>Feature sequence01 365 135 gene locus_tag LOCUS_00010 365 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 408 671 gene locus_tag LOCUS_00020 408 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1251 1093 gene locus_tag LOCUS_00030 1251 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1449 1525 gene locus_tag LOCUS_t00010 1449 1525 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1563 1713 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2014 2179 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2194 2880 gene locus_tag LOCUS_00040 2194 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3037 3618 gene locus_tag LOCUS_00050 3037 3618 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_00050 5883 3856 gene locus_tag LOCUS_00060 gene feoB 5883 3856 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868866.1 protein_id gnl|my_center|LOCUS_00060 6176 5886 gene locus_tag LOCUS_00070 6176 5886 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868865.1 protein_id gnl|my_center|LOCUS_00070 6497 6267 gene locus_tag LOCUS_00080 6497 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7191 6475 gene locus_tag LOCUS_00090 7191 6475 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868863.1 protein_id gnl|my_center|LOCUS_00090 7361 8236 gene locus_tag LOCUS_00100 7361 8236 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681792.1 protein_id gnl|my_center|LOCUS_00100 8262 9245 gene locus_tag LOCUS_00110 8262 9245 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_00110 9370 10068 gene locus_tag LOCUS_00120 9370 10068 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869173.1 protein_id gnl|my_center|LOCUS_00120 12360 10165 gene locus_tag LOCUS_00130 12360 10165 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869076.1 protein_id gnl|my_center|LOCUS_00130 12727 13254 gene locus_tag LOCUS_00140 12727 13254 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546838.1 protein_id gnl|my_center|LOCUS_00140 13277 14707 gene locus_tag LOCUS_00150 13277 14707 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_00150 14876 16309 gene locus_tag LOCUS_00160 14876 16309 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868909.1 protein_id gnl|my_center|LOCUS_00160 16364 16555 gene locus_tag LOCUS_00170 16364 16555 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565643.1 protein_id gnl|my_center|LOCUS_00170 16582 16890 gene locus_tag LOCUS_00180 16582 16890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 16905 17864 gene locus_tag LOCUS_00190 16905 17864 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_00190 18511 18011 gene locus_tag LOCUS_00200 18511 18011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 18716 19174 gene locus_tag LOCUS_00210 18716 19174 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_00210 19190 20773 gene locus_tag LOCUS_00220 19190 20773 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461217.1 protein_id gnl|my_center|LOCUS_00220 20766 21212 gene locus_tag LOCUS_00230 gene tadA 20766 21212 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_00230 21445 21537 gene locus_tag LOCUS_t00020 21445 21537 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22154 23365 gene locus_tag LOCUS_00240 22154 23365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146490.1 protein_id gnl|my_center|LOCUS_00240 23352 24455 gene locus_tag LOCUS_00250 23352 24455 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861572.1 protein_id gnl|my_center|LOCUS_00250 24874 26163 gene locus_tag LOCUS_00260 gene larA 24874 26163 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986388.1 protein_id gnl|my_center|LOCUS_00260 27451 26180 gene locus_tag LOCUS_00270 gene arcA 27451 26180 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485355.1 protein_id gnl|my_center|LOCUS_00270 27895 28350 gene locus_tag LOCUS_00280 27895 28350 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_00280 28347 28703 gene locus_tag LOCUS_00290 28347 28703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 28781 28868 gene locus_tag LOCUS_t00030 28781 28868 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30070 28973 gene locus_tag LOCUS_00300 30070 28973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 30343 30978 gene locus_tag LOCUS_00310 30343 30978 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870124.1 protein_id gnl|my_center|LOCUS_00310 30975 34070 gene locus_tag LOCUS_00320 30975 34070 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870125.1 protein_id gnl|my_center|LOCUS_00320 34067 35395 gene locus_tag LOCUS_00330 34067 35395 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870126.1 protein_id gnl|my_center|LOCUS_00330 35403 36566 gene locus_tag LOCUS_00340 35403 36566 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_00340 36655 38436 gene locus_tag LOCUS_00350 36655 38436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38724 40073 gene locus_tag LOCUS_00360 38724 40073 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205893.1 protein_id gnl|my_center|LOCUS_00360 40107 41060 gene locus_tag LOCUS_00370 40107 41060 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_00370 41131 43083 gene locus_tag LOCUS_00380 41131 43083 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_00380 43100 43807 gene locus_tag LOCUS_00390 43100 43807 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861637.1 protein_id gnl|my_center|LOCUS_00390 43791 44492 gene locus_tag LOCUS_00400 43791 44492 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 protein_id gnl|my_center|LOCUS_00400 44489 45673 gene locus_tag LOCUS_00410 44489 45673 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_00410 45918 47063 gene locus_tag LOCUS_00420 45918 47063 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869548.1 protein_id gnl|my_center|LOCUS_00420 47060 47734 gene locus_tag LOCUS_00430 47060 47734 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869549.1 protein_id gnl|my_center|LOCUS_00430 47983 48162 gene locus_tag LOCUS_00440 47983 48162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 48254 48730 gene locus_tag LOCUS_00450 48254 48730 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 protein_id gnl|my_center|LOCUS_00450 48745 49143 gene locus_tag LOCUS_00460 48745 49143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 49200 50168 gene locus_tag LOCUS_00470 49200 50168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 50185 51054 gene locus_tag LOCUS_00480 gene cpaB 50185 51054 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932120.1 protein_id gnl|my_center|LOCUS_00480 51054 52208 gene locus_tag LOCUS_00490 51054 52208 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_00490 52205 53323 gene locus_tag LOCUS_00500 52205 53323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 53320 54663 gene locus_tag LOCUS_00510 53320 54663 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_00510 54666 55592 gene locus_tag LOCUS_00520 54666 55592 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_00520 55605 56495 gene locus_tag LOCUS_00530 55605 56495 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_00530 56981 57835 gene locus_tag LOCUS_00540 56981 57835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 58462 59982 gene locus_tag LOCUS_00550 58462 59982 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_00550 60101 61030 gene locus_tag LOCUS_00560 60101 61030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_00560 61047 61910 gene locus_tag LOCUS_00570 61047 61910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_00570 61930 62919 gene locus_tag LOCUS_00580 61930 62919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_00580 62931 63911 gene locus_tag LOCUS_00590 62931 63911 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_00590 63918 64967 gene locus_tag LOCUS_00600 63918 64967 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673388.1 protein_id gnl|my_center|LOCUS_00600 65148 65915 gene locus_tag LOCUS_00610 65148 65915 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459450.1 protein_id gnl|my_center|LOCUS_00610 65925 67622 gene locus_tag LOCUS_00620 65925 67622 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538194.1 protein_id gnl|my_center|LOCUS_00620 67658 69184 gene locus_tag LOCUS_00630 67658 69184 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_00630 69283 70212 gene locus_tag LOCUS_00640 69283 70212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_00640 70226 71080 gene locus_tag LOCUS_00650 70226 71080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_00650 71094 72083 gene locus_tag LOCUS_00660 71094 72083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_00660 72080 73057 gene locus_tag LOCUS_00670 72080 73057 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_00670 73057 74277 gene locus_tag LOCUS_00680 gene pepT 73057 74277 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_00680 74644 74889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75285 76517 gene locus_tag LOCUS_00690 gene pepT 75285 76517 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_00690 77329 76604 gene locus_tag LOCUS_00700 77329 76604 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438111.1 protein_id gnl|my_center|LOCUS_00700 78713 77430 gene locus_tag LOCUS_00710 gene abgA 78713 77430 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444929.1 protein_id gnl|my_center|LOCUS_00710 79915 78713 gene locus_tag LOCUS_00720 79915 78713 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582490.1 protein_id gnl|my_center|LOCUS_00720 80092 80544 gene locus_tag LOCUS_00730 80092 80544 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_00730 81084 80737 gene locus_tag LOCUS_00740 81084 80737 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869489.1 protein_id gnl|my_center|LOCUS_00740 81313 82113 gene locus_tag LOCUS_00750 gene rpsB 81313 82113 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869490.1 protein_id gnl|my_center|LOCUS_00750 82137 82733 gene locus_tag LOCUS_00760 gene tsf 82137 82733 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869491.1 protein_id gnl|my_center|LOCUS_00760 82817 83548 gene locus_tag LOCUS_00770 gene pyrH 82817 83548 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869492.1 protein_id gnl|my_center|LOCUS_00770 83541 84101 gene locus_tag LOCUS_00780 gene frr 83541 84101 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869493.1 protein_id gnl|my_center|LOCUS_00780 85492 84191 gene locus_tag LOCUS_00790 85492 84191 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869182.1 protein_id gnl|my_center|LOCUS_00790 85739 86719 gene locus_tag LOCUS_00800 gene gyaR 85739 86719 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_00800 87969 86779 gene locus_tag LOCUS_00810 87969 86779 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869494.1 protein_id gnl|my_center|LOCUS_00810 88122 88661 gene locus_tag LOCUS_00820 gene raiA 88122 88661 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869495.1 protein_id gnl|my_center|LOCUS_00820 88740 89093 gene locus_tag LOCUS_00830 gene hypA 88740 89093 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462320.1 protein_id gnl|my_center|LOCUS_00830 89086 89751 gene locus_tag LOCUS_00840 gene hypB 89086 89751 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007234.1 protein_id gnl|my_center|LOCUS_00840 89742 91724 gene locus_tag LOCUS_00850 89742 91724 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869496.1 protein_id gnl|my_center|LOCUS_00850 91684 92565 gene locus_tag LOCUS_00860 91684 92565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 92562 95177 gene locus_tag LOCUS_00870 92562 95177 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869498.1 protein_id gnl|my_center|LOCUS_00870 95183 95788 gene locus_tag LOCUS_00880 95183 95788 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_00880 95816 96598 gene locus_tag LOCUS_00890 gene surE 95816 96598 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869500.1 protein_id gnl|my_center|LOCUS_00890 96946 98163 gene locus_tag LOCUS_00900 96946 98163 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869501.1 protein_id gnl|my_center|LOCUS_00900 98210 98977 gene locus_tag LOCUS_00910 98210 98977 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_00910 99135 99335 gene locus_tag LOCUS_00920 99135 99335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 99592 101760 gene locus_tag LOCUS_00930 99592 101760 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868920.1 protein_id gnl|my_center|LOCUS_00930 101757 102806 gene locus_tag LOCUS_00940 101757 102806 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868921.1 protein_id gnl|my_center|LOCUS_00940 102800 104221 gene locus_tag LOCUS_00950 102800 104221 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868922.1 protein_id gnl|my_center|LOCUS_00950 104221 105555 gene locus_tag LOCUS_00960 104221 105555 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868923.1 protein_id gnl|my_center|LOCUS_00960 106189 105653 gene locus_tag LOCUS_00970 gene purE 106189 105653 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_00970 107482 106208 gene locus_tag LOCUS_00980 gene purD 107482 106208 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869504.1 protein_id gnl|my_center|LOCUS_00980 109027 107498 gene locus_tag LOCUS_00990 gene purH 109027 107498 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869505.1 protein_id gnl|my_center|LOCUS_00990 109622 109014 gene locus_tag LOCUS_01000 gene purN 109622 109014 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869506.1 protein_id gnl|my_center|LOCUS_01000 110617 109619 gene locus_tag LOCUS_01010 gene purM 110617 109619 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869507.1 protein_id gnl|my_center|LOCUS_01010 111974 110601 gene locus_tag LOCUS_01020 gene purF 111974 110601 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869508.1 protein_id gnl|my_center|LOCUS_01020 114128 111975 gene locus_tag LOCUS_01030 gene purL 114128 111975 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869509.1 protein_id gnl|my_center|LOCUS_01030 114834 114130 gene locus_tag LOCUS_01040 gene purQ 114834 114130 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869510.1 protein_id gnl|my_center|LOCUS_01040 115085 114837 gene locus_tag LOCUS_01050 gene purS 115085 114837 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869511.1 protein_id gnl|my_center|LOCUS_01050 115217 115417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 116051 116341 gene locus_tag LOCUS_01060 116051 116341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 116504 118315 gene locus_tag LOCUS_01070 gene lepA 116504 118315 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925365.1 protein_id gnl|my_center|LOCUS_01070 118327 119424 gene locus_tag LOCUS_01080 gene hemW 118327 119424 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869514.1 protein_id gnl|my_center|LOCUS_01080 119444 120028 gene locus_tag LOCUS_01090 119444 120028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 120623 120015 gene locus_tag LOCUS_01100 gene yedF 120623 120015 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869005.1 protein_id gnl|my_center|LOCUS_01100 120896 122308 gene locus_tag LOCUS_01110 gene selA 120896 122308 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869516.1 protein_id gnl|my_center|LOCUS_01110 122301 124241 gene locus_tag LOCUS_01120 gene selB 122301 124241 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869517.1 protein_id gnl|my_center|LOCUS_01120 124338 124580 gene locus_tag LOCUS_01130 124338 124580 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869518.1 protein_id gnl|my_center|LOCUS_01130 124622 124761 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 124822 125694 gene locus_tag LOCUS_01140 124822 125694 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869519.1 protein_id gnl|my_center|LOCUS_01140 125691 126488 gene locus_tag LOCUS_01150 125691 126488 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869520.1 protein_id gnl|my_center|LOCUS_01150 126562 126744 gene locus_tag LOCUS_01160 126562 126744 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869521.1 protein_id gnl|my_center|LOCUS_01160 126855 126931 gene locus_tag LOCUS_t00040 126855 126931 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 126996 127772 gene locus_tag LOCUS_01170 126996 127772 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869522.1 protein_id gnl|my_center|LOCUS_01170 127812 128807 gene locus_tag LOCUS_01180 gene trpS 127812 128807 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869523.1 protein_id gnl|my_center|LOCUS_01180 128817 129596 gene locus_tag LOCUS_01190 128817 129596 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869524.1 protein_id gnl|my_center|LOCUS_01190 129568 130113 gene locus_tag LOCUS_01200 gene scpB 129568 130113 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869525.1 protein_id gnl|my_center|LOCUS_01200 130120 130836 gene locus_tag LOCUS_01210 130120 130836 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869526.1 protein_id gnl|my_center|LOCUS_01210 130868 131758 gene locus_tag LOCUS_01220 130868 131758 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_01220 131762 132439 gene locus_tag LOCUS_01230 gene cmk 131762 132439 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869528.1 protein_id gnl|my_center|LOCUS_01230 132436 133062 gene locus_tag LOCUS_01240 132436 133062 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869529.1 protein_id gnl|my_center|LOCUS_01240 133046 134176 gene locus_tag LOCUS_01250 gene hflX 133046 134176 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869530.1 protein_id gnl|my_center|LOCUS_01250 134205 135089 gene locus_tag LOCUS_01260 134205 135089 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869531.1 protein_id gnl|my_center|LOCUS_01260 135089 135358 gene locus_tag LOCUS_01270 135089 135358 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925137.1 protein_id gnl|my_center|LOCUS_01270 135435 135920 gene locus_tag LOCUS_01280 gene gmk 135435 135920 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_01280 135935 136186 gene locus_tag LOCUS_01290 135935 136186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 136167 137393 gene locus_tag LOCUS_01300 gene coaBC 136167 137393 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869535.1 protein_id gnl|my_center|LOCUS_01300 137390 139210 gene locus_tag LOCUS_01310 137390 139210 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869536.1 protein_id gnl|my_center|LOCUS_01310 139237 140547 gene locus_tag LOCUS_01320 gene der 139237 140547 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869537.1 protein_id gnl|my_center|LOCUS_01320 140659 140934 gene locus_tag LOCUS_01330 140659 140934 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869538.1 protein_id gnl|my_center|LOCUS_01330 141811 140996 gene locus_tag LOCUS_01340 gene rsmA 141811 140996 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869539.1 protein_id gnl|my_center|LOCUS_01340 144043 142019 gene locus_tag LOCUS_01350 144043 142019 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966093.1 protein_id gnl|my_center|LOCUS_01350 144862 144785 gene locus_tag LOCUS_t00050 144862 144785 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 148561 145010 gene locus_tag LOCUS_01360 gene nifJ 148561 145010 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_01360 148965 149912 gene locus_tag LOCUS_01370 gene trmB 148965 149912 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869856.1 protein_id gnl|my_center|LOCUS_01370 149909 150310 gene locus_tag LOCUS_01380 149909 150310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 150310 150822 gene locus_tag LOCUS_01390 150310 150822 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869855.1 protein_id gnl|my_center|LOCUS_01390 150819 151325 gene locus_tag LOCUS_01400 gene coaD 150819 151325 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869854.1 protein_id gnl|my_center|LOCUS_01400 152544 151336 gene locus_tag LOCUS_01410 152544 151336 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869853.1 protein_id gnl|my_center|LOCUS_01410 152632 153834 gene locus_tag LOCUS_01420 152632 153834 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925178.1 protein_id gnl|my_center|LOCUS_01420 153870 154433 gene locus_tag LOCUS_01430 153870 154433 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938506.1 protein_id gnl|my_center|LOCUS_01430 154453 154656 gene locus_tag LOCUS_01440 gene rpmF 154453 154656 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869850.1 protein_id gnl|my_center|LOCUS_01440 154954 155487 gene locus_tag LOCUS_01450 gene fapR 154954 155487 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869849.1 protein_id gnl|my_center|LOCUS_01450 155506 156504 gene locus_tag LOCUS_01460 gene plsX 155506 156504 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869848.1 protein_id gnl|my_center|LOCUS_01460 156508 157506 gene locus_tag LOCUS_01470 156508 157506 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869847.1 protein_id gnl|my_center|LOCUS_01470 157582 158466 gene locus_tag LOCUS_01480 gene fabK 157582 158466 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925404.1 protein_id gnl|my_center|LOCUS_01480 158487 159437 gene locus_tag LOCUS_01490 gene fabD 158487 159437 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869845.1 protein_id gnl|my_center|LOCUS_01490 159434 160180 gene locus_tag LOCUS_01500 gene fabG 159434 160180 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_01500 160209 160460 gene locus_tag LOCUS_01510 gene acpP 160209 160460 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280528.1 protein_id gnl|my_center|LOCUS_01510 160559 161797 gene locus_tag LOCUS_01520 gene fabF 160559 161797 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869842.1 protein_id gnl|my_center|LOCUS_01520 162202 162312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 162661 162880 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 163252 163395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 163400 163600 gene locus_tag LOCUS_01530 163400 163600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 163683 164438 gene locus_tag LOCUS_01540 163683 164438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869832.1 protein_id gnl|my_center|LOCUS_01540 165696 164500 gene locus_tag LOCUS_01550 165696 164500 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878822.1 protein_id gnl|my_center|LOCUS_01550 166625 165759 gene locus_tag LOCUS_01560 gene selD 166625 165759 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869559.1 protein_id gnl|my_center|LOCUS_01560 167096 168118 gene locus_tag LOCUS_01570 gene prfB 167096 168118 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869561.1 protein_id gnl|my_center|LOCUS_01570 168139 170043 gene locus_tag LOCUS_01580 168139 170043 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_01580 170046 170657 gene locus_tag LOCUS_01590 gene tmk 170046 170657 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869767.1 protein_id gnl|my_center|LOCUS_01590 170654 171088 gene locus_tag LOCUS_01600 170654 171088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 171064 171831 gene locus_tag LOCUS_01610 171064 171831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 171803 173161 gene locus_tag LOCUS_01620 171803 173161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 173182 174114 gene locus_tag LOCUS_01630 gene ftsY 173182 174114 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869763.1 protein_id gnl|my_center|LOCUS_01630 174428 174907 gene locus_tag LOCUS_01640 174428 174907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 174874 175437 gene locus_tag LOCUS_01650 174874 175437 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121758.1 protein_id gnl|my_center|LOCUS_01650 175434 176729 gene locus_tag LOCUS_01660 gene purB 175434 176729 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869761.1 protein_id gnl|my_center|LOCUS_01660 176741 177742 gene locus_tag LOCUS_01670 gene glpX 176741 177742 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869760.1 protein_id gnl|my_center|LOCUS_01670 180059 177777 gene locus_tag LOCUS_01680 gene hypF 180059 177777 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_01680 180146 180685 gene locus_tag LOCUS_01690 gene cobO 180146 180685 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442279.1 protein_id gnl|my_center|LOCUS_01690 180686 183238 gene locus_tag LOCUS_01700 180686 183238 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455818.1 protein_id gnl|my_center|LOCUS_01700 183251 184309 gene locus_tag LOCUS_01710 gene mnmA 183251 184309 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_01710 184297 186741 gene locus_tag LOCUS_01720 184297 186741 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869728.1 protein_id gnl|my_center|LOCUS_01720 186757 187461 gene locus_tag LOCUS_01730 186757 187461 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_01730 187854 187546 gene locus_tag LOCUS_01740 187854 187546 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869726.1 protein_id gnl|my_center|LOCUS_01740 188897 187860 gene locus_tag LOCUS_01750 gene hisC 188897 187860 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927011.1 protein_id gnl|my_center|LOCUS_01750 189158 190336 gene locus_tag LOCUS_01760 189158 190336 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925084.1 protein_id gnl|my_center|LOCUS_01760 190438 191010 gene locus_tag LOCUS_01770 gene efp 190438 191010 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869789.1 protein_id gnl|my_center|LOCUS_01770 191031 191453 gene locus_tag LOCUS_01780 191031 191453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869788.1 protein_id gnl|my_center|LOCUS_01780 191475 192020 gene locus_tag LOCUS_01790 191475 192020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 192090 192578 gene locus_tag LOCUS_01800 192090 192578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 192579 193058 gene locus_tag LOCUS_01810 gene nusB 192579 193058 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869785.1 protein_id gnl|my_center|LOCUS_01810 193024 194235 gene locus_tag LOCUS_01820 gene xseA 193024 194235 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869784.1 protein_id gnl|my_center|LOCUS_01820 194248 195258 gene locus_tag LOCUS_01830 gene mtnA 194248 195258 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925400.1 protein_id gnl|my_center|LOCUS_01830 195291 196532 gene locus_tag LOCUS_01840 195291 196532 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925399.1 protein_id gnl|my_center|LOCUS_01840 196536 197819 gene locus_tag LOCUS_01850 196536 197819 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869781.1 protein_id gnl|my_center|LOCUS_01850 197841 200489 gene locus_tag LOCUS_01860 gene alaS 197841 200489 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869780.1 protein_id gnl|my_center|LOCUS_01860 200492 200908 gene locus_tag LOCUS_01870 gene ruvX 200492 200908 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869779.1 protein_id gnl|my_center|LOCUS_01870 201030 201164 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 201178 203805 gene locus_tag LOCUS_01880 201178 203805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 201812 201958 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 203792 205558 gene locus_tag LOCUS_01890 gene mutL 203792 205558 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869777.1 protein_id gnl|my_center|LOCUS_01890 205558 206514 gene locus_tag LOCUS_01900 gene miaA 205558 206514 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869776.1 protein_id gnl|my_center|LOCUS_01900 206577 207347 gene locus_tag LOCUS_01910 gene ispH 206577 207347 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869775.1 protein_id gnl|my_center|LOCUS_01910 207370 208875 gene locus_tag LOCUS_01920 207370 208875 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869774.1 protein_id gnl|my_center|LOCUS_01920 208950 209450 gene locus_tag LOCUS_01930 gene def 208950 209450 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869773.1 protein_id gnl|my_center|LOCUS_01930 209447 210391 gene locus_tag LOCUS_01940 209447 210391 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869772.1 protein_id gnl|my_center|LOCUS_01940 210384 211160 gene locus_tag LOCUS_01950 210384 211160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_01950 211202 211420 gene locus_tag LOCUS_01960 211202 211420 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_01960 211445 212509 gene locus_tag LOCUS_01970 211445 212509 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_01970 212523 213269 gene locus_tag LOCUS_01980 212523 213269 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_01980 213282 213842 gene locus_tag LOCUS_01990 213282 213842 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_01990 213843 214388 gene locus_tag LOCUS_02000 213843 214388 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869771.1 protein_id gnl|my_center|LOCUS_02000 214454 215335 gene locus_tag LOCUS_02010 214454 215335 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869770.1 protein_id gnl|my_center|LOCUS_02010 215354 216187 gene locus_tag LOCUS_02020 215354 216187 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869769.1 protein_id gnl|my_center|LOCUS_02020 216180 217490 gene locus_tag LOCUS_02030 216180 217490 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869768.1 protein_id gnl|my_center|LOCUS_02030 217487 218428 gene locus_tag LOCUS_02040 217487 218428 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792442.1 protein_id gnl|my_center|LOCUS_02040 218448 218942 gene locus_tag LOCUS_02050 218448 218942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 218956 219360 gene locus_tag LOCUS_02060 218956 219360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 219720 219373 gene locus_tag LOCUS_02070 219720 219373 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_02070 220403 219972 gene locus_tag LOCUS_02080 220403 219972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 220494 220928 gene locus_tag LOCUS_02090 220494 220928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 221175 221882 gene locus_tag LOCUS_02100 221175 221882 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439170.1 protein_id gnl|my_center|LOCUS_02100 222091 222280 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 222471 222373 gene locus_tag LOCUS_t00060 222471 222373 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 222654 223898 gene locus_tag LOCUS_02110 222654 223898 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 protein_id gnl|my_center|LOCUS_02110 223962 224453 gene locus_tag LOCUS_02120 223962 224453 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869013.1 protein_id gnl|my_center|LOCUS_02120 225906 224485 gene locus_tag LOCUS_02130 gene cysS 225906 224485 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_02130 225994 227490 gene locus_tag LOCUS_02140 225994 227490 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869758.1 protein_id gnl|my_center|LOCUS_02140 227468 228577 gene locus_tag LOCUS_02150 gene ribD 227468 228577 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869757.1 protein_id gnl|my_center|LOCUS_02150 228559 229221 gene locus_tag LOCUS_02160 gene ribE 228559 229221 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987155.1 protein_id gnl|my_center|LOCUS_02160 229218 230489 gene locus_tag LOCUS_02170 229218 230489 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869755.1 protein_id gnl|my_center|LOCUS_02170 230513 231004 gene locus_tag LOCUS_02180 gene ribE 230513 231004 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869754.1 protein_id gnl|my_center|LOCUS_02180 230997 232280 gene locus_tag LOCUS_02190 gene serS 230997 232280 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869753.1 protein_id gnl|my_center|LOCUS_02190 232434 234182 gene locus_tag LOCUS_02200 232434 234182 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869752.1 protein_id gnl|my_center|LOCUS_02200 234190 234657 gene locus_tag LOCUS_02210 234190 234657 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080815.1 protein_id gnl|my_center|LOCUS_02210 234641 234760 gene locus_tag LOCUS_02220 234641 234760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 234754 234981 gene locus_tag LOCUS_02230 234754 