCUS_08070 35201 34701 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804919.1 protein_id gnl|my_center|LOCUS_08070 36268 35198 gene locus_tag LOCUS_08080 36268 35198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 37114 36461 gene locus_tag LOCUS_08090 37114 36461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08090 37144 37185 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence017 322 482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1167 826 gene locus_tag LOCUS_08100 1167 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1181 1438 gene locus_tag LOCUS_08110 1181 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1773 1899 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2435 3313 gene locus_tag LOCUS_08120 2435 3313 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 protein_id gnl|my_center|LOCUS_08120 3543 4193 gene locus_tag LOCUS_08130 3543 4193 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224234.1 protein_id gnl|my_center|LOCUS_08130 4190 5071 gene locus_tag LOCUS_08140 4190 5071 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 protein_id gnl|my_center|LOCUS_08140 6419 5193 gene locus_tag LOCUS_08150 6419 5193 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_08150 6927 6448 gene locus_tag LOCUS_08160 6927 6448 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082943.1 protein_id gnl|my_center|LOCUS_08160 7708 7052 gene locus_tag LOCUS_08170 7708 7052 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_08170 8421 7801 gene locus_tag LOCUS_08180 8421 7801 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087409.1 protein_id gnl|my_center|LOCUS_08180 10238 8487 gene locus_tag LOCUS_08190 10238 8487 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_08190 10827 10327 gene locus_tag LOCUS_08200 10827 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 10936 11976 gene locus_tag LOCUS_08210 10936 11976 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_08210 12265 13782 gene locus_tag LOCUS_08220 12265 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 14666 13779 gene locus_tag LOCUS_08230 14666 13779 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787928.1 protein_id gnl|my_center|LOCUS_08230 16085 14826 gene locus_tag LOCUS_08240 16085 14826 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_08240 16285 16731 gene locus_tag LOCUS_08250 16285 16731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 16728 17006 gene locus_tag LOCUS_08260 16728 17006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08260 18603 17194 gene locus_tag LOCUS_08270 18603 17194 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 protein_id gnl|my_center|LOCUS_08270 19086 18619 gene locus_tag LOCUS_08280 19086 18619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 19305 19562 gene locus_tag LOCUS_08290 19305 19562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 19576 20610 gene locus_tag LOCUS_08300 19576 20610 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905400.1 protein_id gnl|my_center|LOCUS_08300 21036 21929 gene locus_tag LOCUS_08310 21036 21929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 21933 23069 gene locus_tag LOCUS_08320 21933 23069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 23634 24113 gene locus_tag LOCUS_08330 23634 24113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 24150 25349 gene locus_tag LOCUS_08340 24150 25349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 25397 26299 gene locus_tag LOCUS_08350 25397 26299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 26301 26570 gene locus_tag LOCUS_08360 26301 26570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 26579 27760 gene locus_tag LOCUS_08370 26579 27760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 27757 28677 gene locus_tag LOCUS_08380 27757 28677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 28876 29949 gene locus_tag LOCUS_08390 28876 29949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 30540 30214 gene locus_tag LOCUS_08400 30540 30214 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_08400 30872 30663 gene locus_tag LOCUS_08410 30872 30663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 30828 31100 gene locus_tag LOCUS_08420 30828 31100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 31781 31368 gene locus_tag LOCUS_08430 31781 31368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 32165 32232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34055 32811 gene locus_tag LOCUS_08440 34055 32811 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869305.1 protein_id gnl|my_center|LOCUS_08440 34454 35317 gene locus_tag LOCUS_08450 34454 35317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727795.1 protein_id gnl|my_center|LOCUS_08450 35510 36325 gene locus_tag LOCUS_08460 35510 36325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 <37516 36340 gene locus_tag LOCUS_08470 <37516 36340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775668.1:IS110 family transposase >Feature sequence018 352 492 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 625 1362 gene locus_tag LOCUS_08480 625 1362 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153482230.1 protein_id gnl|my_center|LOCUS_08480 1365 1982 gene locus_tag LOCUS_08490 1365 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 3092 2115 gene locus_tag LOCUS_08500 3092 2115 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_08500 3343 5133 gene locus_tag LOCUS_08510 3343 5133 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564050.1 protein_id gnl|my_center|LOCUS_08510 5265 6515 gene locus_tag LOCUS_08520 5265 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 6512 7150 gene locus_tag LOCUS_08530 6512 7150 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203508.1 protein_id gnl|my_center|LOCUS_08530 7144 8079 gene locus_tag LOCUS_08540 7144 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 8083 8844 gene locus_tag LOCUS_08550 8083 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 8853 9860 gene locus_tag LOCUS_08560 gene exoA 8853 9860 CDS product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061866.1 protein_id gnl|my_center|LOCUS_08560 9863 11167 gene locus_tag LOCUS_08570 9863 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 11180 12055 gene locus_tag LOCUS_08580 11180 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 12294 12707 gene locus_tag LOCUS_08590 12294 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 12709 13644 gene locus_tag LOCUS_08600 12709 13644 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_08600 13641 14966 gene locus_tag LOCUS_08610 13641 14966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 15080 15853 gene locus_tag LOCUS_08620 15080 15853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 15918 16673 gene locus_tag LOCUS_08630 15918 16673 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_08630 16670 17617 gene locus_tag LOCUS_08640 16670 17617 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732677.1 protein_id gnl|my_center|LOCUS_08640 17592 18701 gene locus_tag LOCUS_08650 17592 18701 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088177.1 protein_id gnl|my_center|LOCUS_08650 19685 18780 gene locus_tag LOCUS_08660 gene rfbD 19685 18780 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_08660 19791 20669 gene locus_tag LOCUS_08670 gene rfbA 19791 20669 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062166.1 protein_id gnl|my_center|LOCUS_08670 20669 21274 gene locus_tag LOCUS_08680 20669 21274 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 protein_id gnl|my_center|LOCUS_08680 21797 21991 gene locus_tag LOCUS_08690 21797 21991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 22003 23472 gene locus_tag LOCUS_08700 22003 23472 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 protein_id gnl|my_center|LOCUS_08700 24722 23502 gene locus_tag LOCUS_08710 24722 23502 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139561.1 protein_id gnl|my_center|LOCUS_08710 25681 24728 gene locus_tag LOCUS_08720 25681 24728 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407642.1 protein_id gnl|my_center|LOCUS_08720 27012 25780 gene locus_tag LOCUS_08730 27012 25780 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754218.1 protein_id gnl|my_center|LOCUS_08730 27310 28239 gene locus_tag LOCUS_08740 gene gmd 27310 28239 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407639.1 protein_id gnl|my_center|LOCUS_08740 28247 29437 gene locus_tag LOCUS_08750 28247 29437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 29475 30707 gene locus_tag LOCUS_08760 29475 30707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 30700 31473 gene locus_tag LOCUS_08770 30700 31473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 31470 32405 gene locus_tag LOCUS_08780 31470 32405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 32508 32939 gene locus_tag LOCUS_08790 32508 32939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 32955 33395 gene locus_tag LOCUS_08800 32955 33395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 33654 33839 gene locus_tag LOCUS_08810 33654 33839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 34273 34845 gene locus_tag LOCUS_08820 34273 34845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414195.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence019 605 802 gene locus_tag LOCUS_08830 605 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 799 1431 gene locus_tag LOCUS_08840 799 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1428 1739 gene locus_tag LOCUS_08850 1428 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1736 1864 gene locus_tag LOCUS_08860 1736 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 2174 2560 gene locus_tag LOCUS_08870 2174 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2557 2811 gene locus_tag LOCUS_08880 2557 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2808 3158 gene locus_tag LOCUS_08890 2808 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3391 4746 gene locus_tag LOCUS_08900 3391 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5236 4985 gene locus_tag LOCUS_08910 5236 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5665 5928 gene locus_tag LOCUS_08920 5665 5928 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929945.1 protein_id gnl|my_center|LOCUS_08920 6060 6890 gene locus_tag LOCUS_08930 gene hisG 6060 6890 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_08930 6977 7366 gene locus_tag LOCUS_08940 6977 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 8583 7363 gene locus_tag LOCUS_08950 8583 7363 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_08950 9183 8602 gene locus_tag LOCUS_08960 9183 8602 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_08960 9250 10023 gene locus_tag LOCUS_08970 gene hisF 9250 10023 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 protein_id gnl|my_center|LOCUS_08970 10934 10311 gene locus_tag LOCUS_08980 10934 10311 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_08980 11006 12070 gene locus_tag LOCUS_08990 11006 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08990 11970 12842 gene locus_tag LOCUS_09000 11970 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09000 12839 14653 gene locus_tag LOCUS_09010 12839 14653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_09010 15110 14700 gene locus_tag LOCUS_09020 15110 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 15191 15631 gene locus_tag LOCUS_09030 gene hisI 15191 15631 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_09030 15624 17189 gene locus_tag LOCUS_09040 15624 17189 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_09040 17186 17797 gene locus_tag LOCUS_09050 17186 17797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 17867 17931 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17955 18332 gene locus_tag LOCUS_09060 17955 18332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 18386 19201 gene locus_tag LOCUS_09070 gene trpC 18386 19201 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_09070 19201 20469 gene locus_tag LOCUS_09080 gene trpB 19201 20469 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728904.1 protein_id gnl|my_center|LOCUS_09080 20466 21266 gene locus_tag LOCUS_09090 gene trpA 20466 21266 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407999.1 protein_id gnl|my_center|LOCUS_09090 21271 21744 gene locus_tag LOCUS_09100 21271 21744 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_09100 21759 22508 gene locus_tag LOCUS_09110 21759 22508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 22505 23428 gene locus_tag LOCUS_09120 22505 23428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 23644 28086 gene locus_tag LOCUS_09130 gene gltB 23644 28086 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_09130 28100 29539 gene locus_tag LOCUS_09140 28100 29539 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_09140 29716 31083 gene locus_tag LOCUS_09150 gene pyk 29716 31083 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805095.1 protein_id gnl|my_center|LOCUS_09150 31213 31297 gene locus_tag LOCUS_t00090 31213 31297 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31372 32019 gene locus_tag LOCUS_09160 31372 32019 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805096.1 protein_id gnl|my_center|LOCUS_09160 32487 32041 gene locus_tag LOCUS_09170 32487 32041 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 protein_id gnl|my_center|LOCUS_09170 32521 32608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence020 1776 973 gene locus_tag LOCUS_09180 1776 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09180 1188 1222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2575 2057 gene locus_tag LOCUS_09190 2575 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 2829 2905 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2936 3178 gene locus_tag LOCUS_09200 2936 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 4035 3400 gene locus_tag LOCUS_09210 4035 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 4034 4348 gene locus_tag LOCUS_09220 4034 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 4345 4551 gene locus_tag LOCUS_09230 4345 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4630 4881 gene locus_tag LOCUS_09240 4630 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5883 5113 gene locus_tag LOCUS_09250 5883 5113 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_09250 5907 5927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6642 5995 gene locus_tag LOCUS_09260 gene raiA 6642 5995 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776077.1 protein_id gnl|my_center|LOCUS_09260 7677 6886 gene locus_tag LOCUS_09270 7677 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 7867 9498 gene locus_tag LOCUS_09280 7867 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 9495 10136 gene locus_tag LOCUS_09290 9495 10136 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_09290 11160 10240 gene locus_tag LOCUS_09300 11160 10240 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_09300 13128 11161 gene locus_tag LOCUS_09310 13128 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 14561 13185 gene locus_tag LOCUS_09320 14561 13185 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_09320 15781 14561 gene locus_tag LOCUS_09330 15781 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 16552 15797 gene locus_tag LOCUS_09340 16552 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 16966 16787 gene locus_tag LOCUS_09350 16966 16787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 17164 18651 gene locus_tag LOCUS_09360 17164 18651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 18648 20111 gene locus_tag LOCUS_09370 18648 20111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 21283 20087 gene locus_tag LOCUS_09380 21283 20087 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 protein_id gnl|my_center|LOCUS_09380 21862 21938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21942 22763 gene locus_tag LOCUS_09390 21942 22763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 24525 22768 gene locus_tag LOCUS_09400 24525 22768 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776079.1 protein_id gnl|my_center|LOCUS_09400 26138 24573 gene locus_tag LOCUS_09410 26138 24573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 26122 26334 gene locus_tag LOCUS_09420 26122 26334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 26753 26874 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27278 27718 gene locus_tag LOCUS_09430 27278 27718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 27709 28953 gene locus_tag LOCUS_09440 27709 28953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 29228 29995 gene locus_tag LOCUS_09450 29228 29995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 29992 31389 gene locus_tag LOCUS_09460 29992 31389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 31467 32705 gene locus_tag LOCUS_09470 31467 32705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 33527 32748 gene locus_tag LOCUS_09480 33527 32748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence021 795 94 gene locus_tag LOCUS_09490 795 94 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_09490 1018 809 gene locus_tag LOCUS_09500 1018 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1751 1020 gene locus_tag LOCUS_09510 1751 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2517 1762 gene locus_tag LOCUS_09520 2517 1762 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891353.1 protein_id gnl|my_center|LOCUS_09520 2610 2879 gene locus_tag LOCUS_09530 gene crgA 2610 2879 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_09530 4660 3206 gene locus_tag LOCUS_09540 gene tnpB 4660 3206 CDS product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083165449.1 protein_id gnl|my_center|LOCUS_09540 4804 5049 gene locus_tag LOCUS_09550 4804 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 5049 5396 gene locus_tag LOCUS_09560 5049 5396 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085147429.1 protein_id gnl|my_center|LOCUS_09560 6318 5452 gene locus_tag LOCUS_09570 6318 5452 CDS product IS5-like element ISRhru6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085977020.1 protein_id gnl|my_center|LOCUS_09570 7232 6312 gene locus_tag LOCUS_09580 7232 6312 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803866.1 protein_id gnl|my_center|LOCUS_09580 7801 7280 gene locus_tag LOCUS_09590 7801 7280 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929825.1 protein_id gnl|my_center|LOCUS_09590 7924 8673 gene locus_tag LOCUS_09600 7924 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 10089 10321 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12297 10642 gene locus_tag LOCUS_09610 12297 10642 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_09610 13205 12294 gene locus_tag LOCUS_09620 13205 12294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 protein_id gnl|my_center|LOCUS_09620 13610 15979 gene locus_tag LOCUS_09630 13610 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 15912 16838 gene locus_tag LOCUS_09640 15912 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 16879 17715 gene locus_tag LOCUS_09650 16879 17715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 17727 18035 gene locus_tag LOCUS_09660 17727 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 19299 18367 gene locus_tag LOCUS_09670 19299 18367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 20071 20751 gene locus_tag LOCUS_09680 20071 20751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 21926 20883 gene locus_tag LOCUS_09690 21926 20883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 23009 23788 gene locus_tag LOCUS_09700 23009 23788 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_09700 24582 24088 gene locus_tag LOCUS_09710 24582 24088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 25252 25896 gene locus_tag LOCUS_09720 25252 25896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 25893 26255 gene locus_tag LOCUS_09730 25893 26255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 26917 26243 gene locus_tag LOCUS_09740 26917 26243 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974780.1 protein_id gnl|my_center|LOCUS_09740 27756 26914 gene locus_tag LOCUS_09750 27756 26914 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029489.1 protein_id gnl|my_center|LOCUS_09750 28264 28328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28376 28699 gene locus_tag LOCUS_09760 28376 28699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 28696 28893 gene locus_tag LOCUS_09770 28696 28893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 29159 28839 gene locus_tag LOCUS_09780 29159 28839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 29758 29360 gene locus_tag LOCUS_09790 29758 29360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 29848 30360 gene locus_tag LOCUS_09800 29848 30360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09800 30360 30686 gene locus_tag LOCUS_09810 30360 30686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 30683 32275 gene locus_tag LOCUS_09820 30683 32275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227708.1 protein_id gnl|my_center|LOCUS_09820 32272 32520 gene locus_tag LOCUS_09830 32272 32520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 32520 33704 gene locus_tag LOCUS_09840 32520 33704 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_09840 33868 33794 gene locus_tag LOCUS_t00100 33868 33794 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 33872 33936 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence022 183 443 gene locus_tag LOCUS_09850 183 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09850 1613 462 gene locus_tag LOCUS_09860 1613 462 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_09860 1704 2798 gene locus_tag LOCUS_09870 1704 2798 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015376.1 protein_id gnl|my_center|LOCUS_09870 3848 2847 gene locus_tag LOCUS_09880 3848 2847 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_09880 4669 3845 gene locus_tag LOCUS_09890 4669 3845 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_09890 4776 5420 gene locus_tag LOCUS_09900 gene cofC 4776 5420 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223625.1 protein_id gnl|my_center|LOCUS_09900 5430 5642 gene locus_tag LOCUS_09910 5430 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 6287 5733 gene locus_tag LOCUS_09920 6287 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 7309 6716 gene locus_tag LOCUS_09930 gene leuD 7309 6716 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223620.1 protein_id gnl|my_center|LOCUS_09930 8741 7350 gene locus_tag LOCUS_09940 gene leuC 8741 7350 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_09940 8905 9636 gene locus_tag LOCUS_09950 8905 9636 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775885.1 protein_id gnl|my_center|LOCUS_09950 9923 9850 gene locus_tag LOCUS_t00110 9923 9850 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10109 10037 gene locus_tag LOCUS_t00120 10109 10037 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11054 10320 gene locus_tag LOCUS_09960 11054 10320 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284413.1 protein_id gnl|my_center|LOCUS_09960 12548 11070 gene locus_tag LOCUS_09970 gene gltX 12548 11070 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394117.1 protein_id gnl|my_center|LOCUS_09970 13373 12594 gene locus_tag LOCUS_09980 13373 12594 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775888.1 protein_id gnl|my_center|LOCUS_09980 13497 14435 gene locus_tag LOCUS_09990 13497 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_09990 14432 14668 gene locus_tag LOCUS_10000 14432 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 14704 15183 gene locus_tag LOCUS_10010 14704 15183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 15234 15815 gene locus_tag LOCUS_10020 15234 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 17503 15923 gene locus_tag LOCUS_10030 gene cimA 17503 15923 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_10030 17932 17983 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19147 18035 gene locus_tag LOCUS_10040 19147 18035 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_10040 20311 19238 gene locus_tag LOCUS_10050 20311 19238 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899576.1 protein_id gnl|my_center|LOCUS_10050 22362 20749 gene locus_tag LOCUS_10060 gene serA 22362 20749 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_10060 23658 22630 gene locus_tag LOCUS_10070 gene ilvC 23658 22630 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_10070 24289 23777 gene locus_tag LOCUS_10080 gene ilvN 24289 23777 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_10080 26489 24519 gene locus_tag LOCUS_10090 26489 24519 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_10090 28506 26752 gene locus_tag LOCUS_10100 gene ilvD 28506 26752 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079804.1 protein_id gnl|my_center|LOCUS_10100 29137 28577 gene locus_tag LOCUS_10110 29137 28577 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084578.1 protein_id gnl|my_center|LOCUS_10110 29476 29183 gene locus_tag LOCUS_10120 29476 29183 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223899.1 protein_id gnl|my_center|LOCUS_10120 30126 29473 gene locus_tag LOCUS_10130 30126 29473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10130 30140 30658 gene locus_tag LOCUS_10140 30140 30658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 31516 30593 gene locus_tag LOCUS_10150 31516 30593 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_10150 31808 31488 gene locus_tag LOCUS_10160 31808 31488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 31774 32709 gene locus_tag LOCUS_10170 31774 32709 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_10170 <34032 32803 gene locus_tag LOCUS_10180 <34032 32803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030281.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence023 1809 280 gene locus_tag LOCUS_10190 1809 280 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_10190 2810 1830 gene locus_tag LOCUS_10200 2810 1830 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_10200 3999 2812 gene locus_tag LOCUS_10210 gene pdhA 3999 2812 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_10210 5326 4241 gene locus_tag LOCUS_10220 gene hisC 5326 4241 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_10220 5316 5786 gene locus_tag LOCUS_10230 5316 5786 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_10230 7213 5942 gene locus_tag LOCUS_10240 7213 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 7442 7260 gene locus_tag LOCUS_10250 7442 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 7653 7767 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7916 8890 gene locus_tag LOCUS_10260 7916 8890 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_10260 9605 8901 gene locus_tag LOCUS_10270 9605 8901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_10270 10422 9598 gene locus_tag LOCUS_10280 10422 9598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809682.1 protein_id gnl|my_center|LOCUS_10280 11504 10419 gene locus_tag LOCUS_10290 11504 10419 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_10290 12376 11501 gene locus_tag LOCUS_10300 12376 11501 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_10300 13666 12383 gene locus_tag LOCUS_10310 13666 12383 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088421.1 protein_id gnl|my_center|LOCUS_10310 14898 13663 gene locus_tag LOCUS_10320 14898 13663 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056494.1 protein_id gnl|my_center|LOCUS_10320 15060 15842 gene locus_tag LOCUS_10330 15060 15842 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976364.1 protein_id gnl|my_center|LOCUS_10330 17627 15906 gene locus_tag LOCUS_10340 gene paaN 17627 15906 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 protein_id gnl|my_center|LOCUS_10340 18433 17846 gene locus_tag LOCUS_10350 18433 17846 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_10350 18481 19527 gene locus_tag LOCUS_10360 gene galE 18481 19527 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_10360 20495 19512 gene locus_tag LOCUS_10370 20495 19512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 20773 22209 gene locus_tag LOCUS_10380 20773 22209 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_10380 22264 23289 gene locus_tag LOCUS_10390 gene cydB 22264 23289 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_10390 23289 24920 gene locus_tag LOCUS_10400 23289 24920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10400 24917 26659 gene locus_tag LOCUS_10410 24917 26659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10410 27376 26801 gene locus_tag LOCUS_10420 27376 26801 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222749.1 protein_id gnl|my_center|LOCUS_10420 28199 27369 gene locus_tag LOCUS_10430 28199 27369 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_10430 28394 29749 gene locus_tag LOCUS_10440 28394 29749 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_10440 29774 30910 gene locus_tag LOCUS_10450 29774 30910 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728881.1 protein_id gnl|my_center|LOCUS_10450 30907 31605 gene locus_tag LOCUS_10460 gene bioD 30907 31605 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_10460 31893 32783 gene locus_tag LOCUS_10470 31893 32783 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222836.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence024 840 166 gene locus_tag LOCUS_10480 gene modA 840 166 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_10480 785 985 gene locus_tag LOCUS_10490 785 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1077 1172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1834 2367 gene locus_tag LOCUS_10500 1834 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2572 3054 gene locus_tag LOCUS_10510 2572 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3787 3191 gene locus_tag LOCUS_10520 3787 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4099 4024 gene locus_tag LOCUS_t00130 4099 4024 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4914 4252 gene locus_tag LOCUS_10530 gene orn 4914 4252 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_10530 5033 4959 gene locus_tag LOCUS_t00140 5033 4959 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5165 6904 gene locus_tag LOCUS_10540 5165 6904 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_10540 6952 8733 gene locus_tag LOCUS_10550 6952 8733 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_10550 8970 9542 gene locus_tag LOCUS_10560 8970 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 9656 11338 gene locus_tag LOCUS_10570 gene ettA 9656 11338 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804765.1 protein_id gnl|my_center|LOCUS_10570 11887 11345 gene locus_tag LOCUS_10580 11887 11345 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_10580 12009 13154 gene locus_tag LOCUS_10590 12009 13154 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072191.1 protein_id gnl|my_center|LOCUS_10590 13188 13952 gene locus_tag LOCUS_10600 13188 13952 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 protein_id gnl|my_center|LOCUS_10600 14813 14052 gene locus_tag LOCUS_10610 gene fabG 14813 14052 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_10610 15995 14868 gene locus_tag LOCUS_10620 15995 14868 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_10620 17015 16053 gene locus_tag LOCUS_10630 17015 16053 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804769.1 protein_id gnl|my_center|LOCUS_10630 17269 17012 gene locus_tag LOCUS_10640 17269 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 17162 17509 gene locus_tag LOCUS_10650 17162 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 17509 18132 gene locus_tag LOCUS_10660 17509 18132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 19466 18114 gene locus_tag LOCUS_10670 19466 18114 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_10670 19964 19581 gene locus_tag LOCUS_10680 19964 19581 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_10680 21050 19989 gene locus_tag LOCUS_10690 21050 19989 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_10690 21114 22592 gene locus_tag LOCUS_10700 21114 22592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10700 22492 23241 gene locus_tag LOCUS_10710 22492 23241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10710 25859 23295 gene locus_tag LOCUS_10720 gene pepN 25859 23295 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804773.1 protein_id gnl|my_center|LOCUS_10720 25935 26543 gene locus_tag LOCUS_10730 25935 26543 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_10730 26594 27073 gene locus_tag LOCUS_10740 26594 27073 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_10740 27167 28276 gene locus_tag LOCUS_10750 27167 28276 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_10750 28805 28302 gene locus_tag LOCUS_10760 28805 28302 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614581.1 protein_id gnl|my_center|LOCUS_10760 28950 30491 gene locus_tag LOCUS_10770 28950 30491 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_10770 30700 30627 gene locus_tag LOCUS_t00150 30700 30627 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 30818 30892 gene locus_tag LOCUS_t00160 30818 30892 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 31149 32567 gene locus_tag LOCUS_10780 gene tig 31149 32567 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_10780 32859 33479 gene locus_tag LOCUS_10790 32859 33479 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence025 253 672 gene locus_tag LOCUS_10800 253 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 669 1640 gene locus_tag LOCUS_10810 669 1640 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_10810 2107 1637 gene locus_tag LOCUS_10820 2107 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3309 2104 gene locus_tag LOCUS_10830 3309 2104 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_10830 4085 3306 gene locus_tag LOCUS_10840 4085 3306 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_10840 4804 4082 gene locus_tag LOCUS_10850 gene nth 4804 4082 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343767.1 protein_id gnl|my_center|LOCUS_10850 4911 5573 gene locus_tag LOCUS_10860 4911 5573 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_10860 6472 5684 gene locus_tag LOCUS_10870 6472 5684 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_10870 7260 6469 gene locus_tag LOCUS_10880 7260 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 7844 7371 gene locus_tag LOCUS_10890 7844 7371 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_10890 8009 7848 gene locus_tag LOCUS_10900 8009 7848 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063257.1 protein_id gnl|my_center|LOCUS_10900 8106 9131 gene locus_tag LOCUS_10910 8106 9131 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_10910 9131 10717 gene locus_tag LOCUS_10920 9131 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 10912 13377 gene locus_tag LOCUS_10930 10912 13377 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_10930 13974 13501 gene locus_tag LOCUS_10940 13974 13501 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_10940 14024 14971 gene locus_tag LOCUS_10950 14024 14971 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731114.1 protein_id gnl|my_center|LOCUS_10950 15123 15171 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16268 15819 gene locus_tag LOCUS_10960 16268 15819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 16600 16304 gene locus_tag LOCUS_10970 16600 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 16803 16958 gene locus_tag LOCUS_10980 16803 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010059700.1 protein_id gnl|my_center|LOCUS_10980 17059 17235 gene locus_tag LOCUS_10990 17059 17235 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_10990 17692 18573 gene locus_tag LOCUS_11000 17692 18573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 18614 20161 gene locus_tag LOCUS_11010 18614 20161 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 protein_id gnl|my_center|LOCUS_11010 21012 20206 gene locus_tag LOCUS_11020 21012 20206 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728971.1 protein_id gnl|my_center|LOCUS_11020 21134 21850 gene locus_tag LOCUS_11030 21134 21850 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247811.1 protein_id gnl|my_center|LOCUS_11030 21904 22320 gene locus_tag LOCUS_11040 21904 22320 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973339.1 protein_id gnl|my_center|LOCUS_11040 22393 23208 gene locus_tag LOCUS_11050 22393 23208 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977730.1 protein_id gnl|my_center|LOCUS_11050 23320 23598 gene locus_tag LOCUS_11060 23320 23598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 24057 23536 gene locus_tag LOCUS_11070 24057 23536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11070 25287 24715 gene locus_tag LOCUS_11080 25287 24715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414195.1 protein_id gnl|my_center|LOCUS_11080 25781 26584 gene locus_tag LOCUS_11090 25781 26584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 26682 28115 gene locus_tag LOCUS_11100 26682 28115 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 protein_id gnl|my_center|LOCUS_11100 28818 29072 gene locus_tag LOCUS_11110 28818 29072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11110 29556 29996 gene locus_tag LOCUS_11120 29556 29996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11120 30079 30267 gene locus_tag LOCUS_11130 30079 30267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 30707 30435 gene locus_tag LOCUS_11140 30707 30435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11140 30894 30628 gene locus_tag LOCUS_11150 30894 30628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11150 31632 31132 gene locus_tag LOCUS_11160 31632 31132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 31752 32360 gene locus_tag LOCUS_11170 31752 32360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence026 1396 596 gene locus_tag LOCUS_11180 1396 596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_11180 1465 2877 gene locus_tag LOCUS_11190 gene hisD 1465 2877 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224127.1 protein_id gnl|my_center|LOCUS_11190 2880 4007 gene locus_tag LOCUS_11200 2880 4007 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_11200 4004 4699 gene locus_tag LOCUS_11210 gene hisB 4004 4699 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052519.1 protein_id gnl|my_center|LOCUS_11210 4743 5342 gene locus_tag LOCUS_11220 4743 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5343 5984 gene locus_tag LOCUS_11230 gene hisH 5343 5984 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_11230 6049 6786 gene locus_tag LOCUS_11240 gene priA 6049 6786 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_11240 6783 7232 gene locus_tag LOCUS_11250 6783 7232 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_11250 7229 8011 gene locus_tag LOCUS_11260 7229 8011 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027875.1 protein_id gnl|my_center|LOCUS_11260 9598 8138 gene locus_tag LOCUS_11270 9598 8138 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776487.1 protein_id gnl|my_center|LOCUS_11270 9932 9648 gene locus_tag LOCUS_11280 9932 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11280 10094 9936 gene locus_tag LOCUS_11290 10094 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11290 10178 11476 gene locus_tag LOCUS_11300 10178 11476 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230592.1 protein_id gnl|my_center|LOCUS_11300 11796 12587 gene locus_tag LOCUS_11310 gene infC 11796 12587 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_11310 12666 12860 gene locus_tag LOCUS_11320 gene rpmI 12666 12860 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_11320 12901 13008 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13087 13470 gene locus_tag LOCUS_11330 gene rplT 13087 13470 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_11330 13525 14340 gene locus_tag LOCUS_11340 13525 14340 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_11340 14350 15447 gene locus_tag LOCUS_11350 14350 15447 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_11350 15462 15541 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15667 16761 gene locus_tag LOCUS_11360 gene pheS 15667 16761 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_11360 16761 19367 gene locus_tag LOCUS_11370 gene pheT 16761 19367 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_11370 19431 20480 gene locus_tag LOCUS_11380 gene argC 19431 20480 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_11380 20477 21643 gene locus_tag LOCUS_11390 gene argJ 20477 21643 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_11390 21702 22703 gene locus_tag LOCUS_11400 gene argB 21702 22703 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_11400 22703 23902 gene locus_tag LOCUS_11410 22703 23902 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776179.1 protein_id gnl|my_center|LOCUS_11410 23899 24909 gene locus_tag LOCUS_11420 gene argF 23899 24909 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062134354.1 protein_id gnl|my_center|LOCUS_11420 24906 25406 gene locus_tag LOCUS_11430 24906 25406 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_11430 25537 26739 gene locus_tag LOCUS_11440 25537 26739 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 protein_id gnl|my_center|LOCUS_11440 26736 28256 gene locus_tag LOCUS_11450 gene argH 26736 28256 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_11450 29273 28350 gene locus_tag LOCUS_11460 29273 28350 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533422.1 protein_id gnl|my_center|LOCUS_11460 29340 30029 gene locus_tag LOCUS_11470 29340 30029 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_11470 30078 31340 gene locus_tag LOCUS_11480 gene tyrS 30078 31340 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence027 1082 288 gene locus_tag LOCUS_11490 1082 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1904 1122 gene locus_tag LOCUS_11500 1904 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2478 2215 gene locus_tag LOCUS_11510 2478 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3259 4104 gene locus_tag LOCUS_11520 3259 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4786 4331 gene locus_tag LOCUS_11530 4786 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4984 6663 gene locus_tag LOCUS_11540 gene phaC 4984 6663 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 protein_id gnl|my_center|LOCUS_11540 7185 6970 gene locus_tag LOCUS_11550 7185 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11550 8353 7679 gene locus_tag LOCUS_11560 8353 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 8775 8401 gene locus_tag LOCUS_11570 8775 8401 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831581.1 protein_id gnl|my_center|LOCUS_11570 8995 9702 gene locus_tag LOCUS_11580 8995 9702 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 protein_id gnl|my_center|LOCUS_11580 10157 9834 gene locus_tag LOCUS_11590 10157 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 11662 10946 gene locus_tag LOCUS_11600 11662 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 12254 11793 gene locus_tag LOCUS_11610 12254 11793 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804009.1 protein_id gnl|my_center|LOCUS_11610 13159 12266 gene locus_tag LOCUS_11620 13159 12266 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893199.1 protein_id gnl|my_center|LOCUS_11620 13844 13464 gene locus_tag LOCUS_11630 13844 13464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 14321 13977 gene locus_tag LOCUS_11640 14321 13977 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435770.1 protein_id gnl|my_center|LOCUS_11640 15394 14504 gene locus_tag LOCUS_11650 15394 14504 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899172.1 protein_id gnl|my_center|LOCUS_11650 18309 15421 gene locus_tag LOCUS_11660 18309 15421 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950658.1 protein_id gnl|my_center|LOCUS_11660 15511 15643 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18930 18715 gene locus_tag LOCUS_11670 18930 18715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 19168 20730 gene locus_tag LOCUS_11680 19168 20730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 20727 22007 gene locus_tag LOCUS_11690 20727 22007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 22004 26026 gene locus_tag LOCUS_11700 22004 26026 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052667156.1 protein_id gnl|my_center|LOCUS_11700 26019 27260 gene locus_tag LOCUS_11710 26019 27260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 29394 28045 gene locus_tag LOCUS_11720 29394 28045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 30772 29858 gene locus_tag LOCUS_11730 30772 29858 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229482.1 protein_id gnl|my_center|LOCUS_11730 31053 30769 gene locus_tag LOCUS_11740 31053 30769 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229481.