234981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 235026 236933 gene locus_tag LOCUS_02240 235026 236933 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869718.1 protein_id gnl|my_center|LOCUS_02240 236918 237136 gene locus_tag LOCUS_02250 236918 237136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 237147 237785 gene locus_tag LOCUS_02260 237147 237785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 237697 238794 gene locus_tag LOCUS_02270 237697 238794 CDS product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228562.1 protein_id gnl|my_center|LOCUS_02270 238812 239078 gene locus_tag LOCUS_02280 238812 239078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 239096 240853 gene locus_tag LOCUS_02290 239096 240853 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228560.1 protein_id gnl|my_center|LOCUS_02290 240850 242232 gene locus_tag LOCUS_02300 240850 242232 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296141.1 protein_id gnl|my_center|LOCUS_02300 242229 242882 gene locus_tag LOCUS_02310 242229 242882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 242888 243352 gene locus_tag LOCUS_02320 242888 243352 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583662.1 protein_id gnl|my_center|LOCUS_02320 243386 243688 gene locus_tag LOCUS_02330 243386 243688 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869751.1 protein_id gnl|my_center|LOCUS_02330 243690 244304 gene locus_tag LOCUS_02340 gene recR 243690 244304 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869750.1 protein_id gnl|my_center|LOCUS_02340 244317 245492 gene locus_tag LOCUS_02350 244317 245492 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869749.1 protein_id gnl|my_center|LOCUS_02350 245489 246667 gene locus_tag LOCUS_02360 gene ispF 245489 246667 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869748.1 protein_id gnl|my_center|LOCUS_02360 246673 248073 gene locus_tag LOCUS_02370 gene gltX 246673 248073 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880773.1 protein_id gnl|my_center|LOCUS_02370 248100 249575 gene locus_tag LOCUS_02380 gene guaB 248100 249575 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869746.1 protein_id gnl|my_center|LOCUS_02380 249588 249779 gene locus_tag LOCUS_02390 249588 249779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 249922 250401 gene locus_tag LOCUS_02400 gene rimP 249922 250401 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_02400 250440 251528 gene locus_tag LOCUS_02410 gene nusA 250440 251528 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869743.1 protein_id gnl|my_center|LOCUS_02410 251543 251839 gene locus_tag LOCUS_02420 251543 251839 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869742.1 protein_id gnl|my_center|LOCUS_02420 251832 252161 gene locus_tag LOCUS_02430 251832 252161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 252154 254136 gene locus_tag LOCUS_02440 gene infB 252154 254136 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869740.1 protein_id gnl|my_center|LOCUS_02440 254139 254504 gene locus_tag LOCUS_02450 254139 254504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 254476 254862 gene locus_tag LOCUS_02460 gene rbfA 254476 254862 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869738.1 protein_id gnl|my_center|LOCUS_02460 254846 255835 gene locus_tag LOCUS_02470 254846 255835 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869737.1 protein_id gnl|my_center|LOCUS_02470 255828 256739 gene locus_tag LOCUS_02480 gene truB 255828 256739 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869736.1 protein_id gnl|my_center|LOCUS_02480 256752 257681 gene locus_tag LOCUS_02490 gene ribF 256752 257681 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925165.1 protein_id gnl|my_center|LOCUS_02490 257733 257808 gene locus_tag LOCUS_t00070 257733 257808 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 257944 258450 gene locus_tag LOCUS_02500 257944 258450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 258507 260477 gene locus_tag LOCUS_02510 258507 260477 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_02510 >Feature sequence02 1625 2416 gene locus_tag LOCUS_02520 1625 2416 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339313.1 protein_id gnl|my_center|LOCUS_02520 3699 2554 gene locus_tag LOCUS_02530 3699 2554 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_02530 3867 4619 gene locus_tag LOCUS_02540 3867 4619 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582830.1 protein_id gnl|my_center|LOCUS_02540 4645 5565 gene locus_tag LOCUS_02550 gene ftcD 4645 5565 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869662.1 protein_id gnl|my_center|LOCUS_02550 5562 6806 gene locus_tag LOCUS_02560 gene hutI 5562 6806 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869661.1 protein_id gnl|my_center|LOCUS_02560 6842 8875 gene locus_tag LOCUS_02570 6842 8875 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869356.1 protein_id gnl|my_center|LOCUS_02570 9019 9885 gene locus_tag LOCUS_02580 9019 9885 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870138.1 protein_id gnl|my_center|LOCUS_02580 9898 10776 gene locus_tag LOCUS_02590 9898 10776 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870137.1 protein_id gnl|my_center|LOCUS_02590 10773 11552 gene locus_tag LOCUS_02600 10773 11552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870136.1 protein_id gnl|my_center|LOCUS_02600 11536 12246 gene locus_tag LOCUS_02610 11536 12246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870135.1 protein_id gnl|my_center|LOCUS_02610 12283 13437 gene locus_tag LOCUS_02620 12283 13437 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870134.1 protein_id gnl|my_center|LOCUS_02620 13709 14416 gene locus_tag LOCUS_02630 13709 14416 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868955.1 protein_id gnl|my_center|LOCUS_02630 14530 16200 gene locus_tag LOCUS_02640 gene ilvD 14530 16200 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023301.1 protein_id gnl|my_center|LOCUS_02640 16252 17235 gene locus_tag LOCUS_02650 16252 17235 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 protein_id gnl|my_center|LOCUS_02650 17319 17765 gene locus_tag LOCUS_02660 17319 17765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 17786 19282 gene locus_tag LOCUS_02670 17786 19282 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 protein_id gnl|my_center|LOCUS_02670 19314 20069 gene locus_tag LOCUS_02680 gene fabG 19314 20069 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_02680 20569 20819 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21237 22430 gene locus_tag LOCUS_02690 21237 22430 CDS product 3-hydroxy-3-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814048.1 protein_id gnl|my_center|LOCUS_02690 22725 23747 gene locus_tag LOCUS_02700 22725 23747 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948802.1 protein_id gnl|my_center|LOCUS_02700 23725 25416 gene locus_tag LOCUS_02710 23725 25416 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948803.1 protein_id gnl|my_center|LOCUS_02710 25388 26353 gene locus_tag LOCUS_02720 25388 26353 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948804.1 protein_id gnl|my_center|LOCUS_02720 26476 30744 gene locus_tag LOCUS_02730 26476 30744 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107756.1 protein_id gnl|my_center|LOCUS_02730 32098 30836 gene locus_tag LOCUS_02740 32098 30836 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 protein_id gnl|my_center|LOCUS_02740 34439 32334 gene locus_tag LOCUS_02750 34439 32334 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925439.1 protein_id gnl|my_center|LOCUS_02750 34933 34439 gene locus_tag LOCUS_02760 34933 34439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 35366 35577 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35651 35911 gene locus_tag LOCUS_02770 35651 35911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 36827 36030 gene locus_tag LOCUS_02780 36827 36030 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225093.1 protein_id gnl|my_center|LOCUS_02780 39167 37011 gene locus_tag LOCUS_02790 39167 37011 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083057.1 protein_id gnl|my_center|LOCUS_02790 40997 39348 gene locus_tag LOCUS_02800 40997 39348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 41235 41038 gene locus_tag LOCUS_02810 41235 41038 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869363.1 protein_id gnl|my_center|LOCUS_02810 41536 41680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41797 43062 gene locus_tag LOCUS_02820 41797 43062 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_02820 43139 43663 gene locus_tag LOCUS_02830 43139 43663 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830398.1 protein_id gnl|my_center|LOCUS_02830 44828 43731 gene locus_tag LOCUS_02840 44828 43731 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609811.1 protein_id gnl|my_center|LOCUS_02840 45580 44927 gene locus_tag LOCUS_02850 45580 44927 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869660.1 protein_id gnl|my_center|LOCUS_02850 47162 45630 gene locus_tag LOCUS_02860 gene hutH 47162 45630 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925153.1 protein_id gnl|my_center|LOCUS_02860 49003 47357 gene locus_tag LOCUS_02870 gene hcp 49003 47357 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870473.1 protein_id gnl|my_center|LOCUS_02870 49797 49042 gene locus_tag LOCUS_02880 49797 49042 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_02880 50221 49772 gene locus_tag LOCUS_02890 50221 49772 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870471.1 protein_id gnl|my_center|LOCUS_02890 50394 52271 gene locus_tag LOCUS_02900 50394 52271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 53451 52276 gene locus_tag LOCUS_02910 53451 52276 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869004.1 protein_id gnl|my_center|LOCUS_02910 54139 53555 gene locus_tag LOCUS_02920 54139 53555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 54910 54161 gene locus_tag LOCUS_02930 54910 54161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 56149 54935 gene locus_tag LOCUS_02940 56149 54935 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173870.1 protein_id gnl|my_center|LOCUS_02940 57429 56215 gene locus_tag LOCUS_02950 57429 56215 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869075.1 protein_id gnl|my_center|LOCUS_02950 58451 57453 gene locus_tag LOCUS_02960 58451 57453 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870488.1 protein_id gnl|my_center|LOCUS_02960 58852 60177 gene locus_tag LOCUS_02970 gene dnaA 58852 60177 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925053.1 protein_id gnl|my_center|LOCUS_02970 60446 60282 gene locus_tag LOCUS_02980 60446 60282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 60402 61580 gene locus_tag LOCUS_02990 gene dnaN 60402 61580 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868759.1 protein_id gnl|my_center|LOCUS_02990 61645 62667 gene locus_tag LOCUS_03000 61645 62667 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868760.1 protein_id gnl|my_center|LOCUS_03000 62700 64595 gene locus_tag LOCUS_03010 gene mnmG 62700 64595 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868761.1 protein_id gnl|my_center|LOCUS_03010 64576 65052 gene locus_tag LOCUS_03020 64576 65052 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868762.1 protein_id gnl|my_center|LOCUS_03020 65184 65939 gene locus_tag LOCUS_03030 65184 65939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 66020 66919 gene locus_tag LOCUS_03040 66020 66919 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869288.1 protein_id gnl|my_center|LOCUS_03040 66943 67791 gene locus_tag LOCUS_03050 gene panC 66943 67791 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_03050 68212 69189 gene locus_tag LOCUS_03060 68212 69189 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081884.1 protein_id gnl|my_center|LOCUS_03060 69205 70092 gene locus_tag LOCUS_03070 gene dapA 69205 70092 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081879.1 protein_id gnl|my_center|LOCUS_03070 70092 70751 gene locus_tag LOCUS_03080 gene dapB 70092 70751 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081877.1 protein_id gnl|my_center|LOCUS_03080 70724 71422 gene locus_tag LOCUS_03090 gene dapD 70724 71422 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081875.1 protein_id gnl|my_center|LOCUS_03090 71441 72655 gene locus_tag LOCUS_03100 71441 72655 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081873.1 protein_id gnl|my_center|LOCUS_03100 72655 73749 gene locus_tag LOCUS_03110 72655 73749 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 protein_id gnl|my_center|LOCUS_03110 74095 73769 gene locus_tag LOCUS_03120 74095 73769 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869148.1 protein_id gnl|my_center|LOCUS_03120 74985 74107 gene locus_tag LOCUS_03130 74985 74107 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869144.1 protein_id gnl|my_center|LOCUS_03130 75827 74982 gene locus_tag LOCUS_03140 75827 74982 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_03140 76187 75837 gene locus_tag LOCUS_03150 76187 75837 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392924.1 protein_id gnl|my_center|LOCUS_03150 76504 76202 gene locus_tag LOCUS_03160 76504 76202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 76660 77214 gene locus_tag LOCUS_03170 76660 77214 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869149.1 protein_id gnl|my_center|LOCUS_03170 77252 77698 gene locus_tag LOCUS_03180 77252 77698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 77888 78325 gene locus_tag LOCUS_03190 77888 78325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 78363 79655 gene locus_tag LOCUS_03200 78363 79655 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724359.1 protein_id gnl|my_center|LOCUS_03200 81344 79761 gene locus_tag LOCUS_03210 81344 79761 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_03210 83266 81584 gene locus_tag LOCUS_03220 83266 81584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 84054 83269 gene locus_tag LOCUS_03230 84054 83269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 85624 84146 gene locus_tag LOCUS_03240 gene panF 85624 84146 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104834.1 protein_id gnl|my_center|LOCUS_03240 85885 85637 gene locus_tag LOCUS_03250 85885 85637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 86359 87771 gene locus_tag LOCUS_03260 gene nhaC 86359 87771 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261868.1 protein_id gnl|my_center|LOCUS_03260 87781 88959 gene locus_tag LOCUS_03270 gene iadA 87781 88959 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048339.1 protein_id gnl|my_center|LOCUS_03270 89065 90249 gene locus_tag LOCUS_03280 gene iadA 89065 90249 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048339.1 protein_id gnl|my_center|LOCUS_03280 91005 90295 gene locus_tag LOCUS_03290 91005 90295 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868955.1 protein_id gnl|my_center|LOCUS_03290 91367 91858 gene locus_tag LOCUS_03300 91367 91858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 92743 91868 gene locus_tag LOCUS_03310 92743 91868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 93534 92740 gene locus_tag LOCUS_03320 93534 92740 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648073.1 protein_id gnl|my_center|LOCUS_03320 94612 93548 gene locus_tag LOCUS_03330 94612 93548 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868908.1 protein_id gnl|my_center|LOCUS_03330 95187 95367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 95389 95853 gene locus_tag LOCUS_03340 95389 95853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 96337 95906 gene locus_tag LOCUS_03350 96337 95906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 96456 96881 gene locus_tag LOCUS_03360 96456 96881 CDS product molybdenum cofactor biosysynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869150.1 protein_id gnl|my_center|LOCUS_03360 96910 98958 gene locus_tag LOCUS_03370 96910 98958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 98981 99751 gene locus_tag LOCUS_03380 98981 99751 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870402.1 protein_id gnl|my_center|LOCUS_03380 99791 100633 gene locus_tag LOCUS_03390 99791 100633 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870403.1 protein_id gnl|my_center|LOCUS_03390 102007 100736 gene locus_tag LOCUS_03400 102007 100736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 102493 102020 gene locus_tag LOCUS_03410 102493 102020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 103556 102570 gene locus_tag LOCUS_03420 gene yiaO 103556 102570 CDS product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776911.1 protein_id gnl|my_center|LOCUS_03420 104420 103629 gene locus_tag LOCUS_03430 104420 103629 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262133.1 protein_id gnl|my_center|LOCUS_03430 105128 104433 gene locus_tag LOCUS_03440 105128 104433 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811063.1 protein_id gnl|my_center|LOCUS_03440 105830 105156 gene locus_tag LOCUS_03450 105830 105156 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861699.1 protein_id gnl|my_center|LOCUS_03450 107811 106213 gene locus_tag LOCUS_03460 107811 106213 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925288.1 protein_id gnl|my_center|LOCUS_03460 <108739 107935 gene locus_tag LOCUS_03470 <108739 107935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003343849.1:proline/glycine betaine ABC transporter permease >Feature sequence03 1276 554 gene locus_tag LOCUS_03480 1276 554 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868979.1 protein_id gnl|my_center|LOCUS_03480 1602 1783 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2693 2043 gene locus_tag LOCUS_03490 gene hisG 2693 2043 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868982.1 protein_id gnl|my_center|LOCUS_03490 3892 2681 gene locus_tag LOCUS_03500 3892 2681 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868983.1 protein_id gnl|my_center|LOCUS_03500 5145 3889 gene locus_tag LOCUS_03510 gene hisD 5145 3889 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920204.1 protein_id gnl|my_center|LOCUS_03510 5290 6633 gene locus_tag LOCUS_03520 gene radA 5290 6633 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869447.1 protein_id gnl|my_center|LOCUS_03520 6630 7997 gene locus_tag LOCUS_03530 6630 7997 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_03530 8000 8791 gene locus_tag LOCUS_03540 8000 8791 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869449.1 protein_id gnl|my_center|LOCUS_03540 8870 11356 gene locus_tag LOCUS_03550 gene leuS 8870 11356 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869450.1 protein_id gnl|my_center|LOCUS_03550 11356 12297 gene locus_tag LOCUS_03560 11356 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 12647 12357 gene locus_tag LOCUS_03570 gene rpsT 12647 12357 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869452.1 protein_id gnl|my_center|LOCUS_03570 12678 12812 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12904 14868 gene locus_tag LOCUS_03580 12904 14868 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679730.1 protein_id gnl|my_center|LOCUS_03580 15174 15479 gene locus_tag LOCUS_03590 15174 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 15480 15725 gene locus_tag LOCUS_03600 gene yidD 15480 15725 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869455.1 protein_id gnl|my_center|LOCUS_03600 15740 16531 gene locus_tag LOCUS_03610 15740 16531 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869456.1 protein_id gnl|my_center|LOCUS_03610 16572 17210 gene locus_tag LOCUS_03620 16572 17210 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869457.1 protein_id gnl|my_center|LOCUS_03620 17214 17975 gene locus_tag LOCUS_03630 17214 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 18104 19507 gene locus_tag LOCUS_03640 18104 19507 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869463.1 protein_id gnl|my_center|LOCUS_03640 20591 19596 gene locus_tag LOCUS_03650 20591 19596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 21405 20725 gene locus_tag LOCUS_03660 21405 20725 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869465.1 protein_id gnl|my_center|LOCUS_03660 21658 21924 gene locus_tag LOCUS_03670 gene rpsO 21658 21924 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869466.1 protein_id gnl|my_center|LOCUS_03670 22070 24346 gene locus_tag LOCUS_03680 22070 24346 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869467.1 protein_id gnl|my_center|LOCUS_03680 24343 24783 gene locus_tag LOCUS_03690 gene dut 24343 24783 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280519.1 protein_id gnl|my_center|LOCUS_03690 25119 27023 gene locus_tag LOCUS_03700 gene thrS 25119 27023 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869471.1 protein_id gnl|my_center|LOCUS_03700 27326 27829 gene locus_tag LOCUS_03710 gene infC 27326 27829 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869472.1 protein_id gnl|my_center|LOCUS_03710 27873 28070 gene locus_tag LOCUS_03720 gene rpmI 27873 28070 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869473.1 protein_id gnl|my_center|LOCUS_03720 28133 28492 gene locus_tag LOCUS_03730 gene rplT 28133 28492 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869474.1 protein_id gnl|my_center|LOCUS_03730 28495 29814 gene locus_tag LOCUS_03740 28495 29814 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925134.1 protein_id gnl|my_center|LOCUS_03740 29825 30520 gene locus_tag LOCUS_03750 29825 30520 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869476.1 protein_id gnl|my_center|LOCUS_03750 30517 31563 gene locus_tag LOCUS_03760 gene pheS 30517 31563 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925135.1 protein_id gnl|my_center|LOCUS_03760 31557 33959 gene locus_tag LOCUS_03770 gene pheT 31557 33959 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869478.1 protein_id gnl|my_center|LOCUS_03770 33990 34289 gene locus_tag LOCUS_03780 33990 34289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 34289 34561 gene locus_tag LOCUS_03790 34289 34561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 34558 35103 gene locus_tag LOCUS_03800 34558 35103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 35090 37438 gene locus_tag LOCUS_03810 35090 37438 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869482.1 protein_id gnl|my_center|LOCUS_03810 37527 37602 gene locus_tag LOCUS_t00080 37527 37602 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37655 39046 gene locus_tag LOCUS_03820 37655 39046 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869440.1 protein_id gnl|my_center|LOCUS_03820 39052 40236 gene locus_tag LOCUS_03830 39052 40236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869352.1 protein_id gnl|my_center|LOCUS_03830 41282 40317 gene locus_tag LOCUS_03840 41282 40317 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_03840 41533 42108 gene locus_tag LOCUS_03850 41533 42108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 42191 42430 gene locus_tag LOCUS_03860 gene rpmE 42191 42430 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869566.1 protein_id gnl|my_center|LOCUS_03860 42481 43176 gene locus_tag LOCUS_03870 gene thyX 42481 43176 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869567.1 protein_id gnl|my_center|LOCUS_03870 43181 44122 gene locus_tag LOCUS_03880 43181 44122 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869568.1 protein_id gnl|my_center|LOCUS_03880 44106 45182 gene locus_tag LOCUS_03890 gene prfA 44106 45182 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_03890 45169 46041 gene locus_tag LOCUS_03900 45169 46041 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869570.1 protein_id gnl|my_center|LOCUS_03900 46115 47302 gene locus_tag LOCUS_03910 gene trxB 46115 47302 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869571.1 protein_id gnl|my_center|LOCUS_03910 47372 48304 gene locus_tag LOCUS_03920 47372 48304 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869572.1 protein_id gnl|my_center|LOCUS_03920 48318 48770 gene locus_tag LOCUS_03930 48318 48770 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869573.1 protein_id gnl|my_center|LOCUS_03930 48842 49309 gene locus_tag LOCUS_03940 gene fliS 48842 49309 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869575.1 protein_id gnl|my_center|LOCUS_03940 49299 49760 gene locus_tag LOCUS_03950 49299 49760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 49774 50856 gene locus_tag LOCUS_03960 49774 50856 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869577.1 protein_id gnl|my_center|LOCUS_03960 50945 52765 gene locus_tag LOCUS_03970 50945 52765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 52762 56193 gene locus_tag LOCUS_03980 gene dnaE 52762 56193 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869579.1 protein_id gnl|my_center|LOCUS_03980 56235 57986 gene locus_tag LOCUS_03990 gene pyk 56235 57986 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869581.1 protein_id gnl|my_center|LOCUS_03990 58000 58605 gene locus_tag LOCUS_04000 58000 58605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 59363 59495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59599 60678 gene locus_tag LOCUS_04010 59599 60678 CDS product alanine/ornithine racemase family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869584.1 protein_id gnl|my_center|LOCUS_04010 60718 61527 gene locus_tag LOCUS_04020 gene cdaA 60718 61527 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869585.1 protein_id gnl|my_center|LOCUS_04020 61552 62781 gene locus_tag LOCUS_04030 61552 62781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 62811 64178 gene locus_tag LOCUS_04040 gene glmM 62811 64178 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925144.1 protein_id gnl|my_center|LOCUS_04040 64221 65126 gene locus_tag LOCUS_04050 gene galU 64221 65126 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869588.1 protein_id gnl|my_center|LOCUS_04050 65347 67179 gene locus_tag LOCUS_04060 gene glmS 65347 67179 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869589.1 protein_id gnl|my_center|LOCUS_04060 68339 67269 gene locus_tag LOCUS_04070 68339 67269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869590.1 protein_id gnl|my_center|LOCUS_04070 68579 68784 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69168 69328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69838 70003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 70096 70650 gene locus_tag LOCUS_04080 70096 70650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 70893 70627 gene locus_tag LOCUS_04090 70893 70627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 70923 71057 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 71229 71303 gene locus_tag LOCUS_t00090 71229 71303 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 71382 71545 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 71566 72969 gene locus_tag LOCUS_04100 gene glmU 71566 72969 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869823.1 protein_id gnl|my_center|LOCUS_04100 72969 73937 gene locus_tag LOCUS_04110 72969 73937 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869822.1 protein_id gnl|my_center|LOCUS_04110 73987 74652 gene locus_tag LOCUS_04120 73987 74652 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_04120 74659 75261 gene locus_tag LOCUS_04130 gene pth 74659 75261 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869820.1 protein_id gnl|my_center|LOCUS_04130 75328 78468 gene locus_tag LOCUS_04140 75328 78468 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925174.1 protein_id gnl|my_center|LOCUS_04140 78465 79313 gene locus_tag LOCUS_04150 gene mazG 78465 79313 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869818.1 protein_id gnl|my_center|LOCUS_04150 79332 80807 gene locus_tag LOCUS_04160 79332 80807 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870176.1 protein_id gnl|my_center|LOCUS_04160 80825 81823 gene locus_tag LOCUS_04170 80825 81823 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392130.1 protein_id gnl|my_center|LOCUS_04170 81870 84068 gene locus_tag LOCUS_04180 81870 84068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 82822 83002 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 84072 84614 gene locus_tag LOCUS_04190 84072 84614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 84614 85894 gene locus_tag LOCUS_04200 84614 85894 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869813.1 protein_id gnl|my_center|LOCUS_04200 85875 86324 gene locus_tag LOCUS_04210 85875 86324 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869812.1 protein_id gnl|my_center|LOCUS_04210 86321 87247 gene locus_tag LOCUS_04220 gene era 86321 87247 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869811.1 protein_id gnl|my_center|LOCUS_04220 87213 87986 gene locus_tag LOCUS_04230 87213 87986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 88011 88889 gene locus_tag LOCUS_04240 gene glyQ 88011 88889 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869809.1 protein_id gnl|my_center|LOCUS_04240 88913 90982 gene locus_tag LOCUS_04250 gene glyS 88913 90982 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869808.1 protein_id gnl|my_center|LOCUS_04250 90993 91796 gene locus_tag LOCUS_04260 90993 91796 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869807.1 protein_id gnl|my_center|LOCUS_04260 91800 92615 gene locus_tag LOCUS_04270 91800 92615 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869807.1 protein_id gnl|my_center|LOCUS_04270 92651 92790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 93209 93378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 93830 94031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 94177 94350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 94361 96061 gene locus_tag LOCUS_04280 94361 96061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 >Feature sequence04 331 1428 gene locus_tag LOCUS_04290 gene lpxB 331 1428 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870028.1 protein_id gnl|my_center|LOCUS_04290 1425 2531 gene locus_tag LOCUS_04300 1425 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583189.1 protein_id gnl|my_center|LOCUS_04300 2612 4288 gene locus_tag LOCUS_04310 2612 4288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870027.1 protein_id gnl|my_center|LOCUS_04310 4272 6536 gene locus_tag LOCUS_04320 gene lpxK 4272 6536 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870026.1 protein_id gnl|my_center|LOCUS_04320 6554 7411 gene locus_tag LOCUS_04330 gene kdsA 6554 7411 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_04330 7414 8421 gene locus_tag LOCUS_04340 7414 8421 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925427.1 protein_id gnl|my_center|LOCUS_04340 8435 9673 gene locus_tag LOCUS_04350 8435 9673 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_04350 9670 10875 gene locus_tag LOCUS_04360 9670 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 10878 11615 gene locus_tag LOCUS_04370 gene kdsB 10878 11615 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_04370 11628 12755 gene locus_tag LOCUS_04380 11628 12755 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870019.1 protein_id gnl|my_center|LOCUS_04380 12752 13783 gene locus_tag LOCUS_04390 12752 13783 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868771.1 protein_id gnl|my_center|LOCUS_04390 13798 14874 gene locus_tag LOCUS_04400 13798 14874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 15043 16047 gene locus_tag LOCUS_04410 15043 16047 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870430.1 protein_id gnl|my_center|LOCUS_04410 16037 17002 gene locus_tag LOCUS_04420 16037 17002 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925255.1 protein_id gnl|my_center|LOCUS_04420 17082 18293 gene locus_tag LOCUS_04430 17082 18293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 18594 20015 gene locus_tag LOCUS_04440 18594 20015 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870016.1 protein_id gnl|my_center|LOCUS_04440 20136 