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence028 1465 1570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3104 2682 gene locus_tag LOCUS_11750 3104 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 4153 3119 gene locus_tag LOCUS_11760 gene nusA 4153 3119 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_11760 4743 4153 gene locus_tag LOCUS_11770 gene rimP 4743 4153 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_11770 4928 6229 gene locus_tag LOCUS_11780 4928 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 6540 6289 gene locus_tag LOCUS_11790 6540 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6680 7108 gene locus_tag LOCUS_11800 6680 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 7208 7519 gene locus_tag LOCUS_11810 7208 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 8022 7744 gene locus_tag LOCUS_11820 8022 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11820 8263 7979 gene locus_tag LOCUS_11830 8263 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11830 8750 8499 gene locus_tag LOCUS_11840 8750 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 8974 9660 gene locus_tag LOCUS_11850 8974 9660 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111761.1 protein_id gnl|my_center|LOCUS_11850 9657 10802 gene locus_tag LOCUS_11860 9657 10802 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091654.1 protein_id gnl|my_center|LOCUS_11860 10799 12166 gene locus_tag LOCUS_11870 10799 12166 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947654.1 protein_id gnl|my_center|LOCUS_11870 14818 12209 gene locus_tag LOCUS_11880 14818 12209 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514554.1 protein_id gnl|my_center|LOCUS_11880 15138 14815 gene locus_tag LOCUS_11890 15138 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 16711 15380 gene locus_tag LOCUS_11900 16711 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 17322 16804 gene locus_tag LOCUS_11910 17322 16804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11910 17362 17622 gene locus_tag LOCUS_11920 17362 17622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 18264 17842 gene locus_tag LOCUS_11930 18264 17842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11930 18593 18261 gene locus_tag LOCUS_11940 18593 18261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 18800 20794 gene locus_tag LOCUS_11950 18800 20794 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_11950 22592 20811 gene locus_tag LOCUS_11960 22592 20811 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804649.1 protein_id gnl|my_center|LOCUS_11960 23585 22743 gene locus_tag LOCUS_11970 23585 22743 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_11970 24807 23644 gene locus_tag LOCUS_11980 gene ispG 24807 23644 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_11980 26206 24866 gene locus_tag LOCUS_11990 26206 24866 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_11990 27441 26206 gene locus_tag LOCUS_12000 gene dxr 27441 26206 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_12000 28526 27498 gene locus_tag LOCUS_12010 28526 27498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 29654 28641 gene locus_tag LOCUS_12020 gene speB 29654 28641 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence029 254 859 gene locus_tag LOCUS_12030 254 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 999 1436 gene locus_tag LOCUS_12040 999 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2248 1805 gene locus_tag LOCUS_12050 2248 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3052 2303 gene locus_tag LOCUS_12060 3052 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3759 3049 gene locus_tag LOCUS_12070 3759 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 3921 5117 gene locus_tag LOCUS_12080 3921 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 5850 5527 gene locus_tag LOCUS_12090 5850 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 6265 5843 gene locus_tag LOCUS_12100 6265 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 7524 6262 gene locus_tag LOCUS_12110 7524 6262 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459849.1 protein_id gnl|my_center|LOCUS_12110 7780 7499 gene locus_tag LOCUS_12120 7780 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 7982 8293 gene locus_tag LOCUS_12130 7982 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 8290 9390 gene locus_tag LOCUS_12140 8290 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 10264 9716 gene locus_tag LOCUS_12150 10264 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 11418 10261 gene locus_tag LOCUS_12160 11418 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 11722 11513 gene locus_tag LOCUS_12170 11722 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 11921 12490 gene locus_tag LOCUS_12180 11921 12490 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225185.1 protein_id gnl|my_center|LOCUS_12180 13408 12611 gene locus_tag LOCUS_12190 13408 12611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 14096 13401 gene locus_tag LOCUS_12200 14096 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 15048 14695 gene locus_tag LOCUS_12210 15048 14695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 16629 15544 gene locus_tag LOCUS_12220 gene ychF 16629 15544 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730394.1 protein_id gnl|my_center|LOCUS_12220 16965 16684 gene locus_tag LOCUS_12230 16965 16684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 17041 18261 gene locus_tag LOCUS_12240 17041 18261 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_12240 18790 18359 gene locus_tag LOCUS_12250 18790 18359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 19914 18931 gene locus_tag LOCUS_12260 19914 18931 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973920.1 protein_id gnl|my_center|LOCUS_12260 20005 21249 gene locus_tag LOCUS_12270 gene xseA 20005 21249 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776296.1 protein_id gnl|my_center|LOCUS_12270 21297 21566 gene locus_tag LOCUS_12280 21297 21566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 22074 21577 gene locus_tag LOCUS_12290 22074 21577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 22300 23340 gene locus_tag LOCUS_12300 gene glpX 22300 23340 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_12300 23347 23913 gene locus_tag LOCUS_12310 23347 23913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12310 23795 23820 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23877 24299 gene locus_tag LOCUS_12320 23877 24299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12320 24312 25070 gene locus_tag LOCUS_12330 24312 25070 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222983.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12330 26056 25094 gene locus_tag LOCUS_12340 26056 25094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 27048 26119 gene locus_tag LOCUS_12350 27048 26119 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776594.1 protein_id gnl|my_center|LOCUS_12350 28028 27045 gene locus_tag LOCUS_12360 28028 27045 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930288.1 protein_id gnl|my_center|LOCUS_12360 29447 28125 gene locus_tag LOCUS_12370 29447 28125 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930026.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence030 376 1137 gene locus_tag LOCUS_12380 376 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1134 3542 gene locus_tag LOCUS_12390 1134 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 3791 5020 gene locus_tag LOCUS_12400 3791 5020 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730652.1 protein_id gnl|my_center|LOCUS_12400 5410 5679 gene locus_tag LOCUS_12410 5410 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 5724 6107 gene locus_tag LOCUS_12420 5724 6107 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222873.1 protein_id gnl|my_center|LOCUS_12420 6291 6379 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7937 6393 gene locus_tag LOCUS_12430 7937 6393 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950337.1 protein_id gnl|my_center|LOCUS_12430 8186 9373 gene locus_tag LOCUS_12440 8186 9373 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826413.1 protein_id gnl|my_center|LOCUS_12440 10879 9410 gene locus_tag LOCUS_12450 10879 9410 CDS product hydrogenase HycQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400662.1 protein_id gnl|my_center|LOCUS_12450 11541 10879 gene locus_tag LOCUS_12460 11541 10879 CDS product hydrogenase HycP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400661.1 protein_id gnl|my_center|LOCUS_12460 12588 11626 gene locus_tag LOCUS_12470 12588 11626 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_12470 14608 12602 gene locus_tag LOCUS_12480 14608 12602 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_12480 15084 14605 gene locus_tag LOCUS_12490 15084 14605 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400658.1 protein_id gnl|my_center|LOCUS_12490 15475 15122 gene locus_tag LOCUS_12500 15475 15122 CDS product lsr2/espR transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400657.1 protein_id gnl|my_center|LOCUS_12500 15674 16633 gene locus_tag LOCUS_12510 gene ligD 15674 16633 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 protein_id gnl|my_center|LOCUS_12510 17177 17016 gene locus_tag LOCUS_12520 17177 17016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 17375 17788 gene locus_tag LOCUS_12530 17375 17788 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413574.1 protein_id gnl|my_center|LOCUS_12530 17792 18106 gene locus_tag LOCUS_12540 17792 18106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12540 18435 19685 gene locus_tag LOCUS_12550 18435 19685 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899241.1 protein_id gnl|my_center|LOCUS_12550 19780 20040 gene locus_tag LOCUS_12560 19780 20040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 20085 21365 gene locus_tag LOCUS_12570 20085 21365 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_12570 21362 22741 gene locus_tag LOCUS_12580 21362 22741 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_12580 23724 22945 gene locus_tag LOCUS_12590 23724 22945 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775973.1 protein_id gnl|my_center|LOCUS_12590 24819 23788 gene locus_tag LOCUS_12600 gene rsgA 24819 23788 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_12600 25793 24816 gene locus_tag LOCUS_12610 25793 24816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12610 26172 25777 gene locus_tag LOCUS_12620 26172 25777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12620 26692 26165 gene locus_tag LOCUS_12630 26692 26165 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031617.1 protein_id gnl|my_center|LOCUS_12630 26771 27616 gene locus_tag LOCUS_12640 26771 27616 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_12640 27613 28266 gene locus_tag LOCUS_12650 27613 28266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 protein_id gnl|my_center|LOCUS_12650 29362 28280 gene locus_tag LOCUS_12660 29362 28280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 28317 28401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence031 46 546 gene locus_tag LOCUS_12670 46 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 981 1406 gene locus_tag LOCUS_12680 981 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12680 1438 1764 gene locus_tag LOCUS_12690 1438 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 2076 1756 gene locus_tag LOCUS_12700 2076 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1975 3201 gene locus_tag LOCUS_12710 1975 3201 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_12710 3205 4080 gene locus_tag LOCUS_12720 3205 4080 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_12720 4077 5045 gene locus_tag LOCUS_12730 4077 5045 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_12730 5090 5344 gene locus_tag LOCUS_12740 5090 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 5448 5284 gene locus_tag LOCUS_12750 5448 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 5386 5721 gene locus_tag LOCUS_12760 5386 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 5718 6218 gene locus_tag LOCUS_12770 5718 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 6266 6745 gene locus_tag LOCUS_12780 6266 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 6768 7880 gene locus_tag LOCUS_12790 gene prfB 6768 7880 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776050.1 protein_id gnl|my_center|LOCUS_12790 8119 8808 gene locus_tag LOCUS_12800 gene ftsE 8119 8808 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_12800 8886 9788 gene locus_tag LOCUS_12810 gene ftsX 8886 9788 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_12810 9839 11197 gene locus_tag LOCUS_12820 9839 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 11383 11862 gene locus_tag LOCUS_12830 gene smpB 11383 11862 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_12830 11898 13790 gene locus_tag LOCUS_12840 11898 13790 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223053.1 protein_id gnl|my_center|LOCUS_12840 17180 13803 gene locus_tag LOCUS_12850 17180 13803 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223655.1 protein_id gnl|my_center|LOCUS_12850 18306 17284 gene locus_tag LOCUS_12860 18306 17284 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_12860 18393 18760 gene locus_tag LOCUS_tm00010 18393 18760 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 18925 19257 gene locus_tag LOCUS_12870 18925 19257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 19254 19535 gene locus_tag LOCUS_12880 19254 19535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 19578 20393 gene locus_tag LOCUS_12890 19578 20393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12890 20088 20164 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20288 20977 gene locus_tag LOCUS_12900 20288 20977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12900 20974 21381 gene locus_tag LOCUS_12910 20974 21381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 21594 23567 gene locus_tag LOCUS_12920 21594 23567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 23731 24291 gene locus_tag LOCUS_12930 23731 24291 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_12930 24335 24658 gene locus_tag LOCUS_12940 24335 24658 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776029.1 protein_id gnl|my_center|LOCUS_12940 24792 26543 gene locus_tag LOCUS_12950 24792 26543 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 protein_id gnl|my_center|LOCUS_12950 26606 27817 gene locus_tag LOCUS_12960 gene hppD 26606 27817 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083248.1 protein_id gnl|my_center|LOCUS_12960 27238 27278 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27887 28750 gene locus_tag LOCUS_12970 27887 28750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence032 668 141 gene locus_tag LOCUS_12980 668 141 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12980 1399 665 gene locus_tag LOCUS_12990 1399 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12990 3294 1351 gene locus_tag LOCUS_13000 3294 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13000 3993 3337 gene locus_tag LOCUS_13010 gene kdpC 3993 3337 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529646.1 protein_id gnl|my_center|LOCUS_13010 6147 4015 gene locus_tag LOCUS_13020 gene kdpB 6147 4015 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_13020 7805 6147 gene locus_tag LOCUS_13030 gene kdpA 7805 6147 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730504.1 protein_id gnl|my_center|LOCUS_13030 8232 10205 gene locus_tag LOCUS_13040 8232 10205 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973119.1 protein_id gnl|my_center|LOCUS_13040 10914 11135 gene locus_tag LOCUS_13050 10914 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 12674 11208 gene locus_tag LOCUS_13060 12674 11208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723717.1 protein_id gnl|my_center|LOCUS_13060 12853 13227 gene locus_tag LOCUS_13070 12853 13227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 15575 13305 gene locus_tag LOCUS_13080 gene treS 15575 13305 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401001.1 protein_id gnl|my_center|LOCUS_13080 15852 16217 gene locus_tag LOCUS_13090 15852 16217 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831581.1 protein_id gnl|my_center|LOCUS_13090 16482 16556 gene locus_tag LOCUS_t00170 16482 16556 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16622 16696 gene locus_tag LOCUS_t00180 16622 16696 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16836 17006 gene locus_tag LOCUS_13100 gene rpmG 16836 17006 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776157.1 protein_id gnl|my_center|LOCUS_13100 17108 17554 gene locus_tag LOCUS_13110 17108 17554 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776156.1 protein_id gnl|my_center|LOCUS_13110 17547 17990 gene locus_tag LOCUS_13120 17547 17990 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_13120 17999 19093 gene locus_tag LOCUS_13130 17999 19093 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_13130 20137 19115 gene locus_tag LOCUS_13140 20137 19115 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_13140 20307 20630 gene locus_tag LOCUS_13150 20307 20630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 21923 20706 gene locus_tag LOCUS_13160 21923 20706 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_13160 22160 22233 gene locus_tag LOCUS_t00190 22160 22233 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 22350 22622 gene locus_tag LOCUS_13170 22350 22622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 22901 22981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23508 23942 gene locus_tag LOCUS_13180 gene rplK 23508 23942 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_13180 24266 24315 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24322 24606 gene locus_tag LOCUS_13190 24322 24606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 25000 25146 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25171 25629 gene locus_tag LOCUS_13200 25171 25629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 25711 26091 gene locus_tag LOCUS_13210 gene rplL 25711 26091 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222530.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence033 3786 616 gene locus_tag LOCUS_13220 3786 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4296 7244 gene locus_tag LOCUS_13230 4296 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 8611 7334 gene locus_tag LOCUS_13240 8611 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 9479 9802 gene locus_tag LOCUS_13250 9479 9802 CDS product DUF3892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091022.1 protein_id gnl|my_center|LOCUS_13250 12172 10862 gene locus_tag LOCUS_13260 12172 10862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 12253 12456 gene locus_tag LOCUS_13270 12253 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13270 12623 13681 gene locus_tag LOCUS_13280 12623 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 14446 13799 gene locus_tag LOCUS_13290 14446 13799 CDS product DUF2726 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818212.1 protein_id gnl|my_center|LOCUS_13290 15259 14726 gene locus_tag LOCUS_13300 15259 14726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 15677 15492 gene locus_tag LOCUS_13310 15677 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 16245 15961 gene locus_tag LOCUS_13320 16245 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 16966 17634 gene locus_tag LOCUS_13330 16966 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 17631 18503 gene locus_tag LOCUS_13340 17631 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 19500 20546 gene locus_tag LOCUS_13350 19500 20546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 20543 21160 gene locus_tag LOCUS_13360 20543 21160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 21170 21700 gene locus_tag LOCUS_13370 21170 21700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 22026 22190 gene locus_tag LOCUS_13380 22026 22190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 22670 25126 gene locus_tag LOCUS_13390 22670 25126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 25126 26601 gene locus_tag LOCUS_13400 25126 26601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 26711 27046 gene locus_tag LOCUS_13410 26711 27046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 27559 27320 gene locus_tag LOCUS_13420 27559 27320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence034 <1 2697 gene locus_tag LOCUS_13430 <1 2697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296243.1:MobF family relaxase 2926 3162 gene locus_tag LOCUS_13440 2926 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3349 4428 gene locus_tag LOCUS_13450 3349 4428 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861856.1 protein_id gnl|my_center|LOCUS_13450 4865 4461 gene locus_tag LOCUS_13460 gene sodN 4865 4461 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_13460 5039 5197 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7044 6094 gene locus_tag LOCUS_13470 7044 6094 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894625.1 protein_id gnl|my_center|LOCUS_13470 7943 7041 gene locus_tag LOCUS_13480 7943 7041 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230916.1 protein_id gnl|my_center|LOCUS_13480 8279 9445 gene locus_tag LOCUS_13490 8279 9445 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_13490 9684 11051 gene locus_tag LOCUS_13500 9684 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 11655 11152 gene locus_tag LOCUS_13510 11655 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 11712 13733 gene locus_tag LOCUS_13520 11712 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 12308 12415 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14171 13770 gene locus_tag LOCUS_13530 14171 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 14397 14801 gene locus_tag LOCUS_13540 14397 14801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 14798 15814 gene locus_tag LOCUS_13550 14798 15814 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_13550 15811 16356 gene locus_tag LOCUS_13560 15811 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 16353 17606 gene locus_tag LOCUS_13570 16353 17606 CDS product NADH-quinone oxidoreductase subunit NuoF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326195.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13570 17603 17806 gene locus_tag LOCUS_13580 17603 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13580 20194 18131 gene locus_tag LOCUS_13590 20194 18131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 20859 20191 gene locus_tag LOCUS_13600 20859 20191 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405298.1 protein_id gnl|my_center|LOCUS_13600 21569 20856 gene locus_tag LOCUS_13610 21569 20856 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 protein_id gnl|my_center|LOCUS_13610 22088 21573 gene locus_tag LOCUS_13620 22088 21573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 22929 22483 gene locus_tag LOCUS_13630 22929 22483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 23300 22926 gene locus_tag LOCUS_13640 23300 22926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 23970 23536 gene locus_tag LOCUS_13650 23970 23536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 24502 24188 gene locus_tag LOCUS_13660 24502 24188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857117.1 protein_id gnl|my_center|LOCUS_13660 25011 24547 gene locus_tag LOCUS_13670 25011 24547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 25384 25484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26508 26131 gene locus_tag LOCUS_13680 26508 26131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 27388 27134 gene locus_tag LOCUS_13690 27388 27134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence035 545 114 gene locus_tag LOCUS_13700 545 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1260 574 gene locus_tag LOCUS_13710 1260 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1826 1317 gene locus_tag LOCUS_13720 1826 1317 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_13720 5010 2014 gene locus_tag LOCUS_13730 5010 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 5273 5926 gene locus_tag LOCUS_13740 5273 5926 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230765.1 protein_id gnl|my_center|LOCUS_13740 6027 6797 gene locus_tag LOCUS_13750 6027 6797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776310.1 protein_id gnl|my_center|LOCUS_13750 6782 8356 gene locus_tag LOCUS_13760 6782 8356 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029630.1 protein_id gnl|my_center|LOCUS_13760 9099 8353 gene locus_tag LOCUS_13770 9099 8353 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_13770 10006 9197 gene locus_tag LOCUS_13780 gene map 10006 9197 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_13780 10127 10315 gene locus_tag LOCUS_13790 10127 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 10804 10334 gene locus_tag LOCUS_13800 10804 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 11833 10967 gene locus_tag LOCUS_13810 gene panB 11833 10967 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_13810 13816 12077 gene locus_tag LOCUS_13820 13816 12077 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_13820 13865 13937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14005 15348 gene locus_tag LOCUS_13830 14005 15348 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223948.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13830 15349 15636 gene locus_tag LOCUS_13840 15349 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13840 15691 17028 gene locus_tag LOCUS_13850 gene glnA 15691 17028 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_13850 17181 20165 gene locus_tag LOCUS_13860 17181 20165 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_13860 20262 21701 gene locus_tag LOCUS_13870 20262 21701 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315434.1 protein_id gnl|my_center|LOCUS_13870 22246 21758 gene locus_tag LOCUS_13880 22246 21758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 22683 22949 gene locus_tag LOCUS_13890 22683 22949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 23335 23009 gene locus_tag LOCUS_13900 23335 23009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 23517 23332 gene locus_tag LOCUS_13910 23517 23332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 25301 23880 gene locus_tag LOCUS_13920 25301 23880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 25841 25512 gene locus_tag LOCUS_13930 25841 25512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 26481 26095 gene locus_tag LOCUS_13940 26481 26095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 27081 26791 gene locus_tag LOCUS_13950 27081 26791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence036 1073 447 gene locus_tag LOCUS_13960 1073 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1924 1208 gene locus_tag LOCUS_13970 1924 1208 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211463095.1 protein_id gnl|my_center|LOCUS_13970 3578 1899 gene locus_tag LOCUS_13980 3578 1899 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_13980 4122 4306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5467 4403 gene locus_tag LOCUS_13990 5467 4403 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_13990 6313 5471 gene locus_tag LOCUS_14000 6313 5471 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_14000 6414 8126 gene locus_tag LOCUS_14010 gene sirA 6414 8126 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_14010 8123 8863 gene locus_tag LOCUS_14020 8123 8863 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_14020 8860 9810 gene locus_tag LOCUS_14030 gene cysD 8860 9810 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228434.1 protein_id gnl|my_center|LOCUS_14030 9810 11123 gene locus_tag LOCUS_14040 9810 11123 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972823.1 protein_id gnl|my_center|LOCUS_14040 11137 11892 gene locus_tag LOCUS_14050 11137 11892 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943936.1 protein_id gnl|my_center|LOCUS_14050 12531 12013 gene locus_tag LOCUS_14060 12531 12013 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088836.1 protein_id gnl|my_center|LOCUS_14060 13241 12987 gene locus_tag LOCUS_14070 13241 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 13655 14071 gene locus_tag LOCUS_14080 13655 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 14318 15364 gene locus_tag LOCUS_14090 14318 15364 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_14090 15361 16182 gene locus_tag LOCUS_14100 15361 16182 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_14100 16282 17040 gene locus_tag LOCUS_14110 16282 17040 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223724.1 protein_id gnl|my_center|LOCUS_14110 17768 17448 gene locus_tag LOCUS_14120 17768 17448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 20337 18169 gene locus_tag LOCUS_14130 gene helR 20337 18169 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728199.1 protein_id gnl|my_center|LOCUS_14130 21218 20766 gene locus_tag LOCUS_14140 21218 20766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 21867 21235 gene locus_tag LOCUS_14150 21867 21235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 22448 22047 gene locus_tag LOCUS_14160 22448 22047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 23084 22668 gene locus_tag LOCUS_14170 23084 22668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 23151 23540 gene locus_tag LOCUS_14180 23151 23540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 23533 23760 gene locus_tag LOCUS_14190 23533 23760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 24022 24558 gene locus_tag LOCUS_14200 24022 24558 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366168.1 protein_id gnl|my_center|LOCUS_14200 25317 24937 gene locus_tag LOCUS_14210 25317 24937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 25708 26181 gene locus_tag LOCUS_14220 25708 26181 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049746648.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence037 9 2102 gene locus_tag LOCUS_14230 9 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2188 4311 gene locus_tag LOCUS_14240 2188 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 4087 4205 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4212 5615 gene locus_tag LOCUS_14250 4212 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 5620 7860 gene locus_tag LOCUS_14260 5620 7860 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518812.1 protein_id gnl|my_center|LOCUS_14260 8898 8041 gene locus_tag LOCUS_14270 8898 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 9145 9489 gene locus_tag LOCUS_14280 9145 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 9486 10946 gene locus_tag LOCUS_14290 9486 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 11048 11404 gene locus_tag LOCUS_14300 11048 11404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 11388 11627 gene locus_tag LOCUS_14310 11388 11627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 13821 11881 gene locus_tag LOCUS_14320 13821 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 14390 13818 gene locus_tag LOCUS_14330 14390 13818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 15682 14387 gene locus_tag LOCUS_14340 15682 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 17117 15825 gene locus_tag LOCUS_14350 17117 15825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 17581 17282 gene locus_tag LOCUS_14360 17581 17282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 17685 18161 gene locus_tag LOCUS_14370 17685 18161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 18551 18618 gene locus_tag LOCUS_t00200 18551 18618 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 18827 19291 gene locus_tag LOCUS_14380 18827 19291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 19402 19701 gene locus_tag LOCUS_14390 19402 19701 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_14390 19691 20053 gene locus_tag LOCUS_14400 19691 20053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 21479 21943 gene locus_tag LOCUS_14410 21479 21943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 21930 22286 gene locus_tag LOCUS_14420 21930 22286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 22930 22325 gene locus_tag LOCUS_14430 22930 22325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 23120 23350 gene locus_tag LOCUS_14440 23120 23350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 23356 23628 gene locus_tag LOCUS_14450 23356 23628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 23748 24449 gene locus_tag LOCUS_14460 23748 24449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 26783 24570 gene locus_tag LOCUS_14470 26783 24570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 26022 26065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence038 588 286 gene locus_tag LOCUS_14480 588 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1214 1756 gene locus_tag LOCUS_14490 1214 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14490 2251 1793 gene locus_tag LOCUS_14500 2251 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3519 2248 gene locus_tag LOCUS_14510 3519 2248 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029184.1 protein_id gnl|my_center|LOCUS_14510 4086 3535 gene locus_tag LOCUS_14520 4086 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 4658 4206 gene locus_tag LOCUS_14530 4658 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 5124 4660 gene locus_tag LOCUS_14540 5124 4660 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_14540 5868 5167 gene locus_tag LOCUS_14550 5868 5167 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_14550 7015 5888 gene locus_tag LOCUS_14560 7015 5888 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 protein_id gnl|my_center|LOCUS_14560 7948 7067 gene locus_tag LOCUS_14570 7948 7067 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_14570 8089 8838 gene locus_tag LOCUS_14580 8089 8838 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_14580 8835 9440 gene locus_tag LOCUS_14590 8835 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 10500 9529 gene locus_tag LOCUS_14600 10500 9529 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_14600 11633 10683 gene locus_tag LOCUS_14610 11633 10683 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_14610 12130 11639 gene locus_tag LOCUS_14620 12130 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 13410 12127 gene locus_tag LOCUS_14630 13410 12127 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256376.1 protein_id gnl|my_center|LOCUS_14630 13873 13430 gene locus_tag LOCUS_14640 13873 13430 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_14640 14071 15870 gene locus_tag LOCUS_14650 14071 15870 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_14650 17210 15930 gene locus_tag LOCUS_14660 17210 15930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 18376 17207 gene locus_tag LOCUS_14670 18376 17207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 18900 18619 gene locus_tag LOCUS_14680 18900 18619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 19099 20928 gene locus_tag LOCUS_14690 19099 20928 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_14690 20950 21234 gene locus_tag LOCUS_14700 20950 21234 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_14700 21275 21346 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22419 21385 gene locus_tag LOCUS_14710 gene trpD 22419 21385 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_14710 23019 22453 gene locus_tag LOCUS_14720 23019 22453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 23288 23034 gene locus_tag LOCUS_14730 23288 23034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 23170 23739 gene locus_tag LOCUS_14740 23170 23739 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_14740 23786 24568 gene locus_tag LOCUS_14750 23786 24568 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_14750 24665 25741 gene locus_tag LOCUS_14760 24665 25741 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence039 263 514 gene locus_tag LOCUS_14770 gene yefM 263 514 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 protein_id gnl|my_center|LOCUS_14770 511 780 gene locus_tag LOCUS_14780 gene yoeB 511 780 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_14780 1471 1169 gene locus_tag LOCUS_14790 1471 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1558 2394 gene locus_tag LOCUS_14800 gene fdhD 1558 2394 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_14800 4427 2424 gene locus_tag LOCUS_14810 4427 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 5806 4430 gene locus_tag LOCUS_14820 gene selA 5806 4430 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727953.1 protein_id gnl|my_center|LOCUS_14820 5932 5837 gene locus_tag LOCUS_t00210 5932 5837 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 5982 6992 gene locus_tag LOCUS_14830 gene selD 5982 6992 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727954.1 protein_id gnl|my_center|LOCUS_14830 8339 7047 gene locus_tag LOCUS_14840 8339 7047 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476517.1 protein_id gnl|my_center|LOCUS_14840 9633 8452 gene locus_tag LOCUS_14850 gene nrfD 9633 8452 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225065.1 protein_id gnl|my_center|LOCUS_14850 10697 9630 gene locus_tag LOCUS_14860 10697 9630 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804586.1 protein_id gnl|my_center|LOCUS_14860 14092 10715 gene locus_tag LOCUS_14870 gene fdh 14092 10715 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225067.1 transl_except (pos:complement(13523..13525),aa:Sec) note codon on position 190 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_14870 13974 14204 gene locus_tag LOCUS_14880 13974 14204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 14324 14782 gene locus_tag LOCUS_14890 14324 14782 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223540.1 protein_id gnl|my_center|LOCUS_14890 14820 15146 gene locus_tag LOCUS_14900 14820 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 15741 15406 gene locus_tag LOCUS_14910 15741 15406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 16265 15738 gene locus_tag LOCUS_14920 16265 15738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 17309 16758 gene locus_tag LOCUS_14930 17309 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 17767 17306 gene locus_tag LOCUS_14940 17767 17306 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228480.1 protein_id gnl|my_center|LOCUS_14940 18571 17990 gene locus_tag LOCUS_14950 18571 17990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 20157 18703 gene locus_tag LOCUS_14960 20157 18703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 20492 20154 gene locus_tag LOCUS_14970 20492 20154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 21994 20600 gene locus_tag LOCUS_14980 21994 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 22572 22105 gene locus_tag LOCUS_14990 22572 22105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 22831 23730 gene locus_tag LOCUS_15000 22831 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 24415 23951 gene locus_tag LOCUS_15010 24415 23951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 <25366 24791 gene locus_tag LOCUS_15020 <25366 24791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094791896.1:type IV secretory system conjugative DNA transfer family protein >Feature sequence040 412 996 gene locus_tag LOCUS_15030 412 996 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403827.1 protein_id gnl|my_center|LOCUS_15030 1049 1142 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1156 1587 gene locus_tag LOCUS_15040 1156 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2678 1893 gene locus_tag LOCUS_15050 2678 1893 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900518.