20882 gene locus_tag LOCUS_04450 20136 20882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870001.1 protein_id gnl|my_center|LOCUS_04450 20950 21909 gene locus_tag LOCUS_04460 gene pfkA 20950 21909 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870000.1 protein_id gnl|my_center|LOCUS_04460 21906 22787 gene locus_tag LOCUS_04470 21906 22787 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925420.1 protein_id gnl|my_center|LOCUS_04470 23238 22747 gene locus_tag LOCUS_04480 23238 22747 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869997.1 protein_id gnl|my_center|LOCUS_04480 23426 23851 gene locus_tag LOCUS_04490 23426 23851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869996.1 protein_id gnl|my_center|LOCUS_04490 23884 24543 gene locus_tag LOCUS_04500 gene fsa 23884 24543 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869995.1 protein_id gnl|my_center|LOCUS_04500 24533 25918 gene locus_tag LOCUS_04510 gene rho 24533 25918 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869994.1 protein_id gnl|my_center|LOCUS_04510 25953 27383 gene locus_tag LOCUS_04520 25953 27383 CDS product LysM peptidoglycan-binding domain-containing M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869993.1 protein_id gnl|my_center|LOCUS_04520 27496 29082 gene locus_tag LOCUS_04530 27496 29082 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869992.1 protein_id gnl|my_center|LOCUS_04530 28903 29053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29285 30400 gene locus_tag LOCUS_04540 29285 30400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869991.1 protein_id gnl|my_center|LOCUS_04540 30459 30893 gene locus_tag LOCUS_04550 30459 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925185.1 protein_id gnl|my_center|LOCUS_04550 31000 32091 gene locus_tag LOCUS_04560 31000 32091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869989.1 protein_id gnl|my_center|LOCUS_04560 32069 32626 gene locus_tag LOCUS_04570 32069 32626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 32614 34290 gene locus_tag LOCUS_04580 32614 34290 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869987.1 protein_id gnl|my_center|LOCUS_04580 34342 35298 gene locus_tag LOCUS_04590 34342 35298 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869986.1 protein_id gnl|my_center|LOCUS_04590 35819 35325 gene locus_tag LOCUS_04600 gene greA 35819 35325 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869984.1 protein_id gnl|my_center|LOCUS_04600 35967 37706 gene locus_tag LOCUS_04610 35967 37706 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869230.1 protein_id gnl|my_center|LOCUS_04610 37696 38499 gene locus_tag LOCUS_04620 37696 38499 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869232.1 protein_id gnl|my_center|LOCUS_04620 38506 38754 gene locus_tag LOCUS_04630 38506 38754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 38739 39344 gene locus_tag LOCUS_04640 38739 39344 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869234.1 protein_id gnl|my_center|LOCUS_04640 39341 41260 gene locus_tag LOCUS_04650 39341 41260 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869235.1 protein_id gnl|my_center|LOCUS_04650 41257 42276 gene locus_tag LOCUS_04660 gene csaB 41257 42276 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869236.1 protein_id gnl|my_center|LOCUS_04660 42260 43102 gene locus_tag LOCUS_04670 42260 43102 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546285.1 protein_id gnl|my_center|LOCUS_04670 43099 44052 gene locus_tag LOCUS_04680 43099 44052 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869238.1 protein_id gnl|my_center|LOCUS_04680 44055 44750 gene locus_tag LOCUS_04690 44055 44750 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869239.1 protein_id gnl|my_center|LOCUS_04690 44737 45621 gene locus_tag LOCUS_04700 44737 45621 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869240.1 protein_id gnl|my_center|LOCUS_04700 45721 46947 gene locus_tag LOCUS_04710 45721 46947 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869241.1 protein_id gnl|my_center|LOCUS_04710 46981 48195 gene locus_tag LOCUS_04720 46981 48195 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869242.1 protein_id gnl|my_center|LOCUS_04720 48275 49108 gene locus_tag LOCUS_04730 48275 49108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 49122 50408 gene locus_tag LOCUS_04740 49122 50408 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869244.1 protein_id gnl|my_center|LOCUS_04740 50427 50876 gene locus_tag LOCUS_04750 gene rimI 50427 50876 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208657.1 protein_id gnl|my_center|LOCUS_04750 51168 51094 gene locus_tag LOCUS_t00100 51168 51094 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 51277 51720 gene locus_tag LOCUS_04760 51277 51720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869364.1 protein_id gnl|my_center|LOCUS_04760 51792 53417 gene locus_tag LOCUS_04770 51792 53417 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869365.1 protein_id gnl|my_center|LOCUS_04770 53656 53483 gene locus_tag LOCUS_04780 53656 53483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 53794 55533 gene locus_tag LOCUS_04790 53794 55533 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080205.1 protein_id gnl|my_center|LOCUS_04790 55533 56393 gene locus_tag LOCUS_04800 55533 56393 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869367.1 protein_id gnl|my_center|LOCUS_04800 56425 57003 gene locus_tag LOCUS_04810 56425 57003 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249766.1 protein_id gnl|my_center|LOCUS_04810 57800 57036 gene locus_tag LOCUS_04820 57800 57036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 58309 57815 gene locus_tag LOCUS_04830 gene folK 58309 57815 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_04830 59523 58306 gene locus_tag LOCUS_04840 gene folP 59523 58306 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869371.1 protein_id gnl|my_center|LOCUS_04840 60262 59612 gene locus_tag LOCUS_04850 60262 59612 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881302.1 protein_id gnl|my_center|LOCUS_04850 60453 61469 gene locus_tag LOCUS_04860 gene hrcA 60453 61469 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869372.1 protein_id gnl|my_center|LOCUS_04860 61489 62139 gene locus_tag LOCUS_04870 61489 62139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 62184 64013 gene locus_tag LOCUS_04880 gene dnaK 62184 64013 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869374.1 protein_id gnl|my_center|LOCUS_04880 64027 65169 gene locus_tag LOCUS_04890 gene dnaJ 64027 65169 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925123.1 protein_id gnl|my_center|LOCUS_04890 65277 66143 gene locus_tag LOCUS_04900 65277 66143 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869376.1 protein_id gnl|my_center|LOCUS_04900 66182 67441 gene locus_tag LOCUS_04910 66182 67441 CDS product MiaB/RimO family radical SAM methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869378.1 protein_id gnl|my_center|LOCUS_04910 67533 69095 gene locus_tag LOCUS_04920 67533 69095 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869379.1 protein_id gnl|my_center|LOCUS_04920 69092 70060 gene locus_tag LOCUS_04930 69092 70060 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280518.1 protein_id gnl|my_center|LOCUS_04930 70090 70431 gene locus_tag LOCUS_04940 70090 70431 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869381.1 protein_id gnl|my_center|LOCUS_04940 70466 70654 gene locus_tag LOCUS_04950 70466 70654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 70661 71125 gene locus_tag LOCUS_04960 70661 71125 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869383.1 protein_id gnl|my_center|LOCUS_04960 71193 71657 gene locus_tag LOCUS_04970 gene nrdR 71193 71657 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869384.1 protein_id gnl|my_center|LOCUS_04970 71823 72956 gene locus_tag LOCUS_04980 71823 72956 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_04980 73055 73948 gene locus_tag LOCUS_04990 73055 73948 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869388.1 protein_id gnl|my_center|LOCUS_04990 73948 74994 gene locus_tag LOCUS_05000 73948 74994 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869389.1 protein_id gnl|my_center|LOCUS_05000 74991 75782 gene locus_tag LOCUS_05010 74991 75782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925352.1 protein_id gnl|my_center|LOCUS_05010 75775 76494 gene locus_tag LOCUS_05020 75775 76494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869391.1 protein_id gnl|my_center|LOCUS_05020 76964 77143 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 77162 77365 gene locus_tag LOCUS_05030 77162 77365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 >Feature sequence05 514 628 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 808 1079 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1287 1424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1627 1840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3247 1865 gene locus_tag LOCUS_05040 3247 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 4269 3385 gene locus_tag LOCUS_05050 4269 3385 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064335.1 protein_id gnl|my_center|LOCUS_05050 6181 4247 gene locus_tag LOCUS_05060 6181 4247 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_05060 7288 6269 gene locus_tag LOCUS_05070 7288 6269 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063973.1 protein_id gnl|my_center|LOCUS_05070 7760 7972 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9374 8112 gene locus_tag LOCUS_05080 9374 8112 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583978.1 protein_id gnl|my_center|LOCUS_05080 10794 9403 gene locus_tag LOCUS_05090 10794 9403 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 protein_id gnl|my_center|LOCUS_05090 12195 10822 gene locus_tag LOCUS_05100 12195 10822 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525150.1 protein_id gnl|my_center|LOCUS_05100 12514 12185 gene locus_tag LOCUS_05110 12514 12185 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817378.1 protein_id gnl|my_center|LOCUS_05110 13911 12511 gene locus_tag LOCUS_05120 13911 12511 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876596.1 protein_id gnl|my_center|LOCUS_05120 15299 13908 gene locus_tag LOCUS_05130 15299 13908 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583698.1 protein_id gnl|my_center|LOCUS_05130 15571 16587 gene locus_tag LOCUS_05140 15571 16587 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296899.1 protein_id gnl|my_center|LOCUS_05140 17096 16656 gene locus_tag LOCUS_05150 17096 16656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 18423 17194 gene locus_tag LOCUS_05160 18423 17194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 19097 18507 gene locus_tag LOCUS_05170 19097 18507 CDS product DUF6448 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943772.1 protein_id gnl|my_center|LOCUS_05170 21285 19192 gene locus_tag LOCUS_05180 21285 19192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 22428 21304 gene locus_tag LOCUS_05190 22428 21304 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816897.1 protein_id gnl|my_center|LOCUS_05190 22654 23001 gene locus_tag LOCUS_05200 22654 23001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 23153 24283 gene locus_tag LOCUS_05210 23153 24283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 24337 25173 gene locus_tag LOCUS_05220 24337 25173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_05220 25183 25947 gene locus_tag LOCUS_05230 25183 25947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_05230 27383 26001 gene locus_tag LOCUS_05240 27383 26001 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080877.1 protein_id gnl|my_center|LOCUS_05240 27747 28994 gene locus_tag LOCUS_05250 27747 28994 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_05250 28994 29161 gene locus_tag LOCUS_05260 28994 29161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 29834 29292 gene locus_tag LOCUS_05270 29834 29292 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948549.1 protein_id gnl|my_center|LOCUS_05270 30153 31328 gene locus_tag LOCUS_05280 gene trpB 30153 31328 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868857.1 protein_id gnl|my_center|LOCUS_05280 32279 31356 gene locus_tag LOCUS_05290 32279 31356 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_05290 32411 33349 gene locus_tag LOCUS_05300 32411 33349 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943444.1 protein_id gnl|my_center|LOCUS_05300 34108 35565 gene locus_tag LOCUS_05310 gene nhaC 34108 35565 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870142.1 protein_id gnl|my_center|LOCUS_05310 36135 35605 gene locus_tag LOCUS_05320 36135 35605 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_05320 36656 36258 gene locus_tag LOCUS_05330 36656 36258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05330 36806 37798 gene locus_tag LOCUS_05340 36806 37798 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_05340 38100 40619 gene locus_tag LOCUS_05350 gene mgtA 38100 40619 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_05350 40876 42750 gene locus_tag LOCUS_05360 40876 42750 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 protein_id gnl|my_center|LOCUS_05360 43291 43477 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43566 44567 gene locus_tag LOCUS_05370 43566 44567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 46218 44674 gene locus_tag LOCUS_05380 46218 44674 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082994.1 protein_id gnl|my_center|LOCUS_05380 46837 46238 gene locus_tag LOCUS_05390 46837 46238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 46866 47034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48403 47399 gene locus_tag LOCUS_05400 48403 47399 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210045.1 protein_id gnl|my_center|LOCUS_05400 49895 48393 gene locus_tag LOCUS_05410 49895 48393 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210044.1 protein_id gnl|my_center|LOCUS_05410 50969 49968 gene locus_tag LOCUS_05420 50969 49968 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210043.1 protein_id gnl|my_center|LOCUS_05420 52501 51032 gene locus_tag LOCUS_05430 52501 51032 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_05430 53162 52521 gene locus_tag LOCUS_05440 53162 52521 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926557.1 protein_id gnl|my_center|LOCUS_05440 54407 53373 gene locus_tag LOCUS_05450 54407 53373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 54806 54606 gene locus_tag LOCUS_05460 54806 54606 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643615.1 protein_id gnl|my_center|LOCUS_05460 56221 54995 gene locus_tag LOCUS_05470 56221 54995 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_05470 56910 56215 gene locus_tag LOCUS_05480 56910 56215 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_05480 58087 56888 gene locus_tag LOCUS_05490 58087 56888 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_05490 59355 58084 gene locus_tag LOCUS_05500 59355 58084 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926846.1 protein_id gnl|my_center|LOCUS_05500 59889 59560 gene locus_tag LOCUS_05510 59889 59560 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940899.1 protein_id gnl|my_center|LOCUS_05510 60289 60534 gene locus_tag LOCUS_05520 60289 60534 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_05520 60772 62592 gene locus_tag LOCUS_05530 60772 62592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 62642 64399 gene locus_tag LOCUS_05540 62642 64399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_05540 64405 66243 gene locus_tag LOCUS_05550 64405 66243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243525.1 protein_id gnl|my_center|LOCUS_05550 66858 66259 gene locus_tag LOCUS_05560 66858 66259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 67099 66971 gene locus_tag LOCUS_05570 67099 66971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 67284 68987 gene locus_tag LOCUS_05580 67284 68987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 69163 68951 gene locus_tag LOCUS_05590 69163 68951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 69948 69235 gene locus_tag LOCUS_05600 69948 69235 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889244.1 protein_id gnl|my_center|LOCUS_05600 70303 69932 gene locus_tag LOCUS_05610 70303 69932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 72294 70447 gene locus_tag LOCUS_05620 72294 70447 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_05620 72380 72532 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 73144 74046 gene locus_tag LOCUS_05630 73144 74046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 75097 74072 gene locus_tag LOCUS_05640 75097 74072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 75309 76244 gene locus_tag LOCUS_05650 75309 76244 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence06 823 1359 gene locus_tag LOCUS_05660 823 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 1356 2207 gene locus_tag LOCUS_05670 1356 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2622 2227 gene locus_tag LOCUS_05680 2622 2227 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_05680 2903 2703 gene locus_tag LOCUS_05690 2903 2703 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674407.1 protein_id gnl|my_center|LOCUS_05690 4239 3124 gene locus_tag LOCUS_05700 4239 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 4717 5277 gene locus_tag LOCUS_05710 4717 5277 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897687.1 protein_id gnl|my_center|LOCUS_05710 6499 5372 gene locus_tag LOCUS_05720 6499 5372 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704465.1 protein_id gnl|my_center|LOCUS_05720 7140 6553 gene locus_tag LOCUS_05730 7140 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 7158 7310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7915 8059 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8754 8191 gene locus_tag LOCUS_05740 8754 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 9106 8825 gene locus_tag LOCUS_05750 9106 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 9107 9255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11202 10117 gene locus_tag LOCUS_05760 11202 10117 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684567.1 protein_id gnl|my_center|LOCUS_05760 12621 12989 gene locus_tag LOCUS_05770 12621 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 13138 14319 gene locus_tag LOCUS_05780 13138 14319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 14542 16107 gene locus_tag LOCUS_05790 14542 16107 CDS product OPT/YSL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285060.1 protein_id gnl|my_center|LOCUS_05790 16123 16779 gene locus_tag LOCUS_05800 16123 16779 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391752.1 protein_id gnl|my_center|LOCUS_05800 17513 17657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17756 18040 gene locus_tag LOCUS_05810 17756 18040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 18256 18391 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18522 19151 gene locus_tag LOCUS_05820 18522 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 19151 19987 gene locus_tag LOCUS_05830 19151 19987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022686.1 protein_id gnl|my_center|LOCUS_05830 19995 20666 gene locus_tag LOCUS_05840 19995 20666 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391756.1 protein_id gnl|my_center|LOCUS_05840 20679 21632 gene locus_tag LOCUS_05850 20679 21632 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391757.1 protein_id gnl|my_center|LOCUS_05850 22373 22017 gene locus_tag LOCUS_05860 22373 22017 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326526.1 protein_id gnl|my_center|LOCUS_05860 23723 22554 gene locus_tag LOCUS_05870 23723 22554 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_05870 26318 23817 gene locus_tag LOCUS_05880 26318 23817 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_05880 26981 27068 gene locus_tag LOCUS_t00110 26981 27068 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 27847 29052 gene locus_tag LOCUS_05890 27847 29052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 29069 29965 gene locus_tag LOCUS_05900 29069 29965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669611.1 protein_id gnl|my_center|LOCUS_05900 29941 31323 gene locus_tag LOCUS_05910 29941 31323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 31954 32081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32110 32742 gene locus_tag LOCUS_05920 32110 32742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 32754 33869 gene locus_tag LOCUS_05930 32754 33869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 33910 34098 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34487 34645 gene locus_tag LOCUS_05940 34487 34645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 34996 36672 gene locus_tag LOCUS_05950 gene sulP 34996 36672 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_05950 38146 36743 gene locus_tag LOCUS_05960 38146 36743 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438549.1 protein_id gnl|my_center|LOCUS_05960 38360 38611 gene locus_tag LOCUS_05970 38360 38611 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418727.1 protein_id gnl|my_center|LOCUS_05970 39513 38869 gene locus_tag LOCUS_05980 gene ribB 39513 38869 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705223.1 protein_id gnl|my_center|LOCUS_05980 39977 41275 gene locus_tag LOCUS_05990 39977 41275 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_05990 42917 41469 gene locus_tag LOCUS_06000 42917 41469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 43412 44887 gene locus_tag LOCUS_06010 43412 44887 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_06010 44889 45063 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46628 45177 gene locus_tag LOCUS_06020 46628 45177 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_06020 47995 46631 gene locus_tag LOCUS_06030 gene trkA 47995 46631 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870210.1 protein_id gnl|my_center|LOCUS_06030 49284 48235 gene locus_tag LOCUS_06040 49284 48235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 49465 50358 gene locus_tag LOCUS_06050 49465 50358 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_06050 50498 51322 gene locus_tag LOCUS_06060 50498 51322 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_06060 51394 51807 gene locus_tag LOCUS_06070 51394 51807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 51824 52354 gene locus_tag LOCUS_06080 51824 52354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 52354 52878 gene locus_tag LOCUS_06090 52354 52878 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870476.1 protein_id gnl|my_center|LOCUS_06090 52913 53983 gene locus_tag LOCUS_06100 gene corA 52913 53983 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_06100 54026 54763 gene locus_tag LOCUS_06110 gene cobB 54026 54763 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846381.1 protein_id gnl|my_center|LOCUS_06110 54760 55812 gene locus_tag LOCUS_06120 54760 55812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249824.1 protein_id gnl|my_center|LOCUS_06120 55941 57800 gene locus_tag LOCUS_06130 55941 57800 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_06130 57797 58498 gene locus_tag LOCUS_06140 57797 58498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 59427 58501 gene locus_tag LOCUS_06150 59427 58501 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869154.1 protein_id gnl|my_center|LOCUS_06150 59574 59834 gene locus_tag LOCUS_06160 59574 59834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 59852 60337 gene locus_tag LOCUS_06170 59852 60337 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251030.1 protein_id gnl|my_center|LOCUS_06170 60334 60594 gene locus_tag LOCUS_06180 60334 60594 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146638.1 protein_id gnl|my_center|LOCUS_06180 60596 60976 gene locus_tag LOCUS_06190 gene mnhG 60596 60976 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867850.1 protein_id gnl|my_center|LOCUS_06190 60969 61232 gene locus_tag LOCUS_06200 60969 61232 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146635.1 protein_id gnl|my_center|LOCUS_06200 61229 61501 gene locus_tag LOCUS_06210 61229 61501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251034.1 protein_id gnl|my_center|LOCUS_06210 61498 61980 gene locus_tag LOCUS_06220 61498 61980 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867848.1 protein_id gnl|my_center|LOCUS_06220 61970 62317 gene locus_tag LOCUS_06230 61970 62317 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_06230 62314 63879 gene locus_tag LOCUS_06240 62314 63879 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 protein_id gnl|my_center|LOCUS_06240 63879 64220 gene locus_tag LOCUS_06250 63879 64220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 64232 64696 gene locus_tag LOCUS_06260 64232 64696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 64693 65238 gene locus_tag LOCUS_06270 64693 65238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 65250 66488 gene locus_tag LOCUS_06280 65250 66488 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867842.1 protein_id gnl|my_center|LOCUS_06280 66485 67480 gene locus_tag LOCUS_06290 66485 67480 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053771.1 protein_id gnl|my_center|LOCUS_06290 67497 68282 gene locus_tag LOCUS_06300 67497 68282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 69712 68396 gene locus_tag LOCUS_06310 gene gltX 69712 68396 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869827.1 protein_id gnl|my_center|LOCUS_06310 70030 71655 gene locus_tag LOCUS_06320 70030 71655 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_06320 71752 74316 gene locus_tag LOCUS_06330 71752 74316 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925176.1 protein_id gnl|my_center|LOCUS_06330 75077 75196 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75549 75778 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence07 <1 1155 gene locus_tag LOCUS_06340 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000345269.1:TRAP transporter large permease subunit 1182 1967 gene locus_tag LOCUS_06350 1182 1967 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_06350 1971 2633 gene locus_tag LOCUS_06360 1971 2633 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966256.1 protein_id gnl|my_center|LOCUS_06360 2651 3679 gene locus_tag LOCUS_06370 2651 3679 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_06370 3701 4852 gene locus_tag LOCUS_06380 gene dgoD 3701 4852 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_06380 5874 5080 gene locus_tag LOCUS_06390 5874 5080 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016563.1 protein_id gnl|my_center|LOCUS_06390 6595 5933 gene locus_tag LOCUS_06400 6595 5933 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016564.1 protein_id gnl|my_center|LOCUS_06400 7601 6588 gene locus_tag LOCUS_06410 7601 6588 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_06410 8940 7981 gene locus_tag LOCUS_06420 8940 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 9833 9033 gene locus_tag LOCUS_06430 9833 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 10011 10153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10472 10751 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11227 11542 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11920 12067 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12379 12552 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12751 12859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12959 13642 gene locus_tag LOCUS_06440 12959 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 13639 14535 gene locus_tag LOCUS_06450 gene ptb 13639 14535 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_06450 14580 15830 gene locus_tag LOCUS_06460 14580 15830 CDS product 3-hydroxy-3-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814048.1 protein_id gnl|my_center|LOCUS_06460 15966 17078 gene locus_tag LOCUS_06470 15966 17078 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_06470 17209 18105 gene locus_tag LOCUS_06480 17209 18105 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680288.1 protein_id gnl|my_center|LOCUS_06480 18123 19115 gene locus_tag LOCUS_06490 18123 19115 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_06490 19112 19882 gene locus_tag LOCUS_06500 19112 19882 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680286.1 protein_id gnl|my_center|LOCUS_06500 19879 20598 gene locus_tag LOCUS_06510 19879 20598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_06510 20610 21881 gene locus_tag LOCUS_06520 gene larA 20610 21881 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438088.1 protein_id gnl|my_center|LOCUS_06520 21897 23042 gene locus_tag LOCUS_06530 21897 23042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 23044 24222 gene locus_tag LOCUS_06540 23044 24222 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_06540 24582 24430 gene locus_tag LOCUS_06550 24582 24430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 24779 26008 gene locus_tag LOCUS_06560 24779 26008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 27015 26200 gene locus_tag LOCUS_06570 27015 26200 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_06570 27161 27844 gene locus_tag LOCUS_06580 27161 27844 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868955.1 protein_id gnl|my_center|LOCUS_06580 28110 29168 gene locus_tag LOCUS_06590 28110 29168 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_06590 29255 30874 gene locus_tag LOCUS_06600 29255 30874 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_06600 30982 32928 gene locus_tag LOCUS_06610 30982 32928 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016921.1 protein_id gnl|my_center|LOCUS_06610 34449 33010 gene locus_tag LOCUS_06620 34449 33010 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930810.1 protein_id gnl|my_center|LOCUS_06620 34639 35688 gene locus_tag LOCUS_06630 34639 35688 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_06630 36750 35767 gene locus_tag LOCUS_06640 36750 35767 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868770.1 protein_id gnl|my_center|LOCUS_06640 37738 36743 gene locus_tag LOCUS_06650 37738 36743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868769.1 protein_id gnl|my_center|LOCUS_06650 38629 37748 gene locus_tag LOCUS_06660 38629 37748 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868768.1 protein_id gnl|my_center|LOCUS_06660 39575 38649 gene locus_tag LOCUS_06670 39575 38649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868767.1 protein_id gnl|my_center|LOCUS_06670 41731 39827 gene locus_tag LOCUS_06680 gene gyrB 41731 39827 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868886.1 protein_id gnl|my_center|LOCUS_06680 41949 41728 gene locus_tag LOCUS_06690 41949 41728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 42047 42940 gene locus_tag LOCUS_06700 42047 42940 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869288.1 protein_id gnl|my_center|LOCUS_06700 46474 42935 gene locus_tag LOCUS_06710 46474 42935 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870416.1 protein_id gnl|my_center|LOCUS_06710 48545 46461 gene locus_tag LOCUS_06720 48545 46461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 48573 48931 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49651 49836 gene locus_tag LOCUS_06730 49651 49836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 49858 50022 gene locus_tag LOCUS_06740 49858 50022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 50182 50805 gene locus_tag LOCUS_06750 50182 50805 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870009.1 protein_id gnl|my_center|LOCUS_06750 50868 52685 gene locus_tag LOCUS_06760 50868 52685 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_06760 53378 52773 gene locus_tag LOCUS_06770 53378 52773 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925345.1 protein_id gnl|my_center|LOCUS_06770 54762 53383 gene locus_tag LOCUS_06780 54762 53383 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_06780 54876 55556 gene locus_tag LOCUS_06790 54876 55556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870301.1 protein_id gnl|my_center|LOCUS_06790 57241 55598 gene locus_tag LOCUS_06800 57241 55598 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023304.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence08 <1 741 gene locus_tag LOCUS_06810 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869678.1:(E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase 708 1658 gene locus_tag LOCUS_06820 gene argF 708 1658 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869677.1 protein_id gnl|my_center|LOCUS_06820 2344 1937 gene locus_tag LOCUS_06830 gene nikR 2344 1937 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_06830 2650 3396 gene locus_tag LOCUS_06840 gene nadE 2650 3396 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869673.1 protein_id gnl|my_center|LOCUS_06840 3434 4189 gene locus_tag LOCUS_06850 3434 4189 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869672.1 protein_id gnl|my_center|LOCUS_06850 4176 4706 gene locus_tag LOCUS_06860 4176 4706 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869671.1 protein_id gnl|my_center|LOCUS_06860 4727 5305 gene locus_tag LOCUS_06870 4727 5305 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869670.1 protein_id gnl|my_center|LOCUS_06870 5307 6371 gene locus_tag LOCUS_06880 gene ruvB 5307 6371 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925377.1 protein_id gnl|my_center|LOCUS_06880 6372 6596 gene locus_tag LOCUS_06890 6372 6596 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869668.1 protein_id gnl|my_center|LOCUS_06890 6643 8085 gene locus_tag LOCUS_06900 6643 8085 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925376.1 protein_id gnl|my_center|LOCUS_06900 8102 9154 gene locus_tag LOCUS_06910 gene queA 8102 9154 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019178.1 protein_id gnl|my_center|LOCUS_06910 9181 10506 gene locus_tag LOCUS_06920 gene amrA 9181 10506 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869665.1 protein_id gnl|my_center|LOCUS_06920 10503 11174 gene locus_tag LOCUS_06930 10503 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06930 11116 11508 gene locus_tag LOCUS_06940 11116 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06940 11511 12515 gene locus_tag LOCUS_06950 gene mltG 11511 12515 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869656.1 protein_id gnl|my_center|LOCUS_06950 12512 12811 gene locus_tag LOCUS_06960 12512 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 12792 14171 gene locus_tag LOCUS_06970 12792 14171 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583142.1 protein_id gnl|my_center|LOCUS_06970 14158 16584 gene locus_tag LOCUS_06980 14158 16584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 16872 17034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17293 17487 gene locus_tag LOCUS_06990 17293 17487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 17697 17503 gene locus_tag LOCUS_07000 gene rpmB 17697 17503 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869653.1 protein_id gnl|my_center|LOCUS_07000 17810 18037 gene locus_tag LOCUS_07010 17810 18037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 18030 18929 gene locus_tag LOCUS_07020 18030 18929 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869651.1 protein_id gnl|my_center|LOCUS_07020 18971 20842 gene locus_tag LOCUS_07030 gene dxs 18971 20842 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869650.1 protein_id gnl|my_center|LOCUS_07030 20850 21641 gene locus_tag LOCUS_07040 20850 21641 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925152.1 protein_id gnl|my_center|LOCUS_07040 21677 22558 gene locus_tag LOCUS_07050 21677 22558 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869648.1 protein_id gnl|my_center|LOCUS_07050 22564 24267 gene locus_tag LOCUS_07060 22564 24267 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869647.1 protein_id gnl|my_center|LOCUS_07060 24340 24651 gene locus_tag LOCUS_07070 gene rplU 24340 24651 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_07070 24688 25014 gene locus_tag LOCUS_07080 24688 25014 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_07080 25014 25295 gene locus_tag LOCUS_07090 gene rpmA 25014 25295 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869644.1 protein_id gnl|my_center|LOCUS_07090 25411 26733 gene locus_tag LOCUS_07100 gene obgE 25411 26733 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869643.1 protein_id gnl|my_center|LOCUS_07100 26758 27393 gene locus_tag LOCUS_07110 gene nadD 26758 27393 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_07110 27399 28685 gene locus_tag LOCUS_07120 27399 28685 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869641.1 protein_id gnl|my_center|LOCUS_07120 28759 29118 gene locus_tag LOCUS_07130 gene rsfS 28759 29118 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925373.1 protein_id gnl|my_center|LOCUS_07130 29148 29291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30519 29713 gene locus_tag LOCUS_07140 30519 29713 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679851.1 protein_id gnl|my_center|LOCUS_07140 31009 30686 gene locus_tag LOCUS_07150 31009 30686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674683.1 protein_id gnl|my_center|LOCUS_07150 33534 31006 gene locus_tag LOCUS_07160 33534 31006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 33758 33531 gene locus_tag LOCUS_07170 33758 33531 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252989.1 protein_id gnl|my_center|LOCUS_07170 34733 33921 gene locus_tag LOCUS_07180 34733 33921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07180 36008 34818 gene locus_tag LOCUS_07190 36008 34818 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869638.1 protein_id gnl|my_center|LOCUS_07190 37030 36011 gene locus_tag LOCUS_07200 gene gap 37030 36011 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869637.1 protein_id gnl|my_center|LOCUS_07200 38004 37111 gene locus_tag LOCUS_07210 gene whiA 38004 37111 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869635.1 protein_id gnl|my_center|LOCUS_07210 39000 38005 gene locus_tag LOCUS_07220 39000 38005 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869634.1 protein_id gnl|my_center|LOCUS_07220 39025 39283 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41007 40183 gene locus_tag LOCUS_07230 41007 40183 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869632.1 protein_id gnl|my_center|LOCUS_07230 41495 41004 gene locus_tag LOCUS_07240 gene moaC 41495 41004 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869631.1 protein_id gnl|my_center|LOCUS_07240 42484 41504 gene locus_tag LOCUS_07250 gene moaA 42484 41504 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869630.1 protein_id gnl|my_center|LOCUS_07250 44382 42469 gene locus_tag LOCUS_07260 44382 42469 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869629.1 protein_id gnl|my_center|LOCUS_07260 45608 44376 gene locus_tag LOCUS_07270 45608 44376 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869628.1 protein_id gnl|my_center|LOCUS_07270 46282 45620 gene locus_tag LOCUS_07280 46282 45620 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925151.1 protein_id gnl|my_center|LOCUS_07280 47555 46407 gene locus_tag LOCUS_07290 gene ftsZ 47555 46407 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869625.1 protein_id gnl|my_center|LOCUS_07290 48891 47578 gene locus_tag LOCUS_07300 gene ftsA 48891 47578 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925150.1 protein_id gnl|my_center|LOCUS_07300 49593 48922 gene locus_tag LOCUS_07310 49593 48922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 50629 49712 gene locus_tag LOCUS_07320 gene murB 50629 49712 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925148.1 protein_id gnl|my_center|LOCUS_07320 52060 50633 gene locus_tag LOCUS_07330 gene murC 52060 50633 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869621.1 protein_id gnl|my_center|LOCUS_07330 53143 52061 gene locus_tag LOCUS_07340 53143 52061 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869620.1 protein_id gnl|my_center|LOCUS_07340 54282 53140 gene locus_tag LOCUS_07350 54282 53140 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869619.1 protein_id gnl|my_center|LOCUS_07350 55655 54279 gene locus_tag LOCUS_07360 gene murD 55655 54279 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869618.1 protein_id gnl|my_center|LOCUS_07360 56644 55691 gene locus_tag LOCUS_07370 gene mraY 56644 55691 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925371.1 protein_id gnl|my_center|LOCUS_07370 <57202 56637 gene locus_tag LOCUS_07380 <57202 56637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082934.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence09 549 79 gene locus_tag LOCUS_07390 549 79 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235681.1 protein_id gnl|my_center|LOCUS_07390 1722 649 gene locus_tag LOCUS_07400 1722 649 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931069.1 protein_id gnl|my_center|LOCUS_07400 2322 1858 gene locus_tag LOCUS_07410 2322 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 3308 2337 gene locus_tag LOCUS_07420 3308 2337 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390045.1 protein_id gnl|my_center|LOCUS_07420 4326 3322 gene locus_tag LOCUS_07430 4326 3322 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390046.1 protein_id gnl|my_center|LOCUS_07430 5102 4473 gene locus_tag LOCUS_07440 5102 4473 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861699.1 protein_id gnl|my_center|LOCUS_07440 5724 5275 gene locus_tag LOCUS_07450 5724 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 6129 5752 gene locus_tag LOCUS_07460 6129 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 6234 6349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6954 6376 gene locus_tag LOCUS_07470 gene pyrE 6954 6376 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869834.1 protein_id gnl|my_center|LOCUS_07470 7658 6939 gene locus_tag LOCUS_07480 gene pyrF 7658 6939 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869835.1 protein_id gnl|my_center|LOCUS_07480 7659 7811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8762 7827 gene locus_tag LOCUS_07490 8762 7827 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869836.1 protein_id gnl|my_center|LOCUS_07490 9525 8749 gene locus_tag LOCUS_07500 9525 8749 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_07500 10822 9512 gene locus_tag LOCUS_07510 10822 9512 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869838.1 protein_id gnl|my_center|LOCUS_07510 11748 10819 gene locus_tag LOCUS_07520 11748 10819 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925403.1 protein_id gnl|my_center|LOCUS_07520 12305 11748 gene locus_tag LOCUS_07530 gene pyrR 12305 11748 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869840.1 protein_id gnl|my_center|LOCUS_07530 13721 12513 gene locus_tag LOCUS_07540 13721 12513 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438357.1 protein_id gnl|my_center|LOCUS_07540 14649 13795 gene locus_tag LOCUS_07550 gene panB 14649 13795 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_07550 15450 14665 gene locus_tag LOCUS_07560 15450 14665 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_07560 16420 15632 gene locus_tag LOCUS_07570 gene xth 16420 15632 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878084.1 protein_id gnl|my_center|LOCUS_07570 18615 16468 gene locus_tag LOCUS_07580 18615 16468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 19506 18718 gene locus_tag LOCUS_07590 19506 18718 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_07590 19543 19662 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20364 20531 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20752 20928 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22024 22203 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22745 23926 gene locus_tag LOCUS_07600 22745 23926 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868916.1 protein_id gnl|my_center|LOCUS_07600 24068 24226 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25140 25300 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25322 25651 gene locus_tag LOCUS_07610 25322 25651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 26154 25741 gene locus_tag LOCUS_07620 26154 25741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 26232 26999 gene locus_tag LOCUS_07630 gene larB 26232 26999 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_07630 28229 27072 gene locus_tag LOCUS_07640 28229 27072 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869194.1 protein_id gnl|my_center|LOCUS_07640 28374 29597 gene locus_tag LOCUS_07650 28374 29597 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_07650 30787 29603 gene locus_tag LOCUS_07660 30787 29603 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964332.1 protein_id gnl|my_center|LOCUS_07660 30920 31078 gene locus_tag LOCUS_07670 30920 31078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 31094 31327 gene locus_tag LOCUS_07680 31094 31327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 31332 32036 gene locus_tag LOCUS_07690 31332 32036 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405201.1 protein_id gnl|my_center|LOCUS_07690 32679 32587 gene locus_tag LOCUS_t00120 32679 32587 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 34239 33517 gene locus_tag LOCUS_07700 34239 33517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(33988..33990),aa:Sec) note codon on position 84 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_07700 35476 34307 gene locus_tag LOCUS_07710 35476 34307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870150.1 protein_id gnl|my_center|LOCUS_07710 36004 37869 gene locus_tag LOCUS_07720 gene typA 36004 37869 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925120.1 protein_id gnl|my_center|LOCUS_07720 39062 37917 gene locus_tag LOCUS_07730 39062 37917 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869548.1 protein_id gnl|my_center|LOCUS_07730 41464 39095 gene locus_tag LOCUS_07740 41464 39095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 41576 42586 gene locus_tag LOCUS_07750 41576 42586 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869012.1 protein_id gnl|my_center|LOCUS_07750 42670 42843 gene locus_tag LOCUS_07760 42670 42843 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869128.1 protein_id gnl|my_center|LOCUS_07760 42977 44740 gene locus_tag LOCUS_07770 42977 44740 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868889.1 protein_id gnl|my_center|LOCUS_07770 46995 44815 gene locus_tag LOCUS_07780 46995 44815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 47301 47023 gene locus_tag LOCUS_07790 47301 47023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816325.1 protein_id gnl|my_center|LOCUS_07790 48545 47412 gene locus_tag LOCUS_07800 gene rpoD 48545 47412 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280530.1 protein_id gnl|my_center|LOCUS_07800 48904 50529 gene locus_tag LOCUS_07810 48904 50529 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_07810 50733 51314 gene locus_tag LOCUS_07820 50733 51314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence10 614 201 gene locus_tag LOCUS_07830 614 201 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228886.1 protein_id gnl|my_center|LOCUS_07830 796 1027 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2152 1031 gene locus_tag LOCUS_07840 2152 1031 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925088.1 protein_id gnl|my_center|LOCUS_07840 2603 2932 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2939 3727 gene locus_tag LOCUS_07850 2939 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 3732 5150 gene locus_tag LOCUS_07860 3732 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925254.1 protein_id gnl|my_center|LOCUS_07860 5997 5122 gene locus_tag LOCUS_07870 5997 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 6024 6249 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6617 6330 gene locus_tag LOCUS_07880 6617 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 7091 6621 gene locus_tag LOCUS_07890 7091 6621 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582503.1 protein_id gnl|my_center|LOCUS_07890 8587 7154 gene locus_tag LOCUS_07900 8587 7154 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_07900 9148 8609 gene locus_tag LOCUS_07910 9148 8609 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_07910 11173 9152 gene locus_tag LOCUS_07920 gene fdhF 11173 9152 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 protein_id gnl|my_center|LOCUS_07920 12988 11195 gene locus_tag LOCUS_07930 gene nuoF 12988 11195 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_07930 13372 13004 gene locus_tag LOCUS_07940 13372 13004 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_07940 13860 13390 gene locus_tag LOCUS_07950 gene nuoE 13860 13390 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_07950 14157 14447 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15762 15067 gene locus_tag LOCUS_07960 15762 15067 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792728.1 protein_id gnl|my_center|LOCUS_07960 16709 15864 gene locus_tag LOCUS_07970 16709 15864 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938046.1 protein_id gnl|my_center|LOCUS_07970 18423 17035 gene locus_tag LOCUS_07980 18423 17035 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869009.1 protein_id gnl|my_center|LOCUS_07980 20100 18439 gene locus_tag LOCUS_07990 20100 18439 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643005.1 protein_id gnl|my_center|LOCUS_07990 20425 22476 gene locus_tag LOCUS_08000 20425 22476 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_08000 22473 23168 gene locus_tag LOCUS_08010 22473 23168 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_08010 23206 23358 gene locus_tag LOCUS_08020 23206 23358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 23500 25029 gene locus_tag LOCUS_08030 23500 25029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289202.1 protein_id gnl|my_center|LOCUS_08030 25029 26090 gene locus_tag LOCUS_08040 25029 26090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969292.1 protein_id gnl|my_center|LOCUS_08040 26093 26953 gene locus_tag LOCUS_08050 26093 26953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530293.1 protein_id gnl|my_center|LOCUS_08050 26984 27988 gene locus_tag LOCUS_08060 26984 27988 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869312.1 protein_id gnl|my_center|LOCUS_08060 28064 29710 gene locus_tag LOCUS_08070 28064 29710 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_08070 30387 29812 gene locus_tag LOCUS_08080 30387 29812 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925379.1 protein_id gnl|my_center|LOCUS_08080 30536 31324 gene locus_tag LOCUS_08090 30536 31324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 31382 32374 gene locus_tag LOCUS_08100 31382 32374 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288102.1 protein_id gnl|my_center|LOCUS_08100 33566 32490 gene locus_tag LOCUS_08110 33566 32490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972096.1 protein_id gnl|my_center|LOCUS_08110 35264 33570 gene locus_tag LOCUS_08120 35264 33570 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626058.1 protein_id gnl|my_center|LOCUS_08120 36335 35328 gene locus_tag LOCUS_08130 36335 35328 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 protein_id gnl|my_center|LOCUS_08130 36699 37706 gene locus_tag LOCUS_08140 36699 37706 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_08140 37727 38818 gene locus_tag LOCUS_08150 gene gcvT 37727 38818 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_08150 38842 39243 gene locus_tag LOCUS_08160 gene gcvH 38842 39243 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948418.1 protein_id gnl|my_center|LOCUS_08160 39248 40588 gene locus_tag LOCUS_08170 gene gcvPA 39248 40588 CDS product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903221.1 protein_id gnl|my_center|LOCUS_08170 40592 42061 gene locus_tag LOCUS_08180 gene gcvPB 40592 42061 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_08180 42147 43496 gene locus_tag LOCUS_08190 gene lpdA 42147 43496 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948421.1 protein_id gnl|my_center|LOCUS_08190 44335 43631 gene locus_tag LOCUS_08200 44335 43631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 45709 44522 gene locus_tag LOCUS_08210 45709 44522 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016873.1 protein_id gnl|my_center|LOCUS_08210 46177 45743 gene locus_tag LOCUS_08220 46177 45743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08220 46832 46170 gene locus_tag LOCUS_08230 46832 46170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 48526 46997 gene locus_tag LOCUS_08240 48526 46997 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_08240 48986 48555 gene locus_tag LOCUS_08250 48986 48555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 48999 49217 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49649 49857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence11 118 1719 gene locus_tag LOCUS_08260 118 1719 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922193.1 protein_id gnl|my_center|LOCUS_08260 1740 2756 gene locus_tag LOCUS_08270 gene dctP 1740 2756 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870184.1 protein_id gnl|my_center|LOCUS_08270 2815 4086 gene locus_tag LOCUS_08280 2815 4086 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986501.1 protein_id gnl|my_center|LOCUS_08280 4098 5390 gene locus_tag LOCUS_08290 4098 5390 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 protein_id gnl|my_center|LOCUS_08290 5402 6712 gene locus_tag LOCUS_08300 gene grdB 5402 6712 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011345263.1 transl_except (pos:6449..6451,aa:Sec) note codon on position 350 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_08300 6715 7065 gene locus_tag LOCUS_08310 6715 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 7079 8164 gene locus_tag LOCUS_08320 7079 8164 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485002.1 protein_id gnl|my_center|LOCUS_08320 9548 8238 gene locus_tag LOCUS_08330 9548 8238 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869254.1 protein_id gnl|my_center|LOCUS_08330 10566 9577 gene locus_tag LOCUS_08340 10566 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 11318 10653 gene locus_tag LOCUS_08350 11318 10653 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533045.1 protein_id gnl|my_center|LOCUS_08350 12727 11642 gene locus_tag LOCUS_08360 12727 11642 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658381.1 protein_id gnl|my_center|LOCUS_08360 13642 12983 gene locus_tag LOCUS_08370 13642 12983 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870392.1 protein_id gnl|my_center|LOCUS_08370 14148 15539 gene locus_tag LOCUS_08380 gene gcvPA 14148 15539 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250331.1 protein_id gnl|my_center|LOCUS_08380 15564 17153 gene locus_tag LOCUS_08390 gene gcvPB 15564 17153 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_08390 17160 18284 gene locus_tag LOCUS_08400 17160 18284 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_08400 18446 19624 gene locus_tag LOCUS_08410 18446 19624 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_08410 19881 21356 gene locus_tag LOCUS_08420 19881 21356 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005946978.1 protein_id gnl|my_center|LOCUS_08420 21377 21691 gene locus_tag LOCUS_08430 21377 21691 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_08430 21766 23172 gene locus_tag LOCUS_08440 gene pepV 21766 23172 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966010.1 protein_id gnl|my_center|LOCUS_08440 23310 24362 gene locus_tag LOCUS_08450 23310 24362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 24367 25188 gene locus_tag LOCUS_08460 gene proC 24367 25188 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_08460 25221 26102 gene locus_tag LOCUS_08470 25221 26102 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868939.1 protein_id gnl|my_center|LOCUS_08470 26504 26725 gene locus_tag LOCUS_08480 26504 26725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 26768 26974 gene locus_tag LOCUS_08490 26768 26974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 27041 27211 gene locus_tag LOCUS_08500 27041 27211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 27195 27569 gene locus_tag LOCUS_08510 27195 27569 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582852.1 protein_id gnl|my_center|LOCUS_08510 27566 28066 gene locus_tag LOCUS_08520 27566 28066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 28168 29100 gene locus_tag LOCUS_08530 28168 29100 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_08530 29219 29770 gene locus_tag LOCUS_08540 29219 29770 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_08540 30079 31209 gene locus_tag LOCUS_08550 30079 31209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 31219 32379 gene locus_tag LOCUS_08560 31219 32379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 32872 33033 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33110 34123 gene locus_tag LOCUS_08570 33110 34123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 34361 36310 gene locus_tag LOCUS_08580 gene asnB 34361 36310 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_08580 38784 37786 gene locus_tag LOCUS_08590 gene wlbA 38784 37786 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_08590 40123 38801 gene locus_tag LOCUS_08600 40123 38801 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081274.1 protein_id gnl|my_center|LOCUS_08600 40916 40143 gene locus_tag LOCUS_08610 40916 40143 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_08610 41130 40909 gene locus_tag LOCUS_08620 41130 40909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 42150 41137 gene locus_tag LOCUS_08630 42150 41137 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667998.1 protein_id gnl|my_center|LOCUS_08630 43082 42213 gene locus_tag LOCUS_08640 gene lpxD 43082 42213 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903952.1 protein_id gnl|my_center|LOCUS_08640 43375 43073 gene locus_tag LOCUS_08650 43375 43073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 43376 43603 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <45053 44409 gene locus_tag LOCUS_08660 <45053 44409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012895956.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) >Feature sequence12 1361 249 gene locus_tag LOCUS_08670 gene recA 1361 249 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870381.1 protein_id gnl|my_center|LOCUS_08670 1995 1423 gene locus_tag LOCUS_08680 gene thpR 1995 1423 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_08680 3209 1995 gene locus_tag LOCUS_08690 3209 1995 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404055.1 protein_id gnl|my_center|LOCUS_08690 3680 3216 gene locus_tag LOCUS_08700 3680 3216 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870384.1 protein_id gnl|my_center|LOCUS_08700 4966 3677 gene locus_tag LOCUS_08710 gene rimO 4966 3677 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880515.1 protein_id gnl|my_center|LOCUS_08710 5856 4963 gene locus_tag LOCUS_08720 gene rodZ 5856 4963 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482997.1 protein_id gnl|my_center|LOCUS_08720 6556 5825 gene locus_tag LOCUS_08730 gene rpe 6556 5825 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870387.1 protein_id gnl|my_center|LOCUS_08730 7713 6535 gene locus_tag LOCUS_08740 7713 6535 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870388.1 protein_id gnl|my_center|LOCUS_08740 9047 7719 gene locus_tag LOCUS_08750 9047 7719 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870389.1 protein_id gnl|my_center|LOCUS_08750 9739 9044 gene locus_tag LOCUS_08760 9739 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 9782 9951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10710 10015 gene locus_tag LOCUS_08770 10710 10015 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870390.1 protein_id gnl|my_center|LOCUS_08770 11946 10816 gene locus_tag LOCUS_08780 11946 10816 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870391.1 protein_id gnl|my_center|LOCUS_08780 12776 12114 gene locus_tag LOCUS_08790 12776 12114 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870392.1 protein_id gnl|my_center|LOCUS_08790 12969 13172 gene locus_tag LOCUS_08800 12969 13172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 14527 13157 gene locus_tag LOCUS_08810 14527 13157 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870395.1 protein_id gnl|my_center|LOCUS_08810 15831 14827 gene locus_tag LOCUS_08820 15831 14827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 16007 16858 gene locus_tag LOCUS_08830 16007 16858 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868984.1 protein_id gnl|my_center|LOCUS_08830 16882 17019 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19493 18015 gene locus_tag LOCUS_08840 19493 18015 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868959.1 protein_id gnl|my_center|LOCUS_08840 20928 19531 gene locus_tag LOCUS_08850 20928 19531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870399.1 protein_id gnl|my_center|LOCUS_08850 21015 22319 gene locus_tag LOCUS_08860 gene asnS 21015 22319 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870400.1 protein_id gnl|my_center|LOCUS_08860 23779 22499 gene locus_tag LOCUS_08870 23779 22499 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869072.1 protein_id gnl|my_center|LOCUS_08870 25350 24412 gene locus_tag LOCUS_08880 25350 24412 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869071.1 protein_id gnl|my_center|LOCUS_08880 26370 25357 gene locus_tag LOCUS_08890 26370 25357 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869070.1 protein_id gnl|my_center|LOCUS_08890 27612 26398 gene locus_tag LOCUS_08900 27612 26398 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082320.1 protein_id gnl|my_center|LOCUS_08900 27778 28989 gene locus_tag LOCUS_08910 27778 28989 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438357.1 protein_id gnl|my_center|LOCUS_08910 29108 31228 gene locus_tag LOCUS_08920 29108 31228 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_08920 33261 31300 gene locus_tag LOCUS_08930 33261 31300 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546396.1 protein_id gnl|my_center|LOCUS_08930 33430 34050 gene locus_tag LOCUS_08940 33430 34050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 34241 35467 gene locus_tag LOCUS_08950 34241 35467 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869068.1 protein_id gnl|my_center|LOCUS_08950 35568 36773 gene locus_tag LOCUS_08960 35568 36773 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869068.1 protein_id gnl|my_center|LOCUS_08960 36888 38255 gene locus_tag LOCUS_08970 gene mnmE 36888 38255 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295261.1 protein_id gnl|my_center|LOCUS_08970 38284 38877 gene locus_tag LOCUS_08980 38284 38877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 39373 38993 gene locus_tag LOCUS_08990 39373 38993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 40508 39402 gene locus_tag LOCUS_09000 40508 39402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868879.1 protein_id gnl|my_center|LOCUS_09000 41551 40505 gene locus_tag LOCUS_09010 41551 40505 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_09010 43158 41548 gene locus_tag LOCUS_09020 43158 41548 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_09020 <44527 43303 gene locus_tag LOCUS_09030 <44527 43303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868876.1:DUF3798 domain-containing protein >Feature sequence13 <1 1728 gene locus_tag LOCUS_09040 <1 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870444.1:AsmA-like C-terminal region-containing protein 1756 2496 gene locus_tag LOCUS_09050 1756 2496 