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15050 3073 2651 gene locus_tag LOCUS_15060 3073 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15060 3224 3526 gene locus_tag LOCUS_15070 3224 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3516 4145 gene locus_tag LOCUS_15080 3516 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4142 4900 gene locus_tag LOCUS_15090 4142 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4976 5896 gene locus_tag LOCUS_15100 4976 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6982 6059 gene locus_tag LOCUS_15110 6982 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7584 6979 gene locus_tag LOCUS_15120 7584 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 8846 7584 gene locus_tag LOCUS_15130 8846 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 9132 9875 gene locus_tag LOCUS_15140 9132 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15140 9872 10267 gene locus_tag LOCUS_15150 9872 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15150 10222 10488 gene locus_tag LOCUS_15160 10222 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 10598 11374 gene locus_tag LOCUS_15170 10598 11374 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729851.1 protein_id gnl|my_center|LOCUS_15170 11563 11772 gene locus_tag LOCUS_15180 11563 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 12453 13436 gene locus_tag LOCUS_15190 12453 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15190 13411 14415 gene locus_tag LOCUS_15200 13411 14415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 14537 15169 gene locus_tag LOCUS_15210 14537 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 16491 15370 gene locus_tag LOCUS_15220 16491 15370 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_15220 16776 17000 gene locus_tag LOCUS_15230 16776 17000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 17186 17797 gene locus_tag LOCUS_15240 17186 17797 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079489.1 protein_id gnl|my_center|LOCUS_15240 18542 17883 gene locus_tag LOCUS_15250 18542 17883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226912.1 protein_id gnl|my_center|LOCUS_15250 20553 19189 gene locus_tag LOCUS_15260 20553 19189 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219112755.1 protein_id gnl|my_center|LOCUS_15260 21746 20550 gene locus_tag LOCUS_15270 gene serA 21746 20550 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363235.1 protein_id gnl|my_center|LOCUS_15270 21974 22858 gene locus_tag LOCUS_15280 21974 22858 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228672.1 protein_id gnl|my_center|LOCUS_15280 23974 22790 gene locus_tag LOCUS_15290 23974 22790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 24038 24097 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence041 1660 137 gene locus_tag LOCUS_15300 1660 137 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226747.1 protein_id gnl|my_center|LOCUS_15300 2593 1712 gene locus_tag LOCUS_15310 gene nadC 2593 1712 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 protein_id gnl|my_center|LOCUS_15310 4329 2590 gene locus_tag LOCUS_15320 4329 2590 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_15320 4748 4326 gene locus_tag LOCUS_15330 4748 4326 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 protein_id gnl|my_center|LOCUS_15330 5779 4760 gene locus_tag LOCUS_15340 gene panC 5779 4760 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975450.1 protein_id gnl|my_center|LOCUS_15340 6684 5776 gene locus_tag LOCUS_15350 6684 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15350 6769 7704 gene locus_tag LOCUS_15360 6769 7704 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_15360 7731 8894 gene locus_tag LOCUS_15370 7731 8894 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_15370 9480 8956 gene locus_tag LOCUS_15380 9480 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 10355 9474 gene locus_tag LOCUS_15390 10355 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 11164 10352 gene locus_tag LOCUS_15400 gene folP 11164 10352 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_15400 12894 11161 gene locus_tag LOCUS_15410 12894 11161 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028953.1 protein_id gnl|my_center|LOCUS_15410 13484 12891 gene locus_tag LOCUS_15420 gene folE 13484 12891 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_15420 14652 13453 gene locus_tag LOCUS_15430 14652 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15430 15547 14681 gene locus_tag LOCUS_15440 15547 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15440 16293 15742 gene locus_tag LOCUS_15450 gene hpt 16293 15742 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_15450 17126 16359 gene locus_tag LOCUS_15460 17126 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 17298 17345 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18554 17460 gene locus_tag LOCUS_15470 18554 17460 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_15470 18671 19186 gene locus_tag LOCUS_15480 18671 19186 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_15480 20537 19197 gene locus_tag LOCUS_15490 20537 19197 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104427.1 protein_id gnl|my_center|LOCUS_15490 21214 20567 gene locus_tag LOCUS_15500 21214 20567 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975126.1 protein_id gnl|my_center|LOCUS_15500 21941 21222 gene locus_tag LOCUS_15510 21941 21222 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226228.1 protein_id gnl|my_center|LOCUS_15510 22014 22655 gene locus_tag LOCUS_15520 gene folE 22014 22655 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_15520 22721 23893 gene locus_tag LOCUS_15530 22721 23893 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence042 1474 2451 gene locus_tag LOCUS_15540 1474 2451 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027413.1 protein_id gnl|my_center|LOCUS_15540 2625 3440 gene locus_tag LOCUS_15550 2625 3440 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226558.1 protein_id gnl|my_center|LOCUS_15550 5378 3423 gene locus_tag LOCUS_15560 gene acs 5378 3423 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_15560 5983 5501 gene locus_tag LOCUS_15570 5983 5501 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969220.1 protein_id gnl|my_center|LOCUS_15570 6068 7015 gene locus_tag LOCUS_15580 6068 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 7755 7141 gene locus_tag LOCUS_15590 gene satP 7755 7141 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368353.1 protein_id gnl|my_center|LOCUS_15590 9506 7959 gene locus_tag LOCUS_15600 9506 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 9822 9514 gene locus_tag LOCUS_15610 9822 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 10724 9909 gene locus_tag LOCUS_15620 10724 9909 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_15620 11958 10735 gene locus_tag LOCUS_15630 11958 10735 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_15630 11962 12804 gene locus_tag LOCUS_15640 11962 12804 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_15640 13345 14073 gene locus_tag LOCUS_15650 13345 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 14070 15221 gene locus_tag LOCUS_15660 14070 15221 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_15660 15218 16024 gene locus_tag LOCUS_15670 15218 16024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 16021 16611 gene locus_tag LOCUS_15680 16021 16611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 16689 16772 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17038 17376 gene locus_tag LOCUS_15690 17038 17376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 17477 17800 gene locus_tag LOCUS_15700 17477 17800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 18004 17783 gene locus_tag LOCUS_15710 18004 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15710 19214 17910 gene locus_tag LOCUS_15720 19214 17910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15720 19295 19384 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19715 20062 gene locus_tag LOCUS_15730 19715 20062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 20337 20687 gene locus_tag LOCUS_15740 gene bldG 20337 20687 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_15740 20906 23293 gene locus_tag LOCUS_15750 20906 23293 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_15750 24229 23417 gene locus_tag LOCUS_15760 24229 23417 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence043 993 331 gene locus_tag LOCUS_15770 993 331 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037896947.1 protein_id gnl|my_center|LOCUS_15770 1639 1058 gene locus_tag LOCUS_15780 gene dcd 1639 1058 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_15780 1751 1811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3106 1928 gene locus_tag LOCUS_15790 3106 1928 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_15790 3297 3094 gene locus_tag LOCUS_15800 3297 3094 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043441830.1 protein_id gnl|my_center|LOCUS_15800 4829 3315 gene locus_tag LOCUS_15810 4829 3315 CDS product plasmid replication initiator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108990145.1 protein_id gnl|my_center|LOCUS_15810 5173 4829 gene locus_tag LOCUS_15820 5173 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 6606 5173 gene locus_tag LOCUS_15830 6606 5173 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110627.1 protein_id gnl|my_center|LOCUS_15830 6859 6608 gene locus_tag LOCUS_15840 6859 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 7134 6856 gene locus_tag LOCUS_15850 7134 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 7363 7112 gene locus_tag LOCUS_15860 7363 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 7802 7365 gene locus_tag LOCUS_15870 7802 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 7876 8703 gene locus_tag LOCUS_15880 7876 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 9595 8819 gene locus_tag LOCUS_15890 9595 8819 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 protein_id gnl|my_center|LOCUS_15890 9652 10086 gene locus_tag LOCUS_15900 9652 10086 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055467863.1 protein_id gnl|my_center|LOCUS_15900 10865 10116 gene locus_tag LOCUS_15910 10865 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 11983 10862 gene locus_tag LOCUS_15920 11983 10862 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749584.1 protein_id gnl|my_center|LOCUS_15920 12336 11986 gene locus_tag LOCUS_15930 12336 11986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 14693 12618 gene locus_tag LOCUS_15940 14693 12618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 17263 14693 gene locus_tag LOCUS_15950 17263 14693 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223090.1 protein_id gnl|my_center|LOCUS_15950 17667 17263 gene locus_tag LOCUS_15960 17667 17263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 17926 17672 gene locus_tag LOCUS_15970 17926 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562703.1 protein_id gnl|my_center|LOCUS_15970 18351 18100 gene locus_tag LOCUS_15980 18351 18100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 18466 18804 gene locus_tag LOCUS_15990 18466 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 18788 19324 gene locus_tag LOCUS_16000 18788 19324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 19544 20233 gene locus_tag LOCUS_16010 19544 20233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 20233 21792 gene locus_tag LOCUS_16020 20233 21792 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_16020 21789 24284 gene locus_tag LOCUS_16030 21789 24284 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence044 1366 65 gene locus_tag LOCUS_16040 1366 65 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_16040 335 375 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2498 1359 gene locus_tag LOCUS_16050 2498 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4793 2529 gene locus_tag LOCUS_16060 4793 2529 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 protein_id gnl|my_center|LOCUS_16060 6043 4790 gene locus_tag LOCUS_16070 6043 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 7056 6040 gene locus_tag LOCUS_16080 7056 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 8393 7053 gene locus_tag LOCUS_16090 8393 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222294.1 protein_id gnl|my_center|LOCUS_16090 9817 8390 gene locus_tag LOCUS_16100 9817 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 10389 9814 gene locus_tag LOCUS_16110 10389 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 11682 10417 gene locus_tag LOCUS_16120 11682 10417 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479620.1 protein_id gnl|my_center|LOCUS_16120 12157 11702 gene locus_tag LOCUS_16130 12157 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 12163 12227 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12615 14162 gene locus_tag LOCUS_16140 12615 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16140 14162 15277 gene locus_tag LOCUS_16150 14162 15277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 15265 16710 gene locus_tag LOCUS_16160 15265 16710 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_16160 17890 18070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18788 18186 gene locus_tag LOCUS_16170 18788 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 18876 20738 gene locus_tag LOCUS_16180 18876 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 20662 20916 gene locus_tag LOCUS_16190 20662 20916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 20921 22129 gene locus_tag LOCUS_16200 20921 22129 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223998.1 protein_id gnl|my_center|LOCUS_16200 23418 23107 gene locus_tag LOCUS_16210 23418 23107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 23763 24101 gene locus_tag LOCUS_16220 23763 24101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16220 24711 24118 gene locus_tag LOCUS_16230 24711 24118 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence045 <1 897 gene locus_tag LOCUS_16240 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030467.1:vitamin B12-dependent ribonucleotide reductase 1905 1087 gene locus_tag LOCUS_16250 1905 1087 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227194.1 protein_id gnl|my_center|LOCUS_16250 5161 2060 gene locus_tag LOCUS_16260 5161 2060 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 protein_id gnl|my_center|LOCUS_16260 6078 5254 gene locus_tag LOCUS_16270 6078 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 6757 6422 gene locus_tag LOCUS_16280 6757 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 6933 6754 gene locus_tag LOCUS_16290 6933 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 7745 7101 gene locus_tag LOCUS_16300 7745 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 11286 7873 gene locus_tag LOCUS_16310 11286 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 14204 11283 gene locus_tag LOCUS_16320 14204 11283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 14323 14378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15873 14659 gene locus_tag LOCUS_16330 15873 14659 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081138.1 protein_id gnl|my_center|LOCUS_16330 16442 15969 gene locus_tag LOCUS_16340 16442 15969 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895382.1 protein_id gnl|my_center|LOCUS_16340 17411 16554 gene locus_tag LOCUS_16350 17411 16554 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_16350 17709 17395 gene locus_tag LOCUS_16360 17709 17395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 19032 17893 gene locus_tag LOCUS_16370 19032 17893 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_16370 21091 19367 gene locus_tag LOCUS_16380 21091 19367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 22281 21088 gene locus_tag LOCUS_16390 22281 21088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_16390 23021 22278 gene locus_tag LOCUS_16400 23021 22278 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929996.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence046 <1 681 gene locus_tag LOCUS_16410 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975715.1:phosphopyruvate hydratase 1172 2566 gene locus_tag LOCUS_16420 1172 2566 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230584.1 protein_id gnl|my_center|LOCUS_16420 2786 3739 gene locus_tag LOCUS_16430 2786 3739 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_16430 3919 4362 gene locus_tag LOCUS_16440 3919 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225797.1 protein_id gnl|my_center|LOCUS_16440 4744 4517 gene locus_tag LOCUS_16450 4744 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5417 4722 gene locus_tag LOCUS_16460 5417 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 6166 5861 gene locus_tag LOCUS_16470 6166 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 6379 6519 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6743 6531 gene locus_tag LOCUS_16480 6743 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 7036 7189 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7637 8275 gene locus_tag LOCUS_16490 gene upp 7637 8275 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_16490 8391 8561 gene locus_tag LOCUS_16500 8391 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 8571 9347 gene locus_tag LOCUS_16510 8571 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 9579 10544 gene locus_tag LOCUS_16520 9579 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 11925 10531 gene locus_tag LOCUS_16530 11925 10531 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223979.1 protein_id gnl|my_center|LOCUS_16530 12257 11922 gene locus_tag LOCUS_16540 12257 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 13378 12257 gene locus_tag LOCUS_16550 13378 12257 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223977.1 protein_id gnl|my_center|LOCUS_16550 13533 14615 gene locus_tag LOCUS_16560 13533 14615 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467826.1 protein_id gnl|my_center|LOCUS_16560 14901 15074 gene locus_tag LOCUS_16570 14901 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 15075 15467 gene locus_tag LOCUS_16580 15075 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 15467 16309 gene locus_tag LOCUS_16590 15467 16309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 16499 16708 gene locus_tag LOCUS_16600 16499 16708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 17787 16813 gene locus_tag LOCUS_16610 17787 16813 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_16610 18094 17873 gene locus_tag LOCUS_16620 18094 17873 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056341.1 protein_id gnl|my_center|LOCUS_16620 19722 18214 gene locus_tag LOCUS_16630 19722 18214 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_16630 20381 19875 gene locus_tag LOCUS_16640 20381 19875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 20692 20348 gene locus_tag LOCUS_16650 20692 20348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 20848 21165 gene locus_tag LOCUS_16660 20848 21165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 22310 22383 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23328 22636 gene locus_tag LOCUS_16670 23328 22636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence047 2703 1867 gene locus_tag LOCUS_16680 2703 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3191 3682 gene locus_tag LOCUS_16690 3191 3682 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030444.1 protein_id gnl|my_center|LOCUS_16690 3786 4778 gene locus_tag LOCUS_16700 gene tdh 3786 4778 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_16700 4865 6064 gene locus_tag LOCUS_16710 4865 6064 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_16710 7406 6039 gene locus_tag LOCUS_16720 7406 6039 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_16720 7762 7421 gene locus_tag LOCUS_16730 7762 7421 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_16730 8039 7755 gene locus_tag LOCUS_16740 8039 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 8176 8643 gene locus_tag LOCUS_16750 gene bcp 8176 8643 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_16750 8842 8924 gene locus_tag LOCUS_t00220 8842 8924 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8939 9421 gene locus_tag LOCUS_16760 gene arfB 8939 9421 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776269.1 protein_id gnl|my_center|LOCUS_16760 10993 9470 gene locus_tag LOCUS_16770 10993 9470 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112402.1 protein_id gnl|my_center|LOCUS_16770 11663 11049 gene locus_tag LOCUS_16780 gene rdgB 11663 11049 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_16780 11836 11660 gene locus_tag LOCUS_16790 11836 11660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 11879 12031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13185 12418 gene locus_tag LOCUS_16800 13185 12418 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_16800 13991 13182 gene locus_tag LOCUS_16810 gene murI 13991 13182 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 protein_id gnl|my_center|LOCUS_16810 14679 14074 gene locus_tag LOCUS_16820 14679 14074 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776025.1 protein_id gnl|my_center|LOCUS_16820 15042 14752 gene locus_tag LOCUS_16830 gene clpS 15042 14752 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_16830 15066 16379 gene locus_tag LOCUS_16840 15066 16379 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_16840 16403 17005 gene locus_tag LOCUS_16850 16403 17005 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_16850 18305 17052 gene locus_tag LOCUS_16860 18305 17052 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083253.1 protein_id gnl|my_center|LOCUS_16860 18384 19289 gene locus_tag LOCUS_16870 18384 19289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113317.1 protein_id gnl|my_center|LOCUS_16870 19286 20539 gene locus_tag LOCUS_16880 gene fahA 19286 20539 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029743.1 protein_id gnl|my_center|LOCUS_16880 21031 20546 gene locus_tag LOCUS_16890 21031 20546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 21240 22499 gene locus_tag LOCUS_16900 21240 22499 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_16900 22515 22829 gene locus_tag LOCUS_16910 22515 22829 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence048 1410 682 gene locus_tag LOCUS_16920 gene recO 1410 682 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_16920 3222 1459 gene locus_tag LOCUS_16930 gene leuA 3222 1459 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_16930 3344 3778 gene locus_tag LOCUS_16940 3344 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 4767 3853 gene locus_tag LOCUS_16950 gene era 4767 3853 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_16950 6092 4764 gene locus_tag LOCUS_16960 6092 4764 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_16960 6605 6117 gene locus_tag LOCUS_16970 gene ybeY 6605 6117 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 protein_id gnl|my_center|LOCUS_16970 7625 6612 gene locus_tag LOCUS_16980 7625 6612 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_16980 8052 7687 gene locus_tag LOCUS_16990 8052 7687 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_16990 8121 8675 gene locus_tag LOCUS_17000 8121 8675 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975326.1 protein_id gnl|my_center|LOCUS_17000 8672 9793 gene locus_tag LOCUS_17010 8672 9793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 10563 9820 gene locus_tag LOCUS_17020 10563 9820 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_17020 11743 10601 gene locus_tag LOCUS_17030 gene dnaJ 11743 10601 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_17030 12816 11785 gene locus_tag LOCUS_17040 gene hrcA 12816 11785 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_17040 12937 13908 gene locus_tag LOCUS_17050 12937 13908 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057615.1 protein_id gnl|my_center|LOCUS_17050 14077 14517 gene locus_tag LOCUS_17060 14077 14517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 15740 14514 gene locus_tag LOCUS_17070 gene hemW 15740 14514 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_17070 18440 15789 gene locus_tag LOCUS_17080 18440 15789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 16652 16713 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18546 19064 gene locus_tag LOCUS_17090 18546 19064 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775768.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17090 20257 19076 gene locus_tag LOCUS_17100 20257 19076 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_17100 20562 20272 gene locus_tag LOCUS_17110 20562 20272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 20902 20612 gene locus_tag LOCUS_17120 20902 20612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 22543 20915 gene locus_tag LOCUS_17130 22543 20915 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188488774.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence049 856 389 gene locus_tag LOCUS_17140 856 389 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142456.1 protein_id gnl|my_center|LOCUS_17140 941 1231 gene locus_tag LOCUS_17150 941 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1337 1999 gene locus_tag LOCUS_17160 1337 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17160 2003 2908 gene locus_tag LOCUS_17170 gene dapB 2003 2908 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804662.1 protein_id gnl|my_center|LOCUS_17170 2040 2115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3316 3002 gene locus_tag LOCUS_17180 3316 3002 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804664.1 protein_id gnl|my_center|LOCUS_17180 4107 3313 gene locus_tag LOCUS_17190 4107 3313 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804665.1 protein_id gnl|my_center|LOCUS_17190 4290 4135 gene locus_tag LOCUS_17200 4290 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 4289 4831 gene locus_tag LOCUS_17210 4289 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 4809 5870 gene locus_tag LOCUS_17220 gene paaA 4809 5870 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031683.1 protein_id gnl|my_center|LOCUS_17220 5867 6181 gene locus_tag LOCUS_17230 gene paaB 5867 6181 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_17230 6178 7020 gene locus_tag LOCUS_17240 gene paaC 6178 7020 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223465.1 protein_id gnl|my_center|LOCUS_17240 7053 7538 gene locus_tag LOCUS_17250 gene paaJ 7053 7538 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223466.1 protein_id gnl|my_center|LOCUS_17250 7538 8719 gene locus_tag LOCUS_17260 gene paaK 7538 8719 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083203.1 protein_id gnl|my_center|LOCUS_17260 8880 9086 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9602 9138 gene locus_tag LOCUS_17270 9602 9138 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008593045.1 protein_id gnl|my_center|LOCUS_17270 10483 9599 gene locus_tag LOCUS_17280 10483 9599 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089252.1 protein_id gnl|my_center|LOCUS_17280 10533 11372 gene locus_tag LOCUS_17290 gene dapA 10533 11372 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_17290 11468 13054 gene locus_tag LOCUS_17300 11468 13054 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_17300 14924 13629 gene locus_tag LOCUS_17310 14924 13629 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224833.1 protein_id gnl|my_center|LOCUS_17310 14953 15162 gene locus_tag LOCUS_17320 14953 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 15419 15467 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15828 18476 gene locus_tag LOCUS_17330 15828 18476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 18686 19222 gene locus_tag LOCUS_17340 18686 19222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 19391 20314 gene locus_tag LOCUS_17350 19391 20314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 21804 20458 gene locus_tag LOCUS_17360 21804 20458 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence050 790 104 gene locus_tag LOCUS_17370 790 104 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227997.1 protein_id gnl|my_center|LOCUS_17370 1251 1814 gene locus_tag LOCUS_17380 1251 1814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975880.1 protein_id gnl|my_center|LOCUS_17380 1855 2883 gene locus_tag LOCUS_17390 1855 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2883 3680 gene locus_tag LOCUS_17400 2883 3680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975878.1 protein_id gnl|my_center|LOCUS_17400 3776 4753 gene locus_tag LOCUS_17410 3776 4753 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028669.1 protein_id gnl|my_center|LOCUS_17410 4906 5787 gene locus_tag LOCUS_17420 4906 5787 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225443.1 protein_id gnl|my_center|LOCUS_17420 6094 7173 gene locus_tag LOCUS_17430 6094 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225442.1 protein_id gnl|my_center|LOCUS_17430 8377 7289 gene locus_tag LOCUS_17440 8377 7289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_17440 9195 8377 gene locus_tag LOCUS_17450 9195 8377 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_17450 10076 9192 gene locus_tag LOCUS_17460 10076 9192 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 protein_id gnl|my_center|LOCUS_17460 11199 10069 gene locus_tag LOCUS_17470 11199 10069 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_17470 11403 12803 gene locus_tag LOCUS_17480 11403 12803 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_17480 14693 12921 gene locus_tag LOCUS_17490 14693 12921 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_17490 15149 14871 gene locus_tag LOCUS_17500 15149 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 15421 18867 gene locus_tag LOCUS_17510 15421 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 19300 18860 gene locus_tag LOCUS_17520 19300 18860 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929528.1 protein_id gnl|my_center|LOCUS_17520 19415 20599 gene locus_tag LOCUS_17530 19415 20599 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412771.1 protein_id gnl|my_center|LOCUS_17530 20677 22269 gene locus_tag LOCUS_17540 20677 22269 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231527.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence051 786 85 gene locus_tag LOCUS_17550 786 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1724 708 gene locus_tag LOCUS_17560 1724 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 825 922 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2673 1717 gene locus_tag LOCUS_17570 2673 1717 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951710.1 protein_id gnl|my_center|LOCUS_17570 2804 3355 gene locus_tag LOCUS_17580 2804 3355 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228809.1 protein_id gnl|my_center|LOCUS_17580 3419 4267 gene locus_tag LOCUS_17590 3419 4267 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228811.1 protein_id gnl|my_center|LOCUS_17590 4292 4882 gene locus_tag LOCUS_17600 4292 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 6042 4939 gene locus_tag LOCUS_17610 gene gcvT 6042 4939 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085318.1 protein_id gnl|my_center|LOCUS_17610 6120 7685 gene locus_tag LOCUS_17620 6120 7685 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_17620 7938 7729 gene locus_tag LOCUS_17630 7938 7729 CDS product DUF5302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228723.1 protein_id gnl|my_center|LOCUS_17630 8315 8007 gene locus_tag LOCUS_17640 8315 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 8676 10055 gene locus_tag LOCUS_17650 gene lpdA 8676 10055 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_17650 10160 11941 gene locus_tag LOCUS_17660 gene sucB 10160 11941 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775679.1 protein_id gnl|my_center|LOCUS_17660 11956 12864 gene locus_tag LOCUS_17670 11956 12864 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_17670 13279 12878 gene locus_tag LOCUS_17680 13279 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 14322 13363 gene locus_tag LOCUS_17690 14322 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 13388 13414 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14203 14817 gene locus_tag LOCUS_17700 14203 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 15820 14747 gene locus_tag LOCUS_17710 15820 14747 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230995.1 protein_id gnl|my_center|LOCUS_17710 18014 15807 gene locus_tag LOCUS_17720 18014 15807 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226971.1 protein_id gnl|my_center|LOCUS_17720 18088 18741 gene locus_tag LOCUS_17730 gene lipB 18088 18741 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 protein_id gnl|my_center|LOCUS_17730 18951 19976 gene locus_tag LOCUS_17740 gene lipA 18951 19976 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060750.1 protein_id gnl|my_center|LOCUS_17740 19993 20727 gene locus_tag LOCUS_17750 19993 20727 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775683.1 protein_id gnl|my_center|LOCUS_17750 20822 20971 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21622 21158 gene locus_tag LOCUS_17760 21622 21158 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_17760 21835 22038 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence052 870 307 gene locus_tag LOCUS_17770 870 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17770 1811 1215 gene locus_tag LOCUS_17780 1811 1215 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013585.1 protein_id gnl|my_center|LOCUS_17780 2326 1823 gene locus_tag LOCUS_17790 2326 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2392 2763 gene locus_tag LOCUS_17800 2392 2763 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_17800 3623 2769 gene locus_tag LOCUS_17810 3623 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3936 3640 gene locus_tag LOCUS_17820 3936 3640 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_17820 4018 4728 gene locus_tag LOCUS_17830 gene glnR 4018 4728 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_17830 4801 5829 gene locus_tag LOCUS_17840 gene mshD 4801 5829 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_17840 5961 8147 gene locus_tag LOCUS_17850 5961 8147 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_17850 8170 9114 gene locus_tag LOCUS_17860 8170 9114 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_17860 9293 10000 gene locus_tag LOCUS_17870 9293 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17870 10200 10436 gene locus_tag LOCUS_17880 10200 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 10463 11473 gene locus_tag LOCUS_17890 gene pstC 10463 11473 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230714.1 protein_id gnl|my_center|LOCUS_17890 11470 12396 gene locus_tag LOCUS_17900 gene pstA 11470 12396 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064265.1 protein_id gnl|my_center|LOCUS_17900 12454 13230 gene locus_tag LOCUS_17910 gene pstB 12454 13230 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730783.1 protein_id gnl|my_center|LOCUS_17910 14204 13206 gene locus_tag LOCUS_17920 gene pitH 14204 13206 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_17920 13264 13350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14899 14210 gene locus_tag LOCUS_17930 14899 14210 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_17930 15118 14933 gene locus_tag LOCUS_17940 15118 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 16015 15365 gene locus_tag LOCUS_17950 16015 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804371.1 protein_id gnl|my_center|LOCUS_17950 18577 16055 gene locus_tag LOCUS_17960 18577 16055 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222778.1 protein_id gnl|my_center|LOCUS_17960 19869 18619 gene locus_tag LOCUS_17970 gene ilvA 19869 18619 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223532.1 protein_id gnl|my_center|LOCUS_17970 20444 19866 gene locus_tag LOCUS_17980 20444 19866 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776270.1 protein_id gnl|my_center|LOCUS_17980 21198 20641 gene locus_tag LOCUS_17990 21198 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 21717 21851 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence053 123 893 gene locus_tag LOCUS_18000 123 893 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_18000 2176 956 gene locus_tag LOCUS_18010 2176 956 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047119416.1 protein_id gnl|my_center|LOCUS_18010 2247 3308 gene locus_tag LOCUS_18020 2247 3308 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005121850.1 protein_id gnl|my_center|LOCUS_18020 4447 3410 gene locus_tag LOCUS_18030 gene ligD 4447 3410 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_18030 4603 5022 gene locus_tag LOCUS_18040 gene msrB 4603 5022 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_18040 5074 5589 gene locus_tag LOCUS_18050 5074 5589 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977487.1 protein_id gnl|my_center|LOCUS_18050 6414 5704 gene locus_tag LOCUS_18060 6414 5704 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_18060 7849 6419 gene locus_tag LOCUS_18070 gene hemG 7849 6419 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_18070 8043 9017 gene locus_tag LOCUS_18080 8043 9017 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742052.1 protein_id gnl|my_center|LOCUS_18080 10252 9164 gene locus_tag LOCUS_18090 gene hemE 10252 9164 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_18090 11101 10268 gene locus_tag LOCUS_18100 11101 10268 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083532.1 protein_id gnl|my_center|LOCUS_18100 10995 11753 gene locus_tag LOCUS_18110 10995 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 11953 13194 gene locus_tag LOCUS_18120 11953 13194 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_18120 13254 14306 gene locus_tag LOCUS_18130 13254 14306 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_18130 14303 16429 gene locus_tag LOCUS_18140 14303 16429 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_18140 16536 18077 gene locus_tag LOCUS_18150 16536 18077 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_18150 20002 18110 gene locus_tag LOCUS_18160 gene dxs 20002 18110 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_18160 20265 20101 gene locus_tag LOCUS_18170 20265 20101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 20726 20394 gene locus_tag LOCUS_18180 20726 20394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence054 941 234 gene locus_tag LOCUS_18190 941 234 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_18190 1087 2076 gene locus_tag LOCUS_18200 1087 2076 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_18200 1731 1811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2117 2536 gene locus_tag LOCUS_18210 2117 2536 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228951.1 protein_id gnl|my_center|LOCUS_18210 3968 2547 gene locus_tag LOCUS_18220 3968 2547 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_18220 3980 5380 gene locus_tag LOCUS_18230 3980 5380 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_18230 6533 5403 gene locus_tag LOCUS_18240 6533 5403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704970.1 protein_id gnl|my_center|LOCUS_18240 7513 6530 gene locus_tag LOCUS_18250 7513 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18250 7613 7693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9185 8130 gene locus_tag LOCUS_18260 9185 8130 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211596.1 protein_id gnl|my_center|LOCUS_18260 10032 9307 gene locus_tag LOCUS_18270 gene aqpS 10032 9307 CDS product aquaglyceroporin AqpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969025.1 protein_id gnl|my_center|LOCUS_18270 10302 12182 gene locus_tag LOCUS_18280 10302 12182 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_18280 12892 12179 gene locus_tag LOCUS_18290 gene thiE 12892 12179 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976712.1 protein_id gnl|my_center|LOCUS_18290 13094 12885 gene locus_tag LOCUS_18300 13094 12885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 14289 13096 gene locus_tag LOCUS_18310 gene thiH 14289 13096 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210678.1 protein_id gnl|my_center|LOCUS_18310 15146 14286 gene locus_tag LOCUS_18320 15146 14286 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479758.1 protein_id gnl|my_center|LOCUS_18320 16120 15275 gene locus_tag LOCUS_18330 16120 15275 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_18330 18161 16122 gene locus_tag LOCUS_18340 18161 16122 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878112.1 protein_id gnl|my_center|LOCUS_18340 18441 18163 gene locus_tag LOCUS_18350 18441 18163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 18352 19116 gene locus_tag LOCUS_18360 18352 19116 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029242.1 protein_id gnl|my_center|LOCUS_18360 19220 19747 gene locus_tag LOCUS_18370 19220 19747 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230835.