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023861.1 protein_id gnl|my_center|LOCUS_09050 2744 2502 gene locus_tag LOCUS_09060 2744 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09060 2906 3096 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3876 4023 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4710 4318 gene locus_tag LOCUS_09070 4710 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 4819 4974 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5474 5645 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5976 6155 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6653 6805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8387 10291 gene locus_tag LOCUS_09080 gene glgB 8387 10291 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_09080 10293 12671 gene locus_tag LOCUS_09090 10293 12671 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_09090 12895 14019 gene locus_tag LOCUS_09100 gene proB 12895 14019 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_09100 14032 15288 gene locus_tag LOCUS_09110 14032 15288 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_09110 15327 16373 gene locus_tag LOCUS_09120 gene dctP 15327 16373 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113812.1 protein_id gnl|my_center|LOCUS_09120 16395 16892 gene locus_tag LOCUS_09130 16395 16892 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089572.1 protein_id gnl|my_center|LOCUS_09130 16892 18184 gene locus_tag LOCUS_09140 16892 18184 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113810.1 protein_id gnl|my_center|LOCUS_09140 19014 18307 gene locus_tag LOCUS_09150 19014 18307 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939274.1 protein_id gnl|my_center|LOCUS_09150 19950 19021 gene locus_tag LOCUS_09160 19950 19021 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_09160 21022 19952 gene locus_tag LOCUS_09170 21022 19952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_09170 22574 21027 gene locus_tag LOCUS_09180 22574 21027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_09180 23725 22643 gene locus_tag LOCUS_09190 23725 22643 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_09190 23917 24411 gene locus_tag LOCUS_09200 gene gpt 23917 24411 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 protein_id gnl|my_center|LOCUS_09200 24643 24473 gene locus_tag LOCUS_09210 24643 24473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 24748 25218 gene locus_tag LOCUS_09220 24748 25218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 26207 25380 gene locus_tag LOCUS_09230 26207 25380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 27513 26209 gene locus_tag LOCUS_09240 27513 26209 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947671.1 protein_id gnl|my_center|LOCUS_09240 28650 27562 gene locus_tag LOCUS_09250 28650 27562 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_09250 29546 29028 gene locus_tag LOCUS_09260 29546 29028 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_09260 29632 30453 gene locus_tag LOCUS_09270 gene otsB 29632 30453 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869049.1 protein_id gnl|my_center|LOCUS_09270 30446 31882 gene locus_tag LOCUS_09280 30446 31882 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869048.1 protein_id gnl|my_center|LOCUS_09280 31913 32440 gene locus_tag LOCUS_09290 31913 32440 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442270.1 protein_id gnl|my_center|LOCUS_09290 32475 33014 gene locus_tag LOCUS_09300 32475 33014 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442270.1 protein_id gnl|my_center|LOCUS_09300 33161 35620 gene locus_tag LOCUS_09310 gene gyrA 33161 35620 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869025.1 protein_id gnl|my_center|LOCUS_09310 35617 36246 gene locus_tag LOCUS_09320 35617 36246 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869026.1 protein_id gnl|my_center|LOCUS_09320 36233 36961 gene locus_tag LOCUS_09330 gene pssA 36233 36961 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869027.1 protein_id gnl|my_center|LOCUS_09330 37228 37480 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38065 38285 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39061 39699 gene locus_tag LOCUS_09340 gene thiE 39061 39699 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_09340 40349 39816 gene locus_tag LOCUS_09350 gene thiW 40349 39816 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870435.1 protein_id gnl|my_center|LOCUS_09350 41268 40324 gene locus_tag LOCUS_09360 41268 40324 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693803.1 protein_id gnl|my_center|LOCUS_09360 42030 41293 gene locus_tag LOCUS_09370 42030 41293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263203.1 protein_id gnl|my_center|LOCUS_09370 42701 42027 gene locus_tag LOCUS_09380 42701 42027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 43271 42768 gene locus_tag LOCUS_09390 gene thiT 43271 42768 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869028.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence14 606 1889 gene locus_tag LOCUS_09400 gene tyrS 606 1889 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870294.1 protein_id gnl|my_center|LOCUS_09400 1907 2806 gene locus_tag LOCUS_09410 1907 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2803 3663 gene locus_tag LOCUS_09420 2803 3663 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925457.1 protein_id gnl|my_center|LOCUS_09420 3713 4633 gene locus_tag LOCUS_09430 3713 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 5334 4681 gene locus_tag LOCUS_09440 5334 4681 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811721.1 protein_id gnl|my_center|LOCUS_09440 5924 5334 gene locus_tag LOCUS_09450 5924 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 6372 5911 gene locus_tag LOCUS_09460 6372 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 6674 6543 gene locus_tag LOCUS_09470 6674 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 6816 7703 gene locus_tag LOCUS_09480 6816 7703 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861338.1 protein_id gnl|my_center|LOCUS_09480 9126 7744 gene locus_tag LOCUS_09490 9126 7744 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869220.1 protein_id gnl|my_center|LOCUS_09490 9238 10170 gene locus_tag LOCUS_09500 9238 10170 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531227.1 protein_id gnl|my_center|LOCUS_09500 10590 11903 gene locus_tag LOCUS_09510 10590 11903 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948166.1 protein_id gnl|my_center|LOCUS_09510 13105 11900 gene locus_tag LOCUS_09520 13105 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 13875 13135 gene locus_tag LOCUS_09530 13875 13135 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925202.1 protein_id gnl|my_center|LOCUS_09530 14016 15659 gene locus_tag LOCUS_09540 14016 15659 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870103.1 protein_id gnl|my_center|LOCUS_09540 15685 16530 gene locus_tag LOCUS_09550 15685 16530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 17886 16603 gene locus_tag LOCUS_09560 17886 16603 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_09560 18021 18857 gene locus_tag LOCUS_09570 18021 18857 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869147.1 protein_id gnl|my_center|LOCUS_09570 20033 18900 gene locus_tag LOCUS_09580 20033 18900 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869069.1 protein_id gnl|my_center|LOCUS_09580 20847 20035 gene locus_tag LOCUS_09590 20847 20035 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931881.1 protein_id gnl|my_center|LOCUS_09590 22373 20865 gene locus_tag LOCUS_09600 22373 20865 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870120.1 protein_id gnl|my_center|LOCUS_09600 22479 23570 gene locus_tag LOCUS_09610 gene ychF 22479 23570 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869284.1 protein_id gnl|my_center|LOCUS_09610 23643 24083 gene locus_tag LOCUS_09620 23643 24083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869289.1 protein_id gnl|my_center|LOCUS_09620 24930 24214 gene locus_tag LOCUS_09630 24930 24214 CDS product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869292.1 protein_id gnl|my_center|LOCUS_09630 25088 26017 gene locus_tag LOCUS_09640 25088 26017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 26035 26592 gene locus_tag LOCUS_09650 26035 26592 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_09650 26619 27437 gene locus_tag LOCUS_09660 26619 27437 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868907.1 protein_id gnl|my_center|LOCUS_09660 27767 28744 gene locus_tag LOCUS_09670 27767 28744 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925335.1 protein_id gnl|my_center|LOCUS_09670 28741 30015 gene locus_tag LOCUS_09680 28741 30015 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869299.1 protein_id gnl|my_center|LOCUS_09680 30759 30076 gene locus_tag LOCUS_09690 30759 30076 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869303.1 protein_id gnl|my_center|LOCUS_09690 31334 30807 gene locus_tag LOCUS_09700 31334 30807 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869304.1 protein_id gnl|my_center|LOCUS_09700 31511 32971 gene locus_tag LOCUS_09710 31511 32971 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_09710 33000 33215 gene locus_tag LOCUS_09720 33000 33215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 33338 33424 gene locus_tag LOCUS_t00130 33338 33424 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33569 34528 gene locus_tag LOCUS_09730 33569 34528 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_09730 35044 34574 gene locus_tag LOCUS_09740 gene msrB 35044 34574 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876350.1 protein_id gnl|my_center|LOCUS_09740 35243 36043 gene locus_tag LOCUS_09750 35243 36043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 36051 36869 gene locus_tag LOCUS_09760 36051 36869 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921011.1 protein_id gnl|my_center|LOCUS_09760 38071 36875 gene locus_tag LOCUS_09770 38071 36875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 38878 38111 gene locus_tag LOCUS_09780 38878 38111 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933543.1 protein_id gnl|my_center|LOCUS_09780 39117 38911 gene locus_tag LOCUS_09790 39117 38911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 39270 39977 gene locus_tag LOCUS_09800 39270 39977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence15 62 454 gene locus_tag LOCUS_09810 62 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 451 2115 gene locus_tag LOCUS_09820 451 2115 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869958.1 protein_id gnl|my_center|LOCUS_09820 2134 4443 gene locus_tag LOCUS_09830 2134 4443 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925414.1 protein_id gnl|my_center|LOCUS_09830 4451 4900 gene locus_tag LOCUS_09840 gene dtd 4451 4900 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_09840 4901 5539 gene locus_tag LOCUS_09850 4901 5539 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442291.1 protein_id gnl|my_center|LOCUS_09850 5542 6216 gene locus_tag LOCUS_09860 gene radC 5542 6216 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_09860 6234 7292 gene locus_tag LOCUS_09870 6234 7292 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869954.1 protein_id gnl|my_center|LOCUS_09870 7314 8117 gene locus_tag LOCUS_09880 7314 8117 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869953.1 protein_id gnl|my_center|LOCUS_09880 8114 8575 gene locus_tag LOCUS_09890 8114 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869952.1 protein_id gnl|my_center|LOCUS_09890 8568 10316 gene locus_tag LOCUS_09900 gene mrdA 8568 10316 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869951.1 protein_id gnl|my_center|LOCUS_09900 10331 10999 gene locus_tag LOCUS_09910 10331 10999 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869950.1 protein_id gnl|my_center|LOCUS_09910 11026 11829 gene locus_tag LOCUS_09920 gene minD 11026 11829 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869949.1 protein_id gnl|my_center|LOCUS_09920 11855 12112 gene locus_tag LOCUS_09930 gene minE 11855 12112 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869948.1 protein_id gnl|my_center|LOCUS_09930 12123 13232 gene locus_tag LOCUS_09940 gene rodA 12123 13232 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869947.1 protein_id gnl|my_center|LOCUS_09940 13254 15089 gene locus_tag LOCUS_09950 13254 15089 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869946.1 protein_id gnl|my_center|LOCUS_09950 15089 15745 gene locus_tag LOCUS_09960 15089 15745 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869945.1 protein_id gnl|my_center|LOCUS_09960 15742 17241 gene locus_tag LOCUS_09970 15742 17241 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869944.1 protein_id gnl|my_center|LOCUS_09970 17216 20632 gene locus_tag LOCUS_09980 gene smc 17216 20632 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869943.1 protein_id gnl|my_center|LOCUS_09980 20620 21366 gene locus_tag LOCUS_09990 20620 21366 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869942.1 protein_id gnl|my_center|LOCUS_09990 21366 22187 gene locus_tag LOCUS_10000 gene rsmI 21366 22187 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869941.1 protein_id gnl|my_center|LOCUS_10000 22210 24141 gene locus_tag LOCUS_10010 gene metG 22210 24141 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869940.1 protein_id gnl|my_center|LOCUS_10010 24208 25002 gene locus_tag LOCUS_10020 24208 25002 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_10020 25003 26130 gene locus_tag LOCUS_10030 gene tgt 25003 26130 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869938.1 protein_id gnl|my_center|LOCUS_10030 26120 27100 gene locus_tag LOCUS_10040 26120 27100 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869937.1 protein_id gnl|my_center|LOCUS_10040 27158 27244 gene locus_tag LOCUS_t00140 27158 27244 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27392 31000 gene locus_tag LOCUS_10050 gene rpoB 27392 31000 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869936.1 protein_id gnl|my_center|LOCUS_10050 31001 36196 gene locus_tag LOCUS_10060 31001 36196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 32885 33045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36338 36598 gene locus_tag LOCUS_10070 36338 36598 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869934.1 protein_id gnl|my_center|LOCUS_10070 36640 37011 gene locus_tag LOCUS_10080 gene rpsL 36640 37011 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869933.1 protein_id gnl|my_center|LOCUS_10080 37054 37524 gene locus_tag LOCUS_10090 gene rpsG 37054 37524 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869932.1 protein_id gnl|my_center|LOCUS_10090 37576 39642 gene locus_tag LOCUS_10100 gene fusA 37576 39642 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925413.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence16 136 1548 gene locus_tag LOCUS_10110 136 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1550 2086 gene locus_tag LOCUS_10120 gene hpt 1550 2086 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 protein_id gnl|my_center|LOCUS_10120 2126 4033 gene locus_tag LOCUS_10130 gene ftsH 2126 4033 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_10130 4150 6201 gene locus_tag LOCUS_10140 gene uvrB 4150 6201 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925369.1 protein_id gnl|my_center|LOCUS_10140 6125 8968 gene locus_tag LOCUS_10150 gene uvrA 6125 8968 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869598.1 protein_id gnl|my_center|LOCUS_10150 8946 9722 gene locus_tag LOCUS_10160 gene rlmB 8946 9722 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869599.1 protein_id gnl|my_center|LOCUS_10160 9738 10538 gene locus_tag LOCUS_10170 gene proC 9738 10538 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869320.1 protein_id gnl|my_center|LOCUS_10170 10603 10677 gene locus_tag LOCUS_t00150 10603 10677 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11861 10794 gene locus_tag LOCUS_10180 11861 10794 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_10180 12134 12499 gene locus_tag LOCUS_10190 gene acpS 12134 12499 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869724.1 protein_id gnl|my_center|LOCUS_10190 12506 14038 gene locus_tag LOCUS_10200 12506 14038 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869723.1 protein_id gnl|my_center|LOCUS_10200 14019 14243 gene locus_tag LOCUS_10210 14019 14243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 14264 14731 gene locus_tag LOCUS_10220 gene tsaE 14264 14731 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869721.1 protein_id gnl|my_center|LOCUS_10220 14728 15405 gene locus_tag LOCUS_10230 14728 15405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 15608 15817 gene locus_tag LOCUS_10240 15608 15817 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869714.1 protein_id gnl|my_center|LOCUS_10240 15810 16943 gene locus_tag LOCUS_10250 15810 16943 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869713.1 protein_id gnl|my_center|LOCUS_10250 16943 17770 gene locus_tag LOCUS_10260 16943 17770 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869712.1 protein_id gnl|my_center|LOCUS_10260 17763 18323 gene locus_tag LOCUS_10270 17763 18323 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869711.1 protein_id gnl|my_center|LOCUS_10270 18471 18845 gene locus_tag LOCUS_10280 18471 18845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 18861 20045 gene locus_tag LOCUS_10290 18861 20045 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_10290 20142 21533 gene locus_tag LOCUS_10300 gene rlmD 20142 21533 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869710.1 protein_id gnl|my_center|LOCUS_10300 22080 22463 gene locus_tag LOCUS_10310 22080 22463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 22834 23148 gene locus_tag LOCUS_10320 22834 23148 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812923.1 protein_id gnl|my_center|LOCUS_10320 23664 23482 gene locus_tag LOCUS_10330 23664 23482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 23627 24244 gene locus_tag LOCUS_10340 23627 24244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 24450 24998 gene locus_tag LOCUS_10350 24450 24998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10350 25008 25568 gene locus_tag LOCUS_10360 25008 25568 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272758.1 protein_id gnl|my_center|LOCUS_10360 25565 26254 gene locus_tag LOCUS_10370 25565 26254 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462031.1 protein_id gnl|my_center|LOCUS_10370 26282 26635 gene locus_tag LOCUS_10380 26282 26635 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272757.1 protein_id gnl|my_center|LOCUS_10380 26709 26888 gene locus_tag LOCUS_10390 26709 26888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10390 26930 27697 gene locus_tag LOCUS_10400 26930 27697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10400 27742 27897 gene locus_tag LOCUS_10410 27742 27897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10410 28159 28431 gene locus_tag LOCUS_10420 28159 28431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10420 28822 28897 gene locus_tag LOCUS_t00160 28822 28897 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29111 29437 gene locus_tag LOCUS_10430 29111 29437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 29424 31430 gene locus_tag LOCUS_10440 29424 31430 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925145.1 protein_id gnl|my_center|LOCUS_10440 31712 31849 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32439 32584 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32902 33912 gene locus_tag LOCUS_10450 32902 33912 CDS product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869604.1 protein_id gnl|my_center|LOCUS_10450 33905 34243 gene locus_tag LOCUS_10460 33905 34243 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869605.1 protein_id gnl|my_center|LOCUS_10460 34269 36065 gene locus_tag LOCUS_10470 34269 36065 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925146.1 protein_id gnl|my_center|LOCUS_10470 36055 37476 gene locus_tag LOCUS_10480 36055 37476 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869607.1 protein_id gnl|my_center|LOCUS_10480 37491 38114 gene locus_tag LOCUS_10490 37491 38114 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869608.1 protein_id gnl|my_center|LOCUS_10490 39059 38250 gene locus_tag LOCUS_10500 39059 38250 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869610.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence17 118 1800 gene locus_tag LOCUS_10510 118 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1644 1794 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1817 5629 gene locus_tag LOCUS_10520 1817 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5633 7900 gene locus_tag LOCUS_10530 gene pbpC 5633 7900 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703167.1 protein_id gnl|my_center|LOCUS_10530 9000 8038 gene locus_tag LOCUS_10540 9000 8038 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943043.1 protein_id gnl|my_center|LOCUS_10540 9131 10969 gene locus_tag LOCUS_10550 9131 10969 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_10550 11732 11124 gene locus_tag LOCUS_10560 11732 11124 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_10560 12466 11687 gene locus_tag LOCUS_10570 12466 11687 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870318.1 protein_id gnl|my_center|LOCUS_10570 12909 12478 gene locus_tag LOCUS_10580 gene nifU 12909 12478 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_10580 14104 12914 gene locus_tag LOCUS_10590 gene nifS 14104 12914 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_10590 14545 14123 gene locus_tag LOCUS_10600 14545 14123 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391911.1 protein_id gnl|my_center|LOCUS_10600 14693 14974 gene locus_tag LOCUS_10610 14693 14974 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250016.1 protein_id gnl|my_center|LOCUS_10610 15926 15180 gene locus_tag LOCUS_10620 15926 15180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869435.1 protein_id gnl|my_center|LOCUS_10620 16698 15919 gene locus_tag LOCUS_10630 16698 15919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869436.1 protein_id gnl|my_center|LOCUS_10630 17548 16682 gene locus_tag LOCUS_10640 17548 16682 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869437.1 protein_id gnl|my_center|LOCUS_10640 18438 17557 gene locus_tag LOCUS_10650 18438 17557 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869438.1 protein_id gnl|my_center|LOCUS_10650 19697 18519 gene locus_tag LOCUS_10660 19697 18519 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869553.1 protein_id gnl|my_center|LOCUS_10660 19821 20915 gene locus_tag LOCUS_10670 19821 20915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462288.1 protein_id gnl|my_center|LOCUS_10670 22658 21000 gene locus_tag LOCUS_10680 22658 21000 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049528.1 protein_id gnl|my_center|LOCUS_10680 24949 22664 gene locus_tag LOCUS_10690 24949 22664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 26106 25012 gene locus_tag LOCUS_10700 26106 25012 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925054.1 protein_id gnl|my_center|LOCUS_10700 26445 26227 gene locus_tag LOCUS_10710 26445 26227 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869002.1 protein_id gnl|my_center|LOCUS_10710 27548 26457 gene locus_tag LOCUS_10720 gene yedE 27548 26457 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925089.1 protein_id gnl|my_center|LOCUS_10720 27748 28218 gene locus_tag LOCUS_10730 27748 28218 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_10730 29093 28314 gene locus_tag LOCUS_10740 29093 28314 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869221.1 protein_id gnl|my_center|LOCUS_10740 29253 30305 gene locus_tag LOCUS_10750 29253 30305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 31194 30391 gene locus_tag LOCUS_10760 31194 30391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 31354 31511 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31951 32102 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32242 32390 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32812 32465 gene locus_tag LOCUS_10770 32812 32465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 33025 34368 gene locus_tag LOCUS_10780 33025 34368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 34904 35677 gene locus_tag LOCUS_10790 gene cas6 34904 35677 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_10790 35678 36118 gene locus_tag LOCUS_10800 35678 36118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 36183 36614 gene locus_tag LOCUS_10810 gene cas4 36183 36614 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460582.1 protein_id gnl|my_center|LOCUS_10810 36620 37618 gene locus_tag LOCUS_10820 gene cas1b 36620 37618 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545370.1 protein_id gnl|my_center|LOCUS_10820 37634 37885 gene locus_tag LOCUS_10830 gene cas2 37634 37885 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582991.1 protein_id gnl|my_center|LOCUS_10830 38055 38482 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttctaacttcctataagggatggaaac 38475 38793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38785 >39070 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttctaacttcctataagggatggaaac >Feature sequence18 2425 1265 gene locus_tag LOCUS_10840 gene grdD 2425 1265 CDS product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869881.1 protein_id gnl|my_center|LOCUS_10840 3965 2436 gene locus_tag LOCUS_10850 gene grdC 3965 2436 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869882.1 protein_id gnl|my_center|LOCUS_10850 4335 4102 gene locus_tag LOCUS_10860 4335 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 4349 4521 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5595 4549 gene locus_tag LOCUS_10870 gene grdB 5595 4549 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869883.1 protein_id gnl|my_center|LOCUS_10870 6097 5621 gene locus_tag LOCUS_10880 gene grdA 6097 5621 CDS product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869884.1 transl_except (pos:complement(5966..5968),aa:Sec) note codon on position 44 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_10880 7450 6164 gene locus_tag LOCUS_10890 7450 6164 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869885.1 protein_id gnl|my_center|LOCUS_10890 7803 7480 gene locus_tag LOCUS_10900 7803 7480 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869886.1 protein_id gnl|my_center|LOCUS_10900 8288 7878 gene locus_tag LOCUS_10910 8288 7878 CDS product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869887.1 protein_id gnl|my_center|LOCUS_10910 10015 8678 gene locus_tag LOCUS_10920 10015 8678 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_10920 10312 10551 gene locus_tag LOCUS_10930 10312 10551 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_10930 10526 11662 gene locus_tag LOCUS_10940 gene hypD 10526 11662 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393664.1 protein_id gnl|my_center|LOCUS_10940 11620 12609 gene locus_tag LOCUS_10950 gene hypE 11620 12609 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_10950 13520 12735 gene locus_tag LOCUS_10960 13520 12735 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870003.1 protein_id gnl|my_center|LOCUS_10960 15074 13533 gene locus_tag LOCUS_10970 gene rny 15074 13533 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870004.1 protein_id gnl|my_center|LOCUS_10970 15603 15166 gene locus_tag LOCUS_10980 15603 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 17687 15600 gene locus_tag LOCUS_10990 gene recG 17687 15600 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_10990 18166 17684 gene locus_tag LOCUS_11000 18166 17684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 18563 18159 gene locus_tag LOCUS_11010 18563 18159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 19293 18589 gene locus_tag LOCUS_11020 19293 18589 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870007.1 protein_id gnl|my_center|LOCUS_11020 20213 19287 gene locus_tag LOCUS_11030 20213 19287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 21195 20203 gene locus_tag LOCUS_11040 gene gyaR 21195 20203 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_11040 22008 21235 gene locus_tag LOCUS_11050 gene folE2 22008 21235 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_11050 22369 22001 gene locus_tag LOCUS_11060 gene queD 22369 22001 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582987.1 protein_id gnl|my_center|LOCUS_11060 22705 24819 gene locus_tag LOCUS_11070 22705 24819 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870014.1 protein_id gnl|my_center|LOCUS_11070 25865 24852 gene locus_tag LOCUS_11080 25865 24852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 27525 26593 gene locus_tag LOCUS_11090 27525 26593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 28917 27565 gene locus_tag LOCUS_11100 gene dnaB 28917 27565 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869407.1 protein_id gnl|my_center|LOCUS_11100 29366 28920 gene locus_tag LOCUS_11110 gene rplI 29366 28920 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869406.1 protein_id gnl|my_center|LOCUS_11110 30322 29369 gene locus_tag LOCUS_11120 30322 29369 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869405.1 protein_id gnl|my_center|LOCUS_11120 30696 30424 gene locus_tag LOCUS_11130 gene rpsR 30696 30424 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_11130 31203 30712 gene locus_tag LOCUS_11140 gene ssb 31203 30712 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869403.1 protein_id gnl|my_center|LOCUS_11140 31500 31216 gene locus_tag LOCUS_11150 gene rpsF 31500 31216 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869402.1 protein_id gnl|my_center|LOCUS_11150 31882 31577 gene locus_tag LOCUS_11160 31882 31577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 33565 31889 gene locus_tag LOCUS_11170 gene argS 33565 31889 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869400.1 protein_id gnl|my_center|LOCUS_11170 35411 33585 gene locus_tag LOCUS_11180 35411 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 38108 35430 gene locus_tag LOCUS_11190 gene secA 38108 35430 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869398.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence19 49 354 gene locus_tag LOCUS_11200 gene rpsJ 49 354 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869929.1 protein_id gnl|my_center|LOCUS_11200 385 1011 gene locus_tag LOCUS_11210 gene rplC 385 1011 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869928.1 protein_id gnl|my_center|LOCUS_11210 1041 1664 gene locus_tag LOCUS_11220 gene rplD 1041 1664 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869927.1 protein_id gnl|my_center|LOCUS_11220 1661 1957 gene locus_tag LOCUS_11230 gene rplW 1661 1957 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_11230 1978 2805 gene locus_tag LOCUS_11240 gene rplB 1978 2805 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869925.1 protein_id gnl|my_center|LOCUS_11240 2823 3104 gene locus_tag LOCUS_11250 gene rpsS 2823 3104 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583236.1 protein_id gnl|my_center|LOCUS_11250 3118 3450 gene locus_tag LOCUS_11260 gene rplV 3118 3450 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869924.1 protein_id gnl|my_center|LOCUS_11260 3464 4129 gene locus_tag LOCUS_11270 gene rpsC 3464 4129 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869923.1 protein_id gnl|my_center|LOCUS_11270 4136 4558 gene locus_tag LOCUS_11280 gene rplP 4136 4558 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869922.1 protein_id gnl|my_center|LOCUS_11280 4561 4776 gene locus_tag LOCUS_11290 gene rpmC 4561 4776 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_11290 4783 5082 gene locus_tag LOCUS_11300 gene rpsQ 4783 5082 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869920.1 protein_id gnl|my_center|LOCUS_11300 5086 5454 gene locus_tag LOCUS_11310 gene rplN 5086 5454 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869919.1 protein_id gnl|my_center|LOCUS_11310 5470 5796 gene locus_tag LOCUS_11320 gene rplX 5470 5796 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869918.1 protein_id gnl|my_center|LOCUS_11320 5809 6354 gene locus_tag LOCUS_11330 gene rplE 5809 6354 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869917.1 protein_id gnl|my_center|LOCUS_11330 6375 6560 gene locus_tag LOCUS_11340 6375 6560 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869916.1 protein_id gnl|my_center|LOCUS_11340 6590 6994 gene locus_tag LOCUS_11350 gene rpsH 6590 6994 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925182.1 protein_id gnl|my_center|LOCUS_11350 7011 7550 gene locus_tag LOCUS_11360 gene rplF 7011 7550 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_11360 7653 7931 gene locus_tag LOCUS_11370 gene rplR 7653 7931 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925411.1 protein_id gnl|my_center|LOCUS_11370 7947 8459 gene locus_tag LOCUS_11380 gene rpsE 7947 8459 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925410.1 protein_id gnl|my_center|LOCUS_11380 8474 8659 gene locus_tag LOCUS_11390 gene rpmD 8474 8659 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869911.1 protein_id gnl|my_center|LOCUS_11390 8672 9118 gene locus_tag LOCUS_11400 gene rplO 8672 9118 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869910.1 protein_id gnl|my_center|LOCUS_11400 9119 10417 gene locus_tag LOCUS_11410 gene secY 9119 10417 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869909.1 protein_id gnl|my_center|LOCUS_11410 10435 11091 gene locus_tag LOCUS_11420 10435 11091 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 protein_id gnl|my_center|LOCUS_11420 11088 11864 gene locus_tag LOCUS_11430 gene map 11088 11864 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869907.1 protein_id gnl|my_center|LOCUS_11430 11849 12175 gene locus_tag LOCUS_11440 11849 12175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 12180 12401 gene locus_tag LOCUS_11450 gene infA 12180 12401 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583256.1 protein_id gnl|my_center|LOCUS_11450 12656 13033 gene locus_tag LOCUS_11460 gene rpsM 12656 13033 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_11460 13067 13459 gene locus_tag LOCUS_11470 gene rpsK 13067 13459 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869904.1 protein_id gnl|my_center|LOCUS_11470 13491 14120 gene locus_tag LOCUS_11480 gene rpsD 13491 14120 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869903.1 protein_id gnl|my_center|LOCUS_11480 14133 15158 gene locus_tag LOCUS_11490 14133 15158 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869902.1 protein_id gnl|my_center|LOCUS_11490 15163 15516 gene locus_tag LOCUS_11500 gene rplQ 15163 15516 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280529.1 protein_id gnl|my_center|LOCUS_11500 15777 16349 gene locus_tag LOCUS_11510 15777 16349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 16337 17188 gene locus_tag LOCUS_11520 16337 17188 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869899.1 protein_id gnl|my_center|LOCUS_11520 17185 18000 gene locus_tag LOCUS_11530 17185 18000 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869898.1 protein_id gnl|my_center|LOCUS_11530 17997 18818 gene locus_tag LOCUS_11540 gene truA 17997 18818 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869897.1 protein_id gnl|my_center|LOCUS_11540 18866 19918 gene locus_tag LOCUS_11550 18866 19918 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869896.1 protein_id gnl|my_center|LOCUS_11550 19940 20749 gene locus_tag LOCUS_11560 gene flgF 19940 20749 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869895.1 protein_id gnl|my_center|LOCUS_11560 20768 21556 gene locus_tag LOCUS_11570 gene flgG 20768 21556 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869894.1 protein_id gnl|my_center|LOCUS_11570 21605 22495 gene locus_tag LOCUS_11580 21605 22495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 22492 23073 gene locus_tag LOCUS_11590 22492 23073 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869892.1 protein_id gnl|my_center|LOCUS_11590 23088 24206 gene locus_tag LOCUS_11600 23088 24206 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869891.1 protein_id gnl|my_center|LOCUS_11600 24220 24546 gene locus_tag LOCUS_11610 24220 24546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925180.1 protein_id gnl|my_center|LOCUS_11610 24575 24973 gene locus_tag LOCUS_11620 24575 24973 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869889.1 protein_id gnl|my_center|LOCUS_11620 25071 26237 gene locus_tag LOCUS_11630 25071 26237 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925128.1 protein_id gnl|my_center|LOCUS_11630 26252 26473 gene locus_tag LOCUS_11640 26252 26473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 26457 26882 gene locus_tag LOCUS_11650 26457 26882 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869411.1 protein_id gnl|my_center|LOCUS_11650 26954 27523 gene locus_tag LOCUS_11660 26954 27523 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869413.1 protein_id gnl|my_center|LOCUS_11660 27584 27868 gene locus_tag LOCUS_11670 27584 27868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 27873 28322 gene locus_tag LOCUS_11680 gene flgN 27873 28322 CDS product flagellar export chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869416.1 protein_id gnl|my_center|LOCUS_11680 28335 30821 gene locus_tag LOCUS_11690 gene flgK 28335 30821 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869417.1 protein_id gnl|my_center|LOCUS_11690 30833 33526 gene locus_tag LOCUS_11700 30833 33526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 33557 34030 gene locus_tag LOCUS_11710 33557 34030 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869419.1 protein_id gnl|my_center|LOCUS_11710 34030 34290 gene locus_tag LOCUS_11720 34030 34290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence20 2941 980 gene locus_tag LOCUS_11730 2941 980 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_11730 3449 2901 gene locus_tag LOCUS_11740 3449 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4489 3512 gene locus_tag LOCUS_11750 4489 3512 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_11750 4798 5697 gene locus_tag LOCUS_11760 4798 5697 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965155.1 protein_id gnl|my_center|LOCUS_11760 6220 5711 gene locus_tag LOCUS_11770 6220 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 7624 6266 gene locus_tag LOCUS_11780 7624 6266 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940104.1 protein_id gnl|my_center|LOCUS_11780 8013 9488 gene locus_tag LOCUS_11790 8013 9488 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082772.1 protein_id gnl|my_center|LOCUS_11790 10465 10741 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10800 12407 gene locus_tag LOCUS_11800 10800 12407 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_11800 12634 13725 gene locus_tag LOCUS_11810 12634 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 13722 14234 gene locus_tag LOCUS_11820 13722 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 14361 15482 gene locus_tag LOCUS_11830 14361 15482 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545564.1 protein_id gnl|my_center|LOCUS_11830 15728 16444 gene locus_tag LOCUS_11840 15728 16444 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_11840 17466 16597 gene locus_tag LOCUS_11850 17466 16597 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285667.1 protein_id gnl|my_center|LOCUS_11850 18488 17472 gene locus_tag LOCUS_11860 18488 17472 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018191.1 protein_id gnl|my_center|LOCUS_11860 19402 18500 gene locus_tag LOCUS_11870 19402 18500 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563083.1 protein_id gnl|my_center|LOCUS_11870 20114 19407 gene locus_tag LOCUS_11880 20114 19407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545450.1 protein_id gnl|my_center|LOCUS_11880 20914 20108 gene locus_tag LOCUS_11890 20914 20108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_11890 22203 20980 gene locus_tag LOCUS_11900 22203 20980 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391475.1 protein_id gnl|my_center|LOCUS_11900 23034 23585 gene locus_tag LOCUS_11910 23034 23585 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869204.1 protein_id gnl|my_center|LOCUS_11910 23780 25795 gene locus_tag LOCUS_11920 23780 25795 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869308.1 protein_id gnl|my_center|LOCUS_11920 27747 25996 gene locus_tag LOCUS_11930 27747 25996 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868845.1 protein_id gnl|my_center|LOCUS_11930 28445 27744 gene locus_tag LOCUS_11940 28445 27744 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868846.1 protein_id gnl|my_center|LOCUS_11940 29137 28448 gene locus_tag LOCUS_11950 gene phoU 29137 28448 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868847.1 protein_id gnl|my_center|LOCUS_11950 29955 29176 gene locus_tag LOCUS_11960 gene pstB 29955 29176 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_11960 30810 29959 gene locus_tag LOCUS_11970 gene pstA 30810 29959 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868849.1 protein_id gnl|my_center|LOCUS_11970 31682 30807 gene locus_tag LOCUS_11980 gene pstC 31682 30807 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925270.1 protein_id gnl|my_center|LOCUS_11980 32730 31918 gene locus_tag LOCUS_11990 32730 31918 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_11990 34560 34767 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34940 35941 gene locus_tag LOCUS_12000 34940 35941 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693870.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence21 1172 225 gene locus_tag LOCUS_12010 1172 225 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869545.1 protein_id gnl|my_center|LOCUS_12010 1899 1159 gene locus_tag LOCUS_12020 1899 1159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925139.1 protein_id gnl|my_center|LOCUS_12020 3435 2035 gene locus_tag LOCUS_12030 3435 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869542.1 protein_id gnl|my_center|LOCUS_12030 3780 3544 gene locus_tag LOCUS_12040 3780 3544 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925138.1 protein_id gnl|my_center|LOCUS_12040 4055 4888 gene locus_tag LOCUS_12050 4055 4888 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869857.1 protein_id gnl|my_center|LOCUS_12050 4892 6310 gene locus_tag LOCUS_12060 gene gltA 4892 6310 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869858.1 protein_id gnl|my_center|LOCUS_12060 6341 6556 gene locus_tag LOCUS_12070 6341 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 8747 6666 gene locus_tag LOCUS_12080 gene fusA 8747 6666 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869860.1 protein_id gnl|my_center|LOCUS_12080 8949 8728 gene locus_tag LOCUS_12090 8949 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 10384 8912 gene locus_tag LOCUS_12100 gene gatB 10384 8912 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869861.1 protein_id gnl|my_center|LOCUS_12100 11853 10384 gene locus_tag LOCUS_12110 gene gatA 11853 10384 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_12110 12148 11855 gene locus_tag LOCUS_12120 gene gatC 12148 11855 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124420.1 protein_id gnl|my_center|LOCUS_12120 14181 12160 gene locus_tag LOCUS_12130 gene ligA 14181 12160 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869864.1 protein_id gnl|my_center|LOCUS_12130 15716 14196 gene locus_tag LOCUS_12140 gene lysS 15716 14196 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869865.1 protein_id gnl|my_center|LOCUS_12140 16747 15701 gene locus_tag LOCUS_12150 16747 15701 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869866.1 protein_id gnl|my_center|LOCUS_12150 17492 16719 gene locus_tag LOCUS_12160 17492 16719 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869867.1 protein_id gnl|my_center|LOCUS_12160 18974 17550 gene locus_tag LOCUS_12170 18974 17550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 19633 18971 gene locus_tag LOCUS_12180 19633 18971 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925407.1 protein_id gnl|my_center|LOCUS_12180 20951 19626 gene locus_tag LOCUS_12190 gene miaB 20951 19626 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869870.1 protein_id gnl|my_center|LOCUS_12190 21247 21762 gene locus_tag LOCUS_12200 21247 21762 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869222.1 protein_id gnl|my_center|LOCUS_12200 21740 23647 gene locus_tag LOCUS_12210 21740 23647 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869223.1 protein_id gnl|my_center|LOCUS_12210 23644 24411 gene locus_tag LOCUS_12220 23644 24411 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869224.1 protein_id gnl|my_center|LOCUS_12220 24457 24936 gene locus_tag LOCUS_12230 24457 24936 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869225.1 protein_id gnl|my_center|LOCUS_12230 24936 26744 gene locus_tag LOCUS_12240 24936 26744 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 protein_id gnl|my_center|LOCUS_12240 26852 27361 gene locus_tag LOCUS_12250 26852 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 28274 27516 gene locus_tag LOCUS_12260 28274 27516 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_12260 28648 28487 gene locus_tag LOCUS_12270 28648 28487 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_12270 29870 28764 gene locus_tag LOCUS_12280 29870 28764 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869873.1 protein_id gnl|my_center|LOCUS_12280 30760 29885 gene locus_tag LOCUS_12290 30760 29885 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869874.1 protein_id gnl|my_center|LOCUS_12290 30765 30920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31578 31045 gene locus_tag LOCUS_12300 31578 31045 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869875.1 protein_id gnl|my_center|LOCUS_12300 33545 31602 gene locus_tag LOCUS_12310 33545 31602 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869877.1 protein_id gnl|my_center|LOCUS_12310 34681 33800 gene locus_tag LOCUS_12320 gene alr 34681 33800 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869879.1 protein_id gnl|my_center|LOCUS_12320 34812 34971 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence22 212 538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2173 863 gene locus_tag LOCUS_12330 2173 863 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_12330 2327 3382 gene locus_tag LOCUS_12340 2327 3382 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_12340 3366 3755 gene locus_tag LOCUS_12350 3366 3755 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948150.1 protein_id gnl|my_center|LOCUS_12350 3776 4291 gene locus_tag LOCUS_12360 3776 4291 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_12360 5302 4406 gene locus_tag LOCUS_12370 gene ftcD 5302 4406 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_12370 6631 5393 gene locus_tag LOCUS_12380 gene gltS 6631 5393 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105930.1 protein_id gnl|my_center|LOCUS_12380 8033 6732 gene locus_tag LOCUS_12390 8033 6732 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869324.1 protein_id gnl|my_center|LOCUS_12390 8265 8415 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9287 8463 gene locus_tag LOCUS_12400 9287 8463 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_12400 9876 9301 gene locus_tag LOCUS_12410 9876 9301 CDS product electron transport complex protein RnfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356420.1 protein_id gnl|my_center|LOCUS_12410 10532 9900 gene locus_tag LOCUS_12420 10532 9900 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_12420 11101 10532 gene locus_tag LOCUS_12430 11101 10532 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_12430 12037 11102 gene locus_tag LOCUS_12440 12037 11102 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_12440 13368 12046 gene locus_tag LOCUS_12450 gene rsxC 13368 12046 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_12450 13716 14438 gene locus_tag LOCUS_12460 13716 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 14468 15721 gene locus_tag LOCUS_12470 14468 15721 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870010.1 protein_id gnl|my_center|LOCUS_12470 15816 15972 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16686 17051 gene locus_tag LOCUS_12480 16686 17051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 18724 17135 gene locus_tag LOCUS_12490 18724 17135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 19920 20462 gene locus_tag LOCUS_12500 19920 20462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 20589 22553 gene locus_tag LOCUS_12510 20589 22553 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_12510 23005 23313 gene locus_tag LOCUS_12520 23005 23313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 23376 23612 gene locus_tag LOCUS_12530 23376 23612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 23609 23938 gene locus_tag LOCUS_12540 23609 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 23947 24276 gene locus_tag LOCUS_12550 23947 24276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 24671 24850 gene locus_tag LOCUS_12560 24671 24850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 25532 26347 gene locus_tag LOCUS_12570 25532 26347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 26438 26713 gene locus_tag LOCUS_12580 26438 26713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 26738 27304 gene locus_tag LOCUS_12590 26738 27304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 27401 27961 gene locus_tag LOCUS_12600 27401 27961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 28033 28329 gene locus_tag LOCUS_12610 28033 28329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 29231 28974 gene locus_tag LOCUS_12620 29231 28974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 30184 29318 gene locus_tag LOCUS_12630 30184 29318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 31773 32237 gene locus_tag LOCUS_12640 31773 32237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 32377 32820 gene locus_tag LOCUS_12650 32377 32820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 32998 33585 gene locus_tag LOCUS_12660 32998 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 33869 34090 gene locus_tag LOCUS_12670 33869 34090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence23 1469 921 gene locus_tag LOCUS_12680 1469 921 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243986.1 protein_id gnl|my_center|LOCUS_12680 2552 1560 gene locus_tag LOCUS_12690 2552 1560 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209639.1 protein_id gnl|my_center|LOCUS_12690 2705 2887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2920 3612 gene locus_tag LOCUS_12700 2920 3612 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524570.1 protein_id gnl|my_center|LOCUS_12700 3708 4403 gene locus_tag LOCUS_12710 3708 4403 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524570.1 protein_id gnl|my_center|LOCUS_12710 4455 5165 gene locus_tag LOCUS_12720 4455 5165 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524570.1 protein_id gnl|my_center|LOCUS_12720 6287 5190 gene locus_tag LOCUS_12730 6287 5190 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868952.1 protein_id gnl|my_center|LOCUS_12730 7555 6359 gene locus_tag LOCUS_12740 7555 6359 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_12740 8865 7663 gene locus_tag LOCUS_12750 8865 7663 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868916.1 protein_id gnl|my_center|LOCUS_12750 9277 8897 gene locus_tag LOCUS_12760 9277 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 10389 9298 gene locus_tag LOCUS_12770 10389 9298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868879.1 protein_id gnl|my_center|LOCUS_12770 11441 10386 gene locus_tag LOCUS_12780 11441 10386 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_12780 13044 11434 gene locus_tag LOCUS_12790 13044 11434 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_12790 13634 13434 gene locus_tag LOCUS_12800 13634 13434 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869140.1 protein_id gnl|my_center|LOCUS_12800 13814 14788 gene locus_tag LOCUS_12810 gene galE 13814 14788 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_12810 15392 14862 gene locus_tag LOCUS_12820 15392 14862 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_12820 17300 15501 gene locus_tag LOCUS_12830 gene ggt 17300 15501 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805086.1 protein_id gnl|my_center|LOCUS_12830 17849 17394 gene locus_tag LOCUS_12840 gene mscL 17849 17394 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_12840 18044 19726 gene locus_tag LOCUS_12850 18044 19726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 19737 20711 gene locus_tag LOCUS_12860 19737 20711 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537721.1 protein_id gnl|my_center|LOCUS_12860 20711 21895 gene locus_tag LOCUS_12870 20711 21895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 21892 22671 gene locus_tag LOCUS_12880 21892 22671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 22668 23477 gene locus_tag LOCUS_12890 22668 23477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12890 24636 23449 gene locus_tag LOCUS_12900 24636 23449 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120046589.1 protein_id gnl|my_center|LOCUS_12900 25278 24685 gene locus_tag LOCUS_12910 25278 24685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 26143 25268 gene locus_tag LOCUS_12920 gene rfbD 26143 25268 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925241.1 protein_id gnl|my_center|LOCUS_12920 27036 26206 gene locus_tag LOCUS_12930 27036 26206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191802.1 protein_id gnl|my_center|LOCUS_12930 28182 27100 gene locus_tag LOCUS_12940 28182 27100 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202259.1 protein_id gnl|my_center|LOCUS_12940 29252 28209 gene locus_tag LOCUS_12950 29252 28209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529688.1 protein_id gnl|my_center|LOCUS_12950 29734 29249 gene locus_tag LOCUS_12960 29734 29249 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_12960 30564 29740 gene locus_tag LOCUS_12970 30564 29740 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707668.1 protein_id gnl|my_center|LOCUS_12970 <31926 30712 gene locus_tag LOCUS_12980 <31926 30712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942252.1:serine hydroxymethyltransferase >Feature sequence24 <1 1536 gene locus_tag LOCUS_12990 <1 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941947.1:PAS domain S-box protein 1499 2167 gene locus_tag LOCUS_13000 1499 2167 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_13000 2474 3022 gene locus_tag LOCUS_13010 2474 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3117 3602 gene locus_tag LOCUS_13020 3117 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3599 4432 gene locus_tag LOCUS_13030 3599 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4444 7293 gene locus_tag LOCUS_13040 4444 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 7295 7780 gene locus_tag LOCUS_13050 7295 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 7797 8000 gene locus_tag LOCUS_13060 7797 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 8115 8984 gene locus_tag LOCUS_13070 8115 8984 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_13070 8981 9781 gene locus_tag LOCUS_13080 8981 9781 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925252.1 protein_id gnl|my_center|LOCUS_13080 9774 10592 gene locus_tag LOCUS_13090 9774 10592 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938636.1 protein_id gnl|my_center|LOCUS_13090 13098 10555 gene locus_tag LOCUS_13100 gene mprF 13098 10555 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022655.1 protein_id gnl|my_center|LOCUS_13100 14417 13209 gene locus_tag LOCUS_13110 14417 13209 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016873.1 protein_id gnl|my_center|LOCUS_13110 15155 14466 gene locus_tag LOCUS_13120 15155 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681846.1 protein_id gnl|my_center|LOCUS_13120 15904 15173 gene locus_tag LOCUS_13130 15904 15173 CDS product DUF5058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669897.1 protein_id gnl|my_center|LOCUS_13130 17743 16127 gene locus_tag LOCUS_13140 17743 16127 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256402.1 protein_id gnl|my_center|LOCUS_13140 21482 17823 gene locus_tag LOCUS_13150 21482 17823 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870444.1 protein_id gnl|my_center|LOCUS_13150 22619 21774 gene locus_tag LOCUS_13160 22619 21774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 23311 22577 gene locus_tag LOCUS_13170 23311 22577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 23408 24097 gene locus_tag LOCUS_13180 gene rsmG 23408 24097 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868910.1 protein_id gnl|my_center|LOCUS_13180 24102 24878 gene locus_tag LOCUS_13190 24102 24878 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870446.1 protein_id gnl|my_center|LOCUS_13190 24851 25744 gene locus_tag LOCUS_13200 24851 25744 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870447.1 protein_id gnl|my_center|LOCUS_13200 25760 25984 gene locus_tag LOCUS_13210 25760 25984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 26028 26519 gene locus_tag LOCUS_13220 26028 26519 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_13220 26516 27154 gene locus_tag LOCUS_13230 26516 27154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 27257 27823 gene locus_tag LOCUS_13240 27257 27823 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_13240 29297 27942 gene locus_tag LOCUS_13250 29297 27942 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943456.1 protein_id gnl|my_center|LOCUS_13250 29460 30323 gene locus_tag LOCUS_13260 29460 30323 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582643.1 protein_id gnl|my_center|LOCUS_13260 31258 30431 gene locus_tag LOCUS_13270 31258 30431 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869010.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence25 2099 1224 gene locus_tag LOCUS_13280 gene sdaAA 2099 1224 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869020.1 protein_id gnl|my_center|LOCUS_13280 2782 2096 gene locus_tag LOCUS_13290 gene sdaAB 2782 2096 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869019.1 protein_id gnl|my_center|LOCUS_13290 3363 2773 gene locus_tag LOCUS_13300 3363 2773 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870380.1 protein_id gnl|my_center|LOCUS_13300 3846 5207 gene locus_tag LOCUS_13310 3846 5207 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925116.1 protein_id gnl|my_center|LOCUS_13310 6524 5337 gene locus_tag LOCUS_13320 6524 5337 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_13320 7753 6611 gene locus_tag LOCUS_13330 7753 6611 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 protein_id gnl|my_center|LOCUS_13330 8978 7773 gene locus_tag LOCUS_13340 gene thrC 8978 7773 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251155.1 protein_id gnl|my_center|LOCUS_13340 9172 9957 gene locus_tag LOCUS_13350 9172 9957 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925341.1 protein_id gnl|my_center|LOCUS_13350 9958 11517 gene locus_tag LOCUS_13360 9958 11517 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_13360 12448 11573 gene locus_tag LOCUS_13370 12448 11573 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258724.1 protein_id gnl|my_center|LOCUS_13370 12648 13442 gene locus_tag LOCUS_13380 12648 13442 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_13380 13442 14044 gene locus_tag LOCUS_13390 gene cbiM 13442 14044 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_13390 14041 14646 gene locus_tag LOCUS_13400 14041 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 14636 15358 gene locus_tag LOCUS_13410 gene cbiQ 14636 15358 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626426.1 protein_id gnl|my_center|LOCUS_13410 15355 16011 gene locus_tag LOCUS_13420 15355 16011 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546570.1 protein_id gnl|my_center|LOCUS_13420 16069 16449 gene locus_tag LOCUS_13430 16069 16449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 16409 16651 gene locus_tag LOCUS_13440 16409 16651 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_13440 16743 17906 gene locus_tag LOCUS_13450 16743 17906 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870216.1 protein_id gnl|my_center|LOCUS_13450 17940 20060 gene locus_tag LOCUS_13460 17940 20060 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393690.1 protein_id gnl|my_center|LOCUS_13460 20098 20349 gene locus_tag LOCUS_13470 20098 20349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 21031 20408 gene locus_tag LOCUS_13480 21031 20408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 22196 21051 gene locus_tag LOCUS_13490 22196 21051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 22789 22247 gene locus_tag LOCUS_13500 22789 22247 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_13500 22795 22992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23489 23620 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24543 24693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24702 25244 gene locus_tag LOCUS_13510 24702 25244 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392977.1 protein_id gnl|my_center|LOCUS_13510 25481 25248 gene locus_tag LOCUS_13520 25481 25248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 25551 25715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27259 26189 gene locus_tag LOCUS_13530 27259 26189 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020989.1 protein_id gnl|my_center|LOCUS_13530 28399 27272 gene locus_tag LOCUS_13540 28399 27272 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020990.1 protein_id gnl|my_center|LOCUS_13540 29602 28493 gene locus_tag LOCUS_13550 29602 28493 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_13550 29695 29804 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence26 87 162 gene locus_tag LOCUS_t00170 87 162 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 676 482 gene locus_tag LOCUS_13560 676 482 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_13560 1644 712 gene locus_tag LOCUS_13570 1644 712 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107009.1 protein_id gnl|my_center|LOCUS_13570 1883 2102 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3678 2404 gene locus_tag LOCUS_13580 3678 2404 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296334.1 protein_id gnl|my_center|LOCUS_13580 4032 3727 gene locus_tag LOCUS_13590 4032 3727 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393974.1 protein_id gnl|my_center|LOCUS_13590 5311 4064 gene locus_tag LOCUS_13600 5311 4064 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_13600 5462 6715 gene locus_tag LOCUS_13610 5462 6715 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868912.1 protein_id gnl|my_center|LOCUS_13610 6733 8838 gene locus_tag LOCUS_13620 6733 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 8860 9741 gene locus_tag LOCUS_13630 8860 9741 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942950.1 protein_id gnl|my_center|LOCUS_13630 9769 10221 gene locus_tag LOCUS_13640 9769 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 11228 10275 gene locus_tag LOCUS_13650 gene mutY 11228 10275 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629788.1 protein_id gnl|my_center|LOCUS_13650 12088 11354 gene locus_tag LOCUS_13660 12088 11354 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393691.1 protein_id gnl|my_center|LOCUS_13660 12185 12868 gene locus_tag LOCUS_13670 12185 12868 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_13670 14772 12907 gene locus_tag LOCUS_13680 14772 12907 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870254.1 protein_id gnl|my_center|LOCUS_13680 