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence055 129 779 gene locus_tag LOCUS_18380 129 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 804 1964 gene locus_tag LOCUS_18390 804 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2031 2543 gene locus_tag LOCUS_18400 2031 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2562 3008 gene locus_tag LOCUS_18410 2562 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3005 3322 gene locus_tag LOCUS_18420 3005 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 3322 3684 gene locus_tag LOCUS_18430 3322 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 3681 4121 gene locus_tag LOCUS_18440 3681 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 4151 4903 gene locus_tag LOCUS_18450 4151 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 4986 5495 gene locus_tag LOCUS_18460 4986 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 5741 8368 gene locus_tag LOCUS_18470 5741 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 8365 9681 gene locus_tag LOCUS_18480 8365 9681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 9681 10868 gene locus_tag LOCUS_18490 9681 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 10865 11794 gene locus_tag LOCUS_18500 10865 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 11804 12316 gene locus_tag LOCUS_18510 11804 12316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 12313 12735 gene locus_tag LOCUS_18520 12313 12735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 12744 13568 gene locus_tag LOCUS_18530 12744 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 13574 13981 gene locus_tag LOCUS_18540 13574 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 14001 14471 gene locus_tag LOCUS_18550 14001 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 14473 15033 gene locus_tag LOCUS_18560 14473 15033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 15194 16717 gene locus_tag LOCUS_18570 15194 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 17075 17356 gene locus_tag LOCUS_18580 17075 17356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 17353 18498 gene locus_tag LOCUS_18590 17353 18498 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_18590 18848 19087 gene locus_tag LOCUS_18600 18848 19087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 19084 19812 gene locus_tag LOCUS_18610 19084 19812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 19825 20670 gene locus_tag LOCUS_18620 19825 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 20667 20849 gene locus_tag LOCUS_18630 20667 20849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence056 857 1045 gene locus_tag LOCUS_18640 857 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1284 1069 gene locus_tag LOCUS_18650 1284 1069 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_18650 1954 1658 gene locus_tag LOCUS_18660 1954 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 3578 2232 gene locus_tag LOCUS_18670 3578 2232 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_18670 4518 3721 gene locus_tag LOCUS_18680 4518 3721 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184762880.1 protein_id gnl|my_center|LOCUS_18680 6914 4464 gene locus_tag LOCUS_18690 6914 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 7438 6911 gene locus_tag LOCUS_18700 7438 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18700 8279 7593 gene locus_tag LOCUS_18710 8279 7593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061915636.1 protein_id gnl|my_center|LOCUS_18710 8251 8763 gene locus_tag LOCUS_18720 8251 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 8808 9437 gene locus_tag LOCUS_18730 8808 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 11024 10542 gene locus_tag LOCUS_18740 11024 10542 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225944.1 protein_id gnl|my_center|LOCUS_18740 11440 11021 gene locus_tag LOCUS_18750 11440 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 13397 11586 gene locus_tag LOCUS_18760 gene treZ 13397 11586 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_18760 14677 13397 gene locus_tag LOCUS_18770 14677 13397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 15759 14596 gene locus_tag LOCUS_18780 15759 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 14681 14747 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15899 16495 gene locus_tag LOCUS_18790 15899 16495 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284350.1 protein_id gnl|my_center|LOCUS_18790 16507 17601 gene locus_tag LOCUS_18800 16507 17601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 17619 18518 gene locus_tag LOCUS_18810 17619 18518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 18800 19048 gene locus_tag LOCUS_18820 18800 19048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 19130 20209 gene locus_tag LOCUS_18830 19130 20209 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090620535.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence057 1185 787 gene locus_tag LOCUS_18840 1185 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2056 2664 gene locus_tag LOCUS_18850 2056 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 3382 3116 gene locus_tag LOCUS_18860 3382 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 3661 3845 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3867 4238 gene locus_tag LOCUS_18870 3867 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 4801 4295 gene locus_tag LOCUS_18880 4801 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 6673 4883 gene locus_tag LOCUS_18890 6673 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 8257 6761 gene locus_tag LOCUS_18900 8257 6761 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170315952.1 protein_id gnl|my_center|LOCUS_18900 9720 8260 gene locus_tag LOCUS_18910 9720 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137309464.1 protein_id gnl|my_center|LOCUS_18910 11114 9792 gene locus_tag LOCUS_18920 11114 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 11689 11111 gene locus_tag LOCUS_18930 11689 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 12207 11923 gene locus_tag LOCUS_18940 12207 11923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 12384 12683 gene locus_tag LOCUS_18950 12384 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 13807 12764 gene locus_tag LOCUS_18960 13807 12764 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029047.1 protein_id gnl|my_center|LOCUS_18960 15491 14040 gene locus_tag LOCUS_18970 15491 14040 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903975.1 protein_id gnl|my_center|LOCUS_18970 15871 15488 gene locus_tag LOCUS_18980 15871 15488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 16284 15871 gene locus_tag LOCUS_18990 16284 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 16414 17145 gene locus_tag LOCUS_19000 16414 17145 CDS product DUF5919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229650.1 protein_id gnl|my_center|LOCUS_19000 17615 17124 gene locus_tag LOCUS_19010 gene ispF 17615 17124 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_19010 18249 17608 gene locus_tag LOCUS_19020 18249 17608 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110615.1 protein_id gnl|my_center|LOCUS_19020 18588 18268 gene locus_tag LOCUS_19030 18588 18268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 19101 18754 gene locus_tag LOCUS_19040 19101 18754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 20041 19274 gene locus_tag LOCUS_19050 20041 19274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 20167 20361 gene locus_tag LOCUS_19060 20167 20361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence058 197 6 gene locus_tag LOCUS_19070 197 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 725 516 gene locus_tag LOCUS_19080 725 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 997 1929 gene locus_tag LOCUS_19090 997 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1989 3617 gene locus_tag LOCUS_19100 gene pruA 1989 3617 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730329.1 protein_id gnl|my_center|LOCUS_19100 4192 3695 gene locus_tag LOCUS_19110 4192 3695 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222385.1 protein_id gnl|my_center|LOCUS_19110 4769 4224 gene locus_tag LOCUS_19120 4769 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 5095 4766 gene locus_tag LOCUS_19130 5095 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 5256 10274 gene locus_tag LOCUS_19140 5256 10274 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_19140 10356 11864 gene locus_tag LOCUS_19150 10356 11864 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_19150 12114 11866 gene locus_tag LOCUS_19160 12114 11866 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_19160 12520 12975 gene locus_tag LOCUS_19170 12520 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 13143 13859 gene locus_tag LOCUS_19180 13143 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 13763 14365 gene locus_tag LOCUS_19190 13763 14365 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104243.1 protein_id gnl|my_center|LOCUS_19190 14362 15240 gene locus_tag LOCUS_19200 14362 15240 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079952.1 protein_id gnl|my_center|LOCUS_19200 15592 15326 gene locus_tag LOCUS_19210 15592 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 15639 16499 gene locus_tag LOCUS_19220 15639 16499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 17016 16441 gene locus_tag LOCUS_19230 17016 16441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 17185 17232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17494 17255 gene locus_tag LOCUS_19240 17494 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 17976 17692 gene locus_tag LOCUS_19250 17976 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 17948 19060 gene locus_tag LOCUS_19260 gene moaA 17948 19060 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_19260 19347 19072 gene locus_tag LOCUS_19270 19347 19072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 19763 19338 gene locus_tag LOCUS_19280 19763 19338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 19714 20076 gene locus_tag LOCUS_19290 19714 20076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 20122 20547 gene locus_tag LOCUS_19300 20122 20547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence059 151 363 gene locus_tag LOCUS_19310 151 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 395 667 gene locus_tag LOCUS_19320 gene hypC 395 667 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894089.1 protein_id gnl|my_center|LOCUS_19320 717 1850 gene locus_tag LOCUS_19330 gene hypD 717 1850 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_19330 2393 1860 gene locus_tag LOCUS_19340 2393 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2366 2632 gene locus_tag LOCUS_19350 2366 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2829 3485 gene locus_tag LOCUS_19360 2829 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 3814 4311 gene locus_tag LOCUS_19370 3814 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 4425 5612 gene locus_tag LOCUS_19380 4425 5612 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222776.1 protein_id gnl|my_center|LOCUS_19380 7182 5680 gene locus_tag LOCUS_19390 gene mftF 7182 5680 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112043.1 protein_id gnl|my_center|LOCUS_19390 7982 7179 gene locus_tag LOCUS_19400 7982 7179 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973994.1 protein_id gnl|my_center|LOCUS_19400 9622 7979 gene locus_tag LOCUS_19410 9622 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 9951 9628 gene locus_tag LOCUS_19420 9951 9628 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461371.1 protein_id gnl|my_center|LOCUS_19420 11273 9948 gene locus_tag LOCUS_19430 11273 9948 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461372.1 protein_id gnl|my_center|LOCUS_19430 12330 11266 gene locus_tag LOCUS_19440 12330 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 14306 12327 gene locus_tag LOCUS_19450 14306 12327 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523137.1 protein_id gnl|my_center|LOCUS_19450 16336 14303 gene locus_tag LOCUS_19460 16336 14303 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_19460 17571 16342 gene locus_tag LOCUS_19470 gene mftC 17571 16342 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112050.1 protein_id gnl|my_center|LOCUS_19470 17904 17584 gene locus_tag LOCUS_19480 gene mftB 17904 17584 CDS product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403486.1 protein_id gnl|my_center|LOCUS_19480 18043 17882 gene locus_tag LOCUS_19490 18043 17882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 18300 19592 gene locus_tag LOCUS_19500 gene mdo 18300 19592 CDS product NDMA-dependent methanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731151.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence060 414 507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1593 823 gene locus_tag LOCUS_19510 1593 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 873 943 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1839 1606 gene locus_tag LOCUS_19520 1839 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1723 2193 gene locus_tag LOCUS_19530 1723 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2863 2126 gene locus_tag LOCUS_19540 2863 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3572 2946 gene locus_tag LOCUS_19550 3572 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3843 6035 gene locus_tag LOCUS_19560 3843 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 6571 6056 gene locus_tag LOCUS_19570 6571 6056 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_19570 6964 6581 gene locus_tag LOCUS_19580 6964 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 7281 6961 gene locus_tag LOCUS_19590 7281 6961 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_19590 7312 8106 gene locus_tag LOCUS_19600 7312 8106 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082127.1 protein_id gnl|my_center|LOCUS_19600 8139 8245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9230 8268 gene locus_tag LOCUS_19610 gene meaB 9230 8268 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_19610 10442 9264 gene locus_tag LOCUS_19620 10442 9264 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084654.1 protein_id gnl|my_center|LOCUS_19620 10590 11093 gene locus_tag LOCUS_19630 gene mce 10590 11093 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406879.1 protein_id gnl|my_center|LOCUS_19630 12495 11227 gene locus_tag LOCUS_19640 12495 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446567.1 protein_id gnl|my_center|LOCUS_19640 12658 13443 gene locus_tag LOCUS_19650 12658 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 13578 14924 gene locus_tag LOCUS_19660 gene ccrA 13578 14924 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_19660 15690 14932 gene locus_tag LOCUS_19670 15690 14932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 16003 15704 gene locus_tag LOCUS_19680 16003 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_19680 16494 16027 gene locus_tag LOCUS_19690 16494 16027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19690 17764 16397 gene locus_tag LOCUS_19700 17764 16397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19700 17979 18647 gene locus_tag LOCUS_19710 gene nucS 17979 18647 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775934.1 protein_id gnl|my_center|LOCUS_19710 19192 18599 gene locus_tag LOCUS_19720 19192 18599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 <20511 19206 gene locus_tag LOCUS_19730 <20511 19206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030947.1:protein meaA >Feature sequence061 176 297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 419 1696 gene locus_tag LOCUS_19740 419 1696 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028973.1 protein_id gnl|my_center|LOCUS_19740 1865 1976 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3184 2000 gene locus_tag LOCUS_19750 3184 2000 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_19750 3439 3200 gene locus_tag LOCUS_19760 3439 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 4996 3452 gene locus_tag LOCUS_19770 4996 3452 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182484640.1 protein_id gnl|my_center|LOCUS_19770 5367 5041 gene locus_tag LOCUS_19780 5367 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19780 5574 5921 gene locus_tag LOCUS_19790 5574 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 7014 6025 gene locus_tag LOCUS_19800 7014 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 6986 7228 gene locus_tag LOCUS_19810 6986 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 7232 7378 gene locus_tag LOCUS_19820 7232 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 10718 7500 gene locus_tag LOCUS_19830 10718 7500 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_19830 11066 10794 gene locus_tag LOCUS_19840 11066 10794 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091761302.1 protein_id gnl|my_center|LOCUS_19840 11513 11295 gene locus_tag LOCUS_19850 11513 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 11395 12405 gene locus_tag LOCUS_19860 gene cofD 11395 12405 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_19860 12402 13496 gene locus_tag LOCUS_19870 12402 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 14609 13593 gene locus_tag LOCUS_19880 14609 13593 CDS product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139979125.1 protein_id gnl|my_center|LOCUS_19880 14669 15418 gene locus_tag LOCUS_19890 14669 15418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 15513 16331 gene locus_tag LOCUS_19900 15513 16331 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 protein_id gnl|my_center|LOCUS_19900 17214 16312 gene locus_tag LOCUS_19910 17214 16312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 18897 17488 gene locus_tag LOCUS_19920 18897 17488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 19147 20061 gene locus_tag LOCUS_19930 19147 20061 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412786.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence062 1740 1402 gene locus_tag LOCUS_19940 1740 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4719 1861 gene locus_tag LOCUS_19950 4719 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 5719 4802 gene locus_tag LOCUS_19960 gene tatC 5719 4802 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805201.1 protein_id gnl|my_center|LOCUS_19960 6105 5770 gene locus_tag LOCUS_19970 6105 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 6475 6161 gene locus_tag LOCUS_19980 6475 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 7551 6487 gene locus_tag LOCUS_19990 7551 6487 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_19990 8561 7548 gene locus_tag LOCUS_20000 8561 7548 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_20000 8626 9774 gene locus_tag LOCUS_20010 8626 9774 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_20010 10259 9873 gene locus_tag LOCUS_20020 10259 9873 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_20020 11239 10307 gene locus_tag LOCUS_20030 11239 10307 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20030 12714 11353 gene locus_tag LOCUS_20040 gene pafA 12714 11353 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_20040 12924 13010 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13056 13313 gene locus_tag LOCUS_20050 13056 13313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 13329 14162 gene locus_tag LOCUS_20060 13329 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20060 15057 14206 gene locus_tag LOCUS_20070 gene qorB 15057 14206 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560563.1 protein_id gnl|my_center|LOCUS_20070 15869 15054 gene locus_tag LOCUS_20080 gene prcA 15869 15054 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_20080 16699 15866 gene locus_tag LOCUS_20090 gene prcB 16699 15866 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_20090 16902 16696 gene locus_tag LOCUS_20100 16902 16696 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_20100 18497 16974 gene locus_tag LOCUS_20110 gene dop 18497 16974 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_20110 18548 19561 gene locus_tag LOCUS_20120 18548 19561 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407276.1 protein_id gnl|my_center|LOCUS_20120 19620 20117 gene locus_tag LOCUS_20130 19620 20117 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence063 642 1283 gene locus_tag LOCUS_20140 642 1283 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_20140 1901 1440 gene locus_tag LOCUS_20150 1901 1440 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_20150 2954 1905 gene locus_tag LOCUS_20160 2954 1905 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804832.1 protein_id gnl|my_center|LOCUS_20160 3968 3198 gene locus_tag LOCUS_20170 3968 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 5872 3965 gene locus_tag LOCUS_20180 gene dnaK 5872 3965 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804830.1 protein_id gnl|my_center|LOCUS_20180 6101 6622 gene locus_tag LOCUS_20190 6101 6622 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480299.1 protein_id gnl|my_center|LOCUS_20190 7380 6601 gene locus_tag LOCUS_20200 7380 6601 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225865.1 protein_id gnl|my_center|LOCUS_20200 10341 7816 gene locus_tag LOCUS_20210 10341 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 10999 10322 gene locus_tag LOCUS_20220 10999 10322 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804793.1 protein_id gnl|my_center|LOCUS_20220 11278 11556 gene locus_tag LOCUS_20230 11278 11556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 12054 11638 gene locus_tag LOCUS_20240 12054 11638 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_20240 12574 12065 gene locus_tag LOCUS_20250 12574 12065 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029198.1 protein_id gnl|my_center|LOCUS_20250 12735 12953 gene locus_tag LOCUS_20260 12735 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 12943 13359 gene locus_tag LOCUS_20270 12943 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 13402 13998 gene locus_tag LOCUS_20280 13402 13998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 15258 14032 gene locus_tag LOCUS_20290 gene hutI 15258 14032 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_20290 16598 15255 gene locus_tag LOCUS_20300 16598 15255 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223170.1 protein_id gnl|my_center|LOCUS_20300 17815 16595 gene locus_tag LOCUS_20310 17815 16595 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892540.1 protein_id gnl|my_center|LOCUS_20310 17974 17819 gene locus_tag LOCUS_20320 17974 17819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20320 18399 17926 gene locus_tag LOCUS_20330 18399 17926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20330 18023 18064 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19147 18344 gene locus_tag LOCUS_20340 19147 18344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20340 18569 18640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19193 19261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <20189 19641 gene locus_tag LOCUS_20350 <20189 19641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727479.1:histidine ammonia-lyase >Feature sequence064 <1 1592 gene locus_tag LOCUS_20360 <1 1592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223305.1:glycoside hydrolase family 15 protein 2771 1977 gene locus_tag LOCUS_20370 2771 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 protein_id gnl|my_center|LOCUS_20370 3483 2776 gene locus_tag LOCUS_20380 3483 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 4411 3512 gene locus_tag LOCUS_20390 4411 3512 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749566.1 protein_id gnl|my_center|LOCUS_20390 4833 4411 gene locus_tag LOCUS_20400 4833 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 5203 4862 gene locus_tag LOCUS_20410 5203 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 6141 5323 gene locus_tag LOCUS_20420 6141 5323 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014278.1 protein_id gnl|my_center|LOCUS_20420 6611 6240 gene locus_tag LOCUS_20430 6611 6240 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_20430 7993 6608 gene locus_tag LOCUS_20440 7993 6608 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_20440 8304 7993 gene locus_tag LOCUS_20450 8304 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 8535 8927 gene locus_tag LOCUS_20460 gene trxA 8535 8927 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093515.1 protein_id gnl|my_center|LOCUS_20460 8961 9368 gene locus_tag LOCUS_20470 8961 9368 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_20470 9407 9673 gene locus_tag LOCUS_20480 9407 9673 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013354.1 protein_id gnl|my_center|LOCUS_20480 9971 10366 gene locus_tag LOCUS_20490 9971 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 10457 11008 gene locus_tag LOCUS_20500 10457 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20500 11230 11661 gene locus_tag LOCUS_20510 11230 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20510 11601 12083 gene locus_tag LOCUS_20520 11601 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20520 12999 12241 gene locus_tag LOCUS_20530 12999 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 13266 13027 gene locus_tag LOCUS_20540 13266 13027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 13554 13925 gene locus_tag LOCUS_20550 gene kmtR 13554 13925 CDS product Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404335.1 protein_id gnl|my_center|LOCUS_20550 13915 15078 gene locus_tag LOCUS_20560 13915 15078 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410146.1 protein_id gnl|my_center|LOCUS_20560 16371 15211 gene locus_tag LOCUS_20570 gene nifS 16371 15211 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_20570 17702 16368 gene locus_tag LOCUS_20580 17702 16368 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244177.1 protein_id gnl|my_center|LOCUS_20580 19063 17699 gene locus_tag LOCUS_20590 19063 17699 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_20590 19210 19466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence065 183 294 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 852 1313 gene locus_tag LOCUS_20600 852 1313 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877671.1 protein_id gnl|my_center|LOCUS_20600 1396 2034 gene locus_tag LOCUS_20610 1396 2034 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_20610 2137 3423 gene locus_tag LOCUS_20620 2137 3423 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_20620 3423 3761 gene locus_tag LOCUS_20630 3423 3761 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056967.1 protein_id gnl|my_center|LOCUS_20630 4042 5409 gene locus_tag LOCUS_20640 4042 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 6068 5508 gene locus_tag LOCUS_20650 6068 5508 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730391.1 protein_id gnl|my_center|LOCUS_20650 6547 7092 gene locus_tag LOCUS_20660 6547 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 7180 9033 gene locus_tag LOCUS_20670 7180 9033 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031326.1 protein_id gnl|my_center|LOCUS_20670 9812 9078 gene locus_tag LOCUS_20680 9812 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20680 10101 9748 gene locus_tag LOCUS_20690 10101 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20690 10175 11065 gene locus_tag LOCUS_20700 10175 11065 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_20700 11098 12216 gene locus_tag LOCUS_20710 11098 12216 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_20710 12209 13351 gene locus_tag LOCUS_20720 12209 13351 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727161.1 protein_id gnl|my_center|LOCUS_20720 13401 13937 gene locus_tag LOCUS_20730 13401 13937 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_20730 15001 15155 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15213 16358 gene locus_tag LOCUS_20740 15213 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 16355 17203 gene locus_tag LOCUS_20750 16355 17203 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_20750 17230 17952 gene locus_tag LOCUS_20760 17230 17952 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141279381.1 protein_id gnl|my_center|LOCUS_20760 18632 18012 gene locus_tag LOCUS_20770 18632 18012 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_20770 18986 18702 gene locus_tag LOCUS_20780 18986 18702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 19188 19262 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence066 <1 1071 gene locus_tag LOCUS_20790 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065729.1:DUF3320 domain-containing protein 1505 3079 gene locus_tag LOCUS_20800 1505 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 3383 4192 gene locus_tag LOCUS_20810 3383 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 5135 4449 gene locus_tag LOCUS_20820 5135 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 6058 5150 gene locus_tag LOCUS_20830 6058 5150 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_20830 6110 6454 gene locus_tag LOCUS_20840 6110 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 8266 6758 gene locus_tag LOCUS_20850 8266 6758 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_20850 8294 10900 gene locus_tag LOCUS_20860 8294 10900 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_20860 11511 10909 gene locus_tag LOCUS_20870 11511 10909 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_20870 11675 12865 gene locus_tag LOCUS_20880 11675 12865 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_20880 13845 12886 gene locus_tag LOCUS_20890 13845 12886 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526026.1 protein_id gnl|my_center|LOCUS_20890 13879 14991 gene locus_tag LOCUS_20900 gene galU 13879 14991 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_20900 14988 16253 gene locus_tag LOCUS_20910 14988 16253 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_20910 16250 16726 gene locus_tag LOCUS_20920 gene moaC 16250 16726 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_20920 16723 17220 gene locus_tag LOCUS_20930 16723 17220 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_20930 17217 17867 gene locus_tag LOCUS_20940 17217 17867 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_20940 17898 18776 gene locus_tag LOCUS_20950 17898 18776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 18879 18953 gene locus_tag LOCUS_t00230 18879 18953 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19024 19163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence067 804 283 gene locus_tag LOCUS_20960 804 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 692 1942 gene locus_tag LOCUS_20970 692 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2073 3107 gene locus_tag LOCUS_20980 2073 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 3897 3226 gene locus_tag LOCUS_20990 3897 3226 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776131.1 protein_id gnl|my_center|LOCUS_20990 5772 3907 gene locus_tag LOCUS_21000 5772 3907 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951984.1 protein_id gnl|my_center|LOCUS_21000 7599 5854 gene locus_tag LOCUS_21010 7599 5854 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728748.1 protein_id gnl|my_center|LOCUS_21010 7988 7707 gene locus_tag LOCUS_21020 7988 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 9676 8003 gene locus_tag LOCUS_21030 9676 8003 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222858.1 protein_id gnl|my_center|LOCUS_21030 9737 10522 gene locus_tag LOCUS_21040 9737 10522 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_21040 10679 11743 gene locus_tag LOCUS_21050 10679 11743 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223470.1 protein_id gnl|my_center|LOCUS_21050 11736 12545 gene locus_tag LOCUS_21060 11736 12545 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029956.1 protein_id gnl|my_center|LOCUS_21060 12573 13259 gene locus_tag LOCUS_21070 12573 13259 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_21070 13268 14296 gene locus_tag LOCUS_21080 13268 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 14829 14293 gene locus_tag LOCUS_21090 14829 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 14909 16135 gene locus_tag LOCUS_21100 14909 16135 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_21100 16132 16686 gene locus_tag LOCUS_21110 gene purE 16132 16686 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_21110 17180 16737 gene locus_tag LOCUS_21120 17180 16737 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_21120 17256 19145 gene locus_tag LOCUS_21130 17256 19145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 18218 18344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence068 <1 723 gene locus_tag LOCUS_21140 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974103.1:methylmalonyl-CoA mutase family protein 856 2097 gene locus_tag LOCUS_21150 856 2097 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776145.1 protein_id gnl|my_center|LOCUS_21150 2097 2516 gene locus_tag LOCUS_21160 2097 2516 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908747.1 protein_id gnl|my_center|LOCUS_21160 2576 3880 gene locus_tag LOCUS_21170 2576 3880 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_21170 4273 3935 gene locus_tag LOCUS_21180 4273 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 4266 4700 gene locus_tag LOCUS_21190 4266 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 5159 4710 gene locus_tag LOCUS_21200 5159 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227448.1 protein_id gnl|my_center|LOCUS_21200 6027 5200 gene locus_tag LOCUS_21210 6027 5200 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223050.1 protein_id gnl|my_center|LOCUS_21210 6103 7104 gene locus_tag LOCUS_21220 6103 7104 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 protein_id gnl|my_center|LOCUS_21220 8638 7211 gene locus_tag LOCUS_21230 8638 7211 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223048.1 protein_id gnl|my_center|LOCUS_21230 9773 8700 gene locus_tag LOCUS_21240 9773 8700 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_21240 10666 9770 gene locus_tag LOCUS_21250 10666 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 10702 10828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11081 11190 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12825 11722 gene locus_tag LOCUS_21260 12825 11722 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419768.1 protein_id gnl|my_center|LOCUS_21260 13861 12920 gene locus_tag LOCUS_21270 13861 12920 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_21270 15318 13858 gene locus_tag LOCUS_21280 15318 13858 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222793.1 protein_id gnl|my_center|LOCUS_21280 16337 15339 gene locus_tag LOCUS_21290 gene deoC 16337 15339 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_21290 18312 16453 gene locus_tag LOCUS_21300 18312 16453 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_21300 16629 16696 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19187 18309 gene locus_tag LOCUS_21310 19187 18309 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776134.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence069 <1 886 gene locus_tag LOCUS_21320 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973522.1:ABC transporter permease 964 2727 gene locus_tag LOCUS_21330 964 2727 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_21330 2844 3869 gene locus_tag LOCUS_21340 2844 3869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_21340 3866 4945 gene locus_tag LOCUS_21350 3866 4945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_21350 4989 6158 gene locus_tag LOCUS_21360 4989 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5509 5582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6961 6155 gene locus_tag LOCUS_21370 6961 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 7287 8144 gene locus_tag LOCUS_21380 7287 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467192.1 protein_id gnl|my_center|LOCUS_21380 8244 9632 gene locus_tag LOCUS_21390 8244 9632 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230249.1 protein_id gnl|my_center|LOCUS_21390 10334 9702 gene locus_tag LOCUS_21400 10334 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 11439 10399 gene locus_tag LOCUS_21410 11439 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 12665 11688 gene locus_tag LOCUS_21420 12665 11688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 13273 12593 gene locus_tag LOCUS_21430 13273 12593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 16514 13467 gene locus_tag LOCUS_21440 16514 13467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 15660 15766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16930 16490 gene locus_tag LOCUS_21450 16930 16490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 17355 16927 gene locus_tag LOCUS_21460 17355 16927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 17562 17747 gene locus_tag LOCUS_21470 17562 17747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 18089 17790 gene locus_tag LOCUS_21480 18089 17790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 18406 18556 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence070 234 1004 gene locus_tag LOCUS_21490 234 1004 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223098.1 protein_id gnl|my_center|LOCUS_21490 1345 1479 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2574 2608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3216 3525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4927 4628 gene locus_tag LOCUS_21500 4927 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 5215 4934 gene locus_tag LOCUS_21510 5215 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 5462 5325 gene locus_tag LOCUS_21520 gene rpmH 5462 5325 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_21520 6048 7520 gene locus_tag LOCUS_21530 6048 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 8130 9287 gene locus_tag LOCUS_21540 gene dnaN 8130 9287 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_21540 9361 10269 gene locus_tag LOCUS_21550 gene gnd 9361 10269 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221957.1 protein_id gnl|my_center|LOCUS_21550 10285 11526 gene locus_tag LOCUS_21560 gene recF 10285 11526 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_21560 11678 12226 gene locus_tag LOCUS_21570 11678 12226 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221959.1 protein_id gnl|my_center|LOCUS_21570 12626 14701 gene locus_tag LOCUS_21580 gene gyrB 12626 14701 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803673.1 protein_id gnl|my_center|LOCUS_21580 14757 17426 gene locus_tag LOCUS_21590 gene gyrA 14757 17426 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_21590 17423 17896 gene locus_tag LOCUS_21600 17423 17896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence071 162 417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 870 496 gene locus_tag LOCUS_21610 870 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1284 2183 gene locus_tag LOCUS_21620 1284 2183 CDS product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226733.1 protein_id gnl|my_center|LOCUS_21620 2350 2853 gene locus_tag LOCUS_21630 2350 2853 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227724.1 protein_id gnl|my_center|LOCUS_21630 3124 3282 gene locus_tag LOCUS_21640 3124 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 3265 3269 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3628 3407 gene locus_tag LOCUS_21650 gene vapB2 3628 3407 CDS product type II toxin-antitoxin system antitoxin VapB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401563.1 protein_id gnl|my_center|LOCUS_21650 4051 3821 gene locus_tag LOCUS_21660 4051 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 5112 4048 gene locus_tag LOCUS_21670 5112 4048 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_21670 6122 5109 gene locus_tag LOCUS_21680 6122 5109 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_21680 6619 6765 gene locus_tag LOCUS_21690 6619 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 7946 6762 gene locus_tag LOCUS_21700 7946 6762 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_21700 9121 8261 gene locus_tag LOCUS_21710 9121 8261 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227389.1 protein_id gnl|my_center|LOCUS_21710 10211 9537 gene locus_tag LOCUS_21720 10211 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 10620 10246 gene locus_tag LOCUS_21730 10620 10246 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831581.1 protein_id gnl|my_center|LOCUS_21730 11671 10892 gene locus_tag LOCUS_21740 11671 10892 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_21740 12007 12300 gene locus_tag LOCUS_21750 12007 12300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 12782 13438 gene locus_tag LOCUS_21760 12782 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_21760 13964 13719 gene locus_tag LOCUS_21770 13964 13719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 13845 14174 gene locus_tag LOCUS_21780 13845 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 14366 14545 gene locus_tag LOCUS_21790 14366 14545 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_21790 15077 14775 gene locus_tag LOCUS_21800 15077 14775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 15483 15283 gene locus_tag LOCUS_21810 15483 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 16324 16394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17255 16761 gene locus_tag LOCUS_21820 17255 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 17330 17461 gene locus_tag LOCUS_21830 17330 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence072 456 2036 gene locus_tag LOCUS_21840 456 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21840 2023 2871 gene locus_tag LOCUS_21850 2023 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21850 3085 3744 gene locus_tag LOCUS_21860 3085 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3748 4551 gene locus_tag LOCUS_21870 3748 4551 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_21870 4551 5486 gene locus_tag LOCUS_21880 gene nrfD 4551 5486 CDS product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195192.1 protein_id gnl|my_center|LOCUS_21880 5476 6564 gene locus_tag LOCUS_21890 gene apbC 5476 6564 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_21890 6853 6551 gene locus_tag LOCUS_21900 6853 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 7485 7057 gene locus_tag LOCUS_21910 7485 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 7618 8061 gene locus_tag LOCUS_21920 7618 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 8289 9158 gene locus_tag LOCUS_21930 8289 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 8302 8352 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10327 9542 gene locus_tag LOCUS_21940 10327 9542 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_21940 10395 10793 gene locus_tag LOCUS_21950 10395 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 11224 11351 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11393 11683 gene locus_tag LOCUS_21960 11393 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 11680 11886 gene locus_tag LOCUS_21970 11680 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21970 11852 12097 gene locus_tag LOCUS_21980 11852 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 12220 12984 gene locus_tag LOCUS_21990 12220 12984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865109.1 protein_id gnl|my_center|LOCUS_21990 12977 13765 gene locus_tag LOCUS_22000 12977 13765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973545.1 protein_id gnl|my_center|LOCUS_22000 14349 15176 gene locus_tag LOCUS_22010 14349 15176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 15285 15605 gene locus_tag LOCUS_22020 15285 15605 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090639.1 protein_id gnl|my_center|LOCUS_22020 15628 16008 gene locus_tag LOCUS_22030 15628 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 16675 16361 gene locus_tag LOCUS_22040 16675 16361 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_22040 17187 16711 gene locus_tag LOCUS_22050 17187 16711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence073 390 515 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1598 870 gene locus_tag LOCUS_22060 gene purQ 1598 870 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776337.1 protein_id gnl|my_center|LOCUS_22060 1894 1595 gene locus_tag LOCUS_22070 gene purS 1894 1595 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776336.1 protein_id gnl|my_center|LOCUS_22070 3010 2033 gene locus_tag LOCUS_22080 3010 2033 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_22080 4319 3039 gene locus_tag LOCUS_22090 gene purD 4319 3039 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_22090 4535 4637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4673 5545 gene locus_tag LOCUS_22100 4673 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 5521 6645 gene locus_tag LOCUS_22110 5521 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22110 8018 6732 gene locus_tag LOCUS_22120 8018 6732 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_22120 9321 8173 gene locus_tag LOCUS_22130 9321 8173 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896231.1 protein_id gnl|my_center|LOCUS_22130 9751 9350 gene locus_tag LOCUS_22140 9751 9350 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_22140 10746 9751 gene locus_tag LOCUS_22150 gene fbaA 10746 9751 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_22150 11442 10828 gene locus_tag LOCUS_22160 11442 10828 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323891.1 protein_id gnl|my_center|LOCUS_22160 11799 11884 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11987 12241 gene locus_tag LOCUS_22170 11987 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 12795 12343 gene locus_tag LOCUS_22180 12795 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22180 12934 12812 gene locus_tag LOCUS_22190 12934 12812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 13608 13009 gene locus_tag LOCUS_22200 gene pyrE 13608 13009 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_22200 14429 13653 gene locus_tag LOCUS_22210 14429 13653 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_22210 14428 15261 gene locus_tag LOCUS_22220 14428 15261 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402176.1 protein_id gnl|my_center|LOCUS_22220 15265 16086 gene locus_tag LOCUS_22230 gene thiM 15265 16086 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338388.1 protein_id gnl|my_center|LOCUS_22230 16119 16751 gene locus_tag LOCUS_22240 gene thiE 16119 16751 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338387.1 protein_id gnl|my_center|LOCUS_22240 16834 16939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence074 <1 600 gene locus_tag LOCUS_22250 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027845.1:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase 950 2122 gene locus_tag LOCUS_22260 gene cbpB 950 2122 CDS product peptide-modifying radical SAM enzyme CbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879693.1 protein_id gnl|my_center|LOCUS_22260 3308 2169 gene locus_tag LOCUS_22270 3308 2169 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444889.1 protein_id gnl|my_center|LOCUS_22270 4942 3446 gene locus_tag LOCUS_22280 4942 3446 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228517.1 protein_id gnl|my_center|LOCUS_22280 5708 4959 gene locus_tag LOCUS_22290 5708 4959 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230642.1 protein_id gnl|my_center|LOCUS_22290 5899 6432 gene locus_tag LOCUS_22300 5899 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 6555 6650 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6799 8241 gene locus_tag LOCUS_22310 6799 8241 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113065.1 protein_id gnl|my_center|LOCUS_22310 8530 8357 gene locus_tag LOCUS_22320 8530 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 9930 8794 gene locus_tag LOCUS_22330 9930 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 10766 10005 gene locus_tag LOCUS_22340 10766 10005 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031453.1 protein_id gnl|my_center|LOCUS_22340 11998 10757 gene locus_tag LOCUS_22350 11998 10757 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963526.1 protein_id gnl|my_center|LOCUS_22350 12159 12659 gene locus_tag LOCUS_22360 12159 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 12720 12947 gene locus_tag LOCUS_22370 12720 12947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 14583 12991 gene locus_tag LOCUS_22380 14583 12991 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_22380 15452 14580 gene locus_tag LOCUS_22390 15452 14580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence075 896 324 gene locus_tag LOCUS_22400 896 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1536 2816 gene locus_tag LOCUS_22410 1536 2816 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_22410 3171 2848 gene locus_tag LOCUS_22420 3171 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 3777 3241 gene locus_tag LOCUS_22430 3777 3241 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391304.1 protein_id gnl|my_center|LOCUS_22430 4673 3777 gene locus_tag LOCUS_22440 4673 3777 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065180.1 protein_id gnl|my_center|LOCUS_22440 5108 4683 gene locus_tag LOCUS_22450 5108 4683 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229473.1 protein_id gnl|my_center|LOCUS_22450 6696 5215 gene locus_tag LOCUS_22460 6696 5215 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083578.1 protein_id gnl|my_center|LOCUS_22460 9719 6768 gene locus_tag LOCUS_22470 gene gcvP 9719 6768 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_22470 10641 9997 gene locus_tag LOCUS_22480 10641 9997 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_22480 11309 10800 gene locus_tag LOCUS_22490 11309 10800 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_22490 12026 11328 gene locus_tag LOCUS_22500 12026 11328 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_22500 12528 12076 gene locus_tag LOCUS_22510 12528 12076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 13013 12624 gene locus_tag LOCUS_22520 gene gcvH 13013 12624 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_22520 13834 13073 gene locus_tag LOCUS_22530 13834 13073 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899038.1 protein_id gnl|my_center|LOCUS_22530 14163 13831 gene locus_tag LOCUS_22540 14163 13831 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_22540 15131 14160 gene locus_tag LOCUS_22550 15131 14160 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 protein_id gnl|my_center|LOCUS_22550 15658 15128 gene locus_tag LOCUS_22560 15658 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 16513 15788 gene locus_tag LOCUS_22570 gene narI 16513 15788 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775894.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence076 543 1025 gene locus_tag LOCUS_22580 543 1025 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_22580 1038 1715 gene locus_tag LOCUS_22590 gene ispD 1038 1715 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731019.1 protein_id gnl|my_center|LOCUS_22590 1777 2238 gene locus_tag LOCUS_22600 gene ispF 1777 2238 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804549.1 protein_id gnl|my_center|LOCUS_22600 2295 3755 gene locus_tag LOCUS_22610 gene cysS 2295 3755 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_22610 3769 4740 gene locus_tag LOCUS_22620 gene rlmB 3769 4740 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_22620 4881 5219 gene locus_tag LOCUS_22630 4881 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 5252 5689 gene locus_tag LOCUS_22640 5252 5689 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_22640 6346 5810 gene locus_tag LOCUS_22650 6346 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 7562 6480 gene locus_tag LOCUS_22660 gene ugpC 7562 6480 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804887.1 protein_id gnl|my_center|LOCUS_22660 8430 7699 gene locus_tag LOCUS_22670 8430 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 8311 8685 gene locus_tag LOCUS_22680 8311 8685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 9665 8580 gene locus_tag LOCUS_22690 9665 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 9677 9797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10197 10625 gene locus_tag LOCUS_22700 10197 10625 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_22700 10660 12333 gene locus_tag LOCUS_22710 10660 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 12675 12751 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12798 13502 gene locus_tag LOCUS_22720 12798 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 13640 13715 gene locus_tag LOCUS_t00240 13640 13715 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13863 14204 gene locus_tag LOCUS_22730 13863 14204 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173989.1 protein_id gnl|my_center|LOCUS_22730 14210 14689 gene locus_tag LOCUS_22740 14210 14689 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899141.1 protein_id gnl|my_center|LOCUS_22740 14986 15792 gene locus_tag LOCUS_22750 14986 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 15819 16004 gene locus_tag LOCUS_22760 15819 16004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 <16600 16069 gene locus_tag LOCUS_22770 <16600 16069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003410146.1:cation diffusion facilitator family transporter >Feature sequence077 813 334 gene locus_tag LOCUS_22780 813 334 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229804.1 protein_id gnl|my_center|LOCUS_22780 2990 810 gene locus_tag LOCUS_22790 gene ligA 2990 810 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908495.1 protein_id gnl|my_center|LOCUS_22790 4655 3633 gene locus_tag LOCUS_22800 4655 3633 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_22800 5852 4665 gene locus_tag LOCUS_22810 gene mnmA 5852 4665 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_22810 6619 5852 gene locus_tag LOCUS_22820 6619 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22820 7097 6582 gene locus_tag LOCUS_22830 7097 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22830 8183 7224 gene locus_tag LOCUS_22840 8183 7224 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_22840 9098 8283 gene locus_tag LOCUS_22850 9098 8283 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_22850 10044 9265 gene locus_tag LOCUS_22860 10044 9265 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_22860 10508 10041 gene locus_tag LOCUS_22870 10508 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 10543 12786 gene locus_tag LOCUS_22880 gene glgX 10543 12786 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486968.1 protein_id gnl|my_center|LOCUS_22880 15364 12776 gene locus_tag LOCUS_22890 15364 12776 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence078 1286 129 gene locus_tag LOCUS_22900 1286 129 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228727.1 protein_id gnl|my_center|LOCUS_22900 1458 1685 gene locus_tag LOCUS_22910 gene bldC 1458 1685 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_22910 1808 2443 gene locus_tag LOCUS_22920 1808 2443 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392649.1 protein_id gnl|my_center|LOCUS_22920 2440 3615 gene locus_tag LOCUS_22930 2440 3615 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968894.1 protein_id gnl|my_center|LOCUS_22930 3612 4796 gene locus_tag LOCUS_22940 3612 4796 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968893.1 protein_id gnl|my_center|LOCUS_22940 4797 5486 gene locus_tag LOCUS_22950 4797 5486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889094.1 protein_id gnl|my_center|LOCUS_22950 5480 6079 gene locus_tag LOCUS_22960 5480 6079 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889093.1 protein_id gnl|my_center|LOCUS_22960 6246 6644 gene locus_tag LOCUS_22970 6246 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 6684 7250 gene locus_tag LOCUS_22980 6684 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 7568 9613 gene locus_tag LOCUS_22990 7568 9613 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143126.1 protein_id gnl|my_center|LOCUS_22990 9918 9643 gene locus_tag LOCUS_23000 9918 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 10475 10765 gene locus_tag LOCUS_23010 10475 10765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 11472 10975 gene locus_tag LOCUS_23020 11472 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 11890 11492 gene locus_tag LOCUS_23030 11890 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 12626 12102 gene locus_tag LOCUS_23040 12626 12102 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028791.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23040 13267 12623 gene locus_tag LOCUS_23050 13267 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 13632 14066 gene locus_tag LOCUS_23060 13632 14066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23060 13976 14497 gene locus_tag LOCUS_23070 13976 14497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23070 14430 14633 gene locus_tag LOCUS_23080 14430 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23080 15208 14897 gene locus_tag LOCUS_23090 15208 14897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 15460 15218 gene locus_tag LOCUS_23100 15460 15218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 15607 15771 gene locus_tag LOCUS_23110 15607 15771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 16274 16501 gene locus_tag LOCUS_23120 16274 16501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence079 339 1067 gene locus_tag LOCUS_23130 339 1067 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015667.1 protein_id gnl|my_center|LOCUS_23130 1116 1913 gene locus_tag LOCUS_23140 1116 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2250 2023 gene locus_tag LOCUS_23150 2250 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2224 2448 gene locus_tag LOCUS_23160 2224 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3536 2694 gene locus_tag LOCUS_23170 3536 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 3654 4127 gene locus_tag LOCUS_23180 3654 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 4127 4450 gene locus_tag LOCUS_23190 4127 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 4447 4644 gene locus_tag LOCUS_23200 4447 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 4641 6131 gene locus_tag LOCUS_23210 4641 6131 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110627.1 protein_id gnl|my_center|LOCUS_23210 6128 6445 gene locus_tag LOCUS_23220 6128 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 6442 8022 gene locus_tag LOCUS_23230 6442 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 8245 9357 gene locus_tag LOCUS_23240 8245 9357 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_23240 9595 9846 gene locus_tag LOCUS_23250 9595 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 9865 10161 gene locus_tag LOCUS_23260 9865 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 11072 10476 gene locus_tag LOCUS_23270 11072 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 11627 12481 gene locus_tag LOCUS_23280 gene menB 11627 12481 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_23280 12516 13250 gene locus_tag LOCUS_23290 12516 13250 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_23290 13321 14430 gene locus_tag LOCUS_23300 gene hadC 13321 14430 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_23300 14443 15834 gene locus_tag LOCUS_23310 gene fldB 14443 15834 CDS product phenyllactyl-CoA dehydratase subunit FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048237.1 protein_id gnl|my_center|LOCUS_23310 15831 16169 gene locus_tag LOCUS_23320 15831 16169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23320 >Feature sequence080 <1 666 gene locus_tag LOCUS_23330 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226827.1:uroporphyrinogen-III C-methyltransferase 684 769 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 832 1047 gene locus_tag LOCUS_23340 832 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_23340 1688 1083 gene locus_tag LOCUS_23350 1688 1083 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805010.1 protein_id gnl|my_center|LOCUS_23350 1699 3156 gene locus_tag LOCUS_23360 1699 3156 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878135.1 protein_id gnl|my_center|LOCUS_23360 4406 3201 gene locus_tag LOCUS_23370 gene nadA 4406 3201 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_23370 4573 5385 gene locus_tag LOCUS_23380 4573 5385 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230235.1 protein_id gnl|my_center|LOCUS_23380 5517 6683 gene locus_tag LOCUS_23390 5517 6683 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209537.1 protein_id gnl|my_center|LOCUS_23390 6789 7235 gene locus_tag LOCUS_23400 gene erpA 6789 7235 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805013.1 protein_id gnl|my_center|LOCUS_23400 7768 7340 gene locus_tag LOCUS_23410 7768 7340 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400864.1 protein_id gnl|my_center|LOCUS_23410 7997 7812 gene locus_tag LOCUS_23420 7997 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 8096 9082 gene locus_tag LOCUS_23430 8096 9082 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_23430 9101 9778 gene locus_tag LOCUS_23440 gene aat 9101 9778 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072572.1 protein_id gnl|my_center|LOCUS_23440 10089 9718 gene locus_tag LOCUS_23450 10089 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23450 11282 10086 gene locus_tag LOCUS_23460 11282 10086 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23460 11378 12259 gene locus_tag LOCUS_23470 gene coxB 11378 12259 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805014.1 protein_id gnl|my_center|LOCUS_23470 12259 13644 gene locus_tag LOCUS_23480 12259 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 13530 13631 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13641 14018 gene locus_tag LOCUS_23490 13641 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23490 14015 14416 gene locus_tag LOCUS_23500 14015 14416 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_23500 14805 14461 gene locus_tag LOCUS_23510 14805 14461 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_23510 14912 14977 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15011 15298 gene locus_tag LOCUS_23520 15011 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 16144 15305 gene locus_tag LOCUS_23530 16144 15305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence081 181 960 gene locus_tag LOCUS_23540 gene nuoE 181 960 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_23540 957 2273 gene locus_tag LOCUS_23550 gene nuoF 957 2273 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893427.1 protein_id gnl|my_center|LOCUS_23550 2270 4771 gene locus_tag LOCUS_23560 2270 4771 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_23560 4768 6174 gene locus_tag LOCUS_23570 gene nuoH 4768 6174 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_23570 6167 6442 gene locus_tag LOCUS_23580 6167 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 6531 6803 gene locus_tag LOCUS_23590 6531 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 6800 7567 gene locus_tag LOCUS_23600 6800 7567 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 protein_id gnl|my_center|LOCUS_23600 7564 7863 gene locus_tag LOCUS_23610 gene nuoK 7564 7863 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893422.1 protein_id gnl|my_center|LOCUS_23610 7877 9832 gene locus_tag LOCUS_23620 gene nuoL 7877 9832 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_23620 9832 11367 gene locus_tag LOCUS_23630 9832 11367 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 protein_id gnl|my_center|LOCUS_23630 11364 12923 gene locus_tag LOCUS_23640 gene nuoN 11364 12923 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_23640 12920 13951 gene locus_tag LOCUS_23650 12920 13951 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_23650 14968 14045 gene locus_tag LOCUS_23660 gene rarD 14968 14045 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_23660 <16021 15038 gene locus_tag LOCUS_23670 <16021 15038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029750.1:2-oxoacid:ferredoxin oxidoreductase subunit beta >Feature sequence082 <1 1140 gene locus_tag LOCUS_23680 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975050.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 1118 2104 gene locus_tag LOCUS_23690 1118 2104 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530704.1 protein_id gnl|my_center|LOCUS_23690 3665 2241 gene locus_tag LOCUS_23700 3665 2241 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_23700 5265 3601 gene locus_tag LOCUS_23710 5265 3601 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978555.1 protein_id gnl|my_center|LOCUS_23710 3776 3888 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7260 5269 gene locus_tag LOCUS_23720 7260 5269 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921515.1 protein_id gnl|my_center|LOCUS_23720 6424 6502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7977 7318 gene locus_tag LOCUS_23730 7977 7318 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064469.1 protein_id gnl|my_center|LOCUS_23730 8310 8936 gene locus_tag LOCUS_23740 8310 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 8855 8894 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9054 9809 gene locus_tag LOCUS_23750 9054 9809 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_23750 10113 11099 gene locus_tag LOCUS_23760 gene acdA 10113 11099 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_23760 11096 12091 gene locus_tag LOCUS_23770 11096 12091 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_23770 12088 13179 gene locus_tag LOCUS_23780 12088 13179 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132624759.1 protein_id gnl|my_center|LOCUS_23780 13623 13745 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14205 14948 gene locus_tag LOCUS_23790 gene fabG 14205 14948 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 protein_id gnl|my_center|LOCUS_23790 <15934 15197 gene locus_tag LOCUS_23800 <15934 15197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010927121.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence083 519 148 gene locus_tag LOCUS_23810 519 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 854 516 gene locus_tag LOCUS_23820 854 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1533 1000 gene locus_tag LOCUS_23830 1533 1000 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228353.1 protein_id gnl|my_center|LOCUS_23830 1855 2010 gene locus_tag LOCUS_23840 1855 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010059700.1 protein_id gnl|my_center|LOCUS_23840 2094 2270 gene locus_tag LOCUS_23850 2094 2270 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_23850 2385 2813 gene locus_tag LOCUS_23860 2385 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 3577 2873 gene locus_tag LOCUS_23870 3577 2873 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_23870 4182 4493 gene locus_tag LOCUS_23880 4182 4493 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_23880 4477 4779 gene locus_tag LOCUS_23890 4477 4779 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_23890 5499 9167 gene locus_tag LOCUS_23900 gene nifJ 5499 9167 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_23900 7923 8036 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8338 8403 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9292 10176 gene locus_tag LOCUS_23910 9292 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_23910 10535 12214 gene locus_tag LOCUS_23920 10535 12214 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973742.1 protein_id gnl|my_center|LOCUS_23920 13524 12211 gene locus_tag LOCUS_23930 13524 12211 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495247.1 protein_id gnl|my_center|LOCUS_23930 15137 13521 gene locus_tag LOCUS_23940 15137 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 15376 15224 gene locus_tag LOCUS_23950 15376 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence084 897 7 gene locus_tag LOCUS_23960 897 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 2972 894 gene locus_tag LOCUS_23970 2972 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 3310 4113 gene locus_tag LOCUS_23980 3310 4113 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 protein_id gnl|my_center|LOCUS_23980 4110 5399 gene locus_tag LOCUS_23990 4110 5399 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530725.1 protein_id gnl|my_center|LOCUS_23990 5444 5854 gene locus_tag LOCUS_24000 5444 5854 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 protein_id gnl|my_center|LOCUS_24000 6704 5964 gene locus_tag LOCUS_24010 6704 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 6886 8640 gene locus_tag LOCUS_24020 6886 8640 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029406.1 protein_id gnl|my_center|LOCUS_24020 9291 8695 gene locus_tag LOCUS_24030 9291 8695 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221471091.1 protein_id gnl|my_center|LOCUS_24030 9415 10053 gene locus_tag LOCUS_24040 9415 10053 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144585984.1 protein_id gnl|my_center|LOCUS_24040 10175 10393 gene locus_tag LOCUS_24050 10175 10393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 10384 10782 gene locus_tag LOCUS_24060 10384 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 10854 11555 gene locus_tag LOCUS_24070 10854 11555 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222045.1 protein_id gnl|my_center|LOCUS_24070 11660 12073 gene locus_tag LOCUS_24080 11660 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 12496 12188 gene locus_tag LOCUS_24090 12496 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 13083 12724 gene locus_tag LOCUS_24100 13083 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 13391 13194 gene locus_tag LOCUS_24110 13391 13194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 13854 13492 gene locus_tag LOCUS_24120 13854 13492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 14327 13854 gene locus_tag LOCUS_24130 14327 13854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 14545 14710 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence085 1856 870 gene locus_tag LOCUS_24140 gene thrB 1856 870 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_24140 2954 1860 gene locus_tag LOCUS_24150 gene thrC 2954 1860 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_24150 4372 2957 gene locus_tag LOCUS_24160 4372 2957 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_24160 5912 4488 gene locus_tag LOCUS_24170 gene lysA 5912 4488 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775960.1 protein_id gnl|my_center|LOCUS_24170 7558 5912 gene locus_tag LOCUS_24180 gene argS 7558 5912 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_24180 8142 7573 gene locus_tag LOCUS_24190 8142 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 8265 8339 gene locus_tag LOCUS_t00250 8265 8339 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9448 9552 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9553 10224 gene locus_tag LOCUS_24200 9553 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 10229 10645 gene locus_tag LOCUS_24210 10229 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 10920 11759 gene locus_tag LOCUS_24220 10920 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 12950 11913 gene locus_tag LOCUS_24230 12950 11913 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183373870.1 protein_id gnl|my_center|LOCUS_24230 14341 12947 gene locus_tag LOCUS_24240 14341 12947 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence086 1 1782 gene locus_tag LOCUS_24250 1 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 3199 2039 gene locus_tag LOCUS_24260 3199 2039 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230795.1 protein_id gnl|my_center|LOCUS_24260 3449 4699 gene locus_tag LOCUS_24270 gene fasR 3449 4699 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_24270 4767 5945 gene locus_tag LOCUS_24280 4767 5945 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_24280 6000 6938 gene locus_tag LOCUS_24290 6000 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24290 7109 7357 gene locus_tag LOCUS_24300 7109 7357 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775709.1 protein_id gnl|my_center|LOCUS_24300 7522 8772 gene locus_tag LOCUS_24310 7522 8772 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_24310 8772 10025 gene locus_tag LOCUS_24320 8772 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24320 9976 10224 gene locus_tag LOCUS_24330 9976 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24330 10859 10344 gene locus_tag LOCUS_24340 10859 10344 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_24340 11085 11159 gene locus_tag LOCUS_t00260 11085 11159 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11494 11300 gene locus_tag LOCUS_24350 11494 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24350 12222 11515 gene locus_tag LOCUS_24360 12222 11515 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24360 13576 12215 gene locus_tag LOCUS_24370 13576 12215 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_24370 <14530 13728 gene locus_tag LOCUS_24380 <14530 13728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110870.1:HNH endonuclease signature motif containing protein >Feature sequence087 2428 1982 gene locus_tag LOCUS_24390 2428 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 2862 2440 gene locus_tag LOCUS_24400 2862 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 4338 3073 gene locus_tag LOCUS_24410 4338 3073 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029184.1 protein_id gnl|my_center|LOCUS_24410 4480 4989 gene locus_tag LOCUS_24420 4480 4989 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_24420 6211 5312 gene locus_tag LOCUS_24430 gene metF 6211 5312 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_24430 6421 6233 gene locus_tag LOCUS_24440 6421 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 6389 7435 gene locus_tag LOCUS_24450 6389 7435 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_24450 7468 9045 gene locus_tag LOCUS_24460 gene crtI 7468 9045 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_24460 9093 10052 gene locus_tag LOCUS_24470 9093 10052 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224196.1 protein_id gnl|my_center|LOCUS_24470 10335 9991 gene locus_tag LOCUS_24480 10335 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 10681 10349 gene locus_tag LOCUS_24490 10681 10349 CDS product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225087.1 protein_id gnl|my_center|LOCUS_24490 11147 10734 gene locus_tag LOCUS_24500 11147 10734 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_24500 11287 13176 gene locus_tag LOCUS_24510 gene pknB 11287 13176 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_24510 13488 13738 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgcaatggagcccggccatgaagaccgggaagacc 13831 14379 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgcaatggagcccggccatgaagaccgggaagac >Feature sequence088 522 40 gene locus_tag LOCUS_24520 522 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1164 553 gene locus_tag LOCUS_24530 1164 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1902 1729 gene locus_tag LOCUS_24540 1902 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2154 2963 gene locus_tag LOCUS_24550 2154 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 3091 4395 gene locus_tag LOCUS_24560 3091 4395 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 protein_id gnl|my_center|LOCUS_24560 4392 5135 gene locus_tag LOCUS_24570 4392 5135 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051560.1 protein_id gnl|my_center|LOCUS_24570 6237 5137 gene locus_tag LOCUS_24580 6237 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 7079 6258 gene locus_tag LOCUS_24590 7079 6258 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467152.1 protein_id gnl|my_center|LOCUS_24590 7115 8290 gene locus_tag LOCUS_24600 7115 8290 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020842.1 protein_id gnl|my_center|LOCUS_24600 8287 9144 gene locus_tag LOCUS_24610 8287 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 9384 9052 gene locus_tag LOCUS_24620 9384 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 10597 9389 gene locus_tag LOCUS_24630 10597 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 10724 12061 gene locus_tag LOCUS_24640 10724 12061 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_24640 12061 12753 gene locus_tag LOCUS_24650 12061 12753 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_24650 13413 12706 gene locus_tag LOCUS_24660 13413 12706 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413654.1 protein_id gnl|my_center|LOCUS_24660 14170 13418 gene locus_tag LOCUS_24670 14170 13418 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence089 842 12 gene locus_tag LOCUS_24680 842 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1627 839 gene locus_tag LOCUS_24690 1627 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 3291 1627 gene locus_tag LOCUS_24700 3291 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 3959 3288 gene locus_tag LOCUS_24710 3959 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 4375 3956 gene locus_tag LOCUS_24720 4375 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 6451 4463 gene locus_tag LOCUS_24730 gene nosZ 6451 4463 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_24730 7853 6630 gene locus_tag LOCUS_24740 7853 6630 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_24740 8005 8706 gene locus_tag LOCUS_24750 8005 8706 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727432.1 protein_id gnl|my_center|LOCUS_24750 8836 10113 gene locus_tag LOCUS_24760 8836 10113 CDS product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026930.1 protein_id gnl|my_center|LOCUS_24760 10154 10690 gene locus_tag LOCUS_24770 10154 10690 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978655.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence090 301 3300 gene locus_tag LOCUS_24780 301 3300 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480405.1 protein_id gnl|my_center|LOCUS_24780 3978 3361 gene locus_tag LOCUS_24790 3978 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 5058 5990 gene locus_tag LOCUS_24800 5058 5990 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029094.1 protein_id gnl|my_center|LOCUS_24800 6178 6387 gene locus_tag LOCUS_24810 6178 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 7493 6300 gene locus_tag LOCUS_24820 7493 6300 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410146.1 protein_id gnl|my_center|LOCUS_24820 7977 7588 gene locus_tag LOCUS_24830 gene kmtR 7977 7588 CDS product Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404335.1 protein_id gnl|my_center|LOCUS_24830 8637 8200 gene locus_tag LOCUS_24840 8637 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 9113 8634 gene locus_tag LOCUS_24850 9113 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 9280 10275 gene locus_tag LOCUS_24860 9280 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 10272 11552 gene locus_tag LOCUS_24870 10272 11552 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194502.1 protein_id gnl|my_center|LOCUS_24870 11549 11992 gene locus_tag LOCUS_24880 11549 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 11989 12723 gene locus_tag LOCUS_24890 11989 12723 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392537.1 protein_id gnl|my_center|LOCUS_24890 12791 13138 gene locus_tag LOCUS_24900 12791 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence091 1130 300 gene locus_tag LOCUS_24910 1130 300 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113846.1 protein_id gnl|my_center|LOCUS_24910 1224 1847 gene locus_tag LOCUS_24920 1224 1847 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083483.1 protein_id gnl|my_center|LOCUS_24920 2557 2102 gene locus_tag LOCUS_24930 2557 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 3598 2843 gene locus_tag LOCUS_24940 3598 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 4075 4698 gene locus_tag LOCUS_24950 4075 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 4695 5105 gene locus_tag LOCUS_24960 4695 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 6045 5494 gene locus_tag LOCUS_24970 6045 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 6306 6626 gene locus_tag LOCUS_24980 6306 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 7069 6767 gene locus_tag LOCUS_24990 7069 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24990 8012 7092 gene locus_tag LOCUS_25000 8012 7092 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_25000 8958 7999 gene locus_tag LOCUS_25010 8958 7999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_25010 10172 8955 gene locus_tag LOCUS_25020 10172 8955 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974363.1 protein_id gnl|my_center|LOCUS_25020 10316 10972 gene locus_tag LOCUS_25030 10316 10972 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_25030 10969 12321 gene locus_tag LOCUS_25040 10969 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 13705 12437 gene locus_tag LOCUS_25050 13705 12437 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence092 157 242 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 772 873 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2077 1283 gene locus_tag LOCUS_25060 2077 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2769 2077 gene locus_tag LOCUS_25070 2769 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3274 2771 gene locus_tag LOCUS_25080 3274 2771 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_25080 5183 3276 gene locus_tag LOCUS_25090 5183 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 5492 5651 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6601 5867 gene locus_tag LOCUS_25100 6601 5867 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898703.1 protein_id gnl|my_center|LOCUS_25100 6695 6789 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8768 8148 gene locus_tag LOCUS_25110 8768 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 8761 9174 gene locus_tag LOCUS_25120 8761 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 9167 9940 gene locus_tag LOCUS_25130 9167 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 10035 11216 gene locus_tag LOCUS_25140 10035 11216 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_25140 11209 12501 gene locus_tag LOCUS_25150 11209 12501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087840.1 protein_id gnl|my_center|LOCUS_25150 12498 12890 gene locus_tag LOCUS_25160 12498 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 13263 12991 gene locus_tag LOCUS_25170 13263 12991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence093 173 562 gene locus_tag LOCUS_25180 173 562 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_25180 749 1816 gene locus_tag LOCUS_25190 749 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2276 1860 gene locus_tag LOCUS_25200 2276 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2289 2466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3720 4868 gene locus_tag LOCUS_25210 3720 4868 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942380.1 protein_id gnl|my_center|LOCUS_25210 4865 5734 gene locus_tag LOCUS_25220 4865 5734 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_25220 5734 7656 gene locus_tag LOCUS_25230 5734 7656 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350675.1 protein_id gnl|my_center|LOCUS_25230 7656 8441 gene locus_tag LOCUS_25240 7656 8441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228129.1 protein_id gnl|my_center|LOCUS_25240 8567 9754 gene locus_tag LOCUS_25250 8567 9754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 9751 10185 gene locus_tag LOCUS_25260 gene paaI 9751 10185 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270401.1 protein_id gnl|my_center|LOCUS_25260 10244 10374 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10577 10857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10918 12063 gene locus_tag LOCUS_25270 gene galE 10918 12063 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775237.1 protein_id gnl|my_center|LOCUS_25270 12647 12048 gene locus_tag LOCUS_25280 12647 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25280 12696 12755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence094 <1 309 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgcaatggagcccggccatgaagaccgggaagac 764 480 gene locus_tag LOCUS_25290 764 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2460 769 gene locus_tag LOCUS_25300 gene cas1 2460 769 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_25300 3377 2457 gene locus_tag LOCUS_25310 3377 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 6499 3374 gene locus_tag LOCUS_25320 6499 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 7938 6496 gene locus_tag LOCUS_25330 7938 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 9131 7941 gene locus_tag LOCUS_25340 9131 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 9866 9345 gene locus_tag LOCUS_25350 9866 9345 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976704.1 protein_id gnl|my_center|LOCUS_25350 10992 9943 gene locus_tag LOCUS_25360 10992 9943 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_25360 12383 10989 gene locus_tag LOCUS_25370 12383 10989 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265947.1 protein_id gnl|my_center|LOCUS_25370 13118 12456 gene locus_tag LOCUS_25380 13118 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25380 >Feature sequence095 797 2815 gene locus_tag LOCUS_25390 797 2815 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804249.1 protein_id gnl|my_center|LOCUS_25390 2993 3138 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4060 3896 gene locus_tag LOCUS_25400 4060 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 4343 4041 gene locus_tag LOCUS_25410 4343 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 4597 4340 gene locus_tag LOCUS_25420 4597 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 6201 6378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6573 6825 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9315 8281 gene locus_tag LOCUS_25430 gene fgd 9315 8281 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898438.1 protein_id gnl|my_center|LOCUS_25430 11537 9312 gene locus_tag LOCUS_25440 11537 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 11720 12304 gene locus_tag LOCUS_25450 11720 12304 CDS product DUF6529 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226053.1 protein_id gnl|my_center|LOCUS_25450 12835 13002 gene locus_tag LOCUS_25460 12835 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence096 80 484 gene locus_tag LOCUS_25470 80 484 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400421.1 protein_id gnl|my_center|LOCUS_25470 1306 740 gene locus_tag LOCUS_25480 1306 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 1840 1637 gene locus_tag LOCUS_25490 1840 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 2275 2865 gene locus_tag LOCUS_25500 2275 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 4950 2788 gene locus_tag LOCUS_25510 4950 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 6074 4995 gene locus_tag LOCUS_25520 6074 4995 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_25520 6246 8981 gene locus_tag LOCUS_25530 6246 8981 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977982.1 protein_id gnl|my_center|LOCUS_25530 9808 9284 gene locus_tag LOCUS_25540 9808 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 10049 10279 gene locus_tag LOCUS_25550 10049 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 10481 11062 gene locus_tag LOCUS_25560 10481 11062 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227071.1 protein_id gnl|my_center|LOCUS_25560 11408 11932 gene locus_tag LOCUS_25570 11408 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 12345 12028 gene locus_tag LOCUS_25580 12345 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 12730 12410 gene locus_tag LOCUS_25590 12730 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence097 1306 104 gene locus_tag LOCUS_25600 1306 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2976 1303 gene locus_tag LOCUS_25610 2976 1303 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804979.1 protein_id gnl|my_center|LOCUS_25610 3679 2990 gene locus_tag LOCUS_25620 3679 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 protein_id gnl|my_center|LOCUS_25620 4782 3823 gene locus_tag LOCUS_25630 4782 3823 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_25630 6002 4779 gene locus_tag LOCUS_25640 gene steA 6002 4779 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_25640 7926 6076 gene locus_tag LOCUS_25650 gene recN 7926 6076 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_25650 8884 7952 gene locus_tag LOCUS_25660 8884 7952 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227821.1 protein_id gnl|my_center|LOCUS_25660 9390 8881 gene locus_tag LOCUS_25670 9390 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 9417 9510 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9771 9514 gene locus_tag LOCUS_25680 9771 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 10328 9768 gene locus_tag LOCUS_25690 10328 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 11584 10442 gene locus_tag LOCUS_25700 11584 10442 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_25700 12324 11581 gene locus_tag LOCUS_25710 12324 11581 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977032.1 protein_id gnl|my_center|LOCUS_25710 12545 12342 gene locus_tag LOCUS_25720 12545 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence098 1206 241 gene locus_tag LOCUS_25730 1206 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1294 1493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2448 1741 gene locus_tag LOCUS_25740 gene thiE 2448 1741 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_25740 3260 2445 gene locus_tag LOCUS_25750 3260 2445 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_25750 3462 3262 gene locus_tag LOCUS_25760 3462 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 4760 3459 gene locus_tag LOCUS_25770 gene thiO 4760 3459 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_25770 5359 7092 gene locus_tag LOCUS_25780 5359 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 7972 7391 gene locus_tag LOCUS_25790 7972 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403820.1 protein_id gnl|my_center|LOCUS_25790 8472 7972 gene locus_tag LOCUS_25800 8472 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 9159 10226 gene locus_tag LOCUS_25810 9159 10226 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223366.1 protein_id gnl|my_center|LOCUS_25810 10103 10144 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10704 10198 gene locus_tag LOCUS_25820 10704 10198 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_25820 11153 10725 gene locus_tag LOCUS_25830 11153 10725 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202437260.