15146 16303 gene locus_tag LOCUS_13690 15146 16303 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_13690 16300 17301 gene locus_tag LOCUS_13700 16300 17301 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_13700 17303 18352 gene locus_tag LOCUS_13710 17303 18352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256222.1 protein_id gnl|my_center|LOCUS_13710 19182 18349 gene locus_tag LOCUS_13720 19182 18349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 19573 19184 gene locus_tag LOCUS_13730 19573 19184 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870252.1 protein_id gnl|my_center|LOCUS_13730 20173 19577 gene locus_tag LOCUS_13740 20173 19577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 20472 22058 gene locus_tag LOCUS_13750 20472 22058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 21370 21379 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22109 22331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24339 23140 gene locus_tag LOCUS_13760 24339 23140 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022687.1 protein_id gnl|my_center|LOCUS_13760 24124 24044 gene locus_tag LOCUS_t00180 24124 24044 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 24957 25197 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25794 25981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26787 26963 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27178 27368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27728 27902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29263 28463 gene locus_tag LOCUS_13770 29263 28463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 29330 29606 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence27 662 1399 gene locus_tag LOCUS_13780 662 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1889 2069 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2126 2530 gene locus_tag LOCUS_13790 2126 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2604 3434 gene locus_tag LOCUS_13800 2604 3434 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_13800 3876 3801 gene locus_tag LOCUS_t00190 3876 3801 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3968 3893 gene locus_tag LOCUS_t00200 3968 3893 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4048 3973 gene locus_tag LOCUS_t00210 4048 3973 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4864 4133 gene locus_tag LOCUS_13810 4864 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4908 5196 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6745 6329 gene locus_tag LOCUS_13820 6745 6329 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870043.1 protein_id gnl|my_center|LOCUS_13820 8015 7455 gene locus_tag LOCUS_13830 8015 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870045.1 protein_id gnl|my_center|LOCUS_13830 8359 8051 gene locus_tag LOCUS_13840 8359 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 10002 8407 gene locus_tag LOCUS_13850 10002 8407 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870047.1 protein_id gnl|my_center|LOCUS_13850 10759 10016 gene locus_tag LOCUS_13860 10759 10016 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870048.1 protein_id gnl|my_center|LOCUS_13860 11894 10779 gene locus_tag LOCUS_13870 11894 10779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870049.1 protein_id gnl|my_center|LOCUS_13870 12404 11910 gene locus_tag LOCUS_13880 12404 11910 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870050.1 protein_id gnl|my_center|LOCUS_13880 13037 12408 gene locus_tag LOCUS_13890 13037 12408 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870051.1 protein_id gnl|my_center|LOCUS_13890 15083 13059 gene locus_tag LOCUS_13900 15083 13059 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870052.1 protein_id gnl|my_center|LOCUS_13900 15881 15141 gene locus_tag LOCUS_13910 15881 15141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 15926 16156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17059 16391 gene locus_tag LOCUS_13920 17059 16391 CDS product flagellar brake domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925431.1 protein_id gnl|my_center|LOCUS_13920 17983 17063 gene locus_tag LOCUS_13930 17983 17063 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870055.1 protein_id gnl|my_center|LOCUS_13930 19250 17976 gene locus_tag LOCUS_13940 gene flhF 19250 17976 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870056.1 protein_id gnl|my_center|LOCUS_13940 21377 19251 gene locus_tag LOCUS_13950 gene flhA 21377 19251 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870057.1 protein_id gnl|my_center|LOCUS_13950 22510 21404 gene locus_tag LOCUS_13960 gene flhB 22510 21404 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870058.1 protein_id gnl|my_center|LOCUS_13960 23283 22489 gene locus_tag LOCUS_13970 gene fliR 23283 22489 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870059.1 protein_id gnl|my_center|LOCUS_13970 23549 23280 gene locus_tag LOCUS_13980 gene fliQ 23549 23280 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870060.1 protein_id gnl|my_center|LOCUS_13980 24351 23569 gene locus_tag LOCUS_13990 gene fliP 24351 23569 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925195.1 protein_id gnl|my_center|LOCUS_13990 24718 24329 gene locus_tag LOCUS_14000 24718 24329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 25118 24756 gene locus_tag LOCUS_14010 25118 24756 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_14010 26287 25154 gene locus_tag LOCUS_14020 gene fliN 26287 25154 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870064.1 protein_id gnl|my_center|LOCUS_14020 27302 26277 gene locus_tag LOCUS_14030 gene fliM 27302 26277 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870065.1 protein_id gnl|my_center|LOCUS_14030 27796 27341 gene locus_tag LOCUS_14040 27796 27341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 28544 27828 gene locus_tag LOCUS_14050 28544 27828 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870067.1 protein_id gnl|my_center|LOCUS_14050 29341 28547 gene locus_tag LOCUS_14060 29341 28547 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_14060 29611 29384 gene locus_tag LOCUS_14070 29611 29384 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870069.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence28 <1 2130 gene locus_tag LOCUS_14080 <1 2130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086596.1:HAD-IC family P-type ATPase 3300 2170 gene locus_tag LOCUS_14090 3300 2170 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869322.1 protein_id gnl|my_center|LOCUS_14090 3666 5030 gene locus_tag LOCUS_14100 3666 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 5121 5588 gene locus_tag LOCUS_14110 5121 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 8234 5598 gene locus_tag LOCUS_14120 8234 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 10402 8207 gene locus_tag LOCUS_14130 10402 8207 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_14130 10511 11125 gene locus_tag LOCUS_14140 10511 11125 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869081.1 protein_id gnl|my_center|LOCUS_14140 11303 11563 gene locus_tag LOCUS_14150 11303 11563 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869331.1 protein_id gnl|my_center|LOCUS_14150 11769 13037 gene locus_tag LOCUS_14160 gene hisS 11769 13037 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869333.1 protein_id gnl|my_center|LOCUS_14160 13071 14885 gene locus_tag LOCUS_14170 gene aspS 13071 14885 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869334.1 protein_id gnl|my_center|LOCUS_14170 15001 15699 gene locus_tag LOCUS_14180 15001 15699 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_14180 16562 15696 gene locus_tag LOCUS_14190 16562 15696 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869336.1 protein_id gnl|my_center|LOCUS_14190 17612 16662 gene locus_tag LOCUS_14200 17612 16662 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_14200 17991 17623 gene locus_tag LOCUS_14210 17991 17623 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869346.1 protein_id gnl|my_center|LOCUS_14210 18185 19063 gene locus_tag LOCUS_14220 18185 19063 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545377.1 protein_id gnl|my_center|LOCUS_14220 19082 19564 gene locus_tag LOCUS_14230 19082 19564 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869348.1 protein_id gnl|my_center|LOCUS_14230 20033 19608 gene locus_tag LOCUS_14240 20033 19608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 20216 20893 gene locus_tag LOCUS_14250 20216 20893 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_14250 21924 20935 gene locus_tag LOCUS_14260 21924 20935 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869349.1 protein_id gnl|my_center|LOCUS_14260 22686 22024 gene locus_tag LOCUS_14270 22686 22024 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869350.1 protein_id gnl|my_center|LOCUS_14270 22991 23140 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23995 24138 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24152 24838 gene locus_tag LOCUS_14280 24152 24838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 24894 25169 gene locus_tag LOCUS_14290 gene rpsP 24894 25169 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870158.1 protein_id gnl|my_center|LOCUS_14290 25169 25417 gene locus_tag LOCUS_14300 25169 25417 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870157.1 protein_id gnl|my_center|LOCUS_14300 25423 25959 gene locus_tag LOCUS_14310 gene rimM 25423 25959 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870156.1 protein_id gnl|my_center|LOCUS_14310 25959 27215 gene locus_tag LOCUS_14320 gene trmD 25959 27215 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938137.1 protein_id gnl|my_center|LOCUS_14320 27248 27595 gene locus_tag LOCUS_14330 gene rplS 27248 27595 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870154.1 protein_id gnl|my_center|LOCUS_14330 27656 27742 gene locus_tag LOCUS_t00220 27656 27742 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28617 27829 gene locus_tag LOCUS_14340 28617 27829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869502.1 protein_id gnl|my_center|LOCUS_14340 <29580 28623 gene locus_tag LOCUS_14350 <29580 28623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869503.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase ApgM2 >Feature sequence29 <1 690 gene locus_tag LOCUS_14360 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869732.1:isoleucine--tRNA ligase 770 1753 gene locus_tag LOCUS_14370 770 1753 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925388.1 protein_id gnl|my_center|LOCUS_14370 3389 1686 gene locus_tag LOCUS_14380 gene efbA 3389 1686 CDS product fibronectin-binding protein EfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288890.1 protein_id gnl|my_center|LOCUS_14380 3528 3602 gene locus_tag LOCUS_t00230 3528 3602 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3622 3699 gene locus_tag LOCUS_t00240 3622 3699 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4612 4145 gene locus_tag LOCUS_14390 4612 4145 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948926.1 protein_id gnl|my_center|LOCUS_14390 4805 5134 gene locus_tag LOCUS_14400 4805 5134 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227791.1 protein_id gnl|my_center|LOCUS_14400 5269 6282 gene locus_tag LOCUS_14410 5269 6282 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892094.1 protein_id gnl|my_center|LOCUS_14410 6266 7939 gene locus_tag LOCUS_14420 6266 7939 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626058.1 protein_id gnl|my_center|LOCUS_14420 7943 9025 gene locus_tag LOCUS_14430 7943 9025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976267.1 protein_id gnl|my_center|LOCUS_14430 10988 9108 gene locus_tag LOCUS_14440 10988 9108 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870207.1 protein_id gnl|my_center|LOCUS_14440 12068 11082 gene locus_tag LOCUS_14450 12068 11082 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925213.1 protein_id gnl|my_center|LOCUS_14450 14197 12236 gene locus_tag LOCUS_14460 14197 12236 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869266.1 protein_id gnl|my_center|LOCUS_14460 14759 14208 gene locus_tag LOCUS_14470 14759 14208 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869265.1 protein_id gnl|my_center|LOCUS_14470 15048 15278 gene locus_tag LOCUS_14480 15048 15278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14480 15449 16645 gene locus_tag LOCUS_14490 15449 16645 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430586.1 protein_id gnl|my_center|LOCUS_14490 16908 17199 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17230 17306 gene locus_tag LOCUS_t00250 17230 17306 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 17325 17401 gene locus_tag LOCUS_t00260 17325 17401 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17413 17488 gene locus_tag LOCUS_t00270 17413 17488 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18686 17535 gene locus_tag LOCUS_14500 18686 17535 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545564.1 protein_id gnl|my_center|LOCUS_14500 20304 18718 gene locus_tag LOCUS_14510 20304 18718 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799194.1 protein_id gnl|my_center|LOCUS_14510 20450 20525 gene locus_tag LOCUS_t00280 20450 20525 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 20547 20631 gene locus_tag LOCUS_t00290 20547 20631 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20701 21807 gene locus_tag LOCUS_14520 20701 21807 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204617516.1 protein_id gnl|my_center|LOCUS_14520 21890 23221 gene locus_tag LOCUS_14530 gene ssnA 21890 23221 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047946.1 protein_id gnl|my_center|LOCUS_14530 23209 23448 gene locus_tag LOCUS_14540 23209 23448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 23531 23734 gene locus_tag LOCUS_14550 23531 23734 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925387.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence30 2951 3172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3191 4528 gene locus_tag LOCUS_14560 3191 4528 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_14560 4551 5021 gene locus_tag LOCUS_14570 4551 5021 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948763.1 protein_id gnl|my_center|LOCUS_14570 5159 6664 gene locus_tag LOCUS_14580 gene mdoG 5159 6664 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 protein_id gnl|my_center|LOCUS_14580 6683 7045 gene locus_tag LOCUS_14590 6683 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 7065 9164 gene locus_tag LOCUS_14600 gene mdoH 7065 9164 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103448.1 protein_id gnl|my_center|LOCUS_14600 9203 9964 gene locus_tag LOCUS_14610 gene nudC 9203 9964 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_14610 11139 9961 gene locus_tag LOCUS_14620 11139 9961 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925184.1 protein_id gnl|my_center|LOCUS_14620 11334 11852 gene locus_tag LOCUS_14630 gene tpx 11334 11852 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_14630 12367 11963 gene locus_tag LOCUS_14640 12367 11963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 12673 12380 gene locus_tag LOCUS_14650 12673 12380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 13278 12847 gene locus_tag LOCUS_14660 13278 12847 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_14660 13398 14075 gene locus_tag LOCUS_14670 gene deoC 13398 14075 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458726.1 protein_id gnl|my_center|LOCUS_14670 15027 14101 gene locus_tag LOCUS_14680 15027 14101 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_14680 16283 15126 gene locus_tag LOCUS_14690 16283 15126 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815362.1 protein_id gnl|my_center|LOCUS_14690 17072 16323 gene locus_tag LOCUS_14700 17072 16323 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460928.1 protein_id gnl|my_center|LOCUS_14700 18334 17267 gene locus_tag LOCUS_14710 gene buk 18334 17267 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115781.1 protein_id gnl|my_center|LOCUS_14710 19344 18412 gene locus_tag LOCUS_14720 gene ptb 19344 18412 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869205.1 protein_id gnl|my_center|LOCUS_14720 19514 19660 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21555 20461 gene locus_tag LOCUS_14730 gene buk 21555 20461 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_14730 24159 21610 gene locus_tag LOCUS_14740 24159 21610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence31 <1 615 gene locus_tag LOCUS_14750 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869038.1:methyl-accepting chemotaxis protein 1657 1880 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2240 2989 gene locus_tag LOCUS_14760 gene pxpB 2240 2989 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869461.1 protein_id gnl|my_center|LOCUS_14760 2986 4068 gene locus_tag LOCUS_14770 2986 4068 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869460.1 protein_id gnl|my_center|LOCUS_14770 4084 4854 gene locus_tag LOCUS_14780 4084 4854 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869459.1 protein_id gnl|my_center|LOCUS_14780 4854 5651 gene locus_tag LOCUS_14790 4854 5651 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925131.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14790 6454 5648 gene locus_tag LOCUS_14800 6454 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217519.1 protein_id gnl|my_center|LOCUS_14800 7415 7645 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7688 8758 gene locus_tag LOCUS_14810 7688 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 8895 9779 gene locus_tag LOCUS_14820 8895 9779 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939824.1 protein_id gnl|my_center|LOCUS_14820 9814 11205 gene locus_tag LOCUS_14830 gene pepV 9814 11205 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966010.1 protein_id gnl|my_center|LOCUS_14830 11224 11445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11504 12850 gene locus_tag LOCUS_14840 11504 12850 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869104.1 protein_id gnl|my_center|LOCUS_14840 13308 12913 gene locus_tag LOCUS_14850 13308 12913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 13593 13429 gene locus_tag LOCUS_14860 13593 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 13930 13667 gene locus_tag LOCUS_14870 13930 13667 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869433.1 protein_id gnl|my_center|LOCUS_14870 14334 15515 gene locus_tag LOCUS_14880 14334 15515 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861089.1 protein_id gnl|my_center|LOCUS_14880 15531 16730 gene locus_tag LOCUS_14890 15531 16730 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870172.1 protein_id gnl|my_center|LOCUS_14890 16810 17940 gene locus_tag LOCUS_14900 16810 17940 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173644.1 protein_id gnl|my_center|LOCUS_14900 19288 18038 gene locus_tag LOCUS_14910 gene larC 19288 18038 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_14910 20132 19314 gene locus_tag LOCUS_14920 gene larE 20132 19314 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_14920 21598 20414 gene locus_tag LOCUS_14930 21598 20414 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_14930 21781 22049 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence32 499 1296 gene locus_tag LOCUS_14940 499 1296 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_14940 1338 3443 gene locus_tag LOCUS_14950 1338 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3562 4656 gene locus_tag LOCUS_14960 3562 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 4897 6945 gene locus_tag LOCUS_14970 4897 6945 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925439.1 protein_id gnl|my_center|LOCUS_14970 6950 7582 gene locus_tag LOCUS_14980 gene plsY 6950 7582 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870148.1 protein_id gnl|my_center|LOCUS_14980 7651 8133 gene locus_tag LOCUS_14990 7651 8133 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870147.1 protein_id gnl|my_center|LOCUS_14990 8196 10679 gene locus_tag LOCUS_15000 8196 10679 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870144.1 protein_id gnl|my_center|LOCUS_15000 10810 11658 gene locus_tag LOCUS_15010 10810 11658 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280504.1 protein_id gnl|my_center|LOCUS_15010 11673 12527 gene locus_tag LOCUS_15020 11673 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 12548 12988 gene locus_tag LOCUS_15030 12548 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 13000 13890 gene locus_tag LOCUS_15040 13000 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 15535 13859 gene locus_tag LOCUS_15050 15535 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 15914 16516 gene locus_tag LOCUS_15060 15914 16516 CDS product DUF4412 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870219.1 protein_id gnl|my_center|LOCUS_15060 16606 16779 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17015 17428 gene locus_tag LOCUS_15070 gene speD 17015 17428 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868894.1 protein_id gnl|my_center|LOCUS_15070 17600 17525 gene locus_tag LOCUS_t00300 17600 17525 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17681 17608 gene locus_tag LOCUS_t00310 17681 17608 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 18199 19539 gene locus_tag LOCUS_15080 18199 19539 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_15080 19698 20954 gene locus_tag LOCUS_15090 19698 20954 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868973.1 protein_id gnl|my_center|LOCUS_15090 21066 22115 gene locus_tag LOCUS_15100 gene thrC 21066 22115 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869983.1 protein_id gnl|my_center|LOCUS_15100 22323 22654 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence33 1051 62 gene locus_tag LOCUS_15110 1051 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1889 1125 gene locus_tag LOCUS_15120 1889 1125 CDS product Sir2 family NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869115.1 protein_id gnl|my_center|LOCUS_15120 2007 3377 gene locus_tag LOCUS_15130 2007 3377 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869171.1 protein_id gnl|my_center|LOCUS_15130 3708 4988 gene locus_tag LOCUS_15140 3708 4988 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 protein_id gnl|my_center|LOCUS_15140 4998 7043 gene locus_tag LOCUS_15150 4998 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 6860 7009 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7040 8179 gene locus_tag LOCUS_15160 7040 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 8363 8728 gene locus_tag LOCUS_15170 8363 8728 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_15170 8731 9237 gene locus_tag LOCUS_15180 8731 9237 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_15180 9321 9848 gene locus_tag LOCUS_15190 9321 9848 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870309.1 protein_id gnl|my_center|LOCUS_15190 9897 11111 gene locus_tag LOCUS_15200 9897 11111 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_15200 11161 11943 gene locus_tag LOCUS_15210 11161 11943 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_15210 11993 12162 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13604 13140 gene locus_tag LOCUS_15220 13604 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 13763 14099 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14710 15219 gene locus_tag LOCUS_15230 14710 15219 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870300.1 protein_id gnl|my_center|LOCUS_15230 15268 15849 gene locus_tag LOCUS_15240 15268 15849 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870299.1 protein_id gnl|my_center|LOCUS_15240 15948 16583 gene locus_tag LOCUS_15250 15948 16583 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870298.1 protein_id gnl|my_center|LOCUS_15250 16580 17986 gene locus_tag LOCUS_15260 16580 17986 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870297.1 protein_id gnl|my_center|LOCUS_15260 17988 19604 gene locus_tag LOCUS_15270 17988 19604 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870296.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence34 413 114 gene locus_tag LOCUS_15280 413 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3523 419 gene locus_tag LOCUS_15290 3523 419 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_15290 4611 3520 gene locus_tag LOCUS_15300 4611 3520 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_15300 5961 4630 gene locus_tag LOCUS_15310 5961 4630 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870255.1 protein_id gnl|my_center|LOCUS_15310 6562 5951 gene locus_tag LOCUS_15320 6562 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 8030 6675 gene locus_tag LOCUS_15330 gene mgtE 8030 6675 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080209.1 protein_id gnl|my_center|LOCUS_15330 8706 8311 gene locus_tag LOCUS_15340 gene rpsI 8706 8311 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280533.1 protein_id gnl|my_center|LOCUS_15340 9168 8737 gene locus_tag LOCUS_15350 gene rplM 9168 8737 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870258.1 protein_id gnl|my_center|LOCUS_15350 10382 9339 gene locus_tag LOCUS_15360 10382 9339 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393336.1 protein_id gnl|my_center|LOCUS_15360 10625 10395 gene locus_tag LOCUS_15370 gene secG 10625 10395 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925228.1 protein_id gnl|my_center|LOCUS_15370 11271 10678 gene locus_tag LOCUS_15380 11271 10678 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925229.1 protein_id gnl|my_center|LOCUS_15380 12016 11231 gene locus_tag LOCUS_15390 gene rph 12016 11231 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870262.1 protein_id gnl|my_center|LOCUS_15390 12753 12040 gene locus_tag LOCUS_15400 12753 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 14389 12794 gene locus_tag LOCUS_15410 14389 12794 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925231.1 protein_id gnl|my_center|LOCUS_15410 15836 14478 gene locus_tag LOCUS_15420 15836 14478 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_15420 16873 15836 gene locus_tag LOCUS_15430 16873 15836 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870265.1 protein_id gnl|my_center|LOCUS_15430 17780 16953 gene locus_tag LOCUS_15440 17780 16953 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870266.1 protein_id gnl|my_center|LOCUS_15440 18306 17788 gene locus_tag LOCUS_15450 18306 17788 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870267.1 protein_id gnl|my_center|LOCUS_15450 18844 18326 gene locus_tag LOCUS_15460 gene yfcE 18844 18326 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870269.1 protein_id gnl|my_center|LOCUS_15460 <19696 18852 gene locus_tag LOCUS_15470 <19696 18852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869258.1:homoserine dehydrogenase >Feature sequence35 646 559 gene locus_tag LOCUS_t00320 646 559 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 744 1232 gene locus_tag LOCUS_15480 744 1232 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869359.1 protein_id gnl|my_center|LOCUS_15480 1377 1802 gene locus_tag LOCUS_15490 1377 1802 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925121.1 protein_id gnl|my_center|LOCUS_15490 1853 3703 gene locus_tag LOCUS_15500 1853 3703 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942696.1 protein_id gnl|my_center|LOCUS_15500 3708 4262 gene locus_tag LOCUS_15510 3708 4262 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_15510 4345 4773 gene locus_tag LOCUS_15520 4345 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 4886 5425 gene locus_tag LOCUS_15530 gene lepB 4886 5425 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870097.1 protein_id gnl|my_center|LOCUS_15530 5428 6264 gene locus_tag LOCUS_15540 5428 6264 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870096.1 protein_id gnl|my_center|LOCUS_15540 6249 6830 gene locus_tag LOCUS_15550 6249 6830 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870095.1 protein_id gnl|my_center|LOCUS_15550 6831 7889 gene locus_tag LOCUS_15560 6831 7889 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870094.1 protein_id gnl|my_center|LOCUS_15560 7886 8158 gene locus_tag LOCUS_15570 7886 8158 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870093.1 protein_id gnl|my_center|LOCUS_15570 8162 8527 gene locus_tag LOCUS_15580 8162 8527 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870092.1 protein_id gnl|my_center|LOCUS_15580 8524 10026 gene locus_tag LOCUS_15590 8524 10026 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925199.1 protein_id gnl|my_center|LOCUS_15590 10020 11123 gene locus_tag LOCUS_15600 gene dprA 10020 11123 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870090.1 protein_id gnl|my_center|LOCUS_15600 11145 11417 gene locus_tag LOCUS_15610 11145 11417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 11430 13553 gene locus_tag LOCUS_15620 gene topA 11430 13553 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925198.1 protein_id gnl|my_center|LOCUS_15620 13557 14873 gene locus_tag LOCUS_15630 gene trmFO 13557 14873 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870087.1 protein_id gnl|my_center|LOCUS_15630 15068 15958 gene locus_tag LOCUS_15640 15068 15958 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870086.1 protein_id gnl|my_center|LOCUS_15640 15951 16493 gene locus_tag LOCUS_15650 gene hslV 15951 16493 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925434.1 protein_id gnl|my_center|LOCUS_15650 16490 17905 gene locus_tag LOCUS_15660 gene hslU 16490 17905 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870084.1 protein_id gnl|my_center|LOCUS_15660 17927 18769 gene locus_tag LOCUS_15670 gene codY 17927 18769 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870083.1 protein_id gnl|my_center|LOCUS_15670 18789 18914 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence36 54 635 gene locus_tag LOCUS_15680 gene clpP 54 635 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_15680 737 2023 gene locus_tag LOCUS_15690 gene clpX 737 2023 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869700.1 protein_id gnl|my_center|LOCUS_15690 2027 4366 gene locus_tag LOCUS_15700 gene lon 2027 4366 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869699.1 protein_id gnl|my_center|LOCUS_15700 4373 4966 gene locus_tag LOCUS_15710 gene yihA 4373 4966 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869698.1 protein_id gnl|my_center|LOCUS_15710 5082 5222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5317 7851 gene locus_tag LOCUS_15720 5317 7851 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869697.1 protein_id gnl|my_center|LOCUS_15720 7857 9218 gene locus_tag LOCUS_15730 7857 9218 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869696.1 protein_id gnl|my_center|LOCUS_15730 9202 9966 gene locus_tag LOCUS_15740 9202 9966 CDS product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869695.1 protein_id gnl|my_center|LOCUS_15740 10058 11029 gene locus_tag LOCUS_15750 10058 11029 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925382.1 protein_id gnl|my_center|LOCUS_15750 11240 11358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11377 11538 gene locus_tag LOCUS_15760 11377 11538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 11543 13384 gene locus_tag LOCUS_15770 11543 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 13433 15115 gene locus_tag LOCUS_15780 13433 15115 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_15780 15131 15550 gene locus_tag LOCUS_15790 15131 15550 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869042.1 protein_id gnl|my_center|LOCUS_15790 15553 16521 gene locus_tag LOCUS_15800 gene meaB 15553 16521 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869690.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence37 457 2814 gene locus_tag LOCUS_15810 457 2814 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869422.1 protein_id gnl|my_center|LOCUS_15810 2894 3250 gene locus_tag LOCUS_15820 2894 3250 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869423.1 protein_id gnl|my_center|LOCUS_15820 3372 4388 gene locus_tag LOCUS_15830 3372 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 4419 5456 gene locus_tag LOCUS_15840 gene siaC 4419 5456 CDS product polysialic acid capsule biosynthesis protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215299.1 protein_id gnl|my_center|LOCUS_15840 5456 6622 gene locus_tag LOCUS_15850 gene neuC 5456 6622 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963387.1 protein_id gnl|my_center|LOCUS_15850 6619 7302 gene locus_tag LOCUS_15860 6619 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 7424 7867 gene locus_tag LOCUS_15870 7424 7867 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869434.1 protein_id gnl|my_center|LOCUS_15870 7976 8788 gene locus_tag LOCUS_15880 7976 8788 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 protein_id gnl|my_center|LOCUS_15880 8842 9339 gene locus_tag LOCUS_15890 8842 9339 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869439.1 protein_id gnl|my_center|LOCUS_15890 9349 10548 gene locus_tag LOCUS_15900 9349 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869441.1 protein_id gnl|my_center|LOCUS_15900 10573 10938 gene locus_tag LOCUS_15910 10573 10938 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_15910 10942 11376 gene locus_tag LOCUS_15920 10942 11376 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869443.1 protein_id gnl|my_center|LOCUS_15920 11395 12693 gene locus_tag LOCUS_15930 11395 12693 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869444.1 protein_id gnl|my_center|LOCUS_15930 12707 13048 gene locus_tag LOCUS_15940 12707 13048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869445.1 protein_id gnl|my_center|LOCUS_15940 13056 13811 gene locus_tag LOCUS_15950 13056 13811 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869446.1 protein_id gnl|my_center|LOCUS_15950 13963 13808 gene locus_tag LOCUS_15960 13963 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 14153 14329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence38 1279 176 gene locus_tag LOCUS_15970 1279 176 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_15970 2673 1525 gene locus_tag LOCUS_15980 2673 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_15980 2782 2948 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3466 2966 gene locus_tag LOCUS_15990 3466 2966 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545398.1 protein_id gnl|my_center|LOCUS_15990 4329 3526 gene locus_tag LOCUS_16000 4329 3526 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080898.1 protein_id gnl|my_center|LOCUS_16000 4719 4363 gene locus_tag LOCUS_16010 4719 4363 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080895.1 protein_id gnl|my_center|LOCUS_16010 5273 4782 gene locus_tag LOCUS_16020 5273 4782 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_16020 5506 6078 gene locus_tag LOCUS_16030 5506 6078 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_16030 6195 8057 gene locus_tag LOCUS_16040 gene pepF 6195 8057 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868855.1 protein_id gnl|my_center|LOCUS_16040 9620 8274 gene locus_tag LOCUS_16050 9620 8274 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893189.1 protein_id gnl|my_center|LOCUS_16050 11177 10248 gene locus_tag LOCUS_16060 11177 10248 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943159.1 protein_id gnl|my_center|LOCUS_16060 11462 12652 gene locus_tag LOCUS_16070 11462 12652 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392231.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence39 481 1437 gene locus_tag LOCUS_16080 gene arcC 481 1437 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_16080 1809 2810 gene locus_tag LOCUS_16090 1809 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 4526 2781 gene locus_tag LOCUS_16100 4526 2781 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_16100 4747 4523 gene locus_tag LOCUS_16110 4747 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 5828 4785 gene locus_tag LOCUS_16120 5828 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 6410 6084 gene locus_tag LOCUS_16130 6410 6084 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925118.1 protein_id gnl|my_center|LOCUS_16130 6534 7346 gene locus_tag LOCUS_16140 6534 7346 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_16140 7408 7962 gene locus_tag LOCUS_16150 7408 7962 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_16150 8053 9030 gene locus_tag LOCUS_16160 8053 9030 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925257.1 protein_id gnl|my_center|LOCUS_16160 9014 9466 gene locus_tag LOCUS_16170 9014 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 9459 10556 gene locus_tag LOCUS_16180 9459 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 10553 11182 gene locus_tag LOCUS_16190 10553 11182 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868896.1 protein_id gnl|my_center|LOCUS_16190 11188 12204 gene locus_tag LOCUS_16200 11188 12204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 12074 12174 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence40 1007 1207 gene locus_tag LOCUS_16210 1007 1207 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129735.1 protein_id gnl|my_center|LOCUS_16210 2994 1303 gene locus_tag LOCUS_16220 2994 1303 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869260.1 protein_id gnl|my_center|LOCUS_16220 3272 4333 gene locus_tag LOCUS_16230 3272 4333 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766159.1 protein_id gnl|my_center|LOCUS_16230 4333 7416 gene locus_tag LOCUS_16240 4333 7416 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_16240 7486 8754 gene locus_tag LOCUS_16250 7486 8754 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658539.1 protein_id gnl|my_center|LOCUS_16250 8751 9446 gene locus_tag LOCUS_16260 8751 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 9476 10369 gene locus_tag LOCUS_16270 9476 10369 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_16270 11556 10351 gene locus_tag LOCUS_16280 11556 10351 CDS product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898638.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence41 2904 3395 gene locus_tag LOCUS_16290 gene tsaA 2904 3395 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_16290 3421 3801 gene locus_tag LOCUS_16300 3421 3801 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942875.1 protein_id gnl|my_center|LOCUS_16300 3874 5265 gene locus_tag LOCUS_16310 gene fumC 3874 5265 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456610.1 protein_id gnl|my_center|LOCUS_16310 5355 6686 gene locus_tag LOCUS_16320 5355 6686 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869254.1 protein_id gnl|my_center|LOCUS_16320 6673 7257 gene locus_tag LOCUS_16330 6673 7257 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869954.1 protein_id gnl|my_center|LOCUS_16330 8507 7326 gene locus_tag LOCUS_16340 8507 7326 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_16340 8729 11323 gene locus_tag LOCUS_16350 8729 11323 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082700.1 protein_id gnl|my_center|LOCUS_16350 11859 11512 gene locus_tag LOCUS_16360 11859 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence42 294 571 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 866 1966 gene locus_tag LOCUS_16370 gene upp 866 1966 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925381.1 protein_id gnl|my_center|LOCUS_16370 2030 2875 gene locus_tag LOCUS_16380 2030 2875 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869688.1 protein_id gnl|my_center|LOCUS_16380 2893 4020 gene locus_tag LOCUS_16390 gene wecB 2893 4020 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869687.1 protein_id gnl|my_center|LOCUS_16390 4108 5415 gene locus_tag LOCUS_16400 gene murA 4108 5415 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869686.1 protein_id gnl|my_center|LOCUS_16400 5527 6375 gene locus_tag LOCUS_16410 5527 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869684.1 protein_id gnl|my_center|LOCUS_16410 6372 7028 gene locus_tag LOCUS_16420 6372 7028 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925379.1 protein_id gnl|my_center|LOCUS_16420 7021 7737 gene locus_tag LOCUS_16430 gene uppS 7021 7737 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925378.1 protein_id gnl|my_center|LOCUS_16430 7718 8542 gene locus_tag LOCUS_16440 7718 8542 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869681.1 protein_id gnl|my_center|LOCUS_16440 8539 9699 gene locus_tag LOCUS_16450 8539 9699 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925156.1 protein_id gnl|my_center|LOCUS_16450 9714 10748 gene locus_tag LOCUS_16460 9714 10748 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869679.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence43 121 491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 770 540 gene locus_tag LOCUS_16470 770 540 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870069.1 protein_id gnl|my_center|LOCUS_16470 1526 783 gene locus_tag LOCUS_16480 1526 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1542 1783 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3472 2993 gene locus_tag LOCUS_16490 gene flgD 3472 2993 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870071.1 protein_id gnl|my_center|LOCUS_16490 4586 3486 gene locus_tag LOCUS_16500 4586 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 4679 4897 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5723 5046 gene locus_tag LOCUS_16510 5723 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870073.1 protein_id gnl|my_center|LOCUS_16510 6314 5727 gene locus_tag LOCUS_16520 6314 5727 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870074.1 protein_id gnl|my_center|LOCUS_16520 6768 6319 gene locus_tag LOCUS_16530 6768 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 8147 6804 gene locus_tag LOCUS_16540 gene fliI 8147 6804 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_16540 9018 8128 gene locus_tag LOCUS_16550 9018 8128 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870077.1 protein_id gnl|my_center|LOCUS_16550 10030 9011 gene locus_tag LOCUS_16560 gene fliG 10030 9011 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870078.1 protein_id gnl|my_center|LOCUS_16560 <10581 10054 gene locus_tag LOCUS_16570 <10581 10054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870079.1:flagellar basal-body MS-ring/collar protein FliF >Feature sequence44 1676 573 gene locus_tag LOCUS_16580 gene lptG 1676 573 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_16580 2166 1669 gene locus_tag LOCUS_16590 2166 1669 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870031.1 protein_id gnl|my_center|LOCUS_16590 2962 2156 gene locus_tag LOCUS_16600 gene lpxA 2962 2156 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925190.1 protein_id gnl|my_center|LOCUS_16600 3419 2970 gene locus_tag LOCUS_16610 gene fabZ 3419 2970 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870033.1 protein_id gnl|my_center|LOCUS_16610 4274 3438 gene locus_tag LOCUS_16620 4274 3438 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870034.1 protein_id gnl|my_center|LOCUS_16620 5320 4271 gene locus_tag LOCUS_16630 gene lpxD 5320 4271 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925191.1 protein_id gnl|my_center|LOCUS_16630 6579 5335 gene locus_tag LOCUS_16640 6579 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870036.1 protein_id gnl|my_center|LOCUS_16640 8334 6598 gene locus_tag LOCUS_16650 8334 6598 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925192.1 protein_id gnl|my_center|LOCUS_16650 8999 8370 gene locus_tag LOCUS_16660 8999 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 9639 9049 gene locus_tag LOCUS_16670 9639 9049 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925428.1 protein_id gnl|my_center|LOCUS_16670 10372 9722 gene locus_tag LOCUS_16680 gene cobC 10372 9722 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence45 1093 1309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1374 2798 gene locus_tag LOCUS_16690 1374 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4238 4461 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4712 6658 gene locus_tag LOCUS_16700 4712 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 6651 7322 gene locus_tag LOCUS_16710 gene dctR 6651 7322 CDS product two-component system response regulator DctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234347.1 protein_id gnl|my_center|LOCUS_16710 7582 8913 gene locus_tag LOCUS_16720 7582 8913 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016767.1 protein_id gnl|my_center|LOCUS_16720 8920 9084 gene locus_tag LOCUS_16730 8920 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 9100 10269 gene locus_tag LOCUS_16740 9100 10269 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779464.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence46 1146 391 gene locus_tag LOCUS_16750 1146 391 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479656.1 protein_id gnl|my_center|LOCUS_16750 1276 2472 gene locus_tag LOCUS_16760 gene lysN 1276 2472 CDS product 2-aminoadipate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227918.1 protein_id gnl|my_center|LOCUS_16760 2507 2740 gene locus_tag LOCUS_16770 2507 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2825 4123 gene locus_tag LOCUS_16780 gene lysA 2825 4123 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_16780 5013 5208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5795 7450 gene locus_tag LOCUS_16790 5795 7450 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867411.1 protein_id gnl|my_center|LOCUS_16790 7544 8374 gene locus_tag LOCUS_16800 gene dapF 7544 8374 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868819.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence47 280 1860 gene locus_tag LOCUS_16810 280 1860 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869802.1 protein_id gnl|my_center|LOCUS_16810 1879 3081 gene locus_tag LOCUS_16820 1879 3081 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957409.1 protein_id gnl|my_center|LOCUS_16820 3115 3573 gene locus_tag LOCUS_16830 3115 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 3549 3911 gene locus_tag LOCUS_16840 3549 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4705 4862 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4925 5392 gene locus_tag LOCUS_16850 4925 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 5408 6301 gene locus_tag LOCUS_16860 5408 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 6298 6843 gene locus_tag LOCUS_16870 6298 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 6957 7358 gene locus_tag LOCUS_16880 6957 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 7342 7917 gene locus_tag LOCUS_16890 7342 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 7914 9548 gene locus_tag LOCUS_16900 7914 9548 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869790.1 protein_id gnl|my_center|LOCUS_16900 9586 9674 gene locus_tag LOCUS_t00330 9586 9674 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9716 9792 gene locus_tag LOCUS_t00340 9716 9792 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence48 1025 642 gene locus_tag LOCUS_16910 1025 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1737 1111 gene locus_tag LOCUS_16920 1737 1111 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869963.1 protein_id gnl|my_center|LOCUS_16920 3070 1781 gene locus_tag LOCUS_16930 gene eno 3070 1781 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_16930 3378 3103 gene locus_tag LOCUS_16940 3378 3103 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869965.1 protein_id gnl|my_center|LOCUS_16940 5218 3467 gene locus_tag LOCUS_16950 gene dnaG 5218 3467 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869968.1 protein_id gnl|my_center|LOCUS_16950 7273 5312 gene locus_tag LOCUS_16960 7273 5312 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869969.1 protein_id gnl|my_center|LOCUS_16960 8042 7392 gene locus_tag LOCUS_16970 8042 7392 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925183.1 protein_id gnl|my_center|LOCUS_16970 9143 8052 gene locus_tag LOCUS_16980 9143 8052 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941518.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence49 857 261 gene locus_tag LOCUS_16990 857 261 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203508.1 protein_id gnl|my_center|LOCUS_16990 2014 854 gene locus_tag LOCUS_17000 gene wlbF 2014 854 CDS product O-antigen biosynthesis aminotransferase WlbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853419.1 protein_id gnl|my_center|LOCUS_17000 3246 2020 gene locus_tag LOCUS_17010 gene wlbE 3246 2020 CDS product O-antigen biosynthesis protein WlbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929612.1 protein_id gnl|my_center|LOCUS_17010 3529 3227 gene locus_tag LOCUS_17020 3529 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3855 3529 gene locus_tag LOCUS_17030 3855 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 5716 3881 gene locus_tag LOCUS_17040 5716 3881 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868795.1 protein_id gnl|my_center|LOCUS_17040 6748 5723 gene locus_tag LOCUS_17050 gene tviC 6748 5723 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127915.1 protein_id gnl|my_center|LOCUS_17050 7862 6858 gene locus_tag LOCUS_17060 7862 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 7928 8198 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence50 1144 206 gene locus_tag LOCUS_17070 gene cysK 1144 206 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280536.1 protein_id gnl|my_center|LOCUS_17070 1806 1147 gene locus_tag LOCUS_17080 gene cysE 1806 1147 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_17080 1972 2310 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3106 3600 gene locus_tag LOCUS_17090 3106 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 3849 5282 gene locus_tag LOCUS_17100 3849 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 5428 5243 gene locus_tag LOCUS_17110 5428 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 5427 6242 gene locus_tag LOCUS_17120 5427 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 6748 7014 gene locus_tag LOCUS_17130 6748 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17130 7986 7114 gene locus_tag LOCUS_17140 7986 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence51 593 453 gene locus_tag LOCUS_17150 593 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 578 733 gene locus_tag LOCUS_17160 578 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 821 1033 gene locus_tag LOCUS_17170 821 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1039 3111 gene locus_tag LOCUS_17180 1039 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460589.1 protein_id gnl|my_center|LOCUS_17180 3113 4078 gene locus_tag LOCUS_17190 3113 4078 CDS product type I CRISPR-associated protein Cas7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272464.1 protein_id gnl|my_center|LOCUS_17190 4328 4807 gene locus_tag LOCUS_17200 4328 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5374 7170 gene locus_tag LOCUS_17210 5374 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 7183 7338 gene locus_tag LOCUS_17220 7183 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 7650 7851 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7852 >8003 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttcctataagggatggaaac >Feature sequence52 302 1768 gene locus_tag LOCUS_17230 302 1768 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365289.1 protein_id gnl|my_center|LOCUS_17230 1874 3037 gene locus_tag LOCUS_17240 1874 3037 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266619.1 protein_id gnl|my_center|LOCUS_17240 3056 3598 gene locus_tag LOCUS_17250 3056 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3613 4890 gene locus_tag LOCUS_17260 3613 4890 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461221.1 protein_id gnl|my_center|LOCUS_17260 5057 5224 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5390 6199 gene locus_tag LOCUS_17270 5390 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 6310 7230 gene locus_tag LOCUS_17280 gene ftcD 6310 7230 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681237.1 protein_id gnl|my_center|LOCUS_17280 7231 7860 gene locus_tag LOCUS_17290 7231 7860 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836510.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence53 293 832 gene locus_tag LOCUS_17300 293 832 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925285.1 protein_id gnl|my_center|LOCUS_17300 1610 852 gene locus_tag LOCUS_17310 gene phoU 1610 852 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_17310 3225 1579 gene locus_tag LOCUS_17320 3225 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 4219 3275 gene locus_tag LOCUS_17330 4219 3275 CDS product bifunctional 3-dehydroquinate synthase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545527.1 protein_id gnl|my_center|LOCUS_17330 5755 4316 gene locus_tag LOCUS_17340 gene proS 5755 4316 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869066.1 protein_id gnl|my_center|LOCUS_17340 6919 5828 gene locus_tag LOCUS_17350 6919 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 7041 7391 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence54 1285 92 gene locus_tag LOCUS_17360 1285 92 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_17360 2410 1457 gene locus_tag LOCUS_17370 2410 1457 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289187.1 protein_id gnl|my_center|LOCUS_17370 3729 2494 gene locus_tag LOCUS_17380 3729 2494 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870329.1 protein_id gnl|my_center|LOCUS_17380 5282 4032 gene locus_tag LOCUS_17390 5282 4032 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_17390 6094 5438 gene locus_tag LOCUS_17400 6094 5438 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941342.1 protein_id gnl|my_center|LOCUS_17400 6999 6112 gene locus_tag LOCUS_17410 6999 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence55 89 1558 gene locus_tag LOCUS_17420 89 1558 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_17420 1758 2846 gene locus_tag LOCUS_17430 1758 2846 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085534.1 protein_id gnl|my_center|LOCUS_17430 2965 3489 gene locus_tag LOCUS_17440 2965 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3795 4032 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4149 5009 gene locus_tag LOCUS_17450 4149 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 5065 6651 gene locus_tag LOCUS_17460 5065 6651 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_17460 6731 6955 gene locus_tag LOCUS_17470 6731 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence56 <1 843 gene locus_tag LOCUS_17480 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389892.1:TRAP transporter large permease 865 2166 gene locus_tag LOCUS_17490 865 2166 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949164.1 protein_id gnl|my_center|LOCUS_17490 2194 3915 gene locus_tag LOCUS_17500 gene lpdA 2194 3915 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_17500 4531 5427 gene locus_tag LOCUS_17510 4531 5427 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_17510 5443 6294 gene locus_tag LOCUS_17520 5443 6294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence57 2370 874 gene locus_tag LOCUS_17530 2370 874 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869615.1 protein_id gnl|my_center|LOCUS_17530 4080 2398 gene locus_tag LOCUS_17540 4080 2398 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869614.1 protein_id gnl|my_center|LOCUS_17540 4510 4100 gene locus_tag LOCUS_17550 4510 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 5447 4527 gene locus_tag LOCUS_17560 gene rsmH 5447 4527 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869612.1 protein_id gnl|my_center|LOCUS_17560 5872 5447 gene locus_tag LOCUS_17570 gene mraZ 5872 5447 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869611.1 protein_id gnl|my_center|LOCUS_17570 6204 6342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence58 765 4 gene locus_tag LOCUS_17580 765 4 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869547.1 protein_id gnl|my_center|LOCUS_17580 922 1614 gene locus_tag LOCUS_17590 922 1614 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869549.1 protein_id gnl|my_center|LOCUS_17590 3776 1737 gene locus_tag LOCUS_17600 3776 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 3928 4503 gene locus_tag LOCUS_17610 3928 4503 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383606.1 protein_id gnl|my_center|LOCUS_17610 4493 5227 gene locus_tag LOCUS_17620 4493 5227 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966337.1 protein_id gnl|my_center|LOCUS_17620 5242 6207 gene locus_tag LOCUS_17630 5242 6207 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400829.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence59 254 925 gene locus_tag LOCUS_17640 254 925 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937696.1 protein_id gnl|my_center|LOCUS_17640 2061 1117 gene locus_tag LOCUS_17650 2061 1117 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027134.1 protein_id gnl|my_center|LOCUS_17650 2193 3074 gene locus_tag LOCUS_17660 2193 3074 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948156.1 protein_id gnl|my_center|LOCUS_17660 3193 4089 gene locus_tag LOCUS_17670 gene pstC 3193 4089 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948157.1 protein_id gnl|my_center|LOCUS_17670 4089 4922 gene locus_tag LOCUS_17680 gene pstA 4089 4922 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356806.1 protein_id gnl|my_center|LOCUS_17680 4926 5672 gene locus_tag LOCUS_17690 4926 5672 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948158.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence60 163 1779 gene locus_tag LOCUS_17700 163 1779 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_17700 1956 2288 gene locus_tag LOCUS_17710 1956 2288 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073565.1 protein_id gnl|my_center|LOCUS_17710 2361 3557 gene locus_tag LOCUS_17720 2361 3557 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166479973.1 protein_id gnl|my_center|LOCUS_17720 4991 3603 gene locus_tag LOCUS_17730 gene ablA 4991 3603 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_17730 5412 4954 gene locus_tag LOCUS_17740 5412 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 <6047 5409 gene locus_tag LOCUS_17750 <6047 5409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327978.1:D-alanine--D-alanine ligase >Feature sequence61 45 194 gene locus_tag LOCUS_17760 gene rpmG 45 194 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006582922.1 protein_id gnl|my_center|LOCUS_17760 216 291 gene locus_tag LOCUS_t00350 216 291 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 324 506 gene locus_tag LOCUS_17770 gene secE 324 506 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006582923.1 protein_id gnl|my_center|LOCUS_17770 591 1133 gene locus_tag LOCUS_17780 gene nusG 591 1133 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870244.1 protein_id gnl|my_center|LOCUS_17780 1223 1648 gene locus_tag LOCUS_17790 gene rplK 1223 1648 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870243.1 protein_id gnl|my_center|LOCUS_17790 1715 2428 gene locus_tag LOCUS_17800 gene rplA 1715 2428 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870242.1 protein_id gnl|my_center|LOCUS_17800 2634 3164 gene locus_tag LOCUS_17810 gene rplJ 2634 3164 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870241.1 protein_id gnl|my_center|LOCUS_17810 3257 3637 gene locus_tag LOCUS_17820 gene rplL 3257 3637 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870240.1 protein_id gnl|my_center|LOCUS_17820 3769 4467 gene locus_tag LOCUS_17830 gene nfi 3769 4467 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_17830 4454 5299 gene locus_tag LOCUS_17840 4454 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 5353 5427 gene locus_tag LOCUS_t00360 5353 5427 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5491 5704 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence62 219 426 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2296 719 gene locus_tag LOCUS_17850 2296 719 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_17850 733 883 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3545 2349 gene locus_tag LOCUS_17860 3545 2349 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016873.1 protein_id gnl|my_center|LOCUS_17860 4180 3578 gene locus_tag LOCUS_17870 4180 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5166 4180 gene locus_tag LOCUS_17880 5166 4180 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_17880 <5717 5166 gene locus_tag LOCUS_17890 <5717 5166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016362.1:ABC transporter ATP-binding protein >Feature sequence63 1 417 gene locus_tag LOCUS_17900 1 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 514 2130 gene locus_tag LOCUS_17910 514 2130 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925110.1 protein_id gnl|my_center|LOCUS_17910 2918 2127 gene locus_tag LOCUS_17920 2918 2127 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943941.1 protein_id gnl|my_center|LOCUS_17920 4165 2915 gene locus_tag LOCUS_17930 4165 2915 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence64 44 2098 gene locus_tag LOCUS_17940 44 2098 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869308.1 protein_id gnl|my_center|LOCUS_17940 3096 3241 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence65 310 573 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 678 1778 gene locus_tag LOCUS_17950 gene sfsA 678 1778 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869021.1 protein_id gnl|my_center|LOCUS_17950 2581 1775 gene locus_tag LOCUS_17960 2581 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 2699 3583 gene locus_tag LOCUS_17970 2699 3583 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_17970 3583 4044 gene locus_tag LOCUS_17980 3583 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869060.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence66 271 561 gene locus_tag LOCUS_17990 gene groES 271 561 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_17990 592 2229 gene locus_tag LOCUS_18000 gene groL 592 2229 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869974.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence67 1657 272 gene locus_tag LOCUS_18010 1657 272 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925325.1 protein_id gnl|my_center|LOCUS_18010 3094 1814 gene locus_tag LOCUS_18020 3094 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence68 419 621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1914 1234 gene locus_tag LOCUS_18030 1914 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2012 2467 gene locus_tag LOCUS_18040 2012 2467 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925333.1 protein_id gnl|my_center|LOCUS_18040 2876 2499 gene locus_tag LOCUS_18050 2876 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3088 3489 gene locus_tag LOCUS_18060 gene mce 3088 3489 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence69 <1 1137 gene locus_tag LOCUS_18070 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846514.1:pyruvate, water dikinase 3245 1227 gene locus_tag LOCUS_18080 3245 1227 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869803.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence70 2107 1232 gene locus_tag LOCUS_18090 gene secF 2107 1232 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869960.1 protein_id gnl|my_center|LOCUS_18090 <2989 2126 gene locus_tag LOCUS_18100 <2989 2126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869961.1:protein translocase subunit SecD >Feature sequence71 2001 592 gene locus_tag LOCUS_18110 2001 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence72 137 456 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 584 830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence73 1778 867 gene locus_tag LOCUS_18120 1778 867 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_18120