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence099 427 212 gene locus_tag LOCUS_25840 gene vapB2 427 212 CDS product type II toxin-antitoxin system antitoxin VapB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401563.1 protein_id gnl|my_center|LOCUS_25840 887 2167 gene locus_tag LOCUS_25850 887 2167 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_25850 3535 2912 gene locus_tag LOCUS_25860 3535 2912 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228569.1 protein_id gnl|my_center|LOCUS_25860 4342 3608 gene locus_tag LOCUS_25870 4342 3608 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977890.1 protein_id gnl|my_center|LOCUS_25870 4535 5176 gene locus_tag LOCUS_25880 4535 5176 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228567.1 protein_id gnl|my_center|LOCUS_25880 5682 6047 gene locus_tag LOCUS_25890 5682 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 6503 6129 gene locus_tag LOCUS_25900 6503 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 7264 6500 gene locus_tag LOCUS_25910 gene istB 7264 6500 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_25910 7578 7261 gene locus_tag LOCUS_25920 7578 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 9050 7575 gene locus_tag LOCUS_25930 gene istA 9050 7575 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917171.1 protein_id gnl|my_center|LOCUS_25930 9199 9050 gene locus_tag LOCUS_25940 9199 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 9305 9661 gene locus_tag LOCUS_25950 9305 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 10354 9905 gene locus_tag LOCUS_25960 10354 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 11052 10618 gene locus_tag LOCUS_25970 11052 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence100 540 1235 gene locus_tag LOCUS_25980 540 1235 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971473.1 protein_id gnl|my_center|LOCUS_25980 1703 1347 gene locus_tag LOCUS_25990 1703 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 1862 2115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3522 3599 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3612 3806 gene locus_tag LOCUS_26000 3612 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 4302 4051 gene locus_tag LOCUS_26010 4302 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26010 6205 4331 gene locus_tag LOCUS_26020 6205 4331 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729833.1 protein_id gnl|my_center|LOCUS_26020 6675 6202 gene locus_tag LOCUS_26030 6675 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 7801 6803 gene locus_tag LOCUS_26040 7801 6803 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189804125.1 protein_id gnl|my_center|LOCUS_26040 8069 8755 gene locus_tag LOCUS_26050 8069 8755 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727432.1 protein_id gnl|my_center|LOCUS_26050 8878 8971 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence101 267 1802 gene locus_tag LOCUS_26060 267 1802 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731149.1 protein_id gnl|my_center|LOCUS_26060 1741 2685 gene locus_tag LOCUS_26070 gene mftM 1741 2685 CDS product mycofactocin oligosaccharide methyltransferase MftM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731146.1 protein_id gnl|my_center|LOCUS_26070 1888 1959 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3421 2711 gene locus_tag LOCUS_26080 gene mnoR 3421 2711 CDS product two-component system response regulator MnoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897657.1 protein_id gnl|my_center|LOCUS_26080 4874 3444 gene locus_tag LOCUS_26090 gene mnoS 4874 3444 CDS product two-component system sensor histidine kinase MnoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731147.1 protein_id gnl|my_center|LOCUS_26090 6085 4871 gene locus_tag LOCUS_26100 6085 4871 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878598.1 protein_id gnl|my_center|LOCUS_26100 6664 6275 gene locus_tag LOCUS_26110 6664 6275 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027643.1 protein_id gnl|my_center|LOCUS_26110 8192 6669 gene locus_tag LOCUS_26120 8192 6669 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027628.1 protein_id gnl|my_center|LOCUS_26120 9540 8302 gene locus_tag LOCUS_26130 9540 8302 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027627.1 protein_id gnl|my_center|LOCUS_26130 10748 9729 gene locus_tag LOCUS_26140 gene adhP 10748 9729 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015397.1 protein_id gnl|my_center|LOCUS_26140 <11987 10919 gene locus_tag LOCUS_26150 <11987 10919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776830.1:aldehyde dehydrogenase family protein >Feature sequence102 514 104 gene locus_tag LOCUS_26160 514 104 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_26160 681 1289 gene locus_tag LOCUS_26170 681 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1691 2194 gene locus_tag LOCUS_26180 1691 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2191 3006 gene locus_tag LOCUS_26190 2191 3006 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_26190 3524 2892 gene locus_tag LOCUS_26200 3524 2892 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091994.1 protein_id gnl|my_center|LOCUS_26200 5537 3693 gene locus_tag LOCUS_26210 5537 3693 CDS product peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094611.1 protein_id gnl|my_center|LOCUS_26210 6711 5518 gene locus_tag LOCUS_26220 6711 5518 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516666.1 protein_id gnl|my_center|LOCUS_26220 8093 6708 gene locus_tag LOCUS_26230 8093 6708 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 protein_id gnl|my_center|LOCUS_26230 9409 8093 gene locus_tag LOCUS_26240 9409 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 9855 9409 gene locus_tag LOCUS_26250 9855 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 10123 10533 gene locus_tag LOCUS_26260 10123 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731204.1 protein_id gnl|my_center|LOCUS_26260 10625 11650 gene locus_tag LOCUS_26270 10625 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence103 1009 155 gene locus_tag LOCUS_26280 1009 155 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226056.1 protein_id gnl|my_center|LOCUS_26280 1178 2107 gene locus_tag LOCUS_26290 1178 2107 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_26290 4469 2181 gene locus_tag LOCUS_26300 4469 2181 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_26300 5130 4591 gene locus_tag LOCUS_26310 5130 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 7178 6573 gene locus_tag LOCUS_26320 gene plsY 7178 6573 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_26320 8047 7181 gene locus_tag LOCUS_26330 8047 7181 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_26330 11242 8204 gene locus_tag LOCUS_26340 gene leuS 11242 8204 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_26340 10705 10826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11751 11491 gene locus_tag LOCUS_26350 gene rpsT 11751 11491 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence104 312 1346 gene locus_tag LOCUS_26360 312 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 1516 2163 gene locus_tag LOCUS_26370 1516 2163 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730205.1 protein_id gnl|my_center|LOCUS_26370 2311 3600 gene locus_tag LOCUS_26380 2311 3600 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_26380 3644 4744 gene locus_tag LOCUS_26390 3644 4744 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113078.1 protein_id gnl|my_center|LOCUS_26390 4944 5441 gene locus_tag LOCUS_26400 4944 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 5451 5714 gene locus_tag LOCUS_26410 5451 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 5824 6624 gene locus_tag LOCUS_26420 gene atpB 5824 6624 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_26420 6791 6997 gene locus_tag LOCUS_26430 6791 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 7081 7668 gene locus_tag LOCUS_26440 7081 7668 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_26440 7668 8480 gene locus_tag LOCUS_26450 7668 8480 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_26450 8601 8716 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8762 10228 gene locus_tag LOCUS_26460 gene atpA 8762 10228 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996613.1 protein_id gnl|my_center|LOCUS_26460 9532 9625 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10339 11238 gene locus_tag LOCUS_26470 10339 11238 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence105 248 871 gene locus_tag LOCUS_26480 248 871 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030865.1 protein_id gnl|my_center|LOCUS_26480 871 1539 gene locus_tag LOCUS_26490 871 1539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061915636.1 protein_id gnl|my_center|LOCUS_26490 1536 2255 gene locus_tag LOCUS_26500 1536 2255 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030863.1 protein_id gnl|my_center|LOCUS_26500 2384 4912 gene locus_tag LOCUS_26510 2384 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 4929 5729 gene locus_tag LOCUS_26520 4929 5729 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184762880.1 protein_id gnl|my_center|LOCUS_26520 7285 5777 gene locus_tag LOCUS_26530 7285 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 7815 9500 gene locus_tag LOCUS_26540 7815 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 9497 10351 gene locus_tag LOCUS_26550 9497 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 11368 10283 gene locus_tag LOCUS_26560 11368 10283 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975437.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence106 743 267 gene locus_tag LOCUS_26570 743 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 795 1418 gene locus_tag LOCUS_26580 795 1418 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312082.1 protein_id gnl|my_center|LOCUS_26580 2207 1590 gene locus_tag LOCUS_26590 2207 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2285 2797 gene locus_tag LOCUS_26600 2285 2797 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153437081.1 protein_id gnl|my_center|LOCUS_26600 3246 3022 gene locus_tag LOCUS_26610 3246 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 3445 3581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3610 4449 gene locus_tag LOCUS_26620 3610 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 4672 5307 gene locus_tag LOCUS_26630 4672 5307 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085574.1 protein_id gnl|my_center|LOCUS_26630 5373 5906 gene locus_tag LOCUS_26640 5373 5906 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837076.1 protein_id gnl|my_center|LOCUS_26640 6517 6320 gene locus_tag LOCUS_26650 6517 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 7812 6514 gene locus_tag LOCUS_26660 7812 6514 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144955419.1 protein_id gnl|my_center|LOCUS_26660 7991 8185 gene locus_tag LOCUS_26670 7991 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 8182 9408 gene locus_tag LOCUS_26680 8182 9408 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_26680 10178 9435 gene locus_tag LOCUS_26690 10178 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 10978 10175 gene locus_tag LOCUS_26700 10978 10175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence107 766 941 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1449 2948 gene locus_tag LOCUS_26710 gene lysS 1449 2948 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_26710 2951 3157 gene locus_tag LOCUS_26720 2951 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 3240 3572 gene locus_tag LOCUS_26730 3240 3572 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_26730 4501 3599 gene locus_tag LOCUS_26740 4501 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 5483 4533 gene locus_tag LOCUS_26750 5483 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 5597 6346 gene locus_tag LOCUS_26760 5597 6346 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878394.1 protein_id gnl|my_center|LOCUS_26760 6259 6280 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6350 7177 gene locus_tag LOCUS_26770 6350 7177 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412657.1 protein_id gnl|my_center|LOCUS_26770 7739 7125 gene locus_tag LOCUS_26780 7739 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 7747 8553 gene locus_tag LOCUS_26790 gene allR 7747 8553 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_26790 8734 10311 gene locus_tag LOCUS_26800 gene aceB 8734 10311 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223803.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence108 1279 302 gene locus_tag LOCUS_26810 1279 302 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775770.1 protein_id gnl|my_center|LOCUS_26810 2745 1420 gene locus_tag LOCUS_26820 2745 1420 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908887.1 protein_id gnl|my_center|LOCUS_26820 5181 2779 gene locus_tag LOCUS_26830 gene dinG 5181 2779 CDS product ATP-dependent helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898827.1 protein_id gnl|my_center|LOCUS_26830 6795 5332 gene locus_tag LOCUS_26840 gene hflX 6795 5332 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_26840 7035 7655 gene locus_tag LOCUS_26850 7035 7655 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_26850 8629 7748 gene locus_tag LOCUS_26860 gene dapF 8629 7748 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804680.1 protein_id gnl|my_center|LOCUS_26860 9610 8711 gene locus_tag LOCUS_26870 gene miaA 9610 8711 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_26870 10444 9665 gene locus_tag LOCUS_26880 10444 9665 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_26880 10794 10459 gene locus_tag LOCUS_26890 10794 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 10873 10955 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence109 21 938 gene locus_tag LOCUS_26900 21 938 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230385.1 protein_id gnl|my_center|LOCUS_26900 1455 1015 gene locus_tag LOCUS_26910 gene ndk 1455 1015 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804615.1 protein_id gnl|my_center|LOCUS_26910 1949 1458 gene locus_tag LOCUS_26920 1949 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 3334 1946 gene locus_tag LOCUS_26930 3334 1946 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_26930 3825 3331 gene locus_tag LOCUS_26940 3825 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 5315 3846 gene locus_tag LOCUS_26950 5315 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26950 5355 5416 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7298 5583 gene locus_tag LOCUS_26960 7298 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26960 5851 5934 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7673 10462 gene locus_tag LOCUS_26970 gene valS 7673 10462 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054756.1 protein_id gnl|my_center|LOCUS_26970 9865 9949 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <11163 10599 gene locus_tag LOCUS_26980 <11163 10599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004562779.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence110 78 839 gene locus_tag LOCUS_26990 78 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26990 1292 2587 gene locus_tag LOCUS_27000 1292 2587 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 protein_id gnl|my_center|LOCUS_27000 2962 2657 gene locus_tag LOCUS_27010 2962 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 4565 3426 gene locus_tag LOCUS_27020 4565 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 4628 4831 gene locus_tag LOCUS_27030 4628 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 4908 5408 gene locus_tag LOCUS_27040 4908 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 5844 5422 gene locus_tag LOCUS_27050 5844 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 6114 6326 gene locus_tag LOCUS_27060 6114 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 6337 7515 gene locus_tag LOCUS_27070 6337 7515 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_27070 7724 7650 gene locus_tag LOCUS_t00270 7724 7650 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9349 7856 gene locus_tag LOCUS_27080 gene der 9349 7856 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_27080 10265 9561 gene locus_tag LOCUS_27090 10265 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence111 <1 1185 gene locus_tag LOCUS_27100 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898564.1:signal peptide peptidase SppA 2041 1301 gene locus_tag LOCUS_27110 2041 1301 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974001.1 protein_id gnl|my_center|LOCUS_27110 2649 2038 gene locus_tag LOCUS_27120 2649 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 3165 2710 gene locus_tag LOCUS_27130 3165 2710 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229196.1 protein_id gnl|my_center|LOCUS_27130 7100 3351 gene locus_tag LOCUS_27140 gene cobN 7100 3351 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028008.1 protein_id gnl|my_center|LOCUS_27140 7826 7170 gene locus_tag LOCUS_27150 7826 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 7841 8665 gene locus_tag LOCUS_27160 7841 8665 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_27160 8702 9361 gene locus_tag LOCUS_27170 8702 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 9699 10127 gene locus_tag LOCUS_27180 9699 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence112 8 1162 gene locus_tag LOCUS_27190 8 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225442.1 protein_id gnl|my_center|LOCUS_27190 1991 1194 gene locus_tag LOCUS_27200 1991 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 2751 2080 gene locus_tag LOCUS_27210 2751 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 3070 2930 gene locus_tag LOCUS_27220 3070 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3185 3221 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3829 3338 gene locus_tag LOCUS_27230 3829 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 5129 5224 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5291 6049 gene locus_tag LOCUS_27240 5291 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 7648 6218 gene locus_tag LOCUS_27250 7648 6218 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027921.1 protein_id gnl|my_center|LOCUS_27250 7646 7555 gene locus_tag LOCUS_t00280 7646 7555 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9342 7762 gene locus_tag LOCUS_27260 9342 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 <10444 9570 gene locus_tag LOCUS_27270 <10444 9570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230133.1:long-chain fatty acid--CoA ligase >Feature sequence113 1276 413 gene locus_tag LOCUS_27280 1276 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1233 1421 gene locus_tag LOCUS_27290 1233 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 2561 1704 gene locus_tag LOCUS_27300 2561 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 2973 4031 gene locus_tag LOCUS_27310 2973 4031 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098268.1 protein_id gnl|my_center|LOCUS_27310 4031 4360 gene locus_tag LOCUS_27320 4031 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 4942 4589 gene locus_tag LOCUS_27330 4942 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 5526 5251 gene locus_tag LOCUS_27340 5526 5251 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_27340 5801 5523 gene locus_tag LOCUS_27350 5801 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 6566 6180 gene locus_tag LOCUS_27360 6566 6180 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_27360 7333 6563 gene locus_tag LOCUS_27370 7333 6563 CDS product aminotransferase class I and II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530009.1 protein_id gnl|my_center|LOCUS_27370 7624 8043 gene locus_tag LOCUS_27380 7624 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 8341 8910 gene locus_tag LOCUS_27390 8341 8910 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038041.1 protein_id gnl|my_center|LOCUS_27390 9147 9320 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9580 10095 gene locus_tag LOCUS_27400 9580 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence114 35 925 gene locus_tag LOCUS_27410 gene sucD 35 925 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804538.1 protein_id gnl|my_center|LOCUS_27410 1188 2459 gene locus_tag LOCUS_27420 1188 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 2856 2512 gene locus_tag LOCUS_27430 2856 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 3025 3615 gene locus_tag LOCUS_27440 gene purN 3025 3615 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_27440 3612 5234 gene locus_tag LOCUS_27450 gene purH 3612 5234 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_27450 5357 5794 gene locus_tag LOCUS_27460 5357 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 7477 5891 gene locus_tag LOCUS_27470 7477 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 7653 8516 gene locus_tag LOCUS_27480 7653 8516 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_27480 8513 8782 gene locus_tag LOCUS_27490 8513 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 9356 8907 gene locus_tag LOCUS_27500 9356 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 9724 9473 gene locus_tag LOCUS_27510 9724 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 9507 9521 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence115 255 1043 gene locus_tag LOCUS_27520 255 1043 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_27520 1040 1450 gene locus_tag LOCUS_27530 1040 1450 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_27530 2327 2415 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2728 3732 gene locus_tag LOCUS_27540 2728 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 3767 4555 gene locus_tag LOCUS_27550 3767 4555 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_27550 4534 4980 gene locus_tag LOCUS_27560 4534 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 5069 5335 gene locus_tag LOCUS_27570 5069 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 5353 8109 gene locus_tag LOCUS_27580 5353 8109 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888895.1 protein_id gnl|my_center|LOCUS_27580 10219 8297 gene locus_tag LOCUS_27590 10219 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence116 416 676 gene locus_tag LOCUS_27600 416 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1859 744 gene locus_tag LOCUS_27610 1859 744 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975437.1 protein_id gnl|my_center|LOCUS_27610 3007 1913 gene locus_tag LOCUS_27620 3007 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 4734 4243 gene locus_tag LOCUS_27630 4734 4243 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209677908.1 protein_id gnl|my_center|LOCUS_27630 5485 5264 gene locus_tag LOCUS_27640 5485 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 5621 7144 gene locus_tag LOCUS_27650 5621 7144 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227038.1 protein_id gnl|my_center|LOCUS_27650 7556 8218 gene locus_tag LOCUS_27660 7556 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_27660 8548 9813 gene locus_tag LOCUS_27670 8548 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence117 1063 281 gene locus_tag LOCUS_27680 1063 281 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_27680 1179 1895 gene locus_tag LOCUS_27690 1179 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 1892 2698 gene locus_tag LOCUS_27700 1892 2698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805060.1 protein_id gnl|my_center|LOCUS_27700 2702 3577 gene locus_tag LOCUS_27710 2702 3577 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929933.1 protein_id gnl|my_center|LOCUS_27710 3590 3680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4601 3702 gene locus_tag LOCUS_27720 4601 3702 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_27720 4889 7123 gene locus_tag LOCUS_27730 gene tkt 4889 7123 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_27730 5506 5518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7154 8263 gene locus_tag LOCUS_27740 gene tal 7154 8263 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 protein_id gnl|my_center|LOCUS_27740 8260 9936 gene locus_tag LOCUS_27750 8260 9936 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence118 2413 1667 gene locus_tag LOCUS_27760 2413 1667 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_27760 2434 3141 gene locus_tag LOCUS_27770 2434 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 5113 3257 gene locus_tag LOCUS_27780 5113 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 3911 3968 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6953 5118 gene locus_tag LOCUS_27790 6953 5118 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_27790 7284 7418 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7814 7727 gene locus_tag LOCUS_t00290 7814 7727 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9128 8205 gene locus_tag LOCUS_27800 gene truB 9128 8205 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_27800 9622 9125 gene locus_tag LOCUS_27810 gene rbfA 9622 9125 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence119 778 981 gene locus_tag LOCUS_27820 778 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 1365 2126 gene locus_tag LOCUS_27830 1365 2126 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_27830 2126 2749 gene locus_tag LOCUS_27840 2126 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 2746 3720 gene locus_tag LOCUS_27850 2746 3720 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_27850 3762 3875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6736 3971 gene locus_tag LOCUS_27860 gene ppdK 6736 3971 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_27860 8237 6897 gene locus_tag LOCUS_27870 8237 6897 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730828.1 protein_id gnl|my_center|LOCUS_27870 8317 8679 gene locus_tag LOCUS_27880 8317 8679 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224159.1 protein_id gnl|my_center|LOCUS_27880 8781 9716 gene locus_tag LOCUS_27890 8781 9716 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031130.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence120 605 96 gene locus_tag LOCUS_27900 605 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 783 1226 gene locus_tag LOCUS_27910 783 1226 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_27910 1172 2302 gene locus_tag LOCUS_27920 1172 2302 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_27920 3712 2315 gene locus_tag LOCUS_27930 3712 2315 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_27930 3898 4743 gene locus_tag LOCUS_27940 3898 4743 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_27940 4810 5304 gene locus_tag LOCUS_27950 4810 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 5341 6015 gene locus_tag LOCUS_27960 5341 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 6221 7153 gene locus_tag LOCUS_27970 6221 7153 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_27970 9603 7468 gene locus_tag LOCUS_27980 9603 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 9812 9600 gene locus_tag LOCUS_27990 9812 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence121 581 48 gene locus_tag LOCUS_28000 581 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1281 751 gene locus_tag LOCUS_28010 1281 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 1313 1942 gene locus_tag LOCUS_28020 1313 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 1851 2309 gene locus_tag LOCUS_28030 1851 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 3269 2505 gene locus_tag LOCUS_28040 3269 2505 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974439.1 protein_id gnl|my_center|LOCUS_28040 3767 3444 gene locus_tag LOCUS_28050 3767 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 3991 4446 gene locus_tag LOCUS_28060 3991 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 6346 4523 gene locus_tag LOCUS_28070 6346 4523 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223305.1 protein_id gnl|my_center|LOCUS_28070 7065 6484 gene locus_tag LOCUS_28080 7065 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28080 7385 7065 gene locus_tag LOCUS_28090 7385 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28090 7284 7586 gene locus_tag LOCUS_28100 7284 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 7609 8097 gene locus_tag LOCUS_28110 7609 8097 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_28110 8425 9426 gene locus_tag LOCUS_28120 8425 9426 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 protein_id gnl|my_center|LOCUS_28120 >Feature sequence122 <1 1575 gene locus_tag LOCUS_28130 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029758.1:NADH-quinone oxidoreductase subunit L 1569 3062 gene locus_tag LOCUS_28140 1569 3062 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_28140 3059 4615 gene locus_tag LOCUS_28150 3059 4615 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029760.1 protein_id gnl|my_center|LOCUS_28150 4699 5577 gene locus_tag LOCUS_28160 gene htpX 4699 5577 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_28160 5618 8113 gene locus_tag LOCUS_28170 gene pepN 5618 8113 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 protein_id gnl|my_center|LOCUS_28170 8681 8187 gene locus_tag LOCUS_28180 8681 8187 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_28180 8848 8930 gene locus_tag LOCUS_t00300 8848 8930 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence123 1760 537 gene locus_tag LOCUS_28190 1760 537 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929863.1 protein_id gnl|my_center|LOCUS_28190 3427 1835 gene locus_tag LOCUS_28200 3427 1835 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_28200 5268 3550 gene locus_tag LOCUS_28210 5268 3550 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_28210 6402 5281 gene locus_tag LOCUS_28220 6402 5281 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804502.1 protein_id gnl|my_center|LOCUS_28220 8066 6399 gene locus_tag LOCUS_28230 gene guaB 8066 6399 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974203.1 protein_id gnl|my_center|LOCUS_28230 6491 6588 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8207 8569 gene locus_tag LOCUS_28240 8207 8569 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 protein_id gnl|my_center|LOCUS_28240 8588 8809 gene locus_tag LOCUS_28250 8588 8809 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222201.1 protein_id gnl|my_center|LOCUS_28250 <9554 8910 gene locus_tag LOCUS_28260 <9554 8910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974210.1:chaperonin GroEL >Feature sequence124 498 166 gene locus_tag LOCUS_28270 498 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 699 1202 gene locus_tag LOCUS_28280 699 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 2503 1403 gene locus_tag LOCUS_28290 2503 1403 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224737.1 protein_id gnl|my_center|LOCUS_28290 2876 2490 gene locus_tag LOCUS_28300 2876 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 3639 2941 gene locus_tag LOCUS_28310 3639 2941 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776105.1 protein_id gnl|my_center|LOCUS_28310 4565 3636 gene locus_tag LOCUS_28320 4565 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 4684 5736 gene locus_tag LOCUS_28330 4684 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 7310 5802 gene locus_tag LOCUS_28340 7310 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 8262 7420 gene locus_tag LOCUS_28350 8262 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 8709 8275 gene locus_tag LOCUS_28360 8709 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence125 1363 1848 gene locus_tag LOCUS_28370 1363 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 2421 1924 gene locus_tag LOCUS_28380 2421 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28380 2535 2873 gene locus_tag LOCUS_28390 2535 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 4026 3316 gene locus_tag LOCUS_28400 4026 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 4748 4374 gene locus_tag LOCUS_28410 4748 4374 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_28410 5191 4943 gene locus_tag LOCUS_28420 5191 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 5078 5911 gene locus_tag LOCUS_28430 5078 5911 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029872.1 protein_id gnl|my_center|LOCUS_28430 6130 6879 gene locus_tag LOCUS_28440 6130 6879 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222712.1 protein_id gnl|my_center|LOCUS_28440 9378 6937 gene locus_tag LOCUS_28450 gene pcrA 9378 6937 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence126 500 958 gene locus_tag LOCUS_28460 500 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 1056 1874 gene locus_tag LOCUS_28470 1056 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 2606 1998 gene locus_tag LOCUS_28480 2606 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 2740 2807 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5168 3063 gene locus_tag LOCUS_28490 5168 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 5724 5320 gene locus_tag LOCUS_28500 5724 5320 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_28500 6078 5854 gene locus_tag LOCUS_28510 6078 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 6300 7103 gene locus_tag LOCUS_28520 6300 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 7868 7113 gene locus_tag LOCUS_28530 7868 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 8685 8011 gene locus_tag LOCUS_28540 8685 8011 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486466.1 protein_id gnl|my_center|LOCUS_28540 9095 9176 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence127 1363 842 gene locus_tag LOCUS_28550 1363 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3189 1363 gene locus_tag LOCUS_28560 gene recA 3189 1363 CDS product intein-containing recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908056.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28560 3195 3251 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4796 3942 gene locus_tag LOCUS_28570 4796 3942 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_28570 5521 4793 gene locus_tag LOCUS_28580 5521 4793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_28580 6567 5629 gene locus_tag LOCUS_28590 6567 5629 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_28590 6841 6602 gene locus_tag LOCUS_28600 6841 6602 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857447.1 protein_id gnl|my_center|LOCUS_28600 8876 8981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence128 1918 713 gene locus_tag LOCUS_28610 1918 713 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_28610 5601 2041 gene locus_tag LOCUS_28620 5601 2041 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_28620 5925 5704 gene locus_tag LOCUS_28630 5925 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 6401 6084 gene locus_tag LOCUS_28640 6401 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 7018 7764 gene locus_tag LOCUS_28650 7018 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 8055 9104 gene locus_tag LOCUS_28660 8055 9104 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence129 780 220 gene locus_tag LOCUS_28670 780 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 1704 2504 gene locus_tag LOCUS_28680 1704 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2779 3597 gene locus_tag LOCUS_28690 2779 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 4365 3682 gene locus_tag LOCUS_28700 4365 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 5050 4373 gene locus_tag LOCUS_28710 5050 4373 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_28710 5270 5626 gene locus_tag LOCUS_28720 5270 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 5680 6405 gene locus_tag LOCUS_28730 5680 6405 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_28730 6402 7778 gene locus_tag LOCUS_28740 6402 7778 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851586.1 protein_id gnl|my_center|LOCUS_28740 9223 7940 gene locus_tag LOCUS_28750 9223 7940 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030866.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence130 251 424 gene locus_tag LOCUS_28760 251 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 697 2457 gene locus_tag LOCUS_28770 697 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 4652 2976 gene locus_tag LOCUS_28780 gene pgm 4652 2976 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_28780 6907 4649 gene locus_tag LOCUS_28790 gene glgB 6907 4649 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_28790 8466 6904 gene locus_tag LOCUS_28800 8466 6904 CDS product trehalose biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776613.1 protein_id gnl|my_center|LOCUS_28800 <9249 8466 gene locus_tag LOCUS_28810 <9249 8466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031595.1:alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase >Feature sequence131 1236 664 gene locus_tag LOCUS_28820 1236 664 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_28820 1239 1469 gene locus_tag LOCUS_28830 1239 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 1500 1943 gene locus_tag LOCUS_28840 gene rplM 1500 1943 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_28840 2022 2528 gene locus_tag LOCUS_28850 gene rpsI 2022 2528 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974238.1 protein_id gnl|my_center|LOCUS_28850 2701 4050 gene locus_tag LOCUS_28860 gene glmM 2701 4050 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_28860 4229 5311 gene locus_tag LOCUS_28870 gene ugpC 4229 5311 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804887.1 protein_id gnl|my_center|LOCUS_28870 5345 6610 gene locus_tag LOCUS_28880 5345 6610 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_28880 7295 6645 gene locus_tag LOCUS_28890 gene canB 7295 6645 CDS product beta-carbonic anhydrase CanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419492.1 protein_id gnl|my_center|LOCUS_28890 9004 7292 gene locus_tag LOCUS_28900 9004 7292 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence132 1142 171 gene locus_tag LOCUS_28910 1142 171 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845576.1 protein_id gnl|my_center|LOCUS_28910 1409 3661 gene locus_tag LOCUS_28920 1409 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 4013 3687 gene locus_tag LOCUS_28930 4013 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 4018 4650 gene locus_tag LOCUS_28940 4018 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 5717 4803 gene locus_tag LOCUS_28950 5717 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 6712 5741 gene locus_tag LOCUS_28960 6712 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 7153 7413 gene locus_tag LOCUS_28970 7153 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 8323 7502 gene locus_tag LOCUS_28980 gene istB 8323 7502 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095644379.1 protein_id gnl|my_center|LOCUS_28980 7552 7604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <9202 8320 gene locus_tag LOCUS_28990 <9202 8320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970474.1:IS21-like element ISSme2 family transposase >Feature sequence133 1447 521 gene locus_tag LOCUS_29000 1447 521 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226368.1 protein_id gnl|my_center|LOCUS_29000 1549 1767 gene locus_tag LOCUS_29010 1549 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 2744 2025 gene locus_tag LOCUS_29020 2744 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 4144 3389 gene locus_tag LOCUS_29030 4144 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 4785 4845 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7018 5444 gene locus_tag LOCUS_29040 7018 5444 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225605.1 protein_id gnl|my_center|LOCUS_29040 7163 7444 gene locus_tag LOCUS_29050 7163 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 7819 8115 gene locus_tag LOCUS_29060 7819 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 8568 8356 gene locus_tag LOCUS_29070 8568 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence134 1514 21 gene locus_tag LOCUS_29080 1514 21 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877623.1 protein_id gnl|my_center|LOCUS_29080 2514 1540 gene locus_tag LOCUS_29090 2514 1540 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225281.1 protein_id gnl|my_center|LOCUS_29090 2699 3805 gene locus_tag LOCUS_29100 2699 3805 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530723.1 protein_id gnl|my_center|LOCUS_29100 3954 4805 gene locus_tag LOCUS_29110 3954 4805 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530724.1 protein_id gnl|my_center|LOCUS_29110 4802 6046 gene locus_tag LOCUS_29120 4802 6046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530725.1 protein_id gnl|my_center|LOCUS_29120 6097 7104 gene locus_tag LOCUS_29130 6097 7104 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776787.1 protein_id gnl|my_center|LOCUS_29130 7125 7994 gene locus_tag LOCUS_29140 7125 7994 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529342.1 protein_id gnl|my_center|LOCUS_29140 7994 8854 gene locus_tag LOCUS_29150 7994 8854 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892758.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence135 103 1104 gene locus_tag LOCUS_29160 103 1104 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029047.1 protein_id gnl|my_center|LOCUS_29160 1190 1474 gene locus_tag LOCUS_29170 1190 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 1552 2289 gene locus_tag LOCUS_29180 1552 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 2529 3752 gene locus_tag LOCUS_29190 2529 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3786 5246 gene locus_tag LOCUS_29200 3786 5246 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029051.1 protein_id gnl|my_center|LOCUS_29200 5249 6763 gene locus_tag LOCUS_29210 5249 6763 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031263.1 protein_id gnl|my_center|LOCUS_29210 7349 7810 gene locus_tag LOCUS_29220 7349 7810 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_29220 8758 8120 gene locus_tag LOCUS_29230 8758 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence136 1471 236 gene locus_tag LOCUS_29240 1471 236 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_29240 1637 2308 gene locus_tag LOCUS_29250 gene phoU 1637 2308 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_29250 3072 2317 gene locus_tag LOCUS_29260 3072 2317 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_29260 3618 3082 gene locus_tag LOCUS_29270 3618 3082 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_29270 4961 3615 gene locus_tag LOCUS_29280 gene mshA 4961 3615 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_29280 5462 5091 gene locus_tag LOCUS_29290 5462 5091 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943000.1 protein_id gnl|my_center|LOCUS_29290 6312 5521 gene locus_tag LOCUS_29300 gene menH 6312 5521 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_29300 6662 6336 gene locus_tag LOCUS_29310 6662 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 7413 6868 gene locus_tag LOCUS_29320 7413 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 8473 7589 gene locus_tag LOCUS_29330 8473 7589 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229482.1 protein_id gnl|my_center|LOCUS_29330 8790 8470 gene locus_tag LOCUS_29340 8790 8470 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223344.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence137 227 338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 966 1448 gene locus_tag LOCUS_29350 966 1448 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467066.1 protein_id gnl|my_center|LOCUS_29350 2890 1442 gene locus_tag LOCUS_29360 2890 1442 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 protein_id gnl|my_center|LOCUS_29360 3009 4679 gene locus_tag LOCUS_29370 3009 4679 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030246.1 protein_id gnl|my_center|LOCUS_29370 4676 5446 gene locus_tag LOCUS_29380 4676 5446 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030245.1 protein_id gnl|my_center|LOCUS_29380 5453 6280 gene locus_tag LOCUS_29390 5453 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 7136 6294 gene locus_tag LOCUS_29400 gene rsmI 7136 6294 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_29400 7214 8806 gene locus_tag LOCUS_29410 7214 8806 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_29410 >Feature sequence138 1889 906 gene locus_tag LOCUS_29420 gene pseB 1889 906 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_29420 2051 2584 gene locus_tag LOCUS_29430 2051 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 2581 3702 gene locus_tag LOCUS_29440 gene pseI 2581 3702 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_29440 3707 4774 gene locus_tag LOCUS_29450 3707 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 4834 6093 gene locus_tag LOCUS_29460 gene glf 4834 6093 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015466.1 protein_id gnl|my_center|LOCUS_29460 6029 6065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6148 8331 gene locus_tag LOCUS_29470 6148 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence139 367 651 gene locus_tag LOCUS_29480 367 651 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406322.1 protein_id gnl|my_center|LOCUS_29480 648 920 gene locus_tag LOCUS_29490 gene relE 648 920 CDS product type II toxin-antitoxin system mRNA interferase RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898789.1 protein_id gnl|my_center|LOCUS_29490 1317 2180 gene locus_tag LOCUS_29500 1317 2180 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_29500 2225 2917 gene locus_tag LOCUS_29510 2225 2917 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_29510 2927 4120 gene locus_tag LOCUS_29520 2927 4120 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729720.1 protein_id gnl|my_center|LOCUS_29520 4184 4597 gene locus_tag LOCUS_29530 4184 4597 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_29530 4594 5763 gene locus_tag LOCUS_29540 4594 5763 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085756.1 protein_id gnl|my_center|LOCUS_29540 6816 5962 gene locus_tag LOCUS_29550 gene yaaA 6816 5962 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_29550 6778 8229 gene locus_tag LOCUS_29560 6778 8229 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_29560 8436 8664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence140 756 870 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1695 1372 gene locus_tag LOCUS_29570 1695 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 1819 2043 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2180 2426 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3545 3135 gene locus_tag LOCUS_29580 3545 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 4102 3542 gene locus_tag LOCUS_29590 4102 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673158.1 protein_id gnl|my_center|LOCUS_29590 5940 4549 gene locus_tag LOCUS_29600 5940 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 6509 5940 gene locus_tag LOCUS_29610 6509 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 7017 8102 gene locus_tag LOCUS_29620 7017 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence141 1369 113 gene locus_tag LOCUS_29630 1369 113 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223283.1 protein_id gnl|my_center|LOCUS_29630 1553 2179 gene locus_tag LOCUS_29640 1553 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3307 2255 gene locus_tag LOCUS_29650 3307 2255 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223282.1 protein_id gnl|my_center|LOCUS_29650 4202 3324 gene locus_tag LOCUS_29660 4202 3324 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223281.1 protein_id gnl|my_center|LOCUS_29660 4925 4218 gene locus_tag LOCUS_29670 4925 4218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223280.1 protein_id gnl|my_center|LOCUS_29670 5634 4912 gene locus_tag LOCUS_29680 5634 4912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223279.1 protein_id gnl|my_center|LOCUS_29680 5679 5766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5861 6601 gene locus_tag LOCUS_29690 5861 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 7221 6829 gene locus_tag LOCUS_29700 7221 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 7460 7218 gene locus_tag LOCUS_29710 7460 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 7557 7693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence142 920 561 gene locus_tag LOCUS_29720 920 561 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_29720 994 3735 gene locus_tag LOCUS_29730 994 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 3623 4159 gene locus_tag LOCUS_29740 3623 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 4965 4192 gene locus_tag LOCUS_29750 4965 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 5983 4982 gene locus_tag LOCUS_29760 5983 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 6140 5976 gene locus_tag LOCUS_29770 6140 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 6375 6142 gene locus_tag LOCUS_29780 6375 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 6788 6576 gene locus_tag LOCUS_29790 6788 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 7197 7440 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7593 7817 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8176 8428 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence143 211 1011 gene locus_tag LOCUS_29800 211 1011 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_29800 1079 2503 gene locus_tag LOCUS_29810 1079 2503 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031663.1 protein_id gnl|my_center|LOCUS_29810 2407 2474 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3676 2540 gene locus_tag LOCUS_29820 3676 2540 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191120.1 protein_id gnl|my_center|LOCUS_29820 4893 3685 gene locus_tag LOCUS_29830 4893 3685 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229335.1 protein_id gnl|my_center|LOCUS_29830 5096 5899 gene locus_tag LOCUS_29840 gene pcaH 5096 5899 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728462.1 protein_id gnl|my_center|LOCUS_29840 5892 6476 gene locus_tag LOCUS_29850 gene pcaG 5892 6476 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728463.1 protein_id gnl|my_center|LOCUS_29850 6479 7846 gene locus_tag LOCUS_29860 gene pcaB 6479 7846 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031114.1 protein_id gnl|my_center|LOCUS_29860 7843 8646 gene locus_tag LOCUS_29870 7843 8646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 >Feature sequence144 <1 546 gene locus_tag LOCUS_29880 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357618.1:phenyllactyl-CoA dehydratase activase FldI 543 1394 gene locus_tag LOCUS_29890 543 1394 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_29890 1404 3188 gene locus_tag LOCUS_29900 1404 3188 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 protein_id gnl|my_center|LOCUS_29900 3617 3210 gene locus_tag LOCUS_29910 3617 3210 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 protein_id gnl|my_center|LOCUS_29910 4105 3680 gene locus_tag LOCUS_29920 4105 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29920 4032 4757 gene locus_tag LOCUS_29930 4032 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 5309 4785 gene locus_tag LOCUS_29940 5309 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 5395 5784 gene locus_tag LOCUS_29950 5395 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 6439 6194 gene locus_tag LOCUS_29960 6439 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 6326 7972 gene locus_tag LOCUS_29970 6326 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 >Feature sequence145 711 454 gene locus_tag LOCUS_29980 711 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 1049 708 gene locus_tag LOCUS_29990 1049 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29990 2342 1071 gene locus_tag LOCUS_30000 gene istA 2342 1071 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917171.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30000 3168 2569 gene locus_tag LOCUS_30010 3168 2569 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 protein_id gnl|my_center|LOCUS_30010 3646 3260 gene locus_tag LOCUS_30020 3646 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 3936 3643 gene locus_tag LOCUS_30030 3936 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 4152 4367 gene locus_tag LOCUS_30040 4152 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 4605 4835 gene locus_tag LOCUS_30050 4605 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 4855 5733 gene locus_tag LOCUS_30060 4855 5733 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083436.1 protein_id gnl|my_center|LOCUS_30060 6041 5742 gene locus_tag LOCUS_30070 6041 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 5973 6512 gene locus_tag LOCUS_30080 5973 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 6918 7490 gene locus_tag LOCUS_30090 6918 7490 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224423.1 protein_id gnl|my_center|LOCUS_30090 7587 8249 gene locus_tag LOCUS_30100 7587 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30100 >Feature sequence146 466 855 gene locus_tag LOCUS_30110 466 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 897 970 gene locus_tag LOCUS_t00310 897 970 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2121 970 gene locus_tag LOCUS_30120 2121 970 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_30120 6448 2777 gene locus_tag LOCUS_30130 gene mobF 6448 2777 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296243.1 protein_id gnl|my_center|LOCUS_30130 6461 7816 gene locus_tag LOCUS_30140 6461 7816 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30140 >Feature sequence147 370 458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1614 796 gene locus_tag LOCUS_30150 1614 796 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 protein_id gnl|my_center|LOCUS_30150 1788 2822 gene locus_tag LOCUS_30160 gene trpS 1788 2822 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_30160 2831 3373 gene locus_tag LOCUS_30170 2831 3373 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_30170 3370 4440 gene locus_tag LOCUS_30180 gene yhjD 3370 4440 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727805.1 protein_id gnl|my_center|LOCUS_30180 5662 4499 gene locus_tag LOCUS_30190 5662 4499 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056119.1 protein_id gnl|my_center|LOCUS_30190 5812 6936 gene locus_tag LOCUS_30200 5812 6936 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 protein_id gnl|my_center|LOCUS_30200 7203 6985 gene locus_tag LOCUS_30210 7203 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 7406 7200 gene locus_tag LOCUS_30220 7406 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 7662 7372 gene locus_tag LOCUS_30230 7662 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence148 <1 981 gene locus_tag LOCUS_30240 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106517497.1:30S ribosomal protein S2 679 770 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1259 1903 gene locus_tag LOCUS_30250 1259 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30250 2015 2755 gene locus_tag LOCUS_30260 gene pyrH 2015 2755 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804636.1 protein_id gnl|my_center|LOCUS_30260 2755 3312 gene locus_tag LOCUS_30270 gene frr 2755 3312 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_30270 3330 4205 gene locus_tag LOCUS_30280 3330 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30280 4355 5419 gene locus_tag LOCUS_30290 gene rlmN 4355 5419 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_30290 5552 7453 gene locus_tag LOCUS_30300 5552 7453 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896800.1 protein_id gnl|my_center|LOCUS_30300 <8411 7548 gene locus_tag LOCUS_30310 <8411 7548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005093964.1:aspartate aminotransferase family protein >Feature sequence149 406 1728 gene locus_tag LOCUS_30320 406 1728 CDS product IS1380-like element IS1677 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014460.1 protein_id gnl|my_center|LOCUS_30320 1599 1714 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1929 2702 gene locus_tag LOCUS_30330 1929 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 2721 3191 gene locus_tag LOCUS_30340 2721 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 3164 3397 gene locus_tag LOCUS_30350 3164 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 5266 3509 gene locus_tag LOCUS_30360 5266 3509 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932359.1 protein_id gnl|my_center|LOCUS_30360 5730 5326 gene locus_tag LOCUS_30370 5730 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 6170 5790 gene locus_tag LOCUS_30380 6170 5790 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_30380 6688 6464 gene locus_tag LOCUS_30390 6688 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 6883 7341 gene locus_tag LOCUS_30400 6883 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 7935 8345 gene locus_tag LOCUS_30410 7935 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 >Feature sequence150 195 614 gene locus_tag LOCUS_30420 195 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 618 824 gene locus_tag LOCUS_30430 618 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 1419 1042 gene locus_tag LOCUS_30440 1419 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 1478 1969 gene locus_tag LOCUS_30450 1478 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 1962 3464 gene locus_tag LOCUS_30460 1962 3464 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014233.1 protein_id gnl|my_center|LOCUS_30460 3457 4455 gene locus_tag LOCUS_30470 3457 4455 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854749.1 protein_id gnl|my_center|LOCUS_30470 4536 5486 gene locus_tag LOCUS_30480 4536 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30480 5613 6005 gene locus_tag LOCUS_30490 gene rbsD 5613 6005 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116568.1 protein_id gnl|my_center|LOCUS_30490 6091 7020 gene locus_tag LOCUS_30500 6091 7020 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582789.1 protein_id gnl|my_center|LOCUS_30500 7748 7107 gene locus_tag LOCUS_30510 7748 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 7931 8134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence151 944 375 gene locus_tag LOCUS_30520 944 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225969.1 protein_id gnl|my_center|LOCUS_30520 1245 2936 gene locus_tag LOCUS_30530 1245 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 3685 3766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3873 4991 gene locus_tag LOCUS_30540 3873 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30540 6491 5361 gene locus_tag LOCUS_30550 6491 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 6585 6700 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence152 <1 2746 gene locus_tag LOCUS_30560 <1 2746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000689198.1:peptidase 3656 2871 gene locus_tag LOCUS_30570 3656 2871 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_30570 3871 3656 gene locus_tag LOCUS_30580 3871 3656 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228805.1 protein_id gnl|my_center|LOCUS_30580 4162 4764 gene locus_tag LOCUS_30590 4162 4764 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897489.1 protein_id gnl|my_center|LOCUS_30590 4847 5764 gene locus_tag LOCUS_30600 4847 5764 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_30600 6001 7050 gene locus_tag LOCUS_30610 6001 7050 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028408.1 protein_id gnl|my_center|LOCUS_30610 7112 7402 gene locus_tag LOCUS_30620 7112 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 7440 7557 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence153 805 200 gene locus_tag LOCUS_30630 805 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 978 2417 gene locus_tag LOCUS_30640 978 2417 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727370.1 protein_id gnl|my_center|LOCUS_30640 2659 2964 gene locus_tag LOCUS_30650 2659 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 3858 3253 gene locus_tag LOCUS_30660 3858 3253 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530706.1 protein_id gnl|my_center|LOCUS_30660 3997 5526 gene locus_tag LOCUS_30670 3997 5526 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_30670 6825 6301 gene locus_tag LOCUS_30680 6825 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 7201 7452 gene locus_tag LOCUS_30690 7201 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 >Feature sequence154 519 331 gene locus_tag LOCUS_30700 519 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 2364 916 gene locus_tag LOCUS_30710 2364 916 CDS product IS110-like element ISSfl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049144.1 protein_id gnl|my_center|LOCUS_30710 2832 5060 gene locus_tag LOCUS_30720 2832 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 5150 6142 gene locus_tag LOCUS_30730 5150 6142 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544985.1 protein_id gnl|my_center|LOCUS_30730 6157 7242 gene locus_tag LOCUS_30740 6157 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence155 382 543 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1420 962 gene locus_tag LOCUS_30750 1420 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 1419 1685 gene locus_tag LOCUS_30760 1419 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 3038 3181 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3318 3494 gene locus_tag LOCUS_30770 3318 3494 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_30770 3541 5145 gene locus_tag LOCUS_30780 3541 5145 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 protein_id gnl|my_center|LOCUS_30780 5952 5629 gene locus_tag LOCUS_30790 5952 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131738742.1 protein_id gnl|my_center|LOCUS_30790 6326 5862 gene locus_tag LOCUS_30800 6326 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 6667 6951 gene locus_tag LOCUS_30810 6667 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 >Feature sequence156 1905 802 gene locus_tag LOCUS_30820 1905 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 2080 3186 gene locus_tag LOCUS_30830 gene amrS 2080 3186 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_30830 3243 4061 gene locus_tag LOCUS_30840 gene amrB 3243 4061 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_30840 5084 4083 gene locus_tag LOCUS_30850 5084 4083 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_30850 5385 5909 gene locus_tag LOCUS_30860 5385 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 6661 6071 gene locus_tag LOCUS_30870 6661 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 6708 7130 gene locus_tag LOCUS_30880 6708 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 >Feature sequence157 1927 116 gene locus_tag LOCUS_30890 1927 116 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_30890 2668 2192 gene locus_tag LOCUS_30900 2668 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 2986 3345 gene locus_tag LOCUS_30910 2986 3345 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_30910 3368 4018 gene locus_tag LOCUS_30920 3368 4018 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486629.1 protein_id gnl|my_center|LOCUS_30920 4015 4572 gene locus_tag LOCUS_30930 4015 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30930 4569 5531 gene locus_tag LOCUS_30940 4569 5531 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_30940 5528 6094 gene locus_tag LOCUS_30950 5528 6094 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 protein_id gnl|my_center|LOCUS_30950 6109 6666 gene locus_tag LOCUS_30960 6109 6666 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_30960 6663 6962 gene locus_tag LOCUS_30970 gene nuoK 6663 6962 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029757.1 protein_id gnl|my_center|LOCUS_30970 >Feature sequence158 1308 760 gene locus_tag LOCUS_30980 1308 760 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028212.1 protein_id gnl|my_center|LOCUS_30980 1890 1315 gene locus_tag LOCUS_30990 1890 1315 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411199.1 protein_id gnl|my_center|LOCUS_30990 2050 2442 gene locus_tag LOCUS_31000 2050 2442 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 protein_id gnl|my_center|LOCUS_31000 2908 3321 gene locus_tag LOCUS_31010 2908 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 4773 5129 gene locus_tag LOCUS_31020 4773 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 5293 6996 gene locus_tag LOCUS_31030 5293 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence159 103 30 gene locus_tag LOCUS_t00320 103 30 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 702 172 gene locus_tag LOCUS_31040 702 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 2756 702 gene locus_tag LOCUS_31050 gene dnaG 2756 702 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775727.1 protein_id gnl|my_center|LOCUS_31050 4048 2831 gene locus_tag LOCUS_31060 4048 2831 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_31060 4864 4295 gene locus_tag LOCUS_31070 4864 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 5434 5105 gene locus_tag LOCUS_31080 5434 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 6750 5536 gene locus_tag LOCUS_31090 gene dusB 6750 5536 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147544.1 protein_id gnl|my_center|LOCUS_31090 <7371 6764 gene locus_tag LOCUS_31100 <7371 6764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729870.1:glycine--tRNA ligase >Feature sequence160 1408 428 gene locus_tag LOCUS_31110 1408 428 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_31110 1707 1408 gene locus_tag LOCUS_31120 1707 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 1994 2479 gene locus_tag LOCUS_31130 1994 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3038 2628 gene locus_tag LOCUS_31140 3038 2628 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_31140 3396 3031 gene locus_tag LOCUS_31150 3396 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222284.1 protein_id gnl|my_center|LOCUS_31150 4162 3845 gene locus_tag LOCUS_31160 4162 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 4629 4162 gene locus_tag LOCUS_31170 4629 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 5293 4955 gene locus_tag LOCUS_31180 5293 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 5610 5722 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6652 6694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6822 7160 gene locus_tag LOCUS_31190 6822 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence161 557 708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 709 930 gene locus_tag LOCUS_31200 709 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 968 1714 gene locus_tag LOCUS_31210 gene fabG 968 1714 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807992.1 protein_id gnl|my_center|LOCUS_31210 1785 3161 gene locus_tag LOCUS_31220 gene hacA 1785 3161 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_31220 3133 3669 gene locus_tag LOCUS_31230 3133 3669 CDS product Isopropylmalate/citramalate isomerase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870790.1 protein_id gnl|my_center|LOCUS_31230 3812 3976 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4073 4495 gene locus_tag LOCUS_31240 4073 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 5025 4537 gene locus_tag LOCUS_31250 5025 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 5056 5192 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6773 5661 gene locus_tag LOCUS_31260 6773 5661 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811506.1 protein_id gnl|my_center|LOCUS_31260 6805 6907 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence162 109 870 gene locus_tag LOCUS_31270 109 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 1328 1534 gene locus_tag LOCUS_31280 1328 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 1562 1702 gene locus_tag LOCUS_31290 1562 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1773 1870 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2308 2500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2781 3000 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3118 3783 gene locus_tag LOCUS_31300 3118 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 5097 3904 gene locus_tag LOCUS_31310 5097 3904 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_31310 5498 5094 gene locus_tag LOCUS_31320 5498 5094 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224534.1 protein_id gnl|my_center|LOCUS_31320 5754 5539 gene locus_tag LOCUS_31330 5754 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 6005 6232 gene locus_tag LOCUS_31340 6005 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 6947 6489 gene locus_tag LOCUS_31350 6947 6489 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence163 377 21 gene locus_tag LOCUS_31360 377 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 478 546 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1273 623 gene locus_tag LOCUS_31370 1273 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 2589 1270 gene locus_tag LOCUS_31380 2589 1270 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776070.1 protein_id gnl|my_center|LOCUS_31380 3260 2586 gene locus_tag LOCUS_31390 3260 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 3557 3808 gene locus_tag LOCUS_31400 3557 3808 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776072.1 protein_id gnl|my_center|LOCUS_31400 4395 3844 gene locus_tag LOCUS_31410 4395 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 4551 5330 gene locus_tag LOCUS_31420 4551 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 5327 5941 gene locus_tag LOCUS_31430 5327 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 6775 5948 gene locus_tag LOCUS_31440 6775 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 6815 7017 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence164 381 596 gene locus_tag LOCUS_31450 381 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 608 1591 gene locus_tag LOCUS_31460 608 1591 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31460 1570 2511 gene locus_tag LOCUS_31470 1570 2511 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_31470 2508 3599 gene locus_tag LOCUS_31480 2508 3599 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 protein_id gnl|my_center|LOCUS_31480 3715 4035 gene locus_tag LOCUS_31490 3715 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31490 4467 4955 gene locus_tag LOCUS_31500 4467 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31500 5191 4958 gene locus_tag LOCUS_31510 5191 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 6635 5259 gene locus_tag LOCUS_31520 6635 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence165 442 2427 gene locus_tag LOCUS_31530 442 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 1998 2066 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2391 3098 gene locus_tag LOCUS_31540 2391 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 3241 4446 gene locus_tag LOCUS_31550 3241 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 4722 4922 gene locus_tag LOCUS_31560 4722 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 5180 5380 gene locus_tag LOCUS_31570 5180 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 5835 6476 gene locus_tag LOCUS_31580 5835 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence166 460 47 gene locus_tag LOCUS_31590 460 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 2173 1469 gene locus_tag LOCUS_31600 2173 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 2448 2801 gene locus_tag LOCUS_31610 2448 2801 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294592.1 protein_id gnl|my_center|LOCUS_31610 2801 3001 gene locus_tag LOCUS_31620 2801 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3004 3735 gene locus_tag LOCUS_31630 3004 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31630 3732 5564 gene locus_tag LOCUS_31640 3732 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31640 5561 6667 gene locus_tag LOCUS_31650 5561 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 >Feature sequence167 395 2914 gene locus_tag LOCUS_31660 395 2914 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_31660 3136 3774 gene locus_tag LOCUS_31670 3136 3774 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270136.1 protein_id gnl|my_center|LOCUS_31670 4537 4052 gene locus_tag LOCUS_31680 4537 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 5343 4534 gene locus_tag LOCUS_31690 5343 4534 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 protein_id gnl|my_center|LOCUS_31690 5841 5745 gene locus_tag LOCUS_t00330 5841 5745 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6798 6157 gene locus_tag LOCUS_31700 6798 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence168 954 1958 gene locus_tag LOCUS_31710 954 1958 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_31710 3360 2176 gene locus_tag LOCUS_31720 3360 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 4756 3377 gene locus_tag LOCUS_31730 4756 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 5329 4859 gene locus_tag LOCUS_31740 5329 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 5583 5876 gene locus_tag LOCUS_31750 5583 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 5883 6476 gene locus_tag LOCUS_31760 5883 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 6535 6786 gene locus_tag LOCUS_31770 6535 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence169 183 1499 gene locus_tag LOCUS_31780 183 1499 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851586.1 protein_id gnl|my_center|LOCUS_31780 2307 1630 gene locus_tag LOCUS_31790 2307 1630 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_31790 2659 3309 gene locus_tag LOCUS_31800 2659 3309 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_31800 3829 3581 gene locus_tag LOCUS_31810 3829 3581 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_31810 4318 4064 gene locus_tag LOCUS_31820 4318 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 5158 5547 gene locus_tag LOCUS_31830 5158 5547 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_31830 6570 5620 gene locus_tag LOCUS_31840 6570 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 >Feature sequence170 332 484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3037 1898 gene locus_tag LOCUS_31850 3037 1898 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_31850 3696 3034 gene locus_tag LOCUS_31860 gene tmk 3696 3034 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776596.1 protein_id gnl|my_center|LOCUS_31860 3816 4142 gene locus_tag LOCUS_31870 3816 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 4055 4471 gene locus_tag LOCUS_31880 4055 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 4468 5322 gene locus_tag LOCUS_31890 4468 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 6010 5396 gene locus_tag LOCUS_31900 6010 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 6009 6221 gene locus_tag LOCUS_31910 6009 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 6223 6609 gene locus_tag LOCUS_31920 6223 6609 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_31920 >Feature sequence171 2016 1003 gene locus_tag LOCUS_31930 2016 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 3040 2030 gene locus_tag LOCUS_31940 3040 2030 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_31940 5101 3077 gene locus_tag LOCUS_31950 5101 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31950 <6758 5094 gene locus_tag LOCUS_31960 <6758 5094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028442.1:VCBS repeat-containing protein >Feature sequence172 948 640 gene locus_tag LOCUS_31970 948 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 1011 3167 gene locus_tag LOCUS_31980 1011 3167 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028686.1 protein_id gnl|my_center|LOCUS_31980 3245 3469 gene locus_tag LOCUS_31990 3245 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 3542 5158 gene locus_tag LOCUS_32000 gene purF 3542 5158 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_32000 5168 6289 gene locus_tag LOCUS_32010 gene purM 5168 6289 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804525.1 protein_id gnl|my_center|LOCUS_32010 >Feature sequence173 108 371 gene locus_tag LOCUS_32020 108 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 1000 1350 gene locus_tag LOCUS_32030 1000 1350 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 protein_id gnl|my_center|LOCUS_32030 2277 1597 gene locus_tag LOCUS_32040 2277 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 2857 2270 gene locus_tag LOCUS_32050 2857 2270 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_32050 2874 2942 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3041 3478 gene locus_tag LOCUS_32060 3041 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 3576 4181 gene locus_tag LOCUS_32070 3576 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 4331 4924 gene locus_tag LOCUS_32080 4331 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32080 4813 5253 gene locus_tag LOCUS_32090 4813 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence174 <1 3138 gene locus_tag LOCUS_32100 <1 3138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296243.1:MobF family relaxase 2595 2679 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4234 3230 gene locus_tag LOCUS_32110 4234 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 4683 4285 gene locus_tag LOCUS_32120 4683 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 4722 5966 gene locus_tag LOCUS_32130 4722 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 4969 5066 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5963 6499 gene locus_tag LOCUS_32140 5963 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence175 2236 1064 gene locus_tag LOCUS_32150 2236 1064 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975437.1 protein_id gnl|my_center|LOCUS_32150 2643 2365 gene locus_tag LOCUS_32160 2643 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 4031 2640 gene locus_tag LOCUS_32170 4031 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 2647 2718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4105 4225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence176 944 369 gene locus_tag LOCUS_32180 944 369 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080323.1 protein_id gnl|my_center|LOCUS_32180 1380 949 gene locus_tag LOCUS_32190 1380 949 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_32190 1524 3818 gene locus_tag LOCUS_32200 1524 3818 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660508.1 protein_id gnl|my_center|LOCUS_32200 4520 4143 gene locus_tag LOCUS_32210 4520 4143 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525071.1 protein_id gnl|my_center|LOCUS_32210 5563 5297 gene locus_tag LOCUS_32220 5563 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 6283 5783 gene locus_tag LOCUS_32230 6283 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 >Feature sequence177 <1 851 gene locus_tag LOCUS_32240 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210267314.1:IS630 family transposase 1199 1496 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2414 1860 gene locus_tag LOCUS_32250 2414 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 4417 2408 gene locus_tag LOCUS_32260 4417 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 >Feature sequence178 2431 1139 gene locus_tag LOCUS_32270 2431 1139 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972090.1 protein_id gnl|my_center|LOCUS_32270 4042 2624 gene locus_tag LOCUS_32280 4042 2624 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897685.1 protein_id gnl|my_center|LOCUS_32280 2828 2910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4582 4662 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5617 4673 gene locus_tag LOCUS_32290 5617 4673 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_32290 5669 5754 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence179 691 383 gene locus_tag LOCUS_32300 691 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 2322 706 gene locus_tag LOCUS_32310 2322 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 3799 2315 gene locus_tag LOCUS_32320 3799 2315 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_32320 4896 3799 gene locus_tag LOCUS_32330 4896 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 5219 4893 gene locus_tag LOCUS_32340 5219 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 6163 5459 gene locus_tag LOCUS_32350 6163 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 >Feature sequence180 <1 591 gene locus_tag LOCUS_32360 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976894.1:Fe-S cluster assembly protein SufB 591 1823 gene locus_tag LOCUS_32370 gene sufD 591 1823 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_32370 1820 2200 gene locus_tag LOCUS_32380 1820 2200 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_32380 2207 2965 gene locus_tag LOCUS_32390 gene sufC 2207 2965 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_32390 2984 4300 gene locus_tag LOCUS_32400 2984 4300 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_32400 4300 4815 gene locus_tag LOCUS_32410 4300 4815 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894513.1 protein_id gnl|my_center|LOCUS_32410 4812 5171 gene locus_tag LOCUS_32420 4812 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 5168 5872 gene locus_tag LOCUS_32430 5168 5872 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence181 574 143 gene locus_tag LOCUS_32440 574 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 721 1491 gene locus_tag LOCUS_32450 721 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 1478 1939 gene locus_tag LOCUS_32460 1478 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 2237 2755 gene locus_tag LOCUS_32470 2237 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 2694 3110 gene locus_tag LOCUS_32480 2694 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 4668 3376 gene locus_tag LOCUS_32490 4668 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 6090 4969 gene locus_tag LOCUS_32500 6090 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 5414 5461 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence182 652 218 gene locus_tag LOCUS_32510 gene furA1 652 218 CDS product fur family transcriptional regulator FurA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731249.1 protein_id gnl|my_center|LOCUS_32510 1037 963 gene locus_tag LOCUS_t00340 1037 963 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1125 1054 gene locus_tag LOCUS_t00350 1125 1054 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1259 1186 gene locus_tag LOCUS_t00360 1259 1186 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1464 3137 gene locus_tag LOCUS_32520 1464 3137 CDS product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027581.1 protein_id gnl|my_center|LOCUS_32520 3234 5363 gene locus_tag LOCUS_32530 gene glgX 3234 5363 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804991.1 protein_id gnl|my_center|LOCUS_32530 <6266 5386 gene locus_tag LOCUS_32540 <6266 5386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112196.1:polyphosphate kinase 2 family protein >Feature sequence183 733 83 gene locus_tag LOCUS_32550 733 83 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 protein_id gnl|my_center|LOCUS_32550 1177 2262 gene locus_tag LOCUS_32560 1177 2262 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_32560 2259 2900 gene locus_tag LOCUS_32570 2259 2900 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_32570 3403 3744 gene locus_tag LOCUS_32580 3403 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 5055 3838 gene locus_tag LOCUS_32590 5055 3838 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_32590 5371 5469 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5616 5868 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence184 77 472 gene locus_tag LOCUS_32600 77 472 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977738.1 protein_id gnl|my_center|LOCUS_32600 590 1024 gene locus_tag LOCUS_32610 590 1024 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893670.1 protein_id gnl|my_center|LOCUS_32610 1466 1960 gene locus_tag LOCUS_32620 1466 1960 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209677908.1 protein_id gnl|my_center|LOCUS_32620 3398 2148 gene locus_tag LOCUS_32630 gene ltrA 3398 2148 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022749.1 protein_id gnl|my_center|LOCUS_32630 3968 4036 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5078 4086 gene locus_tag LOCUS_32640 5078 4086 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142819.1 protein_id gnl|my_center|LOCUS_32640 5182 5529 gene locus_tag LOCUS_32650 5182 5529 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977724.1 protein_id gnl|my_center|LOCUS_32650 5715 5863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence185 682 341 gene locus_tag LOCUS_32660 gene mazF6 682 341 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410010.1 protein_id gnl|my_center|LOCUS_32660 927 679 gene locus_tag LOCUS_32670 927 679 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410014.1 protein_id gnl|my_center|LOCUS_32670 2255 1095 gene locus_tag LOCUS_32680 gene nifS 2255 1095 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_32680 3518 2286 gene locus_tag LOCUS_32690 3518 2286 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244177.1 protein_id gnl|my_center|LOCUS_32690 4986 3622 gene locus_tag LOCUS_32700 4986 3622 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_32700 5452 5646 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence186 1025 1414 gene locus_tag LOCUS_32710 1025 1414 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_32710 1534 1836 gene locus_tag LOCUS_32720 1534 1836 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223065.1 protein_id gnl|my_center|LOCUS_32720 1841 2311 gene locus_tag LOCUS_32730 1841 2311 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090095.1 protein_id gnl|my_center|LOCUS_32730 4538 2298 gene locus_tag LOCUS_32740 4538 2298 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_32740 4662 5462 gene locus_tag LOCUS_32750 4662 5462 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231033.1 protein_id gnl|my_center|LOCUS_32750 5872 5459 gene locus_tag LOCUS_32760 5872 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence187 902 282 gene locus_tag LOCUS_32770 902 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 1648 899 gene locus_tag LOCUS_32780 1648 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 2338 3351 gene locus_tag LOCUS_32790 gene trxB 2338 3351 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_32790 3356 4408 gene locus_tag LOCUS_32800 3356 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 4006 4083 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4378 4692 gene locus_tag LOCUS_32810 4378 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 4824 5366 gene locus_tag LOCUS_32820 4824 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030585.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence188 420 178 gene locus_tag LOCUS_32830 420 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 846 514 gene locus_tag LOCUS_32840 846 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 1002 1757 gene locus_tag LOCUS_32850 1002 1757 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413588.1 protein_id gnl|my_center|LOCUS_32850 2180 2351 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2889 3206 gene locus_tag LOCUS_32860 2889 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 3545 4048 gene locus_tag LOCUS_32870 3545 4048 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537140.1 protein_id gnl|my_center|LOCUS_32870 3784 3817 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4048 4371 gene locus_tag LOCUS_32880 4048 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 5166 5363 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence189 911 696 gene locus_tag LOCUS_32890 911 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 1960 1523 gene locus_tag LOCUS_32900 1960 1523 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 protein_id gnl|my_center|LOCUS_32900 2262 2912 gene locus_tag LOCUS_32910 2262 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 3583 2960 gene locus_tag LOCUS_32920 3583 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 3697 3837 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <5501 4359 gene locus_tag LOCUS_32930 <5501 4359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230392.1:trehalose-6-phosphate synthase >Feature sequence190 <1 675 gene locus_tag LOCUS_32940 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225577.1:zinc-dependent alcohol dehydrogenase family protein 677 1522 gene locus_tag LOCUS_32950 677 1522 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_32950 2827 1544 gene locus_tag LOCUS_32960 2827 1544 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_32960 3646 2831 gene locus_tag LOCUS_32970 3646 2831 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_32970 4829 3741 gene locus_tag LOCUS_32980 4829 3741 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224453.1 protein_id gnl|my_center|LOCUS_32980 4783 5355 gene locus_tag LOCUS_32990 4783 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 >Feature sequence191 198 959 gene locus_tag LOCUS_33000 198 959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809682.1 protein_id gnl|my_center|LOCUS_33000 937 1665 gene locus_tag LOCUS_33010 937 1665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022994065.1 protein_id gnl|my_center|LOCUS_33010 1705 2202 gene locus_tag LOCUS_33020 gene ripB 1705 2202 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212069.1 protein_id gnl|my_center|LOCUS_33020 2211 3368 gene locus_tag LOCUS_33030 2211 3368 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 protein_id gnl|my_center|LOCUS_33030 3352 4176 gene locus_tag LOCUS_33040 3352 4176 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028109.1 protein_id gnl|my_center|LOCUS_33040 >Feature sequence192 988 611 gene locus_tag LOCUS_33050 988 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 2488 1208 gene locus_tag LOCUS_33060 gene murA 2488 1208 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084647.1 protein_id gnl|my_center|LOCUS_33060 2530 3165 gene locus_tag LOCUS_33070 2530 3165 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_33070 3660 3220 gene locus_tag LOCUS_33080 3660 3220 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_33080 3940 3668 gene locus_tag LOCUS_33090 3940 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 4288 4118 gene locus_tag LOCUS_33100 4288 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 4209 4451 gene locus_tag LOCUS_33110 4209 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 >Feature sequence193 161 376 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1325 2779 gene locus_tag LOCUS_33120 1325 2779 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978704.1 protein_id gnl|my_center|LOCUS_33120 3651 2968 gene locus_tag LOCUS_33130 3651 2968 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110587.1 protein_id gnl|my_center|LOCUS_33130 3763 4398 gene locus_tag LOCUS_33140 3763 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33140 4591 4664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence194 1658 147 gene locus_tag LOCUS_33150 1658 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 1699 1896 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2912 3871 gene locus_tag LOCUS_33160 gene bioB 2912 3871 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035642.1 protein_id gnl|my_center|LOCUS_33160 4081 4389 gene locus_tag LOCUS_33170 4081 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 4386 4640 gene locus_tag LOCUS_33180 4386 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 4637 4909 gene locus_tag LOCUS_33190 4637 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 4906 5133 gene locus_tag LOCUS_33200 4906 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 >Feature sequence195 317 450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 621 809 gene locus_tag LOCUS_33210 621 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 1456 1208 gene locus_tag LOCUS_33220 1456 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 1897 2214 gene locus_tag LOCUS_33230 1897 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 2580 3830 gene locus_tag LOCUS_33240 2580 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 4123 4337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4650 4880 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence196 369 806 gene locus_tag LOCUS_33250 369 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 806 1546 gene locus_tag LOCUS_33260 806 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33260 1543 2529 gene locus_tag LOCUS_33270 1543 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33270 2560 3021 gene locus_tag LOCUS_33280 2560 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 3739 3050 gene locus_tag LOCUS_33290 3739 3050 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900903.1 protein_id gnl|my_center|LOCUS_33290 3756 3873 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4581 3982 gene locus_tag LOCUS_33300 4581 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 4733 5050 gene locus_tag LOCUS_33310 4733 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 >Feature sequence197 259 20 gene locus_tag LOCUS_33320 259 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 854 498 gene locus_tag LOCUS_33330 854 498 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226694.1 protein_id gnl|my_center|LOCUS_33330 1056 1271 gene locus_tag LOCUS_33340 1056 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 1665 1360 gene locus_tag LOCUS_33350 1665 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 1679 2821 gene locus_tag LOCUS_33360 1679 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 2913 4301 gene locus_tag LOCUS_33370 2913 4301 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_33370 4298 4798 gene locus_tag LOCUS_33380 4298 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence198 <1 2292 gene locus_tag LOCUS_33390 <1 2292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109508967.1:ATP-dependent helicase 2502 2320 gene locus_tag LOCUS_33400 2502 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 3100 2795 gene locus_tag LOCUS_33410 3100 2795 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804673.1 protein_id gnl|my_center|LOCUS_33410 3713 3207 gene locus_tag LOCUS_33420 3713 3207 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_33420 4369 3716 gene locus_tag LOCUS_33430 gene pgsA 4369 3716 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093751.1 protein_id gnl|my_center|LOCUS_33430 <5082 4366 gene locus_tag LOCUS_33440 <5082 4366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973272.1:30S ribosomal protein S12 methylthiotransferase RimO >Feature sequence199 574 703 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1254 1371 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3268 2633 gene locus_tag LOCUS_33450 3268 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 3799 3281 gene locus_tag LOCUS_33460 3799 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 4021 4647 gene locus_tag LOCUS_33470 4021 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 >Feature sequence200 772 1035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1913 1344 gene locus_tag LOCUS_33480 1913 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 2559 2098 gene locus_tag LOCUS_33490 2559 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 3878 2559 gene locus_tag LOCUS_33500 3878 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 <4908 4056 gene locus_tag LOCUS_33510 <4908 4056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028499.1:FHA domain-containing protein >Feature sequence201 407 72 gene locus_tag LOCUS_33520 407 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 1260 397 gene locus_tag LOCUS_33530 1260 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 1901 1257 gene locus_tag LOCUS_33540 1901 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 1999 2388 gene locus_tag LOCUS_33550 1999 2388 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228278.1 protein_id gnl|my_center|LOCUS_33550 2483 2720 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4403 4549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence202 2983 1250 gene locus_tag LOCUS_33560 2983 1250 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_33560 4134 2980 gene locus_tag LOCUS_33570 gene kdd 4134 2980 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_33570 >Feature sequence203 594 241 gene locus_tag LOCUS_33580 gene tnpA 594 241 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862466.1 protein_id gnl|my_center|LOCUS_33580 1118 1325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2423 1635 gene locus_tag LOCUS_33590 2423 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 4267 2423 gene locus_tag LOCUS_33600 4267 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 3401 3575 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence204 201 1508 gene locus_tag LOCUS_33610 201 1508 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_33610 1509 2888 gene locus_tag LOCUS_33620 1509 2888 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_33620 3357 4631 gene locus_tag LOCUS_33630 3357 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33630 >Feature sequence205 402 563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2570 1602 gene locus_tag LOCUS_33640 2570 1602 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173671.1 protein_id gnl|my_center|LOCUS_33640 4355 2658 gene locus_tag LOCUS_33650 4355 2658 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_33650 >Feature sequence206 750 1769 gene locus_tag LOCUS_33660 750 1769 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908796.1 protein_id gnl|my_center|LOCUS_33660 2258 1827 gene locus_tag LOCUS_33670 2258 1827 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_33670 2505 2245 gene locus_tag LOCUS_33680 2505 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 3791 2556 gene locus_tag LOCUS_33690 3791 2556 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804479.1 protein_id gnl|my_center|LOCUS_33690 4097 4393 gene locus_tag LOCUS_33700 gene groES 4097 4393 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_33700 >Feature sequence207 742 347 gene locus_tag LOCUS_33710 742 347 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_33710 1356 739 gene locus_tag LOCUS_33720 1356 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 1699 1385 gene locus_tag LOCUS_33730 1699 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 2588 1692 gene locus_tag LOCUS_33740 2588 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 3466 2585 gene locus_tag LOCUS_33750 3466 2585 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_33750 3915 3640 gene locus_tag LOCUS_33760 3915 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence208 1692 391 gene locus_tag LOCUS_33770 1692 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 2201 2422 gene locus_tag LOCUS_33780 2201 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 2419 2787 gene locus_tag LOCUS_33790 2419 2787 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229161.1 protein_id gnl|my_center|LOCUS_33790 3326 3441 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4329 3640 gene locus_tag LOCUS_33800 4329 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 >Feature sequence209 154 837 gene locus_tag LOCUS_33810 154 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 1021 946 gene locus_tag LOCUS_t00370 1021 946 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1730 1089 gene locus_tag LOCUS_33820 1730 1089 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228468.1 protein_id gnl|my_center|LOCUS_33820 2097 1741 gene locus_tag LOCUS_33830 gene rsfS 2097 1741 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_33830 2717 2124 gene locus_tag LOCUS_33840 gene nadD 2717 2124 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_33840 2977 2735 gene locus_tag LOCUS_33850 2977 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 4368 3082 gene locus_tag LOCUS_33860 4368 3082 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_33860 >Feature sequence210 103 324 gene locus_tag LOCUS_33870 103 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 498 722 gene locus_tag LOCUS_33880 498 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 1730 1978 gene locus_tag LOCUS_33890 1730 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 1975 2394 gene locus_tag LOCUS_33900 1975 2394 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_33900 2391 2813 gene locus_tag LOCUS_33910 2391 2813 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_33910 2930 3523 gene locus_tag LOCUS_33920 2930 3523 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_33920 3656 3826 gene locus_tag LOCUS_33930 3656 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence211 270 1163 gene locus_tag LOCUS_33940 270 1163 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804010.1 protein_id gnl|my_center|LOCUS_33940 1160 1636 gene locus_tag LOCUS_33950 1160 1636 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804009.1 protein_id gnl|my_center|LOCUS_33950 2559 2125 gene locus_tag LOCUS_33960 2559 2125 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 protein_id gnl|my_center|LOCUS_33960 3314 2592 gene locus_tag LOCUS_33970 3314 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 3913 3311 gene locus_tag LOCUS_33980 3913 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 >Feature sequence212 578 886 gene locus_tag LOCUS_33990 gene rplU 578 886 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775855.1 protein_id gnl|my_center|LOCUS_33990 949 1257 gene locus_tag LOCUS_34000 gene rpmA 949 1257 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_34000 1431 2990 gene locus_tag LOCUS_34010 gene obgE 1431 2990 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_34010 3022 4140 gene locus_tag LOCUS_34020 gene proB 3022 4140 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_34020 >Feature sequence213 545 674 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1657 1795 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2182 2310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3962 2940 gene locus_tag LOCUS_34030 3962 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 3981 4117 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence214 876 1000 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1915 1154 gene locus_tag LOCUS_34040 1915 1154 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729298.1 protein_id gnl|my_center|LOCUS_34040 1991 3154 gene locus_tag LOCUS_34050 1991 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34050 3077 3123 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3136 3633 gene locus_tag LOCUS_34060 3136 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34060 3961 3698 gene locus_tag LOCUS_34070 3961 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 >Feature sequence215 1173 904 gene locus_tag LOCUS_34080 1173 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 1963 1142 gene locus_tag LOCUS_34090 1963 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 2324 2082 gene locus_tag LOCUS_34100 2324 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 3261 2701 gene locus_tag LOCUS_34110 3261 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 3326 3958 gene locus_tag LOCUS_34120 3326 3958 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_34120 >Feature sequence216 1761 1971 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2768 3688 gene locus_tag LOCUS_34130 2768 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 >Feature sequence217 382 1290 gene locus_tag LOCUS_34140 382 1290 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655931.1 protein_id gnl|my_center|LOCUS_34140 2280 2372 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2757 3003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3515 3595 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence218 812 1120 gene locus_tag LOCUS_34150 gene rpsJ 812 1120 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776378.1 protein_id gnl|my_center|LOCUS_34150 1131 1787 gene locus_tag LOCUS_34160 gene rplC 1131 1787 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_34160 1789 2538 gene locus_tag LOCUS_34170 gene rplD 1789 2538 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974266.1 protein_id gnl|my_center|LOCUS_34170 2538 2837 gene locus_tag LOCUS_34180 gene rplW 2538 2837 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 protein_id gnl|my_center|LOCUS_34180 2888 3724 gene locus_tag LOCUS_34190 gene rplB 2888 3724 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776374.1 protein_id gnl|my_center|LOCUS_34190 3739 4020 gene locus_tag LOCUS_34200 gene rpsS 3739 4020 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence219 408 1523 gene locus_tag LOCUS_34210 408 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 1516 2415 gene locus_tag LOCUS_34220 1516 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 3377 2919 gene locus_tag LOCUS_34230 3377 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 3429 3818 gene locus_tag LOCUS_34240 3429 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence220 331 504 gene locus_tag LOCUS_34250 331 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 608 937 gene locus_tag LOCUS_34260 608 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 1521 1057 gene locus_tag LOCUS_34270 1521 1057 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223679.1 protein_id gnl|my_center|LOCUS_34270 1758 1531 gene locus_tag LOCUS_34280 1758 1531 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223678.1 protein_id gnl|my_center|LOCUS_34280 1782 2078 gene locus_tag LOCUS_34290 gene gatC 1782 2078 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_34290 2165 3772 gene locus_tag LOCUS_34300 gene gatA 2165 3772 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775913.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence221 1203 1051 gene locus_tag LOCUS_34310 1203 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 1556 1789 gene locus_tag LOCUS_34320 1556 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 1786 2028 gene locus_tag LOCUS_34330 1786 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 3212 2340 gene locus_tag LOCUS_34340 3212 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence222 197 844 gene locus_tag LOCUS_34350 gene tenA 197 844 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066884.1 protein_id gnl|my_center|LOCUS_34350 961 2115 gene locus_tag LOCUS_34360 961 2115 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 protein_id gnl|my_center|LOCUS_34360 3728 2283 gene locus_tag LOCUS_34370 3728 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34370 >Feature sequence223 438 598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 849 995 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1731 1787 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1845 2300 gene locus_tag LOCUS_34380 1845 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34380 2656 2783 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence224 704 318 gene locus_tag LOCUS_34390 704 318 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977738.1 protein_id gnl|my_center|LOCUS_34390 1590 745 gene locus_tag LOCUS_34400 1590 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 1856 2083 gene locus_tag LOCUS_34410 1856 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 2288 2052 gene locus_tag LOCUS_34420 2288 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 2623 2360 gene locus_tag LOCUS_34430 2623 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 2943 3043 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3410 3045 gene locus_tag LOCUS_34440 3410 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 >Feature sequence225 815 630 gene locus_tag LOCUS_34450 815 630 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_34450 1083 1214 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2921 1290 gene locus_tag LOCUS_34460 2921 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34460 3897 2887 gene locus_tag LOCUS_34470 3897 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34470 2993 3028 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence226 46 639 gene locus_tag LOCUS_34480 46 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 636 1487 gene locus_tag LOCUS_34490 636 1487 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776825.1 protein_id gnl|my_center|LOCUS_34490 2239 2859 gene locus_tag LOCUS_34500 gene satP 2239 2859 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815537.1 protein_id gnl|my_center|LOCUS_34500 >Feature sequence227 2012 2941 gene locus_tag LOCUS_34510 gene cysK 2012 2941 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804846.1 protein_id gnl|my_center|LOCUS_34510 2974 3633 gene locus_tag LOCUS_34520 gene cysE 2974 3633 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929921.1 protein_id gnl|my_center|LOCUS_34520 3691 3779 gene locus_tag LOCUS_t00380 3691 3779 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence228 436 41 gene locus_tag LOCUS_34530 436 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 1590 502 gene locus_tag LOCUS_34540 gene menB 1590 502 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485272.1 protein_id gnl|my_center|LOCUS_34540 2204 2022 gene locus_tag LOCUS_34550 2204 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 2361 2423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3591 2791 gene locus_tag LOCUS_34560 3591 2791 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976288.1 protein_id gnl|my_center|LOCUS_34560 >Feature sequence229 <1 975 gene locus_tag LOCUS_34570 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030470.1:MFS transporter 1049 1336 gene locus_tag LOCUS_34580 1049 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 3126 1951 gene locus_tag LOCUS_34590 3126 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence230 566 1801 gene locus_tag LOCUS_34600 566 1801 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084023633.1 protein_id gnl|my_center|LOCUS_34600 3502 2411 gene locus_tag LOCUS_34610 3502 2411 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730979.1 protein_id gnl|my_center|LOCUS_34610 >Feature sequence231 474 641 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 870 2153 gene locus_tag LOCUS_34620 870 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 2544 2918 gene locus_tag LOCUS_34630 gene rpsL 2544 2918 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_34630 2970 3428 gene locus_tag LOCUS_34640 gene rpsG 2970 3428 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974303.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34640 3025 3065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence232 638 321 gene locus_tag LOCUS_34650 638 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 657 783 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1297 803 gene locus_tag LOCUS_34660 1297 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 1572 1297 gene locus_tag LOCUS_34670 1572 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 1584 1671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2463 2197 gene locus_tag LOCUS_34680 2463 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 2633 2706 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence233 737 33 gene locus_tag LOCUS_34690 gene lexA 737 33 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_34690 881 1513 gene locus_tag LOCUS_34700 881 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 1770 1483 gene locus_tag LOCUS_34710 1770 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 1872 2804 gene locus_tag LOCUS_34720 1872 2804 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092179.1 protein_id gnl|my_center|LOCUS_34720 2984 3373 gene locus_tag LOCUS_34730 2984 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence234 166 1617 gene locus_tag LOCUS_34740 gene mtr 166 1617 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728470.1 protein_id gnl|my_center|LOCUS_34740 1628 2590 gene locus_tag LOCUS_34750 1628 2590 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_34750 >Feature sequence235 433 20 gene locus_tag LOCUS_34760 433 20 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_34760 452 607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 718 1143 gene locus_tag LOCUS_34770 718 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 1611 2798 gene locus_tag LOCUS_34780 1611 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 2651 2689 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2795 3364 gene locus_tag LOCUS_34790 2795 3364 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727936.1 protein_id gnl|my_center|LOCUS_34790 >Feature sequence236 1327 2193 gene locus_tag LOCUS_34800 1327 2193 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819430.1 protein_id gnl|my_center|LOCUS_34800 2807 2574 gene locus_tag LOCUS_34810 2807 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 3163 2804 gene locus_tag LOCUS_34820 3163 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 >Feature sequence237 1395 160 gene locus_tag LOCUS_34830 gene pcaF 1395 160 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969982.1 protein_id gnl|my_center|LOCUS_34830 982 1009 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2013 1468 gene locus_tag LOCUS_34840 2013 1468 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_34840 2910 2017 gene locus_tag LOCUS_34850 2910 2017 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230331.1 protein_id gnl|my_center|LOCUS_34850 >Feature sequence238 612 739 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2787 796 gene locus_tag LOCUS_34860 2787 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence239 1628 51 gene locus_tag LOCUS_34870 1628 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34870 <3285 1711 gene locus_tag LOCUS_34880 <3285 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026932.1:nitrate reductase subunit alpha note possible pseudo, frameshifted 1740 1822 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence240 <1 930 gene locus_tag LOCUS_34890 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742083.1:lysine 2,3-aminomutase 1567 1037 gene locus_tag LOCUS_34900 1567 1037 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222885.1 protein_id gnl|my_center|LOCUS_34900 2035 1643 gene locus_tag LOCUS_34910 2035 1643 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_34910 2198 3133 gene locus_tag LOCUS_34920 2198 3133 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_34920 >Feature sequence241 480 1133 gene locus_tag LOCUS_34930 480 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 1130 2305 gene locus_tag LOCUS_34940 1130 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 1153 1232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2335 3243 gene locus_tag LOCUS_34950 2335 3243 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_34950 >Feature sequence242 388 173 gene locus_tag LOCUS_34960 388 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 748 548 gene locus_tag LOCUS_34970 748 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 2176 821 gene locus_tag LOCUS_34980 2176 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 2744 2304 gene locus_tag LOCUS_34990 2744 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 2892 3092 gene locus_tag LOCUS_35000 2892 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 >Feature sequence243 946 512 gene locus_tag LOCUS_35010 946 512 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_35010 1116 1682 gene locus_tag LOCUS_35020 1116 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 2362 1721 gene locus_tag LOCUS_35030 gene hisH 2362 1721 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_35030 2567 2691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence244 1260 877 gene locus_tag LOCUS_35040 1260 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 2819 1314 gene locus_tag LOCUS_35050 2819 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 3075 2905 gene locus_tag LOCUS_35060 3075 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 >Feature sequence245 703 1068 gene locus_tag LOCUS_35070 703 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 1065 1748 gene locus_tag LOCUS_35080 1065 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 2560 2919 gene locus_tag LOCUS_35090 2560 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 >Feature sequence246 862 1008 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1183 1848 gene locus_tag LOCUS_35100 1183 1848 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_35100 1848 2036 gene locus_tag LOCUS_35110 1848 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 2287 2784 gene locus_tag LOCUS_35120 2287 2784 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_35120 >Feature sequence247 547 861 gene locus_tag LOCUS_35130 547 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 1069 1311 gene locus_tag LOCUS_35140 1069 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 1293 1499 gene locus_tag LOCUS_35150 1293 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 2417 1812 gene locus_tag LOCUS_35160 2417 1812 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530706.1 protein_id gnl|my_center|LOCUS_35160 >Feature sequence248 <1 724 gene locus_tag LOCUS_35170 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181780.1:energy-coupling factor transporter transmembrane component T 791 961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2107 2925 gene locus_tag LOCUS_35180 2107 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 >Feature sequence249 468 7 gene locus_tag LOCUS_35190 468 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 1085 720 gene locus_tag LOCUS_35200 1085 720 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_35200 1257 1685 gene locus_tag LOCUS_35210 1257 1685 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972173.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35210 1958 2581 gene locus_tag LOCUS_35220 1958 2581 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899374.1 protein_id gnl|my_center|LOCUS_35220 >Feature sequence250 1279 635 gene locus_tag LOCUS_35230 1279 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 1304 1394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1477 1653 gene locus_tag LOCUS_35240 1477 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 1653 2903 gene locus_tag LOCUS_35250 1653 2903 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence251 231 307 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1238 720 gene locus_tag LOCUS_35260 1238 720 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111753.1 protein_id gnl|my_center|LOCUS_35260 2596 2684 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence252 2184 1336 gene locus_tag LOCUS_35270 2184 1336 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_35270 2981 2211 gene locus_tag LOCUS_35280 2981 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35280 >Feature sequence253 2080 1268 gene locus_tag LOCUS_35290 2080 1268 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229684.1 protein_id gnl|my_center|LOCUS_35290 2551 2698 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence254 1480 920 gene locus_tag LOCUS_35300 1480 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35300 2327 1524 gene locus_tag LOCUS_35310 2327 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35310 >Feature sequence255 314 441 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 446 700 gene locus_tag LOCUS_35320 446 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 1138 773 gene locus_tag LOCUS_35330 1138 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 1261 1929 gene locus_tag LOCUS_35340 1261 1929 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_35340 2891 2091 gene locus_tag LOCUS_35350 gene pcaD 2891 2091 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084070.1 protein_id gnl|my_center|LOCUS_35350 >Feature sequence256 162 373 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 822 938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2768 1617 gene locus_tag LOCUS_35360 2768 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 >Feature sequence257 32 241 gene locus_tag LOCUS_35370 32 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 1298 405 gene locus_tag LOCUS_35380 1298 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 2315 1608 gene locus_tag LOCUS_35390 2315 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 >Feature sequence258 166 392 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2865 1348 gene locus_tag LOCUS_35400 2865 1348 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_35400 >Feature sequence259 833 396 gene locus_tag LOCUS_35410 833 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 1302 2009 gene locus_tag LOCUS_35420 1302 2009 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530738.1 protein_id gnl|my_center|LOCUS_35420 >Feature sequence260 722 165 gene locus_tag LOCUS_35430 722 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 622 948 gene locus_tag LOCUS_35440 622 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 1362 1880 gene locus_tag LOCUS_35450 gene nrdR 1362 1880 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973218.1 protein_id gnl|my_center|LOCUS_35450 2057 2173 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence261 155 1528 gene locus_tag LOCUS_35460 155 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 1351 1386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1489 2088 gene locus_tag LOCUS_35470 1489 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35470 2069 2338 gene locus_tag LOCUS_35480 2069 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35480 >Feature sequence262 104 841 gene locus_tag LOCUS_35490 104 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35490 807 1115 gene locus_tag LOCUS_35500 807 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35500 1329 2573 gene locus_tag LOCUS_35510 1329 2573 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_35510 >Feature sequence263 606 355 gene locus_tag LOCUS_35520 606 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 1419 613 gene locus_tag LOCUS_35530 1419 613 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899614.1 protein_id gnl|my_center|LOCUS_35530 2660 1419 gene locus_tag LOCUS_35540 gene istA 2660 1419 CDS product IS21-like element ISMbo1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414864.1 protein_id gnl|my_center|LOCUS_35540 >Feature sequence264 471 181 gene locus_tag LOCUS_35550 471 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 717 908 gene locus_tag LOCUS_35560 717 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 1129 1566 gene locus_tag LOCUS_35570 1129 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 2217 1807 gene locus_tag LOCUS_35580 2217 1807 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229329.1 protein_id gnl|my_center|LOCUS_35580 2344 2574 gene locus_tag LOCUS_35590 2344 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 >Feature sequence265 193 341 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 711 358 gene locus_tag LOCUS_35600 711 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 >Feature sequence266 499 272 gene locus_tag LOCUS_35610 499 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 607 1467 gene locus_tag LOCUS_35620 607 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 1469 1915 gene locus_tag LOCUS_35630 1469 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 1958 2545 gene locus_tag LOCUS_35640 1958 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35640 >Feature sequence267 56 1564 gene locus_tag LOCUS_35650 56 1564 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972177.1 protein_id gnl|my_center|LOCUS_35650 >Feature sequence268 56 817 gene locus_tag LOCUS_35660 56 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 2054 1311 gene locus_tag LOCUS_35670 2054 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 >Feature sequence269 1097 96 gene locus_tag LOCUS_35680 1097 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35680 2469 1558 gene locus_tag LOCUS_35690 gene xerD 2469 1558 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014350.1 protein_id gnl|my_center|LOCUS_35690 >Feature sequence270 2227 848 gene locus_tag LOCUS_35700 2227 848 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224565.1 protein_id gnl|my_center|LOCUS_35700 >Feature sequence271 157 360 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1840 581 gene locus_tag LOCUS_35710 1840 581 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226226.1 protein_id gnl|my_center|LOCUS_35710 2501 1935 gene locus_tag LOCUS_35720 gene folE 2501 1935 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_35720 >Feature sequence272 2080 1598 gene locus_tag LOCUS_35730 2080 1598 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_35730 >Feature sequence273 347 364 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 394 651 gene locus_tag LOCUS_35740 394 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 1779 673 gene locus_tag LOCUS_35750 1779 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 1787 1955 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence274 606 2030 gene locus_tag LOCUS_35760 606 2030 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_35760 2370 2116 gene locus_tag LOCUS_35770 2370 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence275 2002 2157 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends