>Feature sequence01 503 72 gene locus_tag LOCUS_00010 503 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1330 791 gene locus_tag LOCUS_00020 1330 791 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966677.1 protein_id gnl|my_center|LOCUS_00020 2482 1499 gene locus_tag LOCUS_00030 2482 1499 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215352211.1 protein_id gnl|my_center|LOCUS_00030 2767 2531 gene locus_tag LOCUS_00040 2767 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3500 3039 gene locus_tag LOCUS_00050 3500 3039 CDS product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971767.1 protein_id gnl|my_center|LOCUS_00050 3774 4790 gene locus_tag LOCUS_00060 3774 4790 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678143.1 protein_id gnl|my_center|LOCUS_00060 4849 7779 gene locus_tag LOCUS_00070 4849 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7918 11277 gene locus_tag LOCUS_00080 7918 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11335 12525 gene locus_tag LOCUS_00090 11335 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13297 12551 gene locus_tag LOCUS_00100 13297 12551 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074021.1 protein_id gnl|my_center|LOCUS_00100 14365 13361 gene locus_tag LOCUS_00110 14365 13361 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390023.1 protein_id gnl|my_center|LOCUS_00110 15429 14362 gene locus_tag LOCUS_00120 15429 14362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531724.1 protein_id gnl|my_center|LOCUS_00120 16405 15431 gene locus_tag LOCUS_00130 16405 15431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390025.1 protein_id gnl|my_center|LOCUS_00130 17432 16422 gene locus_tag LOCUS_00140 17432 16422 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470617.1 protein_id gnl|my_center|LOCUS_00140 18722 17589 gene locus_tag LOCUS_00150 18722 17589 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089192.1 protein_id gnl|my_center|LOCUS_00150 19372 18758 gene locus_tag LOCUS_00160 19372 18758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22191 19375 gene locus_tag LOCUS_00170 gene polA 22191 19375 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_00170 24748 22340 gene locus_tag LOCUS_00180 24748 22340 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994162.1 protein_id gnl|my_center|LOCUS_00180 27119 24966 gene locus_tag LOCUS_00190 27119 24966 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_00190 27476 27261 gene locus_tag LOCUS_00200 27476 27261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 27643 28725 gene locus_tag LOCUS_00210 27643 28725 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_00210 28950 28874 gene locus_tag LOCUS_t00010 28950 28874 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29140 29631 gene locus_tag LOCUS_00220 29140 29631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 29648 30139 gene locus_tag LOCUS_00230 29648 30139 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806996.1 protein_id gnl|my_center|LOCUS_00230 30713 31087 gene locus_tag LOCUS_00240 30713 31087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 32114 31530 gene locus_tag LOCUS_00250 32114 31530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 32824 32405 gene locus_tag LOCUS_00260 32824 32405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 33085 32897 gene locus_tag LOCUS_00270 33085 32897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 33766 33335 gene locus_tag LOCUS_00280 33766 33335 CDS product DUF1489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339404.1 protein_id gnl|my_center|LOCUS_00280 35006 33906 gene locus_tag LOCUS_00290 35006 33906 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035548.1 protein_id gnl|my_center|LOCUS_00290 36389 35328 gene locus_tag LOCUS_00300 gene hemW 36389 35328 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310172.1 protein_id gnl|my_center|LOCUS_00300 38485 36485 gene locus_tag LOCUS_00310 38485 36485 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086584.1 protein_id gnl|my_center|LOCUS_00310 39267 38584 gene locus_tag LOCUS_00320 39267 38584 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626629.1 protein_id gnl|my_center|LOCUS_00320 40459 39428 gene locus_tag LOCUS_00330 40459 39428 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992236.1 protein_id gnl|my_center|LOCUS_00330 41002 40568 gene locus_tag LOCUS_00340 41002 40568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41903 41295 gene locus_tag LOCUS_00350 41903 41295 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130548.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00350 43681 41912 gene locus_tag LOCUS_00360 43681 41912 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529771.1 protein_id gnl|my_center|LOCUS_00360 44904 43840 gene locus_tag LOCUS_00370 44904 43840 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101420.1 protein_id gnl|my_center|LOCUS_00370 45462 45235 gene locus_tag LOCUS_00380 45462 45235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 46043 45507 gene locus_tag LOCUS_00390 46043 45507 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_00390 46774 46049 gene locus_tag LOCUS_00400 gene rpiA 46774 46049 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632746.1 protein_id gnl|my_center|LOCUS_00400 47571 46831 gene locus_tag LOCUS_00410 gene pgl 47571 46831 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_00410 48581 47718 gene locus_tag LOCUS_00420 48581 47718 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089502.1 protein_id gnl|my_center|LOCUS_00420 49695 48694 gene locus_tag LOCUS_00430 gene gnd 49695 48694 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766216.1 protein_id gnl|my_center|LOCUS_00430 52575 49720 gene locus_tag LOCUS_00440 52575 49720 CDS product bifunctional transaldolase/phosoglucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089497.1 protein_id gnl|my_center|LOCUS_00440 54775 52673 gene locus_tag LOCUS_00450 gene tkt 54775 52673 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_00450 55122 55670 gene locus_tag LOCUS_00460 55122 55670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 55843 56913 gene locus_tag LOCUS_00470 gene hisC 55843 56913 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067330.1 protein_id gnl|my_center|LOCUS_00470 57105 57374 gene locus_tag LOCUS_00480 57105 57374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 57530 58588 gene locus_tag LOCUS_00490 57530 58588 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241170.1 protein_id gnl|my_center|LOCUS_00490 59317 60390 gene locus_tag LOCUS_00500 59317 60390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00500 60777 60445 gene locus_tag LOCUS_00510 60777 60445 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971365.1 protein_id gnl|my_center|LOCUS_00510 61141 62559 gene locus_tag LOCUS_00520 61141 62559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 64077 63115 gene locus_tag LOCUS_00530 64077 63115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 64904 64077 gene locus_tag LOCUS_00540 gene pgeF 64904 64077 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383754.1 protein_id gnl|my_center|LOCUS_00540 65956 64901 gene locus_tag LOCUS_00550 65956 64901 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388400.1 protein_id gnl|my_center|LOCUS_00550 66782 65934 gene locus_tag LOCUS_00560 gene lgt 66782 65934 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_00560 67051 67644 gene locus_tag LOCUS_00570 67051 67644 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272666.1 protein_id gnl|my_center|LOCUS_00570 67681 68520 gene locus_tag LOCUS_00580 67681 68520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 68592 68891 gene locus_tag LOCUS_00590 68592 68891 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113690.1 protein_id gnl|my_center|LOCUS_00590 70583 68985 gene locus_tag LOCUS_00600 70583 68985 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546216.1 protein_id gnl|my_center|LOCUS_00600 71036 70848 gene locus_tag LOCUS_00610 71036 70848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 71005 73413 gene locus_tag LOCUS_00620 71005 73413 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849784.1 protein_id gnl|my_center|LOCUS_00620 74531 74707 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75009 75166 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75348 75544 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 76853 76290 gene locus_tag LOCUS_00630 76853 76290 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095503.1 protein_id gnl|my_center|LOCUS_00630 78575 77202 gene locus_tag LOCUS_00640 78575 77202 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039986.1 protein_id gnl|my_center|LOCUS_00640 78707 80188 gene locus_tag LOCUS_00650 gene galP 78707 80188 CDS product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112296.1 protein_id gnl|my_center|LOCUS_00650 80958 80173 gene locus_tag LOCUS_00660 gene xth 80958 80173 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339298.1 protein_id gnl|my_center|LOCUS_00660 81326 80955 gene locus_tag LOCUS_00670 gene erpA 81326 80955 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975326.1 protein_id gnl|my_center|LOCUS_00670 81470 82657 gene locus_tag LOCUS_00680 81470 82657 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389533.1 protein_id gnl|my_center|LOCUS_00680 82691 84484 gene locus_tag LOCUS_00690 gene argS 82691 84484 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140224.1 protein_id gnl|my_center|LOCUS_00690 84484 85578 gene locus_tag LOCUS_00700 84484 85578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 85656 86609 gene locus_tag LOCUS_00710 85656 86609 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_00710 86660 87454 gene locus_tag LOCUS_00720 gene scpB 86660 87454 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171841.1 protein_id gnl|my_center|LOCUS_00720 87592 88320 gene locus_tag LOCUS_00730 87592 88320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 88317 89126 gene locus_tag LOCUS_00740 gene tatC 88317 89126 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389524.1 protein_id gnl|my_center|LOCUS_00740 89168 90439 gene locus_tag LOCUS_00750 gene serS 89168 90439 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389523.1 protein_id gnl|my_center|LOCUS_00750 92753 90543 gene locus_tag LOCUS_00760 92753 90543 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813609.1 protein_id gnl|my_center|LOCUS_00760 93088 94224 gene locus_tag LOCUS_00770 93088 94224 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888425.1 protein_id gnl|my_center|LOCUS_00770 95958 94471 gene locus_tag LOCUS_00780 95958 94471 CDS product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970800.1 protein_id gnl|my_center|LOCUS_00780 96623 95955 gene locus_tag LOCUS_00790 96623 95955 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201004.1 protein_id gnl|my_center|LOCUS_00790 99780 96676 gene locus_tag LOCUS_00800 99780 96676 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140385.1 protein_id gnl|my_center|LOCUS_00800 101076 99784 gene locus_tag LOCUS_00810 101076 99784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 102512 101118 gene locus_tag LOCUS_00820 102512 101118 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 protein_id gnl|my_center|LOCUS_00820 102754 103374 gene locus_tag LOCUS_00830 102754 103374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 103377 104564 gene locus_tag LOCUS_00840 103377 104564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00840 104578 104907 gene locus_tag LOCUS_00850 104578 104907 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384254.1 protein_id gnl|my_center|LOCUS_00850 105185 106009 gene locus_tag LOCUS_00860 105185 106009 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039297.1 protein_id gnl|my_center|LOCUS_00860 107183 106089 gene locus_tag LOCUS_00870 107183 106089 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968435.1 protein_id gnl|my_center|LOCUS_00870 107471 107295 gene locus_tag LOCUS_00880 107471 107295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 107502 109010 gene locus_tag LOCUS_00890 107502 109010 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086915.1 protein_id gnl|my_center|LOCUS_00890 109919 109104 gene locus_tag LOCUS_00900 109919 109104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814657.1 protein_id gnl|my_center|LOCUS_00900 111032 109923 gene locus_tag LOCUS_00910 111032 109923 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171333.1 protein_id gnl|my_center|LOCUS_00910 111293 112309 gene locus_tag LOCUS_00920 111293 112309 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090071.1 protein_id gnl|my_center|LOCUS_00920 113654 112371 gene locus_tag LOCUS_00930 113654 112371 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_00930 116315 113910 gene locus_tag LOCUS_00940 116315 113910 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704425.1 protein_id gnl|my_center|LOCUS_00940 118086 117172 gene locus_tag LOCUS_00950 118086 117172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 118524 118703 gene locus_tag LOCUS_00960 118524 118703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 119195 118638 gene locus_tag LOCUS_00970 119195 118638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 120868 119270 gene locus_tag LOCUS_00980 120868 119270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 121067 120992 gene locus_tag LOCUS_t00020 121067 120992 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 122313 121141 gene locus_tag LOCUS_00990 122313 121141 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150041682.1 protein_id gnl|my_center|LOCUS_00990 122374 122541 gene locus_tag LOCUS_01000 122374 122541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 122551 122889 gene locus_tag LOCUS_01010 122551 122889 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_01010 123009 124454 gene locus_tag LOCUS_01020 gene glnA 123009 124454 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389839.1 protein_id gnl|my_center|LOCUS_01020 125749 124526 gene locus_tag LOCUS_01030 125749 124526 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206046.1 protein_id gnl|my_center|LOCUS_01030 126056 127411 gene locus_tag LOCUS_01040 126056 127411 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731109.1 protein_id gnl|my_center|LOCUS_01040 127796 128686 gene locus_tag LOCUS_01050 gene rpoH 127796 128686 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_01050 128775 129368 gene locus_tag LOCUS_01060 128775 129368 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967669.1 protein_id gnl|my_center|LOCUS_01060 130868 129735 gene locus_tag LOCUS_01070 130868 129735 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966754.1 protein_id gnl|my_center|LOCUS_01070 132697 130865 gene locus_tag LOCUS_01080 gene recJ 132697 130865 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_01080 133717 132719 gene locus_tag LOCUS_01090 gene glpX 133717 132719 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442341.1 protein_id gnl|my_center|LOCUS_01090 135081 133768 gene locus_tag LOCUS_01100 135081 133768 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390163.1 protein_id gnl|my_center|LOCUS_01100 136313 135084 gene locus_tag LOCUS_01110 136313 135084 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390164.1 protein_id gnl|my_center|LOCUS_01110 137537 136494 gene locus_tag LOCUS_01120 137537 136494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 137688 138371 gene locus_tag LOCUS_01130 137688 138371 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314627.1 protein_id gnl|my_center|LOCUS_01130 138505 139512 gene locus_tag LOCUS_01140 138505 139512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266244.1 protein_id gnl|my_center|LOCUS_01140 140438 139674 gene locus_tag LOCUS_01150 140438 139674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 141623 140523 gene locus_tag LOCUS_01160 gene pqqE 141623 140523 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038063.1 protein_id gnl|my_center|LOCUS_01160 141919 141620 gene locus_tag LOCUS_01170 141919 141620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 142656 141916 gene locus_tag LOCUS_01180 gene pqqC 142656 141916 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038061.1 protein_id gnl|my_center|LOCUS_01180 143564 142653 gene locus_tag LOCUS_01190 gene pqqB 143564 142653 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038060.1 protein_id gnl|my_center|LOCUS_01190 144465 143944 gene locus_tag LOCUS_01200 144465 143944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 144834 145016 gene locus_tag LOCUS_01210 144834 145016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 145552 145127 gene locus_tag LOCUS_01220 145552 145127 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537794.1 protein_id gnl|my_center|LOCUS_01220 145989 146159 gene locus_tag LOCUS_01230 145989 146159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 146303 147172 gene locus_tag LOCUS_01240 146303 147172 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970541.1 protein_id gnl|my_center|LOCUS_01240 147293 148912 gene locus_tag LOCUS_01250 147293 148912 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530640.1 protein_id gnl|my_center|LOCUS_01250 148927 149196 gene locus_tag LOCUS_01260 148927 149196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 149197 149889 gene locus_tag LOCUS_01270 149197 149889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 150002 151807 gene locus_tag LOCUS_01280 gene lepA 150002 151807 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626581.1 protein_id gnl|my_center|LOCUS_01280 151952 153127 gene locus_tag LOCUS_01290 151952 153127 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_01290 153127 153750 gene locus_tag LOCUS_01300 gene metW 153127 153750 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391015.1 protein_id gnl|my_center|LOCUS_01300 154249 155574 gene locus_tag LOCUS_01310 154249 155574 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_01310 156408 155635 gene locus_tag LOCUS_01320 156408 155635 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479310.1 protein_id gnl|my_center|LOCUS_01320 157255 156563 gene locus_tag LOCUS_01330 157255 156563 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115027.1 protein_id gnl|my_center|LOCUS_01330 158138 157515 gene locus_tag LOCUS_01340 158138 157515 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_01340 158297 158785 gene locus_tag LOCUS_01350 gene folK 158297 158785 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_01350 158865 159236 gene locus_tag LOCUS_01360 gene rpoZ 158865 159236 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389610.1 protein_id gnl|my_center|LOCUS_01360 159243 161600 gene locus_tag LOCUS_01370 159243 161600 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385014.1 protein_id gnl|my_center|LOCUS_01370 161632 162039 gene locus_tag LOCUS_01380 gene acpS 161632 162039 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919432.1 protein_id gnl|my_center|LOCUS_01380 162029 162925 gene locus_tag LOCUS_01390 gene lepB 162029 162925 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087823.1 protein_id gnl|my_center|LOCUS_01390 162922 163668 gene locus_tag LOCUS_01400 gene rnc 162922 163668 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389605.1 protein_id gnl|my_center|LOCUS_01400 163661 164560 gene locus_tag LOCUS_01410 gene era 163661 164560 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722420.1 protein_id gnl|my_center|LOCUS_01410 164670 165407 gene locus_tag LOCUS_01420 gene pyrH 164670 165407 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919787.1 protein_id gnl|my_center|LOCUS_01420 165486 166049 gene locus_tag LOCUS_01430 gene frr 165486 166049 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975304.1 protein_id gnl|my_center|LOCUS_01430 166107 166841 gene locus_tag LOCUS_01440 166107 166841 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531758.1 protein_id gnl|my_center|LOCUS_01440 166838 167668 gene locus_tag LOCUS_01450 166838 167668 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384344.1 protein_id gnl|my_center|LOCUS_01450 167728 168885 gene locus_tag LOCUS_01460 167728 168885 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_01460 168920 170029 gene locus_tag LOCUS_01470 gene rseP 168920 170029 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534980.1 protein_id gnl|my_center|LOCUS_01470 170159 172627 gene locus_tag LOCUS_01480 gene bamA 170159 172627 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440405.1 protein_id gnl|my_center|LOCUS_01480 172818 173513 gene locus_tag LOCUS_01490 172818 173513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 173516 174574 gene locus_tag LOCUS_01500 gene lpxD 173516 174574 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087620.1 protein_id gnl|my_center|LOCUS_01500 174679 175125 gene locus_tag LOCUS_01510 gene fabZ 174679 175125 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389471.1 protein_id gnl|my_center|LOCUS_01510 175261 176118 gene locus_tag LOCUS_01520 gene lpxA 175261 176118 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 protein_id gnl|my_center|LOCUS_01520 176127 176957 gene locus_tag LOCUS_01530 gene lpxI 176127 176957 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389473.1 protein_id gnl|my_center|LOCUS_01530 177175 177567 gene locus_tag LOCUS_01540 gene gloA 177175 177567 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072117.1 protein_id gnl|my_center|LOCUS_01540 178058 177636 gene locus_tag LOCUS_01550 178058 177636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 178217 178351 gene locus_tag LOCUS_01560 gene rpmH 178217 178351 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391083.1 protein_id gnl|my_center|LOCUS_01560 178375 178782 gene locus_tag LOCUS_01570 178375 178782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 178932 180695 gene locus_tag LOCUS_01580 gene yidC 178932 180695 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391086.1 protein_id gnl|my_center|LOCUS_01580 180695 181372 gene locus_tag LOCUS_01590 gene yihA 180695 181372 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391087.1 protein_id gnl|my_center|LOCUS_01590 181415 182320 gene locus_tag LOCUS_01600 gene argB 181415 182320 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391088.1 protein_id gnl|my_center|LOCUS_01600 182525 183373 gene locus_tag LOCUS_01610 gene dapD 182525 183373 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 protein_id gnl|my_center|LOCUS_01610 183397 184599 gene locus_tag LOCUS_01620 gene dapE 183397 184599 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391227.1 protein_id gnl|my_center|LOCUS_01620 184599 185222 gene locus_tag LOCUS_01630 184599 185222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 186020 185499 gene locus_tag LOCUS_01640 186020 185499 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 protein_id gnl|my_center|LOCUS_01640 186870 186013 gene locus_tag LOCUS_01650 gene truA 186870 186013 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391099.1 protein_id gnl|my_center|LOCUS_01650 187799 186867 gene locus_tag LOCUS_01660 gene fmt 187799 186867 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 protein_id gnl|my_center|LOCUS_01660 188386 187820 gene locus_tag LOCUS_01670 gene def 188386 187820 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383428.1 protein_id gnl|my_center|LOCUS_01670 188611 189111 gene locus_tag LOCUS_01680 188611 189111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 189182 189448 gene locus_tag LOCUS_01690 189182 189448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 190151 189537 gene locus_tag LOCUS_01700 gene raiA 190151 189537 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 protein_id gnl|my_center|LOCUS_01700 190485 190760 gene locus_tag LOCUS_01710 190485 190760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 191594 190779 gene locus_tag LOCUS_01720 gene lptB 191594 190779 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_01720 192622 191597 gene locus_tag LOCUS_01730 192622 191597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 193362 192625 gene locus_tag LOCUS_01740 gene lptC 193362 192625 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387774.1 protein_id gnl|my_center|LOCUS_01740 194384 193359 gene locus_tag LOCUS_01750 194384 193359 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625856.1 protein_id gnl|my_center|LOCUS_01750 195071 194412 gene locus_tag LOCUS_01760 195071 194412 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387776.1 protein_id gnl|my_center|LOCUS_01760 195507 196961 gene locus_tag LOCUS_01770 gene proP 195507 196961 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035341.1 protein_id gnl|my_center|LOCUS_01770 197099 197938 gene locus_tag LOCUS_01780 gene rlmB 197099 197938 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921492.1 protein_id gnl|my_center|LOCUS_01780 199230 197872 gene locus_tag LOCUS_01790 199230 197872 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223436.1 protein_id gnl|my_center|LOCUS_01790 200087 199269 gene locus_tag LOCUS_01800 200087 199269 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_01800 200269 200871 gene locus_tag LOCUS_01810 gene gmk 200269 200871 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388188.1 protein_id gnl|my_center|LOCUS_01810 200992 202506 gene locus_tag LOCUS_01820 200992 202506 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388169.1 protein_id gnl|my_center|LOCUS_01820 205149 202699 gene locus_tag LOCUS_01830 205149 202699 CDS product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268510.1 protein_id gnl|my_center|LOCUS_01830 205956 205306 gene locus_tag LOCUS_01840 205956 205306 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867225.1 protein_id gnl|my_center|LOCUS_01840 207020 206235 gene locus_tag LOCUS_01850 207020 206235 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_01850 207802 207017 gene locus_tag LOCUS_01860 207802 207017 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_01860 208072 209397 gene locus_tag LOCUS_01870 208072 209397 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_01870 209475 210869 gene locus_tag LOCUS_01880 gene radA 209475 210869 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 protein_id gnl|my_center|LOCUS_01880 211023 211096 gene locus_tag LOCUS_t00030 211023 211096 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 211840 213369 gene locus_tag LOCUS_01890 211840 213369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 213450 214805 gene locus_tag LOCUS_01900 213450 214805 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731109.1 protein_id gnl|my_center|LOCUS_01900 214983 215180 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 216090 215407 gene locus_tag LOCUS_01910 216090 215407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 220323 216688 gene locus_tag LOCUS_01920 gene putA 220323 216688 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974305.1 protein_id gnl|my_center|LOCUS_01920 221341 220637 gene locus_tag LOCUS_01930 221341 220637 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 protein_id gnl|my_center|LOCUS_01930 221914 222366 gene locus_tag LOCUS_01940 221914 222366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 222592 224514 gene locus_tag LOCUS_01950 gene acs 222592 224514 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921410.1 protein_id gnl|my_center|LOCUS_01950 225062 224613 gene locus_tag LOCUS_01960 225062 224613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 225466 225215 gene locus_tag LOCUS_01970 225466 225215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 225465 226073 gene locus_tag LOCUS_01980 225465 226073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 226101 226400 gene locus_tag LOCUS_01990 226101 226400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 227363 226434 gene locus_tag LOCUS_02000 227363 226434 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_02000 227749 227360 gene locus_tag LOCUS_02010 227749 227360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 227845 228417 gene locus_tag LOCUS_02020 227845 228417 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 protein_id gnl|my_center|LOCUS_02020 228767 229465 gene locus_tag LOCUS_02030 228767 229465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 229490 229957 gene locus_tag LOCUS_02040 229490 229957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 230131 230349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 232087 230654 gene locus_tag LOCUS_02050 232087 230654 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_02050 232725 232192 gene locus_tag LOCUS_02060 232725 232192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 233727 232750 gene locus_tag LOCUS_02070 233727 232750 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_02070 234540 233770 gene locus_tag LOCUS_02080 gene cysQ 234540 233770 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_02080 234786 236252 gene locus_tag LOCUS_02090 234786 236252 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388213.1 protein_id gnl|my_center|LOCUS_02090 236785 236339 gene locus_tag LOCUS_02100 236785 236339 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390049.1 protein_id gnl|my_center|LOCUS_02100 237084 237941 gene locus_tag LOCUS_02110 237084 237941 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136617434.1 protein_id gnl|my_center|LOCUS_02110 239166 238063 gene locus_tag LOCUS_02120 239166 238063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 241877 239307 gene locus_tag LOCUS_02130 gene hrpB 241877 239307 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_02130 242107 244281 gene locus_tag LOCUS_02140 242107 244281 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440066.1 protein_id gnl|my_center|LOCUS_02140 245257 244367 gene locus_tag LOCUS_02150 245257 244367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 245451 245807 gene locus_tag LOCUS_02160 245451 245807 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389230.1 protein_id gnl|my_center|LOCUS_02160 246873 245923 gene locus_tag LOCUS_02170 246873 245923 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327203.1 protein_id gnl|my_center|LOCUS_02170 247303 246989 gene locus_tag LOCUS_02180 247303 246989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 248302 247307 gene locus_tag LOCUS_02190 gene argF 248302 247307 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470667.1 protein_id gnl|my_center|LOCUS_02190 249498 248299 gene locus_tag LOCUS_02200 249498 248299 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965252.1 protein_id gnl|my_center|LOCUS_02200 249741 250412 gene locus_tag LOCUS_02210 249741 250412 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 protein_id gnl|my_center|LOCUS_02210 250610 250864 gene locus_tag LOCUS_02220 250610 250864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 251039 251284 gene locus_tag LOCUS_02230 251039 251284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 251399 252007 gene locus_tag LOCUS_02240 251399 252007 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103182.1 protein_id gnl|my_center|LOCUS_02240 252004 252549 gene locus_tag LOCUS_02250 252004 252549 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087656.1 protein_id gnl|my_center|LOCUS_02250 252546 253256 gene locus_tag LOCUS_02260 gene mtnC 252546 253256 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704722.1 protein_id gnl|my_center|LOCUS_02260 253259 254203 gene locus_tag LOCUS_02270 253259 254203 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_02270 254200 254385 gene locus_tag LOCUS_02280 254200 254385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 254496 257486 gene locus_tag LOCUS_02290 gene ileS 254496 257486 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390714.1 protein_id gnl|my_center|LOCUS_02290 257483 257983 gene locus_tag LOCUS_02300 gene lspA 257483 257983 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174654.1 protein_id gnl|my_center|LOCUS_02300 258039 258569 gene locus_tag LOCUS_02310 258039 258569 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_02310 258586 260568 gene locus_tag LOCUS_02320 gene mutL 258586 260568 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390696.1 protein_id gnl|my_center|LOCUS_02320 260685 262202 gene locus_tag LOCUS_02330 260685 262202 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_02330 263353 262445 gene locus_tag LOCUS_02340 263353 262445 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921297.1 protein_id gnl|my_center|LOCUS_02340 265389 263350 gene locus_tag LOCUS_02350 gene parE 265389 263350 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390520.1 protein_id gnl|my_center|LOCUS_02350 266112 265579 gene locus_tag LOCUS_02360 266112 265579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 266546 267097 gene locus_tag LOCUS_02370 266546 267097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 267667 267218 gene locus_tag LOCUS_02380 267667 267218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 267815 268801 gene locus_tag LOCUS_02390 gene cysK 267815 268801 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527809.1 protein_id gnl|my_center|LOCUS_02390 268817 269377 gene locus_tag LOCUS_02400 268817 269377 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909489.1 protein_id gnl|my_center|LOCUS_02400 270514 269396 gene locus_tag LOCUS_02410 270514 269396 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_02410 271775 270624 gene locus_tag LOCUS_02420 271775 270624 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_02420 272319 271978 gene locus_tag LOCUS_02430 272319 271978 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_02430 273926 272316 gene locus_tag LOCUS_02440 273926 272316 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470630.1 protein_id gnl|my_center|LOCUS_02440 274135 273977 gene locus_tag LOCUS_02450 274135 273977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 276321 274234 gene locus_tag LOCUS_02460 276321 274234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 279033 276325 gene locus_tag LOCUS_02470 gene topA 279033 276325 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390950.1 protein_id gnl|my_center|LOCUS_02470 280313 279075 gene locus_tag LOCUS_02480 gene dprA 280313 279075 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240751.1 protein_id gnl|my_center|LOCUS_02480 280968 280324 gene locus_tag LOCUS_02490 gene plsY 280968 280324 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563048.1 protein_id gnl|my_center|LOCUS_02490 282257 280965 gene locus_tag LOCUS_02500 gene pyrC 282257 280965 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390939.1 protein_id gnl|my_center|LOCUS_02500 283201 282254 gene locus_tag LOCUS_02510 283201 282254 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390938.1 protein_id gnl|my_center|LOCUS_02510 284600 283194 gene locus_tag LOCUS_02520 gene gltX 284600 283194 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389476.1 protein_id gnl|my_center|LOCUS_02520 284686 286893 gene locus_tag LOCUS_02530 284686 286893 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_02530 287535 286909 gene locus_tag LOCUS_02540 287535 286909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 288436 288098 gene locus_tag LOCUS_02550 288436 288098 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807759.1 protein_id gnl|my_center|LOCUS_02550 288570 289766 gene locus_tag LOCUS_02560 gene zapE 288570 289766 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310852.1 protein_id gnl|my_center|LOCUS_02560 290053 292926 gene locus_tag LOCUS_02570 290053 292926 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388968.1 protein_id gnl|my_center|LOCUS_02570 293036 294265 gene locus_tag LOCUS_02580 gene odhB 293036 294265 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970379.1 protein_id gnl|my_center|LOCUS_02580 294341 296086 gene locus_tag LOCUS_02590 gene lpdA 294341 296086 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083281.1 protein_id gnl|my_center|LOCUS_02590 296150 297103 gene locus_tag LOCUS_02600 296150 297103 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832082.1 protein_id gnl|my_center|LOCUS_02600 297231 298949 gene locus_tag LOCUS_02610 gene dld 297231 298949 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222583.1 protein_id gnl|my_center|LOCUS_02610 299442 299053 gene locus_tag LOCUS_02620 299442 299053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 300682 299741 gene locus_tag LOCUS_02630 300682 299741 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969652.1 protein_id gnl|my_center|LOCUS_02630 301263 300748 gene locus_tag LOCUS_02640 301263 300748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 303566 301419 gene locus_tag LOCUS_02650 gene fhuE 303566 301419 CDS product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953417.1 protein_id gnl|my_center|LOCUS_02650 303799 303978 gene locus_tag LOCUS_02660 303799 303978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 305696 304407 gene locus_tag LOCUS_02670 gene ahcY 305696 304407 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_02670 305873 306577 gene locus_tag LOCUS_02680 305873 306577 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626547.1 protein_id gnl|my_center|LOCUS_02680 306949 308034 gene locus_tag LOCUS_02690 306949 308034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 308756 308031 gene locus_tag LOCUS_02700 gene gloB 308756 308031 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 protein_id gnl|my_center|LOCUS_02700 308840 309604 gene locus_tag LOCUS_02710 308840 309604 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391017.1 protein_id gnl|my_center|LOCUS_02710 309660 311444 gene locus_tag LOCUS_02720 309660 311444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 311441 312469 gene locus_tag LOCUS_02730 311441 312469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 312466 313140 gene locus_tag LOCUS_02740 312466 313140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 313137 314258 gene locus_tag LOCUS_02750 313137 314258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 314258 315757 gene locus_tag LOCUS_02760 314258 315757 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528369.1 protein_id gnl|my_center|LOCUS_02760 315788 316312 gene locus_tag LOCUS_02770 315788 316312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 317061 316267 gene locus_tag LOCUS_02780 gene pssA 317061 316267 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_02780 317932 317243 gene locus_tag LOCUS_02790 317932 317243 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338435.1 protein_id gnl|my_center|LOCUS_02790 320655 318010 gene locus_tag LOCUS_02800 gene alaS 320655 318010 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390445.1 protein_id gnl|my_center|LOCUS_02800 321339 320854 gene locus_tag LOCUS_02810 321339 320854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 322592 321489 gene locus_tag LOCUS_02820 322592 321489 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_02820 324083 322953 gene locus_tag LOCUS_02830 324083 322953 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_02830 326153 324420 gene locus_tag LOCUS_02840 326153 324420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 326217 326468 gene locus_tag LOCUS_02850 326217 326468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 326468 327403 gene locus_tag LOCUS_02860 326468 327403 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391485.1 protein_id gnl|my_center|LOCUS_02860 327440 328432 gene locus_tag LOCUS_02870 327440 328432 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625895.1 protein_id gnl|my_center|LOCUS_02870 329220 328468 gene locus_tag LOCUS_02880 329220 328468 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_02880 329384 331009 gene locus_tag LOCUS_02890 329384 331009 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917973.1 protein_id gnl|my_center|LOCUS_02890 331027 333078 gene locus_tag LOCUS_02900 gene mprF 331027 333078 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036515.1 protein_id gnl|my_center|LOCUS_02900 333138 333851 gene locus_tag LOCUS_02910 333138 333851 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919535.1 protein_id gnl|my_center|LOCUS_02910 334771 333950 gene locus_tag LOCUS_02920 334771 333950 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532491.1 protein_id gnl|my_center|LOCUS_02920 335985 334768 gene locus_tag LOCUS_02930 gene tsaD 335985 334768 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626621.1 protein_id gnl|my_center|LOCUS_02930 336159 337232 gene locus_tag LOCUS_02940 gene hemC 336159 337232 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391315.1 protein_id gnl|my_center|LOCUS_02940 337329 338024 gene locus_tag LOCUS_02950 337329 338024 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528909.1 protein_id gnl|my_center|LOCUS_02950 338646 338149 gene locus_tag LOCUS_02960 gene secB 338646 338149 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391357.1 protein_id gnl|my_center|LOCUS_02960 339391 338873 gene locus_tag LOCUS_02970 339391 338873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 339565 340245 gene locus_tag LOCUS_02980 339565 340245 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_02980 340272 341084 gene locus_tag LOCUS_02990 340272 341084 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871021.1 protein_id gnl|my_center|LOCUS_02990 341280 342701 gene locus_tag LOCUS_03000 341280 342701 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262523.1 protein_id gnl|my_center|LOCUS_03000 342852 343427 gene locus_tag LOCUS_03010 342852 343427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 344741 343599 gene locus_tag LOCUS_03020 344741 343599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 345753 344839 gene locus_tag LOCUS_03030 gene hemF 345753 344839 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918394.1 protein_id gnl|my_center|LOCUS_03030 345988 347184 gene locus_tag LOCUS_03040 345988 347184 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599371.1 protein_id gnl|my_center|LOCUS_03040 347181 348035 gene locus_tag LOCUS_03050 347181 348035 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388115.1 protein_id gnl|my_center|LOCUS_03050 348022 348912 gene locus_tag LOCUS_03060 348022 348912 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537507.1 protein_id gnl|my_center|LOCUS_03060 348990 349811 gene locus_tag LOCUS_03070 348990 349811 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350071.1 protein_id gnl|my_center|LOCUS_03070 351659 349980 gene locus_tag LOCUS_03080 351659 349980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 <352992 351656 gene locus_tag LOCUS_03090 <352992 351656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096941.1:MFS transporter >Feature sequence02 1275 1069 gene locus_tag LOCUS_03100 1275 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 1490 1263 gene locus_tag LOCUS_03110 1490 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 1708 2364 gene locus_tag LOCUS_03120 1708 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03120 2401 2652 gene locus_tag LOCUS_03130 2401 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03130 2938 3348 gene locus_tag LOCUS_03140 2938 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03140 3358 3978 gene locus_tag LOCUS_03150 3358 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03150 4980 4393 gene locus_tag LOCUS_03160 4980 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5058 6653 gene locus_tag LOCUS_03170 5058 6653 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942354.1 protein_id gnl|my_center|LOCUS_03170 7206 6874 gene locus_tag LOCUS_03180 7206 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 7289 8179 gene locus_tag LOCUS_03190 7289 8179 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090741.1 protein_id gnl|my_center|LOCUS_03190 8227 9009 gene locus_tag LOCUS_03200 8227 9009 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531213.1 protein_id gnl|my_center|LOCUS_03200 9824 9360 gene locus_tag LOCUS_03210 9824 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 9823 10842 gene locus_tag LOCUS_03220 9823 10842 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969001.1 protein_id gnl|my_center|LOCUS_03220 10892 11326 gene locus_tag LOCUS_03230 10892 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 11328 12461 gene locus_tag LOCUS_03240 11328 12461 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086613793.1 protein_id gnl|my_center|LOCUS_03240 12710 12621 gene locus_tag LOCUS_t00040 12710 12621 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12927 13241 gene locus_tag LOCUS_03250 gene rplU 12927 13241 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003516451.1 protein_id gnl|my_center|LOCUS_03250 13302 13571 gene locus_tag LOCUS_03260 gene rpmA 13302 13571 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383240.1 protein_id gnl|my_center|LOCUS_03260 13678 14697 gene locus_tag LOCUS_03270 gene obgE 13678 14697 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388995.1 protein_id gnl|my_center|LOCUS_03270 15785 16513 gene locus_tag LOCUS_03280 15785 16513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 16914 18044 gene locus_tag LOCUS_03290 gene proB 16914 18044 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972562.1 protein_id gnl|my_center|LOCUS_03290 18725 18078 gene locus_tag LOCUS_03300 18725 18078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 19073 18801 gene locus_tag LOCUS_03310 19073 18801 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529099.1 protein_id gnl|my_center|LOCUS_03310 19335 20807 gene locus_tag LOCUS_03320 gene zwf 19335 20807 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327380.1 protein_id gnl|my_center|LOCUS_03320 20804 21250 gene locus_tag LOCUS_03330 20804 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 22382 21279 gene locus_tag LOCUS_03340 22382 21279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 23256 23729 gene locus_tag LOCUS_03350 gene mraZ 23256 23729 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599021.1 protein_id gnl|my_center|LOCUS_03350 23726 24742 gene locus_tag LOCUS_03360 gene rsmH 23726 24742 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388713.1 protein_id gnl|my_center|LOCUS_03360 24739 25722 gene locus_tag LOCUS_03370 24739 25722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 25761 27842 gene locus_tag LOCUS_03380 25761 27842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 27839 29329 gene locus_tag LOCUS_03390 27839 29329 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920415.1 protein_id gnl|my_center|LOCUS_03390 29326 30711 gene locus_tag LOCUS_03400 gene murF 29326 30711 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337237.1 protein_id gnl|my_center|LOCUS_03400 30715 31812 gene locus_tag LOCUS_03410 gene mraY 30715 31812 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719256.1 protein_id gnl|my_center|LOCUS_03410 31809 33236 gene locus_tag LOCUS_03420 gene murD 31809 33236 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388707.1 protein_id gnl|my_center|LOCUS_03420 33236 34402 gene locus_tag LOCUS_03430 33236 34402 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_03430 34399 35541 gene locus_tag LOCUS_03440 gene murG 34399 35541 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388705.1 protein_id gnl|my_center|LOCUS_03440 35538 36971 gene locus_tag LOCUS_03450 gene murC 35538 36971 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388704.1 protein_id gnl|my_center|LOCUS_03450 36968 37906 gene locus_tag LOCUS_03460 gene murB 36968 37906 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388703.1 protein_id gnl|my_center|LOCUS_03460 37903 38847 gene locus_tag LOCUS_03470 37903 38847 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242931.1 protein_id gnl|my_center|LOCUS_03470 38844 39779 gene locus_tag LOCUS_03480 38844 39779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 39779 41209 gene locus_tag LOCUS_03490 gene ftsA 39779 41209 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388700.1 protein_id gnl|my_center|LOCUS_03490 41299 42813 gene locus_tag LOCUS_03500 gene ftsZ 41299 42813 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920397.1 protein_id gnl|my_center|LOCUS_03500 42969 43952 gene locus_tag LOCUS_03510 gene lpxC 42969 43952 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640382.1 protein_id gnl|my_center|LOCUS_03510 44044 45051 gene locus_tag LOCUS_03520 44044 45051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 45238 46974 gene locus_tag LOCUS_03530 gene recN 45238 46974 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972043.1 protein_id gnl|my_center|LOCUS_03530 46967 49075 gene locus_tag LOCUS_03540 gene ligA 46967 49075 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388694.1 protein_id gnl|my_center|LOCUS_03540 49268 51943 gene locus_tag LOCUS_03550 gene ppdK 49268 51943 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_03550 51993 52826 gene locus_tag LOCUS_03560 51993 52826 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391362.1 protein_id gnl|my_center|LOCUS_03560 53361 53008 gene locus_tag LOCUS_03570 53361 53008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 54056 53541 gene locus_tag LOCUS_03580 gene uraD 54056 53541 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061423.1 protein_id gnl|my_center|LOCUS_03580 54209 54811 gene locus_tag LOCUS_03590 54209 54811 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811006.1 protein_id gnl|my_center|LOCUS_03590 55248 54844 gene locus_tag LOCUS_03600 55248 54844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 55653 57032 gene locus_tag LOCUS_03610 55653 57032 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388441.1 protein_id gnl|my_center|LOCUS_03610 57139 58341 gene locus_tag LOCUS_03620 57139 58341 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440341.1 protein_id gnl|my_center|LOCUS_03620 58338 58763 gene locus_tag LOCUS_03630 58338 58763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 58852 60225 gene locus_tag LOCUS_03640 gene gltX 58852 60225 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388446.1 protein_id gnl|my_center|LOCUS_03640 60932 62167 gene locus_tag LOCUS_03650 60932 62167 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543879.1 protein_id gnl|my_center|LOCUS_03650 63015 62485 gene locus_tag LOCUS_03660 63015 62485 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919453.1 protein_id gnl|my_center|LOCUS_03660 63169 62936 gene locus_tag LOCUS_03670 63169 62936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 64239 63220 gene locus_tag LOCUS_03680 gene ilvC 64239 63220 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388228.1 protein_id gnl|my_center|LOCUS_03680 64811 64293 gene locus_tag LOCUS_03690 gene ilvN 64811 64293 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_03690 66702 64888 gene locus_tag LOCUS_03700 66702 64888 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388226.1 protein_id gnl|my_center|LOCUS_03700 67759 66740 gene locus_tag LOCUS_03710 gene miaA 67759 66740 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388225.1 protein_id gnl|my_center|LOCUS_03710 67791 68675 gene locus_tag LOCUS_03720 gene serB 67791 68675 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388224.1 protein_id gnl|my_center|LOCUS_03720 68687 68881 gene locus_tag LOCUS_03730 68687 68881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 69954 68929 gene locus_tag LOCUS_03740 69954 68929 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_03740 70080 71285 gene locus_tag LOCUS_03750 gene rhlE 70080 71285 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007092.1 protein_id gnl|my_center|LOCUS_03750 72237 71275 gene locus_tag LOCUS_03760 72237 71275 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_03760 72512 73588 gene locus_tag LOCUS_03770 72512 73588 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040643.1 protein_id gnl|my_center|LOCUS_03770 74956 73667 gene locus_tag LOCUS_03780 74956 73667 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338519.1 protein_id gnl|my_center|LOCUS_03780 75143 76600 gene locus_tag LOCUS_03790 75143 76600 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_03790 76742 77746 gene locus_tag LOCUS_03800 gene hemB 76742 77746 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_03800 78071 78814 gene locus_tag LOCUS_03810 78071 78814 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389598.1 protein_id gnl|my_center|LOCUS_03810 79341 78892 gene locus_tag LOCUS_03820 gene arfB 79341 78892 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_03820 81821 79614 gene locus_tag LOCUS_03830 gene parC 81821 79614 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389601.1 protein_id gnl|my_center|LOCUS_03830 81993 82943 gene locus_tag LOCUS_03840 81993 82943 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971744.1 protein_id gnl|my_center|LOCUS_03840 83764 82979 gene locus_tag LOCUS_03850 gene recO 83764 82979 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389602.1 protein_id gnl|my_center|LOCUS_03850 84688 83783 gene locus_tag LOCUS_03860 gene tsf 84688 83783 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389462.1 protein_id gnl|my_center|LOCUS_03860 85618 84815 gene locus_tag LOCUS_03870 gene rpsB 85618 84815 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389461.1 protein_id gnl|my_center|LOCUS_03870 86880 85777 gene locus_tag LOCUS_03880 86880 85777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 87507 87139 gene locus_tag LOCUS_03890 87507 87139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 88404 87592 gene locus_tag LOCUS_03900 88404 87592 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388886.1 protein_id gnl|my_center|LOCUS_03900 89645 88401 gene locus_tag LOCUS_03910 89645 88401 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388887.1 protein_id gnl|my_center|LOCUS_03910 93240 89821 gene locus_tag LOCUS_03920 gene dnaE 93240 89821 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389457.1 protein_id gnl|my_center|LOCUS_03920 93388 94491 gene locus_tag LOCUS_03930 93388 94491 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258096.1 protein_id gnl|my_center|LOCUS_03930 95707 94955 gene locus_tag LOCUS_03940 gene cobM 95707 94955 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878846.1 protein_id gnl|my_center|LOCUS_03940 96085 95711 gene locus_tag LOCUS_03950 96085 95711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 97323 96082 gene locus_tag LOCUS_03960 97323 96082 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526984.1 protein_id gnl|my_center|LOCUS_03960 97430 98230 gene locus_tag LOCUS_03970 97430 98230 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337774.1 protein_id gnl|my_center|LOCUS_03970 98958 98200 gene locus_tag LOCUS_03980 98958 98200 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394055.1 protein_id gnl|my_center|LOCUS_03980 99692 98955 gene locus_tag LOCUS_03990 99692 98955 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067031.1 protein_id gnl|my_center|LOCUS_03990 100376 99699 gene locus_tag LOCUS_04000 100376 99699 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090251772.1 protein_id gnl|my_center|LOCUS_04000 101593 100340 gene locus_tag LOCUS_04010 gene cobG 101593 100340 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086048.1 protein_id gnl|my_center|LOCUS_04010 101839 102678 gene locus_tag LOCUS_04020 gene panC 101839 102678 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533318.1 protein_id gnl|my_center|LOCUS_04020 102717 103070 gene locus_tag LOCUS_04030 102717 103070 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813850.1 protein_id gnl|my_center|LOCUS_04030 103698 103378 gene locus_tag LOCUS_04040 103698 103378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 104032 104214 gene locus_tag LOCUS_04050 104032 104214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 104318 104243 gene locus_tag LOCUS_t00050 104318 104243 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 104449 105492 gene locus_tag LOCUS_04060 104449 105492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 107316 105562 gene locus_tag LOCUS_04070 107316 105562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 108813 107608 gene locus_tag LOCUS_04080 108813 107608 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086408.1 protein_id gnl|my_center|LOCUS_04080 110042 108816 gene locus_tag LOCUS_04090 110042 108816 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969860.1 protein_id gnl|my_center|LOCUS_04090 111169 110186 gene locus_tag LOCUS_04100 gene gluQRS 111169 110186 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_04100 111356 111105 gene locus_tag LOCUS_04110 111356 111105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 111650 112213 gene locus_tag LOCUS_04120 111650 112213 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533486.1 protein_id gnl|my_center|LOCUS_04120 112537 112238 gene locus_tag LOCUS_04130 112537 112238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 112994 112788 gene locus_tag LOCUS_04140 gene copZ 112994 112788 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 protein_id gnl|my_center|LOCUS_04140 113163 113828 gene locus_tag LOCUS_04150 113163 113828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875281.1 protein_id gnl|my_center|LOCUS_04150 113904 114063 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 115627 114086 gene locus_tag LOCUS_04160 115627 114086 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940879.1 protein_id gnl|my_center|LOCUS_04160 116479 116057 gene locus_tag LOCUS_04170 gene ndk 116479 116057 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390018.1 protein_id gnl|my_center|LOCUS_04170 116613 118511 gene locus_tag LOCUS_04180 116613 118511 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_04180 118698 119810 gene locus_tag LOCUS_04190 118698 119810 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035337.1 protein_id gnl|my_center|LOCUS_04190 119883 120560 gene locus_tag LOCUS_04200 119883 120560 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_04200 120557 121981 gene locus_tag LOCUS_04210 120557 121981 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_04210 122098 122454 gene locus_tag LOCUS_04220 122098 122454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 122451 123194 gene locus_tag LOCUS_04230 122451 123194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 123726 123292 gene locus_tag LOCUS_04240 gene infC 123726 123292 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_04240 125916 123985 gene locus_tag LOCUS_04250 gene thrS 125916 123985 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_04250 126866 125967 gene locus_tag LOCUS_04260 126866 125967 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_04260 127845 126925 gene locus_tag LOCUS_04270 127845 126925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 127904 129175 gene locus_tag LOCUS_04280 127904 129175 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211860579.1 protein_id gnl|my_center|LOCUS_04280 129233 130048 gene locus_tag LOCUS_04290 129233 130048 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919103.1 protein_id gnl|my_center|LOCUS_04290 130152 131009 gene locus_tag LOCUS_04300 130152 131009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 131035 132105 gene locus_tag LOCUS_04310 131035 132105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_04310 132108 133079 gene locus_tag LOCUS_04320 132108 133079 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084326.1 protein_id gnl|my_center|LOCUS_04320 133123 134184 gene locus_tag LOCUS_04330 133123 134184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 134915 134433 gene locus_tag LOCUS_04340 gene rnhA 134915 134433 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532769.1 protein_id gnl|my_center|LOCUS_04340 135873 134899 gene locus_tag LOCUS_04350 135873 134899 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390801.1 protein_id gnl|my_center|LOCUS_04350 136888 135887 gene locus_tag LOCUS_04360 gene ispH 136888 135887 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921190.1 protein_id gnl|my_center|LOCUS_04360 137130 137720 gene locus_tag LOCUS_04370 137130 137720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 139148 137787 gene locus_tag LOCUS_04380 139148 137787 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_04380 140992 139151 gene locus_tag LOCUS_04390 140992 139151 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_04390 145685 141132 gene locus_tag LOCUS_04400 gene gltB 145685 141132 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_04400 147143 145692 gene locus_tag LOCUS_04410 147143 145692 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385170.1 protein_id gnl|my_center|LOCUS_04410 148292 147321 gene locus_tag LOCUS_04420 148292 147321 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338750.1 protein_id gnl|my_center|LOCUS_04420 148606 148725 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 148726 148812 gene locus_tag LOCUS_t00060 148726 148812 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 151509 149413 gene locus_tag LOCUS_04430 151509 149413 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268301.1 protein_id gnl|my_center|LOCUS_04430 151778 152071 gene locus_tag LOCUS_04440 151778 152071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 152068 153552 gene locus_tag LOCUS_04450 152068 153552 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463402.1 protein_id gnl|my_center|LOCUS_04450 153549 153818 gene locus_tag LOCUS_04460 153549 153818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 154753 153815 gene locus_tag LOCUS_04470 154753 153815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 155246 158122 gene locus_tag LOCUS_04480 155246 158122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 158253 158984 gene locus_tag LOCUS_04490 gene hisG 158253 158984 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390582.1 protein_id gnl|my_center|LOCUS_04490 158999 160312 gene locus_tag LOCUS_04500 gene hisD 158999 160312 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338373.1 protein_id gnl|my_center|LOCUS_04500 160385 160603 gene locus_tag LOCUS_04510 gene infA 160385 160603 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617696.1 protein_id gnl|my_center|LOCUS_04510 160608 161240 gene locus_tag LOCUS_04520 160608 161240 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640472.1 protein_id gnl|my_center|LOCUS_04520 161237 162331 gene locus_tag LOCUS_04530 161237 162331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 162324 162509 gene locus_tag LOCUS_04540 gene yacG 162324 162509 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084078.1 protein_id gnl|my_center|LOCUS_04540 162564 162639 gene locus_tag LOCUS_t00070 162564 162639 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 162876 162748 gene locus_tag LOCUS_04550 162876 162748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 163262 162963 gene locus_tag LOCUS_04560 163262 162963 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598721.1 protein_id gnl|my_center|LOCUS_04560 163373 163448 gene locus_tag LOCUS_t00080 163373 163448 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 163498 164486 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctgagctgcctgtgcggcagtgaag 166143 164635 gene locus_tag LOCUS_04570 166143 164635 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190458.1 protein_id gnl|my_center|LOCUS_04570 166380 167600 gene locus_tag LOCUS_04580 166380 167600 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388109.1 protein_id gnl|my_center|LOCUS_04580 167753 168772 gene locus_tag LOCUS_04590 167753 168772 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391186.1 protein_id gnl|my_center|LOCUS_04590 169128 170387 gene locus_tag LOCUS_04600 169128 170387 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339050.1 protein_id gnl|my_center|LOCUS_04600 170801 170493 gene locus_tag LOCUS_04610 170801 170493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 172908 171085 gene locus_tag LOCUS_04620 gene typA 172908 171085 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_04620 173237 173542 gene locus_tag LOCUS_04630 173237 173542 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037004.1 protein_id gnl|my_center|LOCUS_04630 173539 175416 gene locus_tag LOCUS_04640 173539 175416 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_04640 175437 175667 gene locus_tag LOCUS_04650 175437 175667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 175828 176175 gene locus_tag LOCUS_04660 175828 176175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 176258 176725 gene locus_tag LOCUS_04670 176258 176725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 176845 177096 gene locus_tag LOCUS_04680 176845 177096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 177093 178541 gene locus_tag LOCUS_04690 177093 178541 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253029.1 protein_id gnl|my_center|LOCUS_04690 178994 179206 gene locus_tag LOCUS_04700 178994 179206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04700 179660 179241 gene locus_tag LOCUS_04710 179660 179241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 179830 180261 gene locus_tag LOCUS_04720 179830 180261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 181111 180329 gene locus_tag LOCUS_04730 181111 180329 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140366.1 protein_id gnl|my_center|LOCUS_04730 181583 181161 gene locus_tag LOCUS_04740 181583 181161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 182011 181583 gene locus_tag LOCUS_04750 182011 181583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 183060 182011 gene locus_tag LOCUS_04760 183060 182011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 183512 183060 gene locus_tag LOCUS_04770 183512 183060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 184678 183608 gene locus_tag LOCUS_04780 184678 183608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 185148 184675 gene locus_tag LOCUS_04790 185148 184675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 185786 185199 gene locus_tag LOCUS_04800 185786 185199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 187129 185783 gene locus_tag LOCUS_04810 187129 185783 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098807.1 protein_id gnl|my_center|LOCUS_04810 188541 187126 gene locus_tag LOCUS_04820 188541 187126 CDS product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269112.1 protein_id gnl|my_center|LOCUS_04820 190751 188538 gene locus_tag LOCUS_04830 190751 188538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 191237 190890 gene locus_tag LOCUS_04840 191237 190890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 191596 191234 gene locus_tag LOCUS_04850 191596 191234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 193090 191600 gene locus_tag LOCUS_04860 193090 191600 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072640.1 protein_id gnl|my_center|LOCUS_04860 193299 193093 gene locus_tag LOCUS_04870 193299 193093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 193922 193296 gene locus_tag LOCUS_04880 193922 193296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 194338 193916 gene locus_tag LOCUS_04890 194338 193916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 194608 194342 gene locus_tag LOCUS_04900 194608 194342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 195557 194619 gene locus_tag LOCUS_04910 195557 194619 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070999.1 protein_id gnl|my_center|LOCUS_04910 196015 195566 gene locus_tag LOCUS_04920 196015 195566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 197016 196018 gene locus_tag LOCUS_04930 197016 196018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 197736 197200 gene locus_tag LOCUS_04940 197736 197200 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070993.1 protein_id gnl|my_center|LOCUS_04940 199078 197897 gene locus_tag LOCUS_04950 199078 197897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 200789 199071 gene locus_tag LOCUS_04960 200789 199071 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072627.1 protein_id gnl|my_center|LOCUS_04960 201027 200791 gene locus_tag LOCUS_04970 201027 200791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 201269 201027 gene locus_tag LOCUS_04980 201269 201027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 202840 201266 gene locus_tag LOCUS_04990 202840 201266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169542415.1 protein_id gnl|my_center|LOCUS_04990 203406 202837 gene locus_tag LOCUS_05000 203406 202837 CDS product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072624.1 protein_id gnl|my_center|LOCUS_05000 203715 203410 gene locus_tag LOCUS_05010 203715 203410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 203933 203712 gene locus_tag LOCUS_05020 203933 203712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 204328 203939 gene locus_tag LOCUS_05030 204328 203939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 205139 204432 gene locus_tag LOCUS_05040 205139 204432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 205579 205199 gene locus_tag LOCUS_05050 205579 205199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 206526 205840 gene locus_tag LOCUS_05060 206526 205840 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072609.1 protein_id gnl|my_center|LOCUS_05060 206911 206519 gene locus_tag LOCUS_05070 206911 206519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 207215 206946 gene locus_tag LOCUS_05080 207215 206946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 207448 207212 gene locus_tag LOCUS_05090 207448 207212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 208080 207445 gene locus_tag LOCUS_05100 208080 207445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 208392 208090 gene locus_tag LOCUS_05110 208392 208090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 208697 208389 gene locus_tag LOCUS_05120 208697 208389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 208921 208694 gene locus_tag LOCUS_05130 208921 208694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 209211 208921 gene locus_tag LOCUS_05140 209211 208921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 210179 209217 gene locus_tag LOCUS_05150 210179 209217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 212191 210221 gene locus_tag LOCUS_05160 212191 210221 CDS product transposase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072599.1 protein_id gnl|my_center|LOCUS_05160 212297 212719 gene locus_tag LOCUS_05170 212297 212719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 213235 212780 gene locus_tag LOCUS_05180 213235 212780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 214050 213232 gene locus_tag LOCUS_05190 214050 213232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 214352 214047 gene locus_tag LOCUS_05200 214352 214047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 214638 215315 gene locus_tag LOCUS_05210 214638 215315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 215368 216042 gene locus_tag LOCUS_05220 215368 216042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 216322 216621 gene locus_tag LOCUS_05230 216322 216621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 216738 217916 gene locus_tag LOCUS_05240 216738 217916 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_05240 218182 220536 gene locus_tag LOCUS_05250 218182 220536 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269073.1 protein_id gnl|my_center|LOCUS_05250 220926 220621 gene locus_tag LOCUS_05260 220926 220621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 223749 221380 gene locus_tag LOCUS_05270 223749 221380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 223987 224062 gene locus_tag LOCUS_t00090 223987 224062 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 224151 225242 gene locus_tag LOCUS_05280 224151 225242 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_05280 225586 225281 gene locus_tag LOCUS_05290 225586 225281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 226145 227077 gene locus_tag LOCUS_05300 226145 227077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 227333 227968 gene locus_tag LOCUS_05310 227333 227968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 228005 228640 gene locus_tag LOCUS_05320 228005 228640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05320 229124 228945 gene locus_tag LOCUS_05330 229124 228945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 229878 229102 gene locus_tag LOCUS_05340 229878 229102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 230552 229875 gene locus_tag LOCUS_05350 230552 229875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 230977 230567 gene locus_tag LOCUS_05360 230977 230567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 231261 231581 gene locus_tag LOCUS_05370 231261 231581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence03 347 563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 938 1212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1440 1635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1714 1899 gene locus_tag LOCUS_05380 1714 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 2734 2849 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2892 3140 gene locus_tag LOCUS_05390 2892 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 4042 3272 gene locus_tag LOCUS_05400 4042 3272 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 protein_id gnl|my_center|LOCUS_05400 4158 5228 gene locus_tag LOCUS_05410 4158 5228 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_05410 5330 5460 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6592 5729 gene locus_tag LOCUS_05420 6592 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 7358 6606 gene locus_tag LOCUS_05430 7358 6606 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390260.1 protein_id gnl|my_center|LOCUS_05430 7633 7872 gene locus_tag LOCUS_05440 7633 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 7962 8360 gene locus_tag LOCUS_05450 7962 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 9743 8433 gene locus_tag LOCUS_05460 gene gltA 9743 8433 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531749.1 protein_id gnl|my_center|LOCUS_05460 10422 9895 gene locus_tag LOCUS_05470 10422 9895 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035432.1 protein_id gnl|my_center|LOCUS_05470 10736 10419 gene locus_tag LOCUS_05480 10736 10419 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528801.1 protein_id gnl|my_center|LOCUS_05480 11641 10805 gene locus_tag LOCUS_05490 11641 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 11827 13344 gene locus_tag LOCUS_05500 11827 13344 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921551.1 protein_id gnl|my_center|LOCUS_05500 14261 13503 gene locus_tag LOCUS_05510 14261 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 18798 14248 gene locus_tag LOCUS_05520 18798 14248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 19470 18838 gene locus_tag LOCUS_05530 19470 18838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 20490 19555 gene locus_tag LOCUS_05540 20490 19555 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_05540 21026 20487 gene locus_tag LOCUS_05550 gene ybeY 21026 20487 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527905.1 protein_id gnl|my_center|LOCUS_05550 22122 21010 gene locus_tag LOCUS_05560 22122 21010 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 protein_id gnl|my_center|LOCUS_05560 23438 22119 gene locus_tag LOCUS_05570 gene miaB 23438 22119 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391517.1 protein_id gnl|my_center|LOCUS_05570 24611 23688 gene locus_tag LOCUS_05580 24611 23688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 25062 26981 gene locus_tag LOCUS_05590 25062 26981 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972438.1 protein_id gnl|my_center|LOCUS_05590 26981 31387 gene locus_tag LOCUS_05600 26981 31387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 32363 31557 gene locus_tag LOCUS_05610 32363 31557 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528894.1 protein_id gnl|my_center|LOCUS_05610 32474 33559 gene locus_tag LOCUS_05620 32474 33559 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640575.1 protein_id gnl|my_center|LOCUS_05620 33823 35739 gene locus_tag LOCUS_05630 gene uvrC 33823 35739 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389875.1 protein_id gnl|my_center|LOCUS_05630 35839 36408 gene locus_tag LOCUS_05640 gene pgsA 35839 36408 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090204.1 protein_id gnl|my_center|LOCUS_05640 36575 37096 gene locus_tag LOCUS_05650 36575 37096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 37142 37405 gene locus_tag LOCUS_05660 gene moaD 37142 37405 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390441.1 protein_id gnl|my_center|LOCUS_05660 37411 37860 gene locus_tag LOCUS_05670 37411 37860 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969085.1 protein_id gnl|my_center|LOCUS_05670 39235 37946 gene locus_tag LOCUS_05680 39235 37946 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930773.1 protein_id gnl|my_center|LOCUS_05680 39339 40493 gene locus_tag LOCUS_05690 gene bioF 39339 40493 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449714.1 protein_id gnl|my_center|LOCUS_05690 40490 41167 gene locus_tag LOCUS_05700 40490 41167 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063999.1 protein_id gnl|my_center|LOCUS_05700 41187 42587 gene locus_tag LOCUS_05710 gene bioD 41187 42587 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064000.1 protein_id gnl|my_center|LOCUS_05710 43435 42770 gene locus_tag LOCUS_05720 gene lexA 43435 42770 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971587.1 protein_id gnl|my_center|LOCUS_05720 43724 44968 gene locus_tag LOCUS_05730 43724 44968 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189302.1 protein_id gnl|my_center|LOCUS_05730 45142 44960 gene locus_tag LOCUS_05740 45142 44960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 46692 45493 gene locus_tag LOCUS_05750 46692 45493 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_05750 46835 47002 gene locus_tag LOCUS_05760 gene rpmG 46835 47002 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920317.1 protein_id gnl|my_center|LOCUS_05760 47652 47086 gene locus_tag LOCUS_05770 47652 47086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098290.1 protein_id gnl|my_center|LOCUS_05770 48025 47696 gene locus_tag LOCUS_05780 48025 47696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 49468 48191 gene locus_tag LOCUS_05790 gene eno 49468 48191 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389638.1 protein_id gnl|my_center|LOCUS_05790 49680 50138 gene locus_tag LOCUS_05800 49680 50138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 50255 51229 gene locus_tag LOCUS_05810 gene thiO 50255 51229 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972408.1 protein_id gnl|my_center|LOCUS_05810 51308 51505 gene locus_tag LOCUS_05820 gene thiS 51308 51505 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972407.1 protein_id gnl|my_center|LOCUS_05820 51509 52285 gene locus_tag LOCUS_05830 51509 52285 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529413.1 protein_id gnl|my_center|LOCUS_05830 52282 52890 gene locus_tag LOCUS_05840 52282 52890 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969797.1 protein_id gnl|my_center|LOCUS_05840 55008 52909 gene locus_tag LOCUS_05850 gene recG 55008 52909 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 protein_id gnl|my_center|LOCUS_05850 55119 55430 gene locus_tag LOCUS_05860 55119 55430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 55427 58897 gene locus_tag LOCUS_05870 gene mfd 55427 58897 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389416.1 protein_id gnl|my_center|LOCUS_05870 59012 62902 gene locus_tag LOCUS_05880 59012 62902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 63855 62977 gene locus_tag LOCUS_05890 63855 62977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 64022 64996 gene locus_tag LOCUS_05900 64022 64996 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 protein_id gnl|my_center|LOCUS_05900 65001 66470 gene locus_tag LOCUS_05910 65001 66470 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 protein_id gnl|my_center|LOCUS_05910 68399 66459 gene locus_tag LOCUS_05920 gene cobT 68399 66459 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529369.1 protein_id gnl|my_center|LOCUS_05920 69435 68428 gene locus_tag LOCUS_05930 gene cobS 69435 68428 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_05930 70072 69533 gene locus_tag LOCUS_05940 70072 69533 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_05940 70189 70527 gene locus_tag LOCUS_05950 70189 70527 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529365.1 protein_id gnl|my_center|LOCUS_05950 70524 71117 gene locus_tag LOCUS_05960 70524 71117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 71784 71095 gene locus_tag LOCUS_05970 gene lipB 71784 71095 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337049.1 protein_id gnl|my_center|LOCUS_05970 71860 71946 gene locus_tag LOCUS_t00100 71860 71946 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 72340 73131 gene locus_tag LOCUS_05980 gene galU 72340 73131 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_05980 73240 74256 gene locus_tag LOCUS_05990 gene moaA 73240 74256 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388276.1 protein_id gnl|my_center|LOCUS_05990 75143 74262 gene locus_tag LOCUS_06000 75143 74262 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 protein_id gnl|my_center|LOCUS_06000 75191 76003 gene locus_tag LOCUS_06010 75191 76003 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338779.1 protein_id gnl|my_center|LOCUS_06010 76071 76331 gene locus_tag LOCUS_06020 gene grxC 76071 76331 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388496.1 protein_id gnl|my_center|LOCUS_06020 76385 76843 gene locus_tag LOCUS_06030 76385 76843 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 protein_id gnl|my_center|LOCUS_06030 76917 77387 gene locus_tag LOCUS_06040 76917 77387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 77418 78686 gene locus_tag LOCUS_06050 77418 78686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 79429 78689 gene locus_tag LOCUS_06060 79429 78689 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388500.1 protein_id gnl|my_center|LOCUS_06060 79604 80857 gene locus_tag LOCUS_06070 79604 80857 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388501.1 protein_id gnl|my_center|LOCUS_06070 80850 81935 gene locus_tag LOCUS_06080 80850 81935 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_06080 81928 83184 gene locus_tag LOCUS_06090 81928 83184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 83318 84478 gene locus_tag LOCUS_06100 gene ispG 83318 84478 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918736.1 protein_id gnl|my_center|LOCUS_06100 84598 85866 gene locus_tag LOCUS_06110 gene hisS 84598 85866 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388506.1 protein_id gnl|my_center|LOCUS_06110 85863 86921 gene locus_tag LOCUS_06120 gene prfA 85863 86921 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337837.1 protein_id gnl|my_center|LOCUS_06120 87439 86963 gene locus_tag LOCUS_06130 87439 86963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 87419 88363 gene locus_tag LOCUS_06140 gene prmC 87419 88363 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_06140 88692 89060 gene locus_tag LOCUS_06150 88692 89060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 89664 89590 gene locus_tag LOCUS_t00110 89664 89590 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 90232 89774 gene locus_tag LOCUS_06160 gene mlaD 90232 89774 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545373.1 protein_id gnl|my_center|LOCUS_06160 90392 91207 gene locus_tag LOCUS_06170 90392 91207 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939922.1 protein_id gnl|my_center|LOCUS_06170 91456 92886 gene locus_tag LOCUS_06180 91456 92886 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265679.1 protein_id gnl|my_center|LOCUS_06180 93989 92904 gene locus_tag LOCUS_06190 93989 92904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217407.1 protein_id gnl|my_center|LOCUS_06190 94564 93986 gene locus_tag LOCUS_06200 94564 93986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 94862 95767 gene locus_tag LOCUS_06210 94862 95767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 95839 96651 gene locus_tag LOCUS_06220 95839 96651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 96660 97868 gene locus_tag LOCUS_06230 96660 97868 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_06230 97872 98510 gene locus_tag LOCUS_06240 gene tmk 97872 98510 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_06240 98517 99464 gene locus_tag LOCUS_06250 98517 99464 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 protein_id gnl|my_center|LOCUS_06250 99461 100999 gene locus_tag LOCUS_06260 gene metG 99461 100999 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389391.1 protein_id gnl|my_center|LOCUS_06260 101003 101803 gene locus_tag LOCUS_06270 101003 101803 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_06270 101816 102616 gene locus_tag LOCUS_06280 101816 102616 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 protein_id gnl|my_center|LOCUS_06280 103570 102659 gene locus_tag LOCUS_06290 103570 102659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 104615 103737 gene locus_tag LOCUS_06300 104615 103737 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_06300 105294 104656 gene locus_tag LOCUS_06310 gene pdxH 105294 104656 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918802.1 protein_id gnl|my_center|LOCUS_06310 105586 106425 gene locus_tag LOCUS_06320 gene fabI 105586 106425 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383908.1 protein_id gnl|my_center|LOCUS_06320 106436 107509 gene locus_tag LOCUS_06330 gene aroC 106436 107509 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971124.1 protein_id gnl|my_center|LOCUS_06330 107942 107511 gene locus_tag LOCUS_06340 107942 107511 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096537.1 protein_id gnl|my_center|LOCUS_06340 108219 109715 gene locus_tag LOCUS_06350 108219 109715 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102300.1 protein_id gnl|my_center|LOCUS_06350 110509 109985 gene locus_tag LOCUS_06360 110509 109985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 111233 110502 gene locus_tag LOCUS_06370 gene queC 111233 110502 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174058.1 protein_id gnl|my_center|LOCUS_06370 111871 111236 gene locus_tag LOCUS_06380 gene queE 111871 111236 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_06380 112906 111887 gene locus_tag LOCUS_06390 gene bioB 112906 111887 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_06390 113234 113049 gene locus_tag LOCUS_06400 113234 113049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 113905 114591 gene locus_tag LOCUS_06410 113905 114591 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529564.1 protein_id gnl|my_center|LOCUS_06410 114646 115440 gene locus_tag LOCUS_06420 114646 115440 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084292.1 protein_id gnl|my_center|LOCUS_06420 115467 117347 gene locus_tag LOCUS_06430 gene cysC 115467 117347 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 protein_id gnl|my_center|LOCUS_06430 117494 118345 gene locus_tag LOCUS_06440 gene cysT 117494 118345 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975580.1 protein_id gnl|my_center|LOCUS_06440 118342 119145 gene locus_tag LOCUS_06450 gene cysW 118342 119145 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391149.1 protein_id gnl|my_center|LOCUS_06450 119196 120215 gene locus_tag LOCUS_06460 gene cysA 119196 120215 CDS product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098202.1 protein_id gnl|my_center|LOCUS_06460 120362 120709 gene locus_tag LOCUS_06470 120362 120709 CDS product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328167.1 protein_id gnl|my_center|LOCUS_06470 120754 122448 gene locus_tag LOCUS_06480 120754 122448 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975275.1 protein_id gnl|my_center|LOCUS_06480 122435 122926 gene locus_tag LOCUS_06490 122435 122926 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084296.1 protein_id gnl|my_center|LOCUS_06490 122942 124957 gene locus_tag LOCUS_06500 122942 124957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 125098 125958 gene locus_tag LOCUS_06510 gene lpxK 125098 125958 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388340.1 protein_id gnl|my_center|LOCUS_06510 125955 126872 gene locus_tag LOCUS_06520 125955 126872 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_06520 126974 127771 gene locus_tag LOCUS_06530 126974 127771 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975064.1 protein_id gnl|my_center|LOCUS_06530 127867 128715 gene locus_tag LOCUS_06540 127867 128715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 129754 128783 gene locus_tag LOCUS_06550 129754 128783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 131029 129797 gene locus_tag LOCUS_06560 gene fabF 131029 129797 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337505.1 protein_id gnl|my_center|LOCUS_06560 131405 131166 gene locus_tag LOCUS_06570 131405 131166 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_06570 131627 131448 gene locus_tag LOCUS_06580 131627 131448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 132419 131676 gene locus_tag LOCUS_06590 gene fabG 132419 131676 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 protein_id gnl|my_center|LOCUS_06590 133384 132440 gene locus_tag LOCUS_06600 gene fabD 133384 132440 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086857.1 protein_id gnl|my_center|LOCUS_06600 134122 133571 gene locus_tag LOCUS_06610 134122 133571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 135389 134130 gene locus_tag LOCUS_06620 135389 134130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 136160 135411 gene locus_tag LOCUS_06630 136160 135411 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896563.1 protein_id gnl|my_center|LOCUS_06630 136761 136405 gene locus_tag LOCUS_06640 136761 136405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 138032 136971 gene locus_tag LOCUS_06650 138032 136971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 138415 139122 gene locus_tag LOCUS_06660 138415 139122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 139710 139213 gene locus_tag LOCUS_06670 gene smpB 139710 139213 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389617.1 protein_id gnl|my_center|LOCUS_06670 140600 139710 gene locus_tag LOCUS_06680 gene dapA 140600 139710 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171604.1 protein_id gnl|my_center|LOCUS_06680 141507 140611 gene locus_tag LOCUS_06690 141507 140611 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720888.1 protein_id gnl|my_center|LOCUS_06690 142250 141504 gene locus_tag LOCUS_06700 142250 141504 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626528.1 protein_id gnl|my_center|LOCUS_06700 142407 142931 gene locus_tag LOCUS_06710 142407 142931 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969576.1 protein_id gnl|my_center|LOCUS_06710 142928 143740 gene locus_tag LOCUS_06720 gene hisN 142928 143740 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_06720 143823 145076 gene locus_tag LOCUS_06730 gene serA 143823 145076 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175507.1 protein_id gnl|my_center|LOCUS_06730 145101 146600 gene locus_tag LOCUS_06740 145101 146600 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 protein_id gnl|my_center|LOCUS_06740 147841 146636 gene locus_tag LOCUS_06750 gene metC 147841 146636 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389303.1 protein_id gnl|my_center|LOCUS_06750 148689 147838 gene locus_tag LOCUS_06760 gene sseA 148689 147838 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966391.1 protein_id gnl|my_center|LOCUS_06760 149297 149998 gene locus_tag LOCUS_06770 149297 149998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 149998 150699 gene locus_tag LOCUS_06780 149998 150699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 152121 150694 gene locus_tag LOCUS_06790 gene cls 152121 150694 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034050559.1 protein_id gnl|my_center|LOCUS_06790 152159 152569 gene locus_tag LOCUS_06800 152159 152569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 152950 152648 gene locus_tag LOCUS_06810 152950 152648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 153362 153024 gene locus_tag LOCUS_06820 gene grxD 153362 153024 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531377.1 protein_id gnl|my_center|LOCUS_06820 153622 153392 gene locus_tag LOCUS_06830 153622 153392 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_06830 155844 153646 gene locus_tag LOCUS_06840 gene purL 155844 153646 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388466.1 protein_id gnl|my_center|LOCUS_06840 156542 155841 gene locus_tag LOCUS_06850 gene purQ 156542 155841 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388467.1 protein_id gnl|my_center|LOCUS_06850 156913 156539 gene locus_tag LOCUS_06860 156913 156539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 157152 156910 gene locus_tag LOCUS_06870 gene purS 157152 156910 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337254.1 protein_id gnl|my_center|LOCUS_06870 157955 157188 gene locus_tag LOCUS_06880 157955 157188 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708153.1 protein_id gnl|my_center|LOCUS_06880 159431 158082 gene locus_tag LOCUS_06890 gene purB 159431 158082 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383544.1 protein_id gnl|my_center|LOCUS_06890 159593 160204 gene locus_tag LOCUS_06900 159593 160204 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328752.1 protein_id gnl|my_center|LOCUS_06900 160331 162250 gene locus_tag LOCUS_06910 160331 162250 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389619.1 protein_id gnl|my_center|LOCUS_06910 162250 162705 gene locus_tag LOCUS_06920 162250 162705 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_06920 162728 163252 gene locus_tag LOCUS_06930 gene pncC 162728 163252 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703241.1 protein_id gnl|my_center|LOCUS_06930 163631 163296 gene locus_tag LOCUS_06940 163631 163296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 164123 163662 gene locus_tag LOCUS_06950 164123 163662 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_06950 165097 164123 gene locus_tag LOCUS_06960 gene lipA 165097 164123 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919603.1 protein_id gnl|my_center|LOCUS_06960 166639 165227 gene locus_tag LOCUS_06970 gene lpdA 166639 165227 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670037.1 protein_id gnl|my_center|LOCUS_06970 167906 166656 gene locus_tag LOCUS_06980 167906 166656 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_06980 169275 167920 gene locus_tag LOCUS_06990 169275 167920 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389633.1 protein_id gnl|my_center|LOCUS_06990 170291 169281 gene locus_tag LOCUS_07000 gene pdhA 170291 169281 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975252.1 protein_id gnl|my_center|LOCUS_07000 170837 170406 gene locus_tag LOCUS_07010 gene moaC 170837 170406 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639855.1 protein_id gnl|my_center|LOCUS_07010 171758 170892 gene locus_tag LOCUS_07020 gene trpC 171758 170892 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389650.1 protein_id gnl|my_center|LOCUS_07020 172873 171761 gene locus_tag LOCUS_07030 gene trpD 172873 171761 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531738.1 protein_id gnl|my_center|LOCUS_07030 173474 172878 gene locus_tag LOCUS_07040 173474 172878 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_07040 175066 173531 gene locus_tag LOCUS_07050 gene trpE 175066 173531 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919761.1 protein_id gnl|my_center|LOCUS_07050 176979 175063 gene locus_tag LOCUS_07060 176979 175063 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389643.1 protein_id gnl|my_center|LOCUS_07060 177180 177935 gene locus_tag LOCUS_07070 gene tpiA 177180 177935 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337104.1 protein_id gnl|my_center|LOCUS_07070 177960 178325 gene locus_tag LOCUS_07080 177960 178325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 178469 180100 gene locus_tag LOCUS_07090 178469 180100 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389640.1 protein_id gnl|my_center|LOCUS_07090 180097 180933 gene locus_tag LOCUS_07100 gene kdsA 180097 180933 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724637.1 protein_id gnl|my_center|LOCUS_07100 183449 181008 gene locus_tag LOCUS_07110 gene gyrB 183449 181008 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387765.1 protein_id gnl|my_center|LOCUS_07110 184659 183550 gene locus_tag LOCUS_07120 gene recF 184659 183550 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527878.1 protein_id gnl|my_center|LOCUS_07120 185895 184771 gene locus_tag LOCUS_07130 gene dnaN 185895 184771 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_07130 185816 186049 gene locus_tag LOCUS_07140 185816 186049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 187471 186026 gene locus_tag LOCUS_07150 gene dnaA 187471 186026 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_07150 188081 187812 gene locus_tag LOCUS_07160 gene rpsT 188081 187812 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241581.1 protein_id gnl|my_center|LOCUS_07160 189026 188217 gene locus_tag LOCUS_07170 gene mutM 189026 188217 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385127.1 protein_id gnl|my_center|LOCUS_07170 189086 189868 gene locus_tag LOCUS_07180 gene ubiE 189086 189868 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626664.1 protein_id gnl|my_center|LOCUS_07180 189884 191113 gene locus_tag LOCUS_07190 gene coaBC 189884 191113 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 protein_id gnl|my_center|LOCUS_07190 191137 191616 gene locus_tag LOCUS_07200 gene dut 191137 191616 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_07200 191613 193388 gene locus_tag LOCUS_07210 191613 193388 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192556.1 protein_id gnl|my_center|LOCUS_07210 193391 194746 gene locus_tag LOCUS_07220 193391 194746 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192968.1 protein_id gnl|my_center|LOCUS_07220 194774 194903 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 195464 194931 gene locus_tag LOCUS_07230 gene msrA 195464 194931 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814600.1 protein_id gnl|my_center|LOCUS_07230 198233 195540 gene locus_tag LOCUS_07240 198233 195540 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389549.1 protein_id gnl|my_center|LOCUS_07240 199071 198376 gene locus_tag LOCUS_07250 199071 198376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 200529 199102 gene locus_tag LOCUS_07260 200529 199102 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_07260 200803 200876 gene locus_tag LOCUS_t00120 200803 200876 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 201946 201155 gene locus_tag LOCUS_07270 201946 201155 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811236.1 protein_id gnl|my_center|LOCUS_07270 202020 203177 gene locus_tag LOCUS_07280 202020 203177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 protein_id gnl|my_center|LOCUS_07280 204183 203206 gene locus_tag LOCUS_07290 gene thiL 204183 203206 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389573.1 protein_id gnl|my_center|LOCUS_07290 204697 204164 gene locus_tag LOCUS_07300 gene nusB 204697 204164 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841646.1 protein_id gnl|my_center|LOCUS_07300 205238 204747 gene locus_tag LOCUS_07310 gene nrdR 205238 204747 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389579.1 protein_id gnl|my_center|LOCUS_07310 205392 205889 gene locus_tag LOCUS_07320 205392 205889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 207436 205940 gene locus_tag LOCUS_07330 gene glpK 207436 205940 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531806.1 protein_id gnl|my_center|LOCUS_07330 208287 207469 gene locus_tag LOCUS_07340 208287 207469 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035613.1 protein_id gnl|my_center|LOCUS_07340 209863 208343 gene locus_tag LOCUS_07350 gene glpD 209863 208343 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526148.1 protein_id gnl|my_center|LOCUS_07350 210759 209992 gene locus_tag LOCUS_07360 210759 209992 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705542.1 protein_id gnl|my_center|LOCUS_07360 212645 210765 gene locus_tag LOCUS_07370 gene recQ 212645 210765 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245677.1 protein_id gnl|my_center|LOCUS_07370 213030 212653 gene locus_tag LOCUS_07380 213030 212653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 214846 213140 gene locus_tag LOCUS_07390 gene cydC 214846 213140 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202266.1 protein_id gnl|my_center|LOCUS_07390 216588 214843 gene locus_tag LOCUS_07400 gene cydD 216588 214843 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097322.1 protein_id gnl|my_center|LOCUS_07400 218438 216699 gene locus_tag LOCUS_07410 218438 216699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 218703 218473 gene locus_tag LOCUS_07420 218703 218473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 219334 218759 gene locus_tag LOCUS_07430 219334 218759 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529285.1 protein_id gnl|my_center|LOCUS_07430 220023 219430 gene locus_tag LOCUS_07440 220023 219430 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529285.1 protein_id gnl|my_center|LOCUS_07440 220051 220797 gene locus_tag LOCUS_07450 gene rsiB1 220051 220797 CDS product PhyR-type response regulator RsiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525566.1 protein_id gnl|my_center|LOCUS_07450 220891 222714 gene locus_tag LOCUS_07460 220891 222714 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_07460 222771 222845 gene locus_tag LOCUS_t00130 222771 222845 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 224489 223179 gene locus_tag LOCUS_07470 224489 223179 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704253.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence04 590 363 gene locus_tag LOCUS_07480 590 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1193 1780 gene locus_tag LOCUS_07490 1193 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3390 2380 gene locus_tag LOCUS_07500 3390 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 4194 4109 gene locus_tag LOCUS_t00140 4194 4109 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4362 5180 gene locus_tag LOCUS_07510 gene panB 4362 5180 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815281.1 protein_id gnl|my_center|LOCUS_07510 6299 5208 gene locus_tag LOCUS_07520 6299 5208 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036367.1 protein_id gnl|my_center|LOCUS_07520 6408 6719 gene locus_tag LOCUS_07530 6408 6719 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770289.1 protein_id gnl|my_center|LOCUS_07530 7596 6985 gene locus_tag LOCUS_07540 7596 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 8872 7886 gene locus_tag LOCUS_07550 gene galE 8872 7886 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_07550 11743 8954 gene locus_tag LOCUS_07560 11743 8954 CDS product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973176.1 protein_id gnl|my_center|LOCUS_07560 13086 11740 gene locus_tag LOCUS_07570 gene lysA 13086 11740 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383406.1 protein_id gnl|my_center|LOCUS_07570 13385 13245 gene locus_tag LOCUS_07580 13385 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 14860 13406 gene locus_tag LOCUS_07590 gene argH 14860 13406 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338440.1 protein_id gnl|my_center|LOCUS_07590 15072 15389 gene locus_tag LOCUS_07600 15072 15389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 15706 16521 gene locus_tag LOCUS_07610 15706 16521 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036073.1 protein_id gnl|my_center|LOCUS_07610 16518 17387 gene locus_tag LOCUS_07620 16518 17387 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391360.1 protein_id gnl|my_center|LOCUS_07620 17494 18081 gene locus_tag LOCUS_07630 gene coaE 17494 18081 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083466.1 protein_id gnl|my_center|LOCUS_07630 18078 18752 gene locus_tag LOCUS_07640 gene dnaQ 18078 18752 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_07640 18908 19432 gene locus_tag LOCUS_07650 18908 19432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 20643 19489 gene locus_tag LOCUS_07660 20643 19489 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_07660 22768 20651 gene locus_tag LOCUS_07670 22768 20651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 23531 22860 gene locus_tag LOCUS_07680 gene rpe 23531 22860 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975644.1 protein_id gnl|my_center|LOCUS_07680 24919 23588 gene locus_tag LOCUS_07690 24919 23588 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391407.1 protein_id gnl|my_center|LOCUS_07690 25596 24973 gene locus_tag LOCUS_07700 gene purN 25596 24973 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919571.1 protein_id gnl|my_center|LOCUS_07700 26687 25605 gene locus_tag LOCUS_07710 gene purM 26687 25605 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337122.1 protein_id gnl|my_center|LOCUS_07710 26790 27638 gene locus_tag LOCUS_07720 gene hdaA 26790 27638 CDS product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532442.1 protein_id gnl|my_center|LOCUS_07720 27828 29894 gene locus_tag LOCUS_07730 27828 29894 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_07730 30145 32409 gene locus_tag LOCUS_07740 30145 32409 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390010.1 protein_id gnl|my_center|LOCUS_07740 32476 33972 gene locus_tag LOCUS_07750 gene ppx 32476 33972 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_07750 34184 36520 gene locus_tag LOCUS_07760 34184 36520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 36517 37410 gene locus_tag LOCUS_07770 36517 37410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 37414 38115 gene locus_tag LOCUS_07780 37414 38115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 38115 39065 gene locus_tag LOCUS_07790 38115 39065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 39062 39997 gene locus_tag LOCUS_07800 39062 39997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 41824 40394 gene locus_tag LOCUS_07810 41824 40394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 42669 41821 gene locus_tag LOCUS_07820 42669 41821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 44180 42846 gene locus_tag LOCUS_07830 gene guaD 44180 42846 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207678.1 protein_id gnl|my_center|LOCUS_07830 44363 45406 gene locus_tag LOCUS_07840 44363 45406 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_07840 47628 45403 gene locus_tag LOCUS_07850 47628 45403 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192976.1 protein_id gnl|my_center|LOCUS_07850 50026 47846 gene locus_tag LOCUS_07860 50026 47846 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004348771.1 protein_id gnl|my_center|LOCUS_07860 50280 50651 gene locus_tag LOCUS_07870 50280 50651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 50773 51297 gene locus_tag LOCUS_07880 50773 51297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 51645 51421 gene locus_tag LOCUS_07890 51645 51421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 52458 51727 gene locus_tag LOCUS_07900 52458 51727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 52972 52466 gene locus_tag LOCUS_07910 52972 52466 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992253.1 protein_id gnl|my_center|LOCUS_07910 53553 52969 gene locus_tag LOCUS_07920 53553 52969 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083302.1 protein_id gnl|my_center|LOCUS_07920 55535 53550 gene locus_tag LOCUS_07930 55535 53550 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085911.1 protein_id gnl|my_center|LOCUS_07930 56126 55596 gene locus_tag LOCUS_07940 gene ccmE 56126 55596 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085910.1 protein_id gnl|my_center|LOCUS_07940 56284 56123 gene locus_tag LOCUS_07950 56284 56123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 57054 56281 gene locus_tag LOCUS_07960 57054 56281 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_07960 57220 57513 gene locus_tag LOCUS_07970 57220 57513 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528905.1 protein_id gnl|my_center|LOCUS_07970 57517 57936 gene locus_tag LOCUS_07980 57517 57936 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_07980 58368 58030 gene locus_tag LOCUS_07990 58368 58030 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532310.1 protein_id gnl|my_center|LOCUS_07990 59111 58407 gene locus_tag LOCUS_08000 59111 58407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 59465 60295 gene locus_tag LOCUS_08010 59465 60295 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118012.1 protein_id gnl|my_center|LOCUS_08010 60443 61492 gene locus_tag LOCUS_08020 60443 61492 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064355.1 protein_id gnl|my_center|LOCUS_08020 61499 61949 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctgagctgcctgtgcggcagtgaag 62358 62173 gene locus_tag LOCUS_08030 62358 62173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 63382 62408 gene locus_tag LOCUS_08040 63382 62408 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_08040 63564 64217 gene locus_tag LOCUS_08050 gene aat 63564 64217 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533070.1 protein_id gnl|my_center|LOCUS_08050 64264 65133 gene locus_tag LOCUS_08060 64264 65133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 65130 65843 gene locus_tag LOCUS_08070 65130 65843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 65862 66470 gene locus_tag LOCUS_08080 65862 66470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 69697 66488 gene locus_tag LOCUS_08090 69697 66488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 69784 72912 gene locus_tag LOCUS_08100 69784 72912 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389791.1 protein_id gnl|my_center|LOCUS_08100 73026 73502 gene locus_tag LOCUS_08110 73026 73502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 73782 73928 gene locus_tag LOCUS_08120 73782 73928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 74303 73914 gene locus_tag LOCUS_08130 74303 73914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 75591 74317 gene locus_tag LOCUS_08140 75591 74317 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548802.1 protein_id gnl|my_center|LOCUS_08140 76944 75634 gene locus_tag LOCUS_08150 76944 75634 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398962.1 protein_id gnl|my_center|LOCUS_08150 77373 78116 gene locus_tag LOCUS_08160 77373 78116 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175307.1 protein_id gnl|my_center|LOCUS_08160 78082 79461 gene locus_tag LOCUS_08170 78082 79461 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083135.1 protein_id gnl|my_center|LOCUS_08170 79591 82761 gene locus_tag LOCUS_08180 79591 82761 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_08180 82758 84098 gene locus_tag LOCUS_08190 82758 84098 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_08190 84095 85675 gene locus_tag LOCUS_08200 84095 85675 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 protein_id gnl|my_center|LOCUS_08200 85813 86244 gene locus_tag LOCUS_08210 gene rplK 85813 86244 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390509.1 protein_id gnl|my_center|LOCUS_08210 86249 86941 gene locus_tag LOCUS_08220 gene rplA 86249 86941 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385334.1 protein_id gnl|my_center|LOCUS_08220 87231 87755 gene locus_tag LOCUS_08230 gene rplJ 87231 87755 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536192.1 protein_id gnl|my_center|LOCUS_08230 87853 88227 gene locus_tag LOCUS_08240 gene rplL 87853 88227 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390506.1 protein_id gnl|my_center|LOCUS_08240 88459 92631 gene locus_tag LOCUS_08250 gene rpoB 88459 92631 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390505.1 protein_id gnl|my_center|LOCUS_08250 92737 96912 gene locus_tag LOCUS_08260 gene rpoC 92737 96912 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390504.1 protein_id gnl|my_center|LOCUS_08260 97265 97636 gene locus_tag LOCUS_08270 gene rpsL 97265 97636 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_08270 97651 98127 gene locus_tag LOCUS_08280 gene rpsG 97651 98127 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707751.1 protein_id gnl|my_center|LOCUS_08280 98220 99410 gene locus_tag LOCUS_08290 gene tuf 98220 99410 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088152.1 protein_id gnl|my_center|LOCUS_08290 99519 99827 gene locus_tag LOCUS_08300 gene rpsJ 99519 99827 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002712302.1 protein_id gnl|my_center|LOCUS_08300 99838 100521 gene locus_tag LOCUS_08310 gene rplC 99838 100521 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919127.1 protein_id gnl|my_center|LOCUS_08310 100526 101140 gene locus_tag LOCUS_08320 gene rplD 100526 101140 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385320.1 protein_id gnl|my_center|LOCUS_08320 101137 101472 gene locus_tag LOCUS_08330 101137 101472 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440457.1 protein_id gnl|my_center|LOCUS_08330 101489 102319 gene locus_tag LOCUS_08340 gene rplB 101489 102319 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390435.1 protein_id gnl|my_center|LOCUS_08340 102333 102611 gene locus_tag LOCUS_08350 gene rpsS 102333 102611 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390434.1 protein_id gnl|my_center|LOCUS_08350 102614 103024 gene locus_tag LOCUS_08360 gene rplV 102614 103024 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707758.1 protein_id gnl|my_center|LOCUS_08360 103028 103705 gene locus_tag LOCUS_08370 gene rpsC 103028 103705 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_08370 103724 104140 gene locus_tag LOCUS_08380 gene rplP 103724 104140 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390431.1 protein_id gnl|my_center|LOCUS_08380 104142 104378 gene locus_tag LOCUS_08390 gene rpmC 104142 104378 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205459.1 protein_id gnl|my_center|LOCUS_08390 104392 104664 gene locus_tag LOCUS_08400 gene rpsQ 104392 104664 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390429.1 protein_id gnl|my_center|LOCUS_08400 104683 105051 gene locus_tag LOCUS_08410 gene rplN 104683 105051 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390428.1 protein_id gnl|my_center|LOCUS_08410 105051 105371 gene locus_tag LOCUS_08420 gene rplX 105051 105371 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_08420 105382 105951 gene locus_tag LOCUS_08430 gene rplE 105382 105951 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336952.1 protein_id gnl|my_center|LOCUS_08430 106035 106340 gene locus_tag LOCUS_08440 gene rpsN 106035 106340 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495202.1 protein_id gnl|my_center|LOCUS_08440 106350 106748 gene locus_tag LOCUS_08450 gene rpsH 106350 106748 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390424.1 protein_id gnl|my_center|LOCUS_08450 106759 107292 gene locus_tag LOCUS_08460 gene rplF 106759 107292 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390423.1 protein_id gnl|my_center|LOCUS_08460 107292 107654 gene locus_tag LOCUS_08470 gene rplR 107292 107654 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603036.1 protein_id gnl|my_center|LOCUS_08470 107670 108242 gene locus_tag LOCUS_08480 gene rpsE 107670 108242 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390421.1 protein_id gnl|my_center|LOCUS_08480 108235 108420 gene locus_tag LOCUS_08490 gene rpmD 108235 108420 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390420.1 protein_id gnl|my_center|LOCUS_08490 108422 108910 gene locus_tag LOCUS_08500 gene rplO 108422 108910 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313981.1 protein_id gnl|my_center|LOCUS_08500 109049 110407 gene locus_tag LOCUS_08510 gene secY 109049 110407 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390418.1 protein_id gnl|my_center|LOCUS_08510 110404 111054 gene locus_tag LOCUS_08520 110404 111054 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_08520 111194 111571 gene locus_tag LOCUS_08530 gene rpsM 111194 111571 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_08530 111638 112030 gene locus_tag LOCUS_08540 gene rpsK 111638 112030 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495225.1 protein_id gnl|my_center|LOCUS_08540 112142 113161 gene locus_tag LOCUS_08550 112142 113161 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626433.1 protein_id gnl|my_center|LOCUS_08550 113191 113616 gene locus_tag LOCUS_08560 gene rplQ 113191 113616 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390413.1 protein_id gnl|my_center|LOCUS_08560 113926 115251 gene locus_tag LOCUS_08570 113926 115251 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266195.1 protein_id gnl|my_center|LOCUS_08570 115479 116522 gene locus_tag LOCUS_08580 115479 116522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 116630 117283 gene locus_tag LOCUS_08590 gene ssuC 116630 117283 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 protein_id gnl|my_center|LOCUS_08590 117280 118086 gene locus_tag LOCUS_08600 117280 118086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529863.1 protein_id gnl|my_center|LOCUS_08600 118171 118407 gene locus_tag LOCUS_08610 118171 118407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 118447 118623 gene locus_tag LOCUS_08620 118447 118623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 120280 118715 gene locus_tag LOCUS_08630 gene opmB 120280 118715 CDS product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_08630 123593 120291 gene locus_tag LOCUS_08640 123593 120291 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521877.1 protein_id gnl|my_center|LOCUS_08640 126766 123590 gene locus_tag LOCUS_08650 126766 123590 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204974.1 protein_id gnl|my_center|LOCUS_08650 127776 126763 gene locus_tag LOCUS_08660 127776 126763 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08660 127660 128013 gene locus_tag LOCUS_08670 127660 128013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 129761 128325 gene locus_tag LOCUS_08680 129761 128325 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037505.1 protein_id gnl|my_center|LOCUS_08680 129831 130136 gene locus_tag LOCUS_08690 129831 130136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 130261 130890 gene locus_tag LOCUS_08700 130261 130890 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390957.1 protein_id gnl|my_center|LOCUS_08700 130887 132020 gene locus_tag LOCUS_08710 130887 132020 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722128.1 protein_id gnl|my_center|LOCUS_08710 132691 132095 gene locus_tag LOCUS_08720 132691 132095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 134945 132765 gene locus_tag LOCUS_08730 134945 132765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018183745.1 protein_id gnl|my_center|LOCUS_08730 137848 134951 gene locus_tag LOCUS_08740 137848 134951 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388124.1 protein_id gnl|my_center|LOCUS_08740 138900 137845 gene locus_tag LOCUS_08750 138900 137845 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_08750 139928 138906 gene locus_tag LOCUS_08760 139928 138906 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400794.1 protein_id gnl|my_center|LOCUS_08760 140027 140620 gene locus_tag LOCUS_08770 140027 140620 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440306.1 protein_id gnl|my_center|LOCUS_08770 140630 141865 gene locus_tag LOCUS_08780 140630 141865 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329136.1 protein_id gnl|my_center|LOCUS_08780 141866 142021 gene locus_tag LOCUS_08790 141866 142021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 142062 143780 gene locus_tag LOCUS_08800 142062 143780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390692.1 protein_id gnl|my_center|LOCUS_08800 144008 145171 gene locus_tag LOCUS_08810 144008 145171 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191546.1 protein_id gnl|my_center|LOCUS_08810 145168 146745 gene locus_tag LOCUS_08820 145168 146745 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097454.1 protein_id gnl|my_center|LOCUS_08820 146871 147163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 147540 147682 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 149036 147918 gene locus_tag LOCUS_08830 149036 147918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 150503 149061 gene locus_tag LOCUS_08840 150503 149061 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_08840 152254 150677 gene locus_tag LOCUS_08850 152254 150677 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067223.1 protein_id gnl|my_center|LOCUS_08850 153793 152255 gene locus_tag LOCUS_08860 gene gpmI 153793 152255 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388989.1 protein_id gnl|my_center|LOCUS_08860 155620 153986 gene locus_tag LOCUS_08870 155620 153986 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_08870 156298 155753 gene locus_tag LOCUS_08880 156298 155753 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596664.1 protein_id gnl|my_center|LOCUS_08880 157300 156425 gene locus_tag LOCUS_08890 157300 156425 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_08890 157596 158462 gene locus_tag LOCUS_08900 gene fghA 157596 158462 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526232.1 protein_id gnl|my_center|LOCUS_08900 159121 158507 gene locus_tag LOCUS_08910 159121 158507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 160077 159118 gene locus_tag LOCUS_08920 160077 159118 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537455.1 protein_id gnl|my_center|LOCUS_08920 160697 160080 gene locus_tag LOCUS_08930 gene ftsE 160697 160080 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626546.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence05 110 943 gene locus_tag LOCUS_08940 110 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1434 1012 gene locus_tag LOCUS_08950 gene hisI 1434 1012 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_08950 2333 1455 gene locus_tag LOCUS_08960 2333 1455 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_08960 4118 2346 gene locus_tag LOCUS_08970 gene asnB 4118 2346 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_08970 5174 4119 gene locus_tag LOCUS_08980 5174 4119 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_08980 6085 5171 gene locus_tag LOCUS_08990 6085 5171 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_08990 6307 6678 gene locus_tag LOCUS_09000 6307 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6856 7551 gene locus_tag LOCUS_09010 6856 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 7560 8954 gene locus_tag LOCUS_09020 7560 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 8947 10416 gene locus_tag LOCUS_09030 gene der 8947 10416 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975953.1 protein_id gnl|my_center|LOCUS_09030 11771 10425 gene locus_tag LOCUS_09040 11771 10425 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105322.1 protein_id gnl|my_center|LOCUS_09040 12090 13472 gene locus_tag LOCUS_09050 12090 13472 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534176.1 protein_id gnl|my_center|LOCUS_09050 15111 13681 gene locus_tag LOCUS_09060 15111 13681 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_09060 15942 15187 gene locus_tag LOCUS_09070 15942 15187 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388329.1 protein_id gnl|my_center|LOCUS_09070 16113 17036 gene locus_tag LOCUS_09080 gene ubiA 16113 17036 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388330.1 protein_id gnl|my_center|LOCUS_09080 17131 17832 gene locus_tag LOCUS_09090 17131 17832 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391445.1 protein_id gnl|my_center|LOCUS_09090 17923 19296 gene locus_tag LOCUS_09100 17923 19296 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_09100 19307 20290 gene locus_tag LOCUS_09110 19307 20290 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919846.1 protein_id gnl|my_center|LOCUS_09110 20321 22492 gene locus_tag LOCUS_09120 20321 22492 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400310.1 protein_id gnl|my_center|LOCUS_09120 22489 23238 gene locus_tag LOCUS_09130 22489 23238 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336958.1 protein_id gnl|my_center|LOCUS_09130 23545 23715 gene locus_tag LOCUS_09140 23545 23715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 23803 24309 gene locus_tag LOCUS_09150 23803 24309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 24424 25818 gene locus_tag LOCUS_09160 gene ffh 24424 25818 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388939.1 protein_id gnl|my_center|LOCUS_09160 25865 26215 gene locus_tag LOCUS_09170 25865 26215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 26240 26794 gene locus_tag LOCUS_09180 gene rimM 26240 26794 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388941.1 protein_id gnl|my_center|LOCUS_09180 26791 27540 gene locus_tag LOCUS_09190 gene trmD 26791 27540 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083317.1 protein_id gnl|my_center|LOCUS_09190 27555 27941 gene locus_tag LOCUS_09200 27555 27941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 28193 29596 gene locus_tag LOCUS_09210 gene leuC 28193 29596 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388944.1 protein_id gnl|my_center|LOCUS_09210 29596 30219 gene locus_tag LOCUS_09220 gene leuD 29596 30219 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388945.1 protein_id gnl|my_center|LOCUS_09220 30238 31356 gene locus_tag LOCUS_09230 gene leuB 30238 31356 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388946.1 protein_id gnl|my_center|LOCUS_09230 31526 33643 gene locus_tag LOCUS_09240 31526 33643 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923339.1 protein_id gnl|my_center|LOCUS_09240 33742 34455 gene locus_tag LOCUS_09250 33742 34455 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550326.1 protein_id gnl|my_center|LOCUS_09250 34452 34742 gene locus_tag LOCUS_09260 34452 34742 CDS product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530160.1 protein_id gnl|my_center|LOCUS_09260 35021 34818 gene locus_tag LOCUS_09270 gene rpsU 35021 34818 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388798.1 protein_id gnl|my_center|LOCUS_09270 35226 35756 gene locus_tag LOCUS_09280 gene def 35226 35756 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388799.1 protein_id gnl|my_center|LOCUS_09280 35753 36436 gene locus_tag LOCUS_09290 35753 36436 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_09290 36456 36983 gene locus_tag LOCUS_09300 36456 36983 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 protein_id gnl|my_center|LOCUS_09300 36973 37704 gene locus_tag LOCUS_09310 36973 37704 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563182.1 protein_id gnl|my_center|LOCUS_09310 37710 39092 gene locus_tag LOCUS_09320 37710 39092 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_09320 39683 39126 gene locus_tag LOCUS_09330 39683 39126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 39960 40514 gene locus_tag LOCUS_09340 39960 40514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 40675 40878 gene locus_tag LOCUS_09350 gene rpmF 40675 40878 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_09350 40970 42076 gene locus_tag LOCUS_09360 gene plsX 40970 42076 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389356.1 protein_id gnl|my_center|LOCUS_09360 42149 43114 gene locus_tag LOCUS_09370 42149 43114 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327909.1 protein_id gnl|my_center|LOCUS_09370 43164 43508 gene locus_tag LOCUS_09380 43164 43508 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389358.1 protein_id gnl|my_center|LOCUS_09380 43501 44409 gene locus_tag LOCUS_09390 43501 44409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 44473 44546 gene locus_tag LOCUS_t00150 44473 44546 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 45752 44616 gene locus_tag LOCUS_09400 45752 44616 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523805.1 protein_id gnl|my_center|LOCUS_09400 45967 47508 gene locus_tag LOCUS_09410 gene murJ 45967 47508 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_09410 47525 48769 gene locus_tag LOCUS_09420 47525 48769 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085807.1 protein_id gnl|my_center|LOCUS_09420 49081 48794 gene locus_tag LOCUS_09430 49081 48794 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006200394.1 protein_id gnl|my_center|LOCUS_09430 49757 49296 gene locus_tag LOCUS_09440 49757 49296 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_09440 50203 51564 gene locus_tag LOCUS_09450 50203 51564 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_09450 52524 51643 gene locus_tag LOCUS_09460 52524 51643 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_09460 53581 52631 gene locus_tag LOCUS_09470 gene trxB 53581 52631 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_09470 53767 54252 gene locus_tag LOCUS_09480 53767 54252 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_09480 54287 55750 gene locus_tag LOCUS_09490 54287 55750 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_09490 55841 56833 gene locus_tag LOCUS_09500 gene gshB 55841 56833 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383077.1 protein_id gnl|my_center|LOCUS_09500 57091 56858 gene locus_tag LOCUS_09510 57091 56858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 57203 57931 gene locus_tag LOCUS_09520 57203 57931 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_09520 58137 59375 gene locus_tag LOCUS_09530 58137 59375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 59372 60334 gene locus_tag LOCUS_09540 59372 60334 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241141.1 protein_id gnl|my_center|LOCUS_09540 60337 60468 gene locus_tag LOCUS_09550 60337 60468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 60990 60772 gene locus_tag LOCUS_09560 60990 60772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 62047 61037 gene locus_tag LOCUS_09570 62047 61037 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844614.1 protein_id gnl|my_center|LOCUS_09570 63371 62031 gene locus_tag LOCUS_09580 63371 62031 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174621.1 protein_id gnl|my_center|LOCUS_09580 64636 63368 gene locus_tag LOCUS_09590 64636 63368 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_09590 66098 64698 gene locus_tag LOCUS_09600 gene thrC 66098 64698 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_09600 67352 66204 gene locus_tag LOCUS_09610 67352 66204 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086613793.1 protein_id gnl|my_center|LOCUS_09610 67352 67531 gene locus_tag LOCUS_09620 67352 67531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 68999 67485 gene locus_tag LOCUS_09630 68999 67485 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_09630 69108 70991 gene locus_tag LOCUS_09640 69108 70991 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_09640 70988 73696 gene locus_tag LOCUS_09650 gene mutS 70988 73696 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 protein_id gnl|my_center|LOCUS_09650 73746 76697 gene locus_tag LOCUS_09660 73746 76697 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391286.1 protein_id gnl|my_center|LOCUS_09660 77632 76769 gene locus_tag LOCUS_09670 77632 76769 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_09670 77854 79572 gene locus_tag LOCUS_09680 77854 79572 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388875.1 protein_id gnl|my_center|LOCUS_09680 79677 79955 gene locus_tag LOCUS_09690 79677 79955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 80084 80389 gene locus_tag LOCUS_09700 gene rpmB 80084 80389 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387963.1 protein_id gnl|my_center|LOCUS_09700 80607 82694 gene locus_tag LOCUS_09710 gene fusA 80607 82694 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707752.1 protein_id gnl|my_center|LOCUS_09710 85528 83369 gene locus_tag LOCUS_09720 85528 83369 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275308.1 protein_id gnl|my_center|LOCUS_09720 88480 85679 gene locus_tag LOCUS_09730 88480 85679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 88603 89901 gene locus_tag LOCUS_09740 88603 89901 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531246.1 protein_id gnl|my_center|LOCUS_09740 90056 90520 gene locus_tag LOCUS_09750 90056 90520 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_09750 90524 92014 gene locus_tag LOCUS_09760 gene sufB 90524 92014 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_09760 92028 92798 gene locus_tag LOCUS_09770 gene sufC 92028 92798 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384245.1 protein_id gnl|my_center|LOCUS_09770 92795 94078 gene locus_tag LOCUS_09780 gene sufD 92795 94078 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_09780 94081 95334 gene locus_tag LOCUS_09790 94081 95334 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390320.1 protein_id gnl|my_center|LOCUS_09790 95331 95801 gene locus_tag LOCUS_09800 95331 95801 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192846.1 protein_id gnl|my_center|LOCUS_09800 95788 96282 gene locus_tag LOCUS_09810 95788 96282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 96300 96671 gene locus_tag LOCUS_09820 96300 96671 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463761.1 protein_id gnl|my_center|LOCUS_09820 97950 96616 gene locus_tag LOCUS_09830 97950 96616 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338785.1 protein_id gnl|my_center|LOCUS_09830 99929 97953 gene locus_tag LOCUS_09840 99929 97953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 100617 100162 gene locus_tag LOCUS_09850 100617 100162 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819714.1 protein_id gnl|my_center|LOCUS_09850 100795 102267 gene locus_tag LOCUS_09860 100795 102267 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389422.1 protein_id gnl|my_center|LOCUS_09860 102305 102389 gene locus_tag LOCUS_t00160 102305 102389 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 102483 103814 gene locus_tag LOCUS_09870 gene tig 102483 103814 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922580.1 protein_id gnl|my_center|LOCUS_09870 104031 104648 gene locus_tag LOCUS_09880 gene clpP 104031 104648 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389425.1 protein_id gnl|my_center|LOCUS_09880 104769 106034 gene locus_tag LOCUS_09890 gene clpX 104769 106034 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389426.1 protein_id gnl|my_center|LOCUS_09890 106216 108729 gene locus_tag LOCUS_09900 gene lon 106216 108729 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 protein_id gnl|my_center|LOCUS_09900 108873 109157 gene locus_tag LOCUS_09910 108873 109157 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_09910 109251 109325 gene locus_tag LOCUS_t00170 109251 109325 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 109564 109929 gene locus_tag LOCUS_09920 109564 109929 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_09920 109943 110506 gene locus_tag LOCUS_09930 109943 110506 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389431.1 protein_id gnl|my_center|LOCUS_09930 110499 111161 gene locus_tag LOCUS_09940 110499 111161 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969144.1 protein_id gnl|my_center|LOCUS_09940 111158 112441 gene locus_tag LOCUS_09950 111158 112441 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389433.1 protein_id gnl|my_center|LOCUS_09950 112438 113082 gene locus_tag LOCUS_09960 112438 113082 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_09960 113094 114422 gene locus_tag LOCUS_09970 gene nuoF 113094 114422 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_09970 114428 116509 gene locus_tag LOCUS_09980 gene nuoG 114428 116509 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 protein_id gnl|my_center|LOCUS_09980 116516 117547 gene locus_tag LOCUS_09990 gene nuoH 116516 117547 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389437.1 protein_id gnl|my_center|LOCUS_09990 117544 118032 gene locus_tag LOCUS_10000 gene nuoI 117544 118032 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389438.1 protein_id gnl|my_center|LOCUS_10000 118069 118782 gene locus_tag LOCUS_10010 118069 118782 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311651.1 protein_id gnl|my_center|LOCUS_10010 118779 119102 gene locus_tag LOCUS_10020 gene nuoK 118779 119102 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_10020 119111 121051 gene locus_tag LOCUS_10030 gene nuoL 119111 121051 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971513.1 protein_id gnl|my_center|LOCUS_10030 121114 122565 gene locus_tag LOCUS_10040 gene nuoN 121114 122565 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531102.1 protein_id gnl|my_center|LOCUS_10040 122575 123336 gene locus_tag LOCUS_10050 122575 123336 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_10050 123320 124132 gene locus_tag LOCUS_10060 123320 124132 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389445.1 protein_id gnl|my_center|LOCUS_10060 124141 125787 gene locus_tag LOCUS_10070 124141 125787 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_10070 125940 127256 gene locus_tag LOCUS_10080 125940 127256 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338481.1 protein_id gnl|my_center|LOCUS_10080 127259 128506 gene locus_tag LOCUS_10090 127259 128506 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_10090 128499 129191 gene locus_tag LOCUS_10100 128499 129191 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312688.1 protein_id gnl|my_center|LOCUS_10100 129600 131078 gene locus_tag LOCUS_10110 129600 131078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 131621 131133 gene locus_tag LOCUS_10120 131621 131133 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389616.1 protein_id gnl|my_center|LOCUS_10120 131875 132684 gene locus_tag LOCUS_10130 gene blcR 131875 132684 CDS product IclR family transcriptional regulator BlcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974399.1 protein_id gnl|my_center|LOCUS_10130 132806 133573 gene locus_tag LOCUS_10140 132806 133573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 135759 133936 gene locus_tag LOCUS_10150 gene glmS 135759 133936 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390777.1 protein_id gnl|my_center|LOCUS_10150 136991 135759 gene locus_tag LOCUS_10160 gene glmU 136991 135759 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337537.1 protein_id gnl|my_center|LOCUS_10160 137219 137899 gene locus_tag LOCUS_10170 137219 137899 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531667.1 protein_id gnl|my_center|LOCUS_10170 138758 137970 gene locus_tag LOCUS_10180 138758 137970 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640161.1 protein_id gnl|my_center|LOCUS_10180 139552 138755 gene locus_tag LOCUS_10190 139552 138755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 140646 139549 gene locus_tag LOCUS_10200 140646 139549 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919039.1 protein_id gnl|my_center|LOCUS_10200 141851 140643 gene locus_tag LOCUS_10210 141851 140643 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919040.1 protein_id gnl|my_center|LOCUS_10210 142792 141848 gene locus_tag LOCUS_10220 142792 141848 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529920.1 protein_id gnl|my_center|LOCUS_10220 142884 143864 gene locus_tag LOCUS_10230 142884 143864 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919044.1 protein_id gnl|my_center|LOCUS_10230 143881 144855 gene locus_tag LOCUS_10240 143881 144855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640162.1 protein_id gnl|my_center|LOCUS_10240 146063 144852 gene locus_tag LOCUS_10250 146063 144852 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_10250 146321 146070 gene locus_tag LOCUS_10260 146321 146070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 148220 146448 gene locus_tag LOCUS_10270 148220 146448 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640164.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence06 225 404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 557 709 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 760 1320 gene locus_tag LOCUS_10280 gene pnuC 760 1320 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035913.1 protein_id gnl|my_center|LOCUS_10280 2350 1505 gene locus_tag LOCUS_10290 gene purU 2350 1505 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068880351.1 protein_id gnl|my_center|LOCUS_10290 3260 2817 gene locus_tag LOCUS_10300 3260 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 4521 3289 gene locus_tag LOCUS_10310 gene hmpA 4521 3289 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889502.1 protein_id gnl|my_center|LOCUS_10310 4498 5067 gene locus_tag LOCUS_10320 4498 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 5194 6570 gene locus_tag LOCUS_10330 5194 6570 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010429677.1 protein_id gnl|my_center|LOCUS_10330 6711 7478 gene locus_tag LOCUS_10340 gene ydfG 6711 7478 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185593.1 protein_id gnl|my_center|LOCUS_10340 7774 8175 gene locus_tag LOCUS_10350 7774 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 9242 8271 gene locus_tag LOCUS_10360 9242 8271 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650892.1 protein_id gnl|my_center|LOCUS_10360 9759 10196 gene locus_tag LOCUS_10370 gene crcB 9759 10196 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_10370 10615 10235 gene locus_tag LOCUS_10380 10615 10235 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491259.1 protein_id gnl|my_center|LOCUS_10380 10872 13469 gene locus_tag LOCUS_10390 10872 13469 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_10390 13612 14877 gene locus_tag LOCUS_10400 13612 14877 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728306.1 protein_id gnl|my_center|LOCUS_10400 15704 14874 gene locus_tag LOCUS_10410 15704 14874 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_10410 16750 16322 gene locus_tag LOCUS_10420 16750 16322 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265510.1 protein_id gnl|my_center|LOCUS_10420 17070 18602 gene locus_tag LOCUS_10430 17070 18602 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317502.1 protein_id gnl|my_center|LOCUS_10430 19883 18726 gene locus_tag LOCUS_10440 19883 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 21851 20217 gene locus_tag LOCUS_10450 21851 20217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 23629 21848 gene locus_tag LOCUS_10460 23629 21848 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110747.1 protein_id gnl|my_center|LOCUS_10460 24311 23634 gene locus_tag LOCUS_10470 24311 23634 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110746.1 protein_id gnl|my_center|LOCUS_10470 24335 24631 gene locus_tag LOCUS_10480 24335 24631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 26944 24722 gene locus_tag LOCUS_10490 26944 24722 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921333.1 protein_id gnl|my_center|LOCUS_10490 27926 27174 gene locus_tag LOCUS_10500 27926 27174 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870392.1 protein_id gnl|my_center|LOCUS_10500 29233 27947 gene locus_tag LOCUS_10510 29233 27947 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972714.1 protein_id gnl|my_center|LOCUS_10510 29835 32243 gene locus_tag LOCUS_10520 29835 32243 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036160.1 protein_id gnl|my_center|LOCUS_10520 32244 33569 gene locus_tag LOCUS_10530 32244 33569 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532883.1 protein_id gnl|my_center|LOCUS_10530 33572 34519 gene locus_tag LOCUS_10540 33572 34519 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527944.1 protein_id gnl|my_center|LOCUS_10540 34610 35281 gene locus_tag LOCUS_10550 34610 35281 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811973.1 protein_id gnl|my_center|LOCUS_10550 35787 36260 gene locus_tag LOCUS_10560 35787 36260 CDS product DUF1636 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562166.1 protein_id gnl|my_center|LOCUS_10560 36257 37306 gene locus_tag LOCUS_10570 gene cobW 36257 37306 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086046.1 protein_id gnl|my_center|LOCUS_10570 37334 41074 gene locus_tag LOCUS_10580 gene cobN 37334 41074 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972577.1 protein_id gnl|my_center|LOCUS_10580 41071 42408 gene locus_tag LOCUS_10590 41071 42408 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531076.1 protein_id gnl|my_center|LOCUS_10590 42569 43168 gene locus_tag LOCUS_10600 gene cobC 42569 43168 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193433.1 protein_id gnl|my_center|LOCUS_10600 43247 43948 gene locus_tag LOCUS_10610 gene cobO 43247 43948 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531120.1 protein_id gnl|my_center|LOCUS_10610 43945 45714 gene locus_tag LOCUS_10620 43945 45714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 45192 45328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46692 45850 gene locus_tag LOCUS_10630 46692 45850 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_10630 48524 47229 gene locus_tag LOCUS_10640 48524 47229 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946287.1 protein_id gnl|my_center|LOCUS_10640 50586 48679 gene locus_tag LOCUS_10650 50586 48679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 51376 50777 gene locus_tag LOCUS_10660 51376 50777 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974638.1 protein_id gnl|my_center|LOCUS_10660 51841 51380 gene locus_tag LOCUS_10670 51841 51380 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_10670 52591 51953 gene locus_tag LOCUS_10680 gene bluB 52591 51953 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086038.1 protein_id gnl|my_center|LOCUS_10680 53577 52588 gene locus_tag LOCUS_10690 gene cbiB 53577 52588 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531121.1 protein_id gnl|my_center|LOCUS_10690 53576 54730 gene locus_tag LOCUS_10700 gene cobD 53576 54730 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972583.1 protein_id gnl|my_center|LOCUS_10700 54763 55341 gene locus_tag LOCUS_10710 54763 55341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 56051 55482 gene locus_tag LOCUS_10720 56051 55482 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013212.1 protein_id gnl|my_center|LOCUS_10720 56377 56222 gene locus_tag LOCUS_10730 56377 56222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 56951 56319 gene locus_tag LOCUS_10740 56951 56319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10740 57197 56970 gene locus_tag LOCUS_10750 57197 56970 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228805.1 protein_id gnl|my_center|LOCUS_10750 58568 57756 gene locus_tag LOCUS_10760 58568 57756 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975752.1 protein_id gnl|my_center|LOCUS_10760 59608 58565 gene locus_tag LOCUS_10770 gene cobT 59608 58565 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531074.1 protein_id gnl|my_center|LOCUS_10770 59668 60234 gene locus_tag LOCUS_10780 gene cobU 59668 60234 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530724.1 protein_id gnl|my_center|LOCUS_10780 61372 60251 gene locus_tag LOCUS_10790 61372 60251 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275472.1 protein_id gnl|my_center|LOCUS_10790 61682 63142 gene locus_tag LOCUS_10800 61682 63142 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_10800 65502 63208 gene locus_tag LOCUS_10810 65502 63208 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925780.1 protein_id gnl|my_center|LOCUS_10810 66054 65584 gene locus_tag LOCUS_10820 66054 65584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 66931 67090 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 67178 67486 gene locus_tag LOCUS_10830 67178 67486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 67653 68237 gene locus_tag LOCUS_10840 67653 68237 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062653665.1 protein_id gnl|my_center|LOCUS_10840 68337 69062 gene locus_tag LOCUS_10850 68337 69062 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720271.1 protein_id gnl|my_center|LOCUS_10850 70533 69076 gene locus_tag LOCUS_10860 70533 69076 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967081.1 protein_id gnl|my_center|LOCUS_10860 70718 71113 gene locus_tag LOCUS_10870 70718 71113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 71833 71141 gene locus_tag LOCUS_10880 71833 71141 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390197.1 protein_id gnl|my_center|LOCUS_10880 72169 73782 gene locus_tag LOCUS_10890 72169 73782 CDS product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073522.1 protein_id gnl|my_center|LOCUS_10890 74692 73961 gene locus_tag LOCUS_10900 74692 73961 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814507.1 protein_id gnl|my_center|LOCUS_10900 74984 75949 gene locus_tag LOCUS_10910 74984 75949 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112998.1 protein_id gnl|my_center|LOCUS_10910 76016 77044 gene locus_tag LOCUS_10920 76016 77044 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037380904.1 protein_id gnl|my_center|LOCUS_10920 77048 78184 gene locus_tag LOCUS_10930 77048 78184 CDS product acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112997.1 protein_id gnl|my_center|LOCUS_10930 78353 78491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 80018 78732 gene locus_tag LOCUS_10940 80018 78732 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261771.1 protein_id gnl|my_center|LOCUS_10940 81198 80146 gene locus_tag LOCUS_10950 81198 80146 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528226.1 protein_id gnl|my_center|LOCUS_10950 82190 81195 gene locus_tag LOCUS_10960 82190 81195 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090493.1 protein_id gnl|my_center|LOCUS_10960 83763 82390 gene locus_tag LOCUS_10970 83763 82390 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037785.1 protein_id gnl|my_center|LOCUS_10970 84899 83985 gene locus_tag LOCUS_10980 84899 83985 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529938.1 protein_id gnl|my_center|LOCUS_10980 85892 84981 gene locus_tag LOCUS_10990 85892 84981 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_10990 85887 86264 gene locus_tag LOCUS_11000 85887 86264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 86328 87986 gene locus_tag LOCUS_11010 86328 87986 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919299.1 protein_id gnl|my_center|LOCUS_11010 88815 88009 gene locus_tag LOCUS_11020 88815 88009 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721008.1 protein_id gnl|my_center|LOCUS_11020 89072 89911 gene locus_tag LOCUS_11030 89072 89911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 90153 91187 gene locus_tag LOCUS_11040 90153 91187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11040 91136 92635 gene locus_tag LOCUS_11050 91136 92635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 94704 92716 gene locus_tag LOCUS_11060 94704 92716 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114310.1 protein_id gnl|my_center|LOCUS_11060 97889 94968 gene locus_tag LOCUS_11070 97889 94968 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918997.1 protein_id gnl|my_center|LOCUS_11070 98886 97987 gene locus_tag LOCUS_11080 98886 97987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 99427 98864 gene locus_tag LOCUS_11090 99427 98864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 101284 99566 gene locus_tag LOCUS_11100 101284 99566 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275403.1 protein_id gnl|my_center|LOCUS_11100 102431 101904 gene locus_tag LOCUS_11110 102431 101904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 102731 102964 gene locus_tag LOCUS_11120 102731 102964 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389736.1 protein_id gnl|my_center|LOCUS_11120 103746 103117 gene locus_tag LOCUS_11130 103746 103117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 103886 104722 gene locus_tag LOCUS_11140 gene moeB 103886 104722 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_11140 104719 105216 gene locus_tag LOCUS_11150 104719 105216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 105305 106351 gene locus_tag LOCUS_11160 105305 106351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 106412 107848 gene locus_tag LOCUS_11170 gene pyk 106412 107848 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390218.1 protein_id gnl|my_center|LOCUS_11170 107991 109199 gene locus_tag LOCUS_11180 107991 109199 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966498.1 protein_id gnl|my_center|LOCUS_11180 110428 109274 gene locus_tag LOCUS_11190 110428 109274 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531920.1 protein_id gnl|my_center|LOCUS_11190 111503 110775 gene locus_tag LOCUS_11200 111503 110775 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383418.1 protein_id gnl|my_center|LOCUS_11200 112471 111500 gene locus_tag LOCUS_11210 gene pdxA 112471 111500 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919557.1 protein_id gnl|my_center|LOCUS_11210 113887 112490 gene locus_tag LOCUS_11220 113887 112490 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970659.1 protein_id gnl|my_center|LOCUS_11220 114515 114012 gene locus_tag LOCUS_11230 gene secB 114515 114012 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391357.1 protein_id gnl|my_center|LOCUS_11230 114747 115121 gene locus_tag LOCUS_11240 114747 115121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 115124 115828 gene locus_tag LOCUS_11250 gene pyrF 115124 115828 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_11250 115832 116479 gene locus_tag LOCUS_11260 115832 116479 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391172.1 protein_id gnl|my_center|LOCUS_11260 116552 116642 gene locus_tag LOCUS_t00180 116552 116642 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 118295 117501 gene locus_tag LOCUS_11270 118295 117501 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063708.1 protein_id gnl|my_center|LOCUS_11270 119292 118309 gene locus_tag LOCUS_11280 119292 118309 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730829.1 protein_id gnl|my_center|LOCUS_11280 119601 121034 gene locus_tag LOCUS_11290 119601 121034 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110556035.1 protein_id gnl|my_center|LOCUS_11290 121038 122057 gene locus_tag LOCUS_11300 gene cydB 121038 122057 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105098.1 protein_id gnl|my_center|LOCUS_11300 122527 123516 gene locus_tag LOCUS_11310 122527 123516 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337458.1 protein_id gnl|my_center|LOCUS_11310 124281 123853 gene locus_tag LOCUS_11320 124281 123853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 126092 124377 gene locus_tag LOCUS_11330 126092 124377 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167367787.1 protein_id gnl|my_center|LOCUS_11330 128077 126401 gene locus_tag LOCUS_11340 128077 126401 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946889.1 protein_id gnl|my_center|LOCUS_11340 128896 131331 gene locus_tag LOCUS_11350 128896 131331 CDS product membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277853.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence07 524 1264 gene locus_tag LOCUS_11360 524 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1261 4641 gene locus_tag LOCUS_11370 gene cas3f 1261 4641 CDS product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_11370 4656 6002 gene locus_tag LOCUS_11380 gene csy1 4656 6002 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_11380 6002 6952 gene locus_tag LOCUS_11390 gene csy2 6002 6952 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 protein_id gnl|my_center|LOCUS_11390 7003 8043 gene locus_tag LOCUS_11400 gene csy3 7003 8043 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029749.1 protein_id gnl|my_center|LOCUS_11400 8033 8614 gene locus_tag LOCUS_11410 gene cas6f 8033 8614 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_11410 8746 9313 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcactgccgcacaggcagctcagaaa 10186 9335 gene locus_tag LOCUS_11420 gene mazG 10186 9335 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_11420 10417 11328 gene locus_tag LOCUS_11430 gene argC 10417 11328 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_11430 12405 11503 gene locus_tag LOCUS_11440 12405 11503 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393506.1 protein_id gnl|my_center|LOCUS_11440 12474 12548 gene locus_tag LOCUS_t00190 12474 12548 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13761 12676 gene locus_tag LOCUS_11450 13761 12676 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299447.1 protein_id gnl|my_center|LOCUS_11450 14154 13948 gene locus_tag LOCUS_11460 14154 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 14465 14154 gene locus_tag LOCUS_11470 14465 14154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 15499 14462 gene locus_tag LOCUS_11480 15499 14462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 16380 15496 gene locus_tag LOCUS_11490 16380 15496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 16565 16377 gene locus_tag LOCUS_11500 16565 16377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 16879 16565 gene locus_tag LOCUS_11510 16879 16565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 17221 16958 gene locus_tag LOCUS_11520 17221 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 17914 17246 gene locus_tag LOCUS_11530 17914 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 18079 18333 gene locus_tag LOCUS_11540 18079 18333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 18682 18350 gene locus_tag LOCUS_11550 18682 18350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 19676 19215 gene locus_tag LOCUS_11560 19676 19215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 19647 19886 gene locus_tag LOCUS_11570 19647 19886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 19883 20380 gene locus_tag LOCUS_11580 19883 20380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 20377 20901 gene locus_tag LOCUS_11590 20377 20901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 20898 21089 gene locus_tag LOCUS_11600 20898 21089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 21090 21572 gene locus_tag LOCUS_11610 21090 21572 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087466.1 protein_id gnl|my_center|LOCUS_11610 21775 21578 gene locus_tag LOCUS_11620 21775 21578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 22164 22328 gene locus_tag LOCUS_11630 22164 22328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 22325 22555 gene locus_tag LOCUS_11640 22325 22555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 22552 22974 gene locus_tag LOCUS_11650 22552 22974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 23098 23328 gene locus_tag LOCUS_11660 23098 23328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 23343 24119 gene locus_tag LOCUS_11670 23343 24119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 24116 24475 gene locus_tag LOCUS_11680 24116 24475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 24468 25946 gene locus_tag LOCUS_11690 24468 25946 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532525.1 protein_id gnl|my_center|LOCUS_11690 26207 26446 gene locus_tag LOCUS_11700 26207 26446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 27028 27246 gene locus_tag LOCUS_11710 27028 27246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 27243 27545 gene locus_tag LOCUS_11720 27243 27545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 27851 29077 gene locus_tag LOCUS_11730 27851 29077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531618.1 protein_id gnl|my_center|LOCUS_11730 29080 30570 gene locus_tag LOCUS_11740 29080 30570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 30567 31460 gene locus_tag LOCUS_11750 30567 31460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 31447 31683 gene locus_tag LOCUS_11760 31447 31683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 31680 33905 gene locus_tag LOCUS_11770 31680 33905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 34031 34390 gene locus_tag LOCUS_11780 34031 34390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 34387 35535 gene locus_tag LOCUS_11790 34387 35535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 35553 36569 gene locus_tag LOCUS_11800 35553 36569 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531602.1 protein_id gnl|my_center|LOCUS_11800 36582 36872 gene locus_tag LOCUS_11810 36582 36872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 36921 37631 gene locus_tag LOCUS_11820 36921 37631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 37634 38317 gene locus_tag LOCUS_11830 37634 38317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531598.1 protein_id gnl|my_center|LOCUS_11830 38314 40137 gene locus_tag LOCUS_11840 38314 40137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095492071.1 protein_id gnl|my_center|LOCUS_11840 40350 40177 gene locus_tag LOCUS_11850 40350 40177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 41147 40401 gene locus_tag LOCUS_11860 41147 40401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 41355 41161 gene locus_tag LOCUS_11870 41355 41161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 41498 41352 gene locus_tag LOCUS_11880 41498 41352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 41582 41947 gene locus_tag LOCUS_11890 41582 41947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 41944 42630 gene locus_tag LOCUS_11900 41944 42630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 42697 42969 gene locus_tag LOCUS_11910 42697 42969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 43153 42923 gene locus_tag LOCUS_11920 43153 42923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 43278 43514 gene locus_tag LOCUS_11930 43278 43514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 43739 43482 gene locus_tag LOCUS_11940 43739 43482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 43888 44217 gene locus_tag LOCUS_11950 43888 44217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 44227 45252 gene locus_tag LOCUS_11960 44227 45252 CDS product tail fiber domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397223.1 protein_id gnl|my_center|LOCUS_11960 45252 47099 gene locus_tag LOCUS_11970 45252 47099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 47259 47110 gene locus_tag LOCUS_11980 47259 47110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 47287 49026 gene locus_tag LOCUS_11990 47287 49026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 49028 50083 gene locus_tag LOCUS_12000 49028 50083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 50086 50739 gene locus_tag LOCUS_12010 50086 50739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 50844 51119 gene locus_tag LOCUS_12020 50844 51119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 51116 51595 gene locus_tag LOCUS_12030 51116 51595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 51597 51854 gene locus_tag LOCUS_12040 51597 51854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 51867 52172 gene locus_tag LOCUS_12050 51867 52172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 52169 52402 gene locus_tag LOCUS_12060 52169 52402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 54224 53229 gene locus_tag LOCUS_12070 54224 53229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 54830 54249 gene locus_tag LOCUS_12080 54830 54249 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265652.1 protein_id gnl|my_center|LOCUS_12080 55100 57775 gene locus_tag LOCUS_12090 55100 57775 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918608.1 protein_id gnl|my_center|LOCUS_12090 57882 58085 gene locus_tag LOCUS_12100 57882 58085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 58509 58856 gene locus_tag LOCUS_12110 58509 58856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 58853 59338 gene locus_tag LOCUS_12120 58853 59338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 59605 59940 gene locus_tag LOCUS_12130 59605 59940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 59937 60170 gene locus_tag LOCUS_12140 59937 60170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 60163 60408 gene locus_tag LOCUS_12150 60163 60408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 60486 61217 gene locus_tag LOCUS_12160 gene xynR 60486 61217 CDS product DNA-binding transcriptional repressor XynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121657.1 protein_id gnl|my_center|LOCUS_12160 61309 61707 gene locus_tag LOCUS_12170 61309 61707 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004348825.1 protein_id gnl|my_center|LOCUS_12170 61753 62976 gene locus_tag LOCUS_12180 61753 62976 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050813472.1 protein_id gnl|my_center|LOCUS_12180 63949 63041 gene locus_tag LOCUS_12190 63949 63041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 64135 64533 gene locus_tag LOCUS_12200 64135 64533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 64685 66550 gene locus_tag LOCUS_12210 gene htpG 64685 66550 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387833.1 protein_id gnl|my_center|LOCUS_12210 67065 67979 gene locus_tag LOCUS_12220 67065 67979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 68255 69433 gene locus_tag LOCUS_12230 68255 69433 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186025.1 protein_id gnl|my_center|LOCUS_12230 71150 69786 gene locus_tag LOCUS_12240 71150 69786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 72953 71499 gene locus_tag LOCUS_12250 72953 71499 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 protein_id gnl|my_center|LOCUS_12250 73367 74815 gene locus_tag LOCUS_12260 73367 74815 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092177.1 protein_id gnl|my_center|LOCUS_12260 74829 75200 gene locus_tag LOCUS_12270 74829 75200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 75559 78495 gene locus_tag LOCUS_12280 75559 78495 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640332.1 protein_id gnl|my_center|LOCUS_12280 78517 81252 gene locus_tag LOCUS_12290 78517 81252 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202335.1 protein_id gnl|my_center|LOCUS_12290 81382 81873 gene locus_tag LOCUS_12300 81382 81873 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_12300 81870 82820 gene locus_tag LOCUS_12310 81870 82820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 83241 85907 gene locus_tag LOCUS_12320 83241 85907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 86909 85980 gene locus_tag LOCUS_12330 gene ppk2 86909 85980 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524222.1 protein_id gnl|my_center|LOCUS_12330 88523 87042 gene locus_tag LOCUS_12340 88523 87042 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189302.1 protein_id gnl|my_center|LOCUS_12340 88735 88523 gene locus_tag LOCUS_12350 88735 88523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 88798 89397 gene locus_tag LOCUS_12360 88798 89397 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074097.1 protein_id gnl|my_center|LOCUS_12360 90695 89403 gene locus_tag LOCUS_12370 90695 89403 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367177.1 protein_id gnl|my_center|LOCUS_12370 92240 90849 gene locus_tag LOCUS_12380 92240 90849 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 protein_id gnl|my_center|LOCUS_12380 93128 92712 gene locus_tag LOCUS_12390 93128 92712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 93371 93958 gene locus_tag LOCUS_12400 93371 93958 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228141.1 protein_id gnl|my_center|LOCUS_12400 94262 94005 gene locus_tag LOCUS_12410 94262 94005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 94496 96637 gene locus_tag LOCUS_12420 94496 96637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 96634 97416 gene locus_tag LOCUS_12430 96634 97416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 97625 98467 gene locus_tag LOCUS_12440 97625 98467 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064667.1 protein_id gnl|my_center|LOCUS_12440 99402 98554 gene locus_tag LOCUS_12450 99402 98554 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_12450 100445 99672 gene locus_tag LOCUS_12460 100445 99672 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973781.1 protein_id gnl|my_center|LOCUS_12460 100602 101501 gene locus_tag LOCUS_12470 100602 101501 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553993.1 protein_id gnl|my_center|LOCUS_12470 101663 102778 gene locus_tag LOCUS_12480 101663 102778 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809454.1 protein_id gnl|my_center|LOCUS_12480 102821 104011 gene locus_tag LOCUS_12490 102821 104011 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827568.1 protein_id gnl|my_center|LOCUS_12490 104392 104054 gene locus_tag LOCUS_12500 104392 104054 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086810.1 protein_id gnl|my_center|LOCUS_12500 105383 104397 gene locus_tag LOCUS_12510 105383 104397 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036055.1 protein_id gnl|my_center|LOCUS_12510 105483 105965 gene locus_tag LOCUS_12520 105483 105965 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171812.1 protein_id gnl|my_center|LOCUS_12520 109521 106129 gene locus_tag LOCUS_12530 109521 106129 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_12530 110266 109514 gene locus_tag LOCUS_12540 110266 109514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 111738 110263 gene locus_tag LOCUS_12550 111738 110263 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_12550 112228 114204 gene locus_tag LOCUS_12560 112228 114204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 114254 116290 gene locus_tag LOCUS_12570 114254 116290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 116914 117897 gene locus_tag LOCUS_12580 116914 117897 CDS product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 protein_id gnl|my_center|LOCUS_12580 117925 118953 gene locus_tag LOCUS_12590 117925 118953 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973349.1 protein_id gnl|my_center|LOCUS_12590 119752 120645 gene locus_tag LOCUS_12600 119752 120645 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_12600 121637 120804 gene locus_tag LOCUS_12610 121637 120804 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283934.1 protein_id gnl|my_center|LOCUS_12610 121737 122483 gene locus_tag LOCUS_12620 121737 122483 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384642.1 protein_id gnl|my_center|LOCUS_12620 122530 123225 gene locus_tag LOCUS_12630 122530 123225 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265932.1 protein_id gnl|my_center|LOCUS_12630 123852 124013 gene locus_tag LOCUS_12640 123852 124013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 124363 124034 gene locus_tag LOCUS_12650 124363 124034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 125194 124460 gene locus_tag LOCUS_12660 125194 124460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963278.1 protein_id gnl|my_center|LOCUS_12660 125638 126999 gene locus_tag LOCUS_12670 125638 126999 CDS product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042065.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence08 301 41 gene locus_tag LOCUS_12680 301 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 367 1032 gene locus_tag LOCUS_12690 367 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1035 1460 gene locus_tag LOCUS_12700 1035 1460 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_12700 1582 2022 gene locus_tag LOCUS_12710 1582 2022 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_12710 2027 3262 gene locus_tag LOCUS_12720 2027 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3346 3876 gene locus_tag LOCUS_12730 3346 3876 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812203.1 protein_id gnl|my_center|LOCUS_12730 5827 4289 gene locus_tag LOCUS_12740 gene oprM 5827 4289 CDS product multidrug efflux RND transporter outer membrane channel subunit OprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084633.1 protein_id gnl|my_center|LOCUS_12740 8990 5832 gene locus_tag LOCUS_12750 8990 5832 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039833.1 protein_id gnl|my_center|LOCUS_12750 10057 8996 gene locus_tag LOCUS_12760 gene acrA 10057 8996 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039199.1 protein_id gnl|my_center|LOCUS_12760 11865 10450 gene locus_tag LOCUS_12770 gene galP 11865 10450 CDS product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098659.1 protein_id gnl|my_center|LOCUS_12770 13297 12140 gene locus_tag LOCUS_12780 gene rodA 13297 12140 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719488.1 protein_id gnl|my_center|LOCUS_12780 15261 13294 gene locus_tag LOCUS_12790 gene mrdA 15261 13294 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_12790 15847 15281 gene locus_tag LOCUS_12800 15847 15281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 16762 15857 gene locus_tag LOCUS_12810 gene mreC 16762 15857 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 protein_id gnl|my_center|LOCUS_12810 17979 16933 gene locus_tag LOCUS_12820 17979 16933 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625945.1 protein_id gnl|my_center|LOCUS_12820 19784 18198 gene locus_tag LOCUS_12830 19784 18198 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919415.1 protein_id gnl|my_center|LOCUS_12830 21183 20107 gene locus_tag LOCUS_12840 21183 20107 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532214.1 protein_id gnl|my_center|LOCUS_12840 21182 21976 gene locus_tag LOCUS_12850 21182 21976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 22110 23387 gene locus_tag LOCUS_12860 22110 23387 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_12860 23511 25745 gene locus_tag LOCUS_12870 23511 25745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 25915 26448 gene locus_tag LOCUS_12880 25915 26448 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388365.1 protein_id gnl|my_center|LOCUS_12880 26588 28846 gene locus_tag LOCUS_12890 26588 28846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 29009 30001 gene locus_tag LOCUS_12900 gene nadA 29009 30001 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206696170.1 protein_id gnl|my_center|LOCUS_12900 30024 30881 gene locus_tag LOCUS_12910 gene nadC 30024 30881 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814746.1 protein_id gnl|my_center|LOCUS_12910 31484 32821 gene locus_tag LOCUS_12920 31484 32821 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257427.1 protein_id gnl|my_center|LOCUS_12920 33684 33001 gene locus_tag LOCUS_12930 33684 33001 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391391.1 protein_id gnl|my_center|LOCUS_12930 35330 33918 gene locus_tag LOCUS_12940 35330 33918 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 protein_id gnl|my_center|LOCUS_12940 37615 35387 gene locus_tag LOCUS_12950 37615 35387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 38395 37841 gene locus_tag LOCUS_12960 38395 37841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 38588 39364 gene locus_tag LOCUS_12970 38588 39364 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174871.1 protein_id gnl|my_center|LOCUS_12970 39998 40927 gene locus_tag LOCUS_12980 gene cyoA 39998 40927 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832113.1 protein_id gnl|my_center|LOCUS_12980 40933 42924 gene locus_tag LOCUS_12990 gene cyoB 40933 42924 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190543.1 protein_id gnl|my_center|LOCUS_12990 42924 43526 gene locus_tag LOCUS_13000 gene cyoC 42924 43526 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544233.1 protein_id gnl|my_center|LOCUS_13000 43526 43858 gene locus_tag LOCUS_13010 43526 43858 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 protein_id gnl|my_center|LOCUS_13010 44420 44088 gene locus_tag LOCUS_13020 44420 44088 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387838.1 protein_id gnl|my_center|LOCUS_13020 47180 44589 gene locus_tag LOCUS_13030 47180 44589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 47288 48718 gene locus_tag LOCUS_13040 47288 48718 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084248.1 protein_id gnl|my_center|LOCUS_13040 48881 49297 gene locus_tag LOCUS_13050 48881 49297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 49494 49943 gene locus_tag LOCUS_13060 49494 49943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086272.1 protein_id gnl|my_center|LOCUS_13060 51007 49976 gene locus_tag LOCUS_13070 51007 49976 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706693.1 protein_id gnl|my_center|LOCUS_13070 51067 53013 gene locus_tag LOCUS_13080 51067 53013 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_13080 53064 54200 gene locus_tag LOCUS_13090 53064 54200 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967037.1 protein_id gnl|my_center|LOCUS_13090 54216 54680 gene locus_tag LOCUS_13100 54216 54680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 56230 54953 gene locus_tag LOCUS_13110 56230 54953 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919351.1 protein_id gnl|my_center|LOCUS_13110 57692 56322 gene locus_tag LOCUS_13120 57692 56322 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145923747.1 protein_id gnl|my_center|LOCUS_13120 59305 57908 gene locus_tag LOCUS_13130 gene gorA 59305 57908 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063691.1 protein_id gnl|my_center|LOCUS_13130 60268 59354 gene locus_tag LOCUS_13140 60268 59354 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197182.1 protein_id gnl|my_center|LOCUS_13140 60706 63072 gene locus_tag LOCUS_13150 60706 63072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 64103 63153 gene locus_tag LOCUS_13160 64103 63153 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084071.1 protein_id gnl|my_center|LOCUS_13160 64852 64103 gene locus_tag LOCUS_13170 64852 64103 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141508.1 protein_id gnl|my_center|LOCUS_13170 65016 66989 gene locus_tag LOCUS_13180 65016 66989 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258483.1 protein_id gnl|my_center|LOCUS_13180 68959 67325 gene locus_tag LOCUS_13190 68959 67325 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_13190 69772 69242 gene locus_tag LOCUS_13200 gene nusG 69772 69242 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_13200 69976 69782 gene locus_tag LOCUS_13210 gene secE 69976 69782 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007611620.1 protein_id gnl|my_center|LOCUS_13210 70167 70091 gene locus_tag LOCUS_t00200 70167 70091 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 70390 70463 gene locus_tag LOCUS_t00210 70390 70463 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 70523 70864 gene locus_tag LOCUS_13220 70523 70864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 70868 71452 gene locus_tag LOCUS_13230 70868 71452 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_13230 71452 72987 gene locus_tag LOCUS_13240 gene atpA 71452 72987 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388979.1 protein_id gnl|my_center|LOCUS_13240 73004 73897 gene locus_tag LOCUS_13250 73004 73897 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388980.1 protein_id gnl|my_center|LOCUS_13250 73929 75401 gene locus_tag LOCUS_13260 gene atpD 73929 75401 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388981.1 protein_id gnl|my_center|LOCUS_13260 75430 75840 gene locus_tag LOCUS_13270 75430 75840 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 protein_id gnl|my_center|LOCUS_13270 76412 75942 gene locus_tag LOCUS_13280 gene queF 76412 75942 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969898.1 protein_id gnl|my_center|LOCUS_13280 76536 77741 gene locus_tag LOCUS_13290 gene rnd 76536 77741 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_13290 78836 77838 gene locus_tag LOCUS_13300 78836 77838 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968402.1 protein_id gnl|my_center|LOCUS_13300 79306 78992 gene locus_tag LOCUS_13310 79306 78992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 79254 79751 gene locus_tag LOCUS_13320 79254 79751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 80460 79873 gene locus_tag LOCUS_13330 80460 79873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 80795 81910 gene locus_tag LOCUS_13340 80795 81910 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815761.1 protein_id gnl|my_center|LOCUS_13340 82335 81979 gene locus_tag LOCUS_13350 gene arsC 82335 81979 CDS product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705616.1 protein_id gnl|my_center|LOCUS_13350 82809 82348 gene locus_tag LOCUS_13360 82809 82348 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969411.1 protein_id gnl|my_center|LOCUS_13360 82915 84387 gene locus_tag LOCUS_13370 82915 84387 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017264205.1 protein_id gnl|my_center|LOCUS_13370 84509 85303 gene locus_tag LOCUS_13380 84509 85303 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082773.1 protein_id gnl|my_center|LOCUS_13380 85468 85851 gene locus_tag LOCUS_13390 85468 85851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 86041 85874 gene locus_tag LOCUS_13400 86041 85874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 86142 87725 gene locus_tag LOCUS_13410 86142 87725 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065280.1 protein_id gnl|my_center|LOCUS_13410 88062 87871 gene locus_tag LOCUS_13420 88062 87871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 89220 88081 gene locus_tag LOCUS_13430 gene cydB 89220 88081 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037378.1 protein_id gnl|my_center|LOCUS_13430 90855 89245 gene locus_tag LOCUS_13440 gene cydA 90855 89245 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884372.1 protein_id gnl|my_center|LOCUS_13440 92596 90905 gene locus_tag LOCUS_13450 gene cydC 92596 90905 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974886.1 protein_id gnl|my_center|LOCUS_13450 94287 92593 gene locus_tag LOCUS_13460 gene cydD 94287 92593 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461540.1 protein_id gnl|my_center|LOCUS_13460 95320 94538 gene locus_tag LOCUS_13470 95320 94538 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_13470 96285 95359 gene locus_tag LOCUS_13480 96285 95359 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_13480 96392 97051 gene locus_tag LOCUS_13490 96392 97051 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 protein_id gnl|my_center|LOCUS_13490 97051 97467 gene locus_tag LOCUS_13500 97051 97467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 97695 100049 gene locus_tag LOCUS_13510 gene piuA 97695 100049 CDS product TonB-dependent siderophore receptor PiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_13510 100253 101899 gene locus_tag LOCUS_13520 gene pgm 100253 101899 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967369.1 protein_id gnl|my_center|LOCUS_13520 102142 102348 gene locus_tag LOCUS_13530 102142 102348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 104089 103073 gene locus_tag LOCUS_13540 gene holA 104089 103073 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_13540 104820 104116 gene locus_tag LOCUS_13550 104820 104116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 107459 104820 gene locus_tag LOCUS_13560 gene leuS 107459 104820 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391378.1 protein_id gnl|my_center|LOCUS_13560 108068 107526 gene locus_tag LOCUS_13570 108068 107526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 109430 108255 gene locus_tag LOCUS_13580 109430 108255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 110450 109860 gene locus_tag LOCUS_13590 110450 109860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 110338 111525 gene locus_tag LOCUS_13600 gene mutY 110338 111525 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 protein_id gnl|my_center|LOCUS_13600 111628 112665 gene locus_tag LOCUS_13610 gene hemH 111628 112665 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393586.1 protein_id gnl|my_center|LOCUS_13610 113625 112669 gene locus_tag LOCUS_13620 113625 112669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 113785 115584 gene locus_tag LOCUS_13630 113785 115584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930051.1 protein_id gnl|my_center|LOCUS_13630 115744 116052 gene locus_tag LOCUS_13640 115744 116052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 116037 118229 gene locus_tag LOCUS_13650 116037 118229 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114848.1 protein_id gnl|my_center|LOCUS_13650 120445 118385 gene locus_tag LOCUS_13660 gene glyS 120445 118385 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390705.1 protein_id gnl|my_center|LOCUS_13660 121334 120450 gene locus_tag LOCUS_13670 121334 120450 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence09 602 1327 gene locus_tag LOCUS_13680 602 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1327 2340 gene locus_tag LOCUS_13690 1327 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3825 3379 gene locus_tag LOCUS_13700 3825 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 4198 4692 gene locus_tag LOCUS_13710 4198 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 5548 6207 gene locus_tag LOCUS_13720 5548 6207 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042061.1 protein_id gnl|my_center|LOCUS_13720 6492 6214 gene locus_tag LOCUS_13730 6492 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 7076 6489 gene locus_tag LOCUS_13740 7076 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 8491 7781 gene locus_tag LOCUS_13750 8491 7781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 9286 8612 gene locus_tag LOCUS_13760 9286 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 9954 11360 gene locus_tag LOCUS_13770 9954 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 11483 14263 gene locus_tag LOCUS_13780 11483 14263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 15178 15447 gene locus_tag LOCUS_13790 15178 15447 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_13790 16880 15615 gene locus_tag LOCUS_13800 16880 15615 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_13800 17082 17008 gene locus_tag LOCUS_t00220 17082 17008 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 17800 17135 gene locus_tag LOCUS_13810 17800 17135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 18699 17878 gene locus_tag LOCUS_13820 gene proC 18699 17878 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391029.1 protein_id gnl|my_center|LOCUS_13820 19199 18699 gene locus_tag LOCUS_13830 19199 18699 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_13830 19574 19287 gene locus_tag LOCUS_13840 19574 19287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 19967 20875 gene locus_tag LOCUS_13850 19967 20875 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389768.1 protein_id gnl|my_center|LOCUS_13850 21396 20965 gene locus_tag LOCUS_13860 21396 20965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 21577 21864 gene locus_tag LOCUS_13870 21577 21864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 22687 21941 gene locus_tag LOCUS_13880 22687 21941 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_13880 25211 22680 gene locus_tag LOCUS_13890 25211 22680 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966489.1 protein_id gnl|my_center|LOCUS_13890 25996 25358 gene locus_tag LOCUS_13900 25996 25358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 27319 26072 gene locus_tag LOCUS_13910 gene argJ 27319 26072 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970084.1 protein_id gnl|my_center|LOCUS_13910 28348 27401 gene locus_tag LOCUS_13920 28348 27401 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388154.1 protein_id gnl|my_center|LOCUS_13920 28583 31306 gene locus_tag LOCUS_13930 gene secA 28583 31306 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387988.1 protein_id gnl|my_center|LOCUS_13930 31376 32095 gene locus_tag LOCUS_13940 31376 32095 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084350.1 protein_id gnl|my_center|LOCUS_13940 32098 32604 gene locus_tag LOCUS_13950 gene ruvC 32098 32604 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388842.1 protein_id gnl|my_center|LOCUS_13950 32601 33209 gene locus_tag LOCUS_13960 gene ruvA 32601 33209 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529140.1 protein_id gnl|my_center|LOCUS_13960 33206 34288 gene locus_tag LOCUS_13970 gene ruvB 33206 34288 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388844.1 protein_id gnl|my_center|LOCUS_13970 34285 34698 gene locus_tag LOCUS_13980 gene ybgC 34285 34698 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_13980 34817 35539 gene locus_tag LOCUS_13990 gene tolQ 34817 35539 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388846.1 protein_id gnl|my_center|LOCUS_13990 35543 35974 gene locus_tag LOCUS_14000 gene tolR 35543 35974 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_14000 36007 36999 gene locus_tag LOCUS_14010 36007 36999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 37024 38388 gene locus_tag LOCUS_14020 gene tolB 37024 38388 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970163.1 protein_id gnl|my_center|LOCUS_14020 38834 39310 gene locus_tag LOCUS_14030 gene pal 38834 39310 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310278.1 protein_id gnl|my_center|LOCUS_14030 39448 40311 gene locus_tag LOCUS_14040 39448 40311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 40298 41632 gene locus_tag LOCUS_14050 gene tilS 40298 41632 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529151.1 protein_id gnl|my_center|LOCUS_14050 41811 43760 gene locus_tag LOCUS_14060 gene ftsH 41811 43760 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310285.1 protein_id gnl|my_center|LOCUS_14060 43831 44865 gene locus_tag LOCUS_14070 gene folP 43831 44865 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337038.1 protein_id gnl|my_center|LOCUS_14070 45005 46363 gene locus_tag LOCUS_14080 gene glmM 45005 46363 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388855.1 protein_id gnl|my_center|LOCUS_14080 46363 47172 gene locus_tag LOCUS_14090 gene thiD 46363 47172 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_14090 47944 47183 gene locus_tag LOCUS_14100 47944 47183 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_14100 48433 48894 gene locus_tag LOCUS_14110 48433 48894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 48891 52067 gene locus_tag LOCUS_14120 gene addB 48891 52067 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_14120 52064 55630 gene locus_tag LOCUS_14130 gene addA 52064 55630 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_14130 55758 56084 gene locus_tag LOCUS_14140 gene trxA 55758 56084 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211990.1 protein_id gnl|my_center|LOCUS_14140 56253 57167 gene locus_tag LOCUS_14150 gene accD 56253 57167 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383297.1 protein_id gnl|my_center|LOCUS_14150 57176 58531 gene locus_tag LOCUS_14160 57176 58531 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383296.1 protein_id gnl|my_center|LOCUS_14160 58662 58588 gene locus_tag LOCUS_t00230 58662 58588 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 58822 60168 gene locus_tag LOCUS_14170 gene cysS 58822 60168 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388447.1 protein_id gnl|my_center|LOCUS_14170 60165 60941 gene locus_tag LOCUS_14180 60165 60941 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_14180 61814 61149 gene locus_tag LOCUS_14190 61814 61149 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_14190 62273 63418 gene locus_tag LOCUS_14200 62273 63418 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389780.1 protein_id gnl|my_center|LOCUS_14200 63449 64633 gene locus_tag LOCUS_14210 63449 64633 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958022.1 protein_id gnl|my_center|LOCUS_14210 64678 64992 gene locus_tag LOCUS_14220 64678 64992 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_14220 65025 66107 gene locus_tag LOCUS_14230 gene mnmA 65025 66107 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337613.1 protein_id gnl|my_center|LOCUS_14230 66122 66808 gene locus_tag LOCUS_14240 66122 66808 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_14240 66997 67214 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69083 68388 gene locus_tag LOCUS_14250 69083 68388 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174878.1 protein_id gnl|my_center|LOCUS_14250 71695 69080 gene locus_tag LOCUS_14260 71695 69080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 73014 72088 gene locus_tag LOCUS_14270 gene rfbD 73014 72088 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532724.1 protein_id gnl|my_center|LOCUS_14270 73624 73007 gene locus_tag LOCUS_14280 gene rfbC 73624 73007 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063476367.1 protein_id gnl|my_center|LOCUS_14280 74520 73627 gene locus_tag LOCUS_14290 gene rfbA 74520 73627 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_14290 75575 74517 gene locus_tag LOCUS_14300 gene rffG 75575 74517 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 protein_id gnl|my_center|LOCUS_14300 75751 77910 gene locus_tag LOCUS_14310 75751 77910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 77927 78598 gene locus_tag LOCUS_14320 77927 78598 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966025.1 protein_id gnl|my_center|LOCUS_14320 80590 79133 gene locus_tag LOCUS_14330 80590 79133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 80609 80742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81132 81456 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81859 82060 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 82102 83487 gene locus_tag LOCUS_14340 gene tldD 82102 83487 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_14340 83580 84842 gene locus_tag LOCUS_14350 gene tyrS 83580 84842 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389785.1 protein_id gnl|my_center|LOCUS_14350 85003 85281 gene locus_tag LOCUS_14360 85003 85281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 85598 86530 gene locus_tag LOCUS_14370 85598 86530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 86502 86879 gene locus_tag LOCUS_14380 86502 86879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 87200 87126 gene locus_tag LOCUS_t00240 87200 87126 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 87685 87266 gene locus_tag LOCUS_14390 gene dksA 87685 87266 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390474.1 protein_id gnl|my_center|LOCUS_14390 89179 87884 gene locus_tag LOCUS_14400 89179 87884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 89914 89333 gene locus_tag LOCUS_14410 89914 89333 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087466.1 protein_id gnl|my_center|LOCUS_14410 90826 90203 gene locus_tag LOCUS_14420 gene rsmD 90826 90203 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388411.1 protein_id gnl|my_center|LOCUS_14420 91597 90830 gene locus_tag LOCUS_14430 91597 90830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 92322 91594 gene locus_tag LOCUS_14440 92322 91594 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_14440 92571 92440 gene locus_tag LOCUS_14450 92571 92440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 92782 93216 gene locus_tag LOCUS_14460 92782 93216 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388408.1 protein_id gnl|my_center|LOCUS_14460 93398 94993 gene locus_tag LOCUS_14470 93398 94993 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525026.1 protein_id gnl|my_center|LOCUS_14470 95420 96553 gene locus_tag LOCUS_14480 95420 96553 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_14480 96546 99635 gene locus_tag LOCUS_14490 96546 99635 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109387.1 protein_id gnl|my_center|LOCUS_14490 99632 101170 gene locus_tag LOCUS_14500 99632 101170 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_14500 101923 101150 gene locus_tag LOCUS_14510 101923 101150 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088802.1 protein_id gnl|my_center|LOCUS_14510 102228 103055 gene locus_tag LOCUS_14520 102228 103055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 103060 104439 gene locus_tag LOCUS_14530 gene hemN 103060 104439 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971733.1 protein_id gnl|my_center|LOCUS_14530 104578 105255 gene locus_tag LOCUS_14540 104578 105255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 105378 107015 gene locus_tag LOCUS_14550 105378 107015 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_14550 107079 107828 gene locus_tag LOCUS_14560 107079 107828 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982194.1 protein_id gnl|my_center|LOCUS_14560 107831 108754 gene locus_tag LOCUS_14570 107831 108754 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813337.1 protein_id gnl|my_center|LOCUS_14570 109506 108850 gene locus_tag LOCUS_14580 109506 108850 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338540.1 protein_id gnl|my_center|LOCUS_14580 109638 111173 gene locus_tag LOCUS_14590 109638 111173 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence10 856 470 gene locus_tag LOCUS_14600 856 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2059 1013 gene locus_tag LOCUS_14610 gene fliG 2059 1013 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388302.1 protein_id gnl|my_center|LOCUS_14610 3472 2423 gene locus_tag LOCUS_14620 3472 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3642 3505 gene locus_tag LOCUS_14630 3642 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5101 3983 gene locus_tag LOCUS_14640 5101 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 6700 5123 gene locus_tag LOCUS_14650 gene flgK 6700 5123 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385165.1 protein_id gnl|my_center|LOCUS_14650 7594 6851 gene locus_tag LOCUS_14660 gene flgF 7594 6851 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390469.1 protein_id gnl|my_center|LOCUS_14660 7866 8654 gene locus_tag LOCUS_14670 gene flgG 7866 8654 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390470.1 protein_id gnl|my_center|LOCUS_14670 8661 9680 gene locus_tag LOCUS_14680 8661 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 9804 10436 gene locus_tag LOCUS_14690 gene flgH 9804 10436 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088573.1 protein_id gnl|my_center|LOCUS_14690 10651 11226 gene locus_tag LOCUS_14700 10651 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 11356 12345 gene locus_tag LOCUS_14710 11356 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 12372 12704 gene locus_tag LOCUS_14720 12372 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 14206 14445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14461 14676 gene locus_tag LOCUS_14730 14461 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 14680 15384 gene locus_tag LOCUS_14740 14680 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 15381 15755 gene locus_tag LOCUS_14750 15381 15755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 15768 16121 gene locus_tag LOCUS_14760 15768 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 16184 16921 gene locus_tag LOCUS_14770 gene fliP 16184 16921 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918835.1 protein_id gnl|my_center|LOCUS_14770 17210 18661 gene locus_tag LOCUS_14780 17210 18661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 18661 18963 gene locus_tag LOCUS_14790 18661 18963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 18965 19348 gene locus_tag LOCUS_14800 18965 19348 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974444.1 protein_id gnl|my_center|LOCUS_14800 19364 21691 gene locus_tag LOCUS_14810 19364 21691 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650306.1 protein_id gnl|my_center|LOCUS_14810 21742 22203 gene locus_tag LOCUS_14820 21742 22203 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324555.1 protein_id gnl|my_center|LOCUS_14820 22200 23042 gene locus_tag LOCUS_14830 22200 23042 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706839.1 protein_id gnl|my_center|LOCUS_14830 23046 24077 gene locus_tag LOCUS_14840 gene cheB 23046 24077 CDS product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974448.1 protein_id gnl|my_center|LOCUS_14840 24164 24553 gene locus_tag LOCUS_14850 24164 24553 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974449.1 protein_id gnl|my_center|LOCUS_14850 24550 25077 gene locus_tag LOCUS_14860 24550 25077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 25104 25469 gene locus_tag LOCUS_14870 25104 25469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 25925 25479 gene locus_tag LOCUS_14880 25925 25479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 25967 26230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28628 26433 gene locus_tag LOCUS_14890 gene flhA 28628 26433 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918794.1 protein_id gnl|my_center|LOCUS_14890 28855 29208 gene locus_tag LOCUS_14900 28855 29208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 30072 29380 gene locus_tag LOCUS_14910 30072 29380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 30323 30544 gene locus_tag LOCUS_14920 30323 30544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 30549 31775 gene locus_tag LOCUS_14930 30549 31775 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390476.1 protein_id gnl|my_center|LOCUS_14930 31786 32148 gene locus_tag LOCUS_14940 31786 32148 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390477.1 protein_id gnl|my_center|LOCUS_14940 32145 32543 gene locus_tag LOCUS_14950 32145 32543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 32899 32588 gene locus_tag LOCUS_14960 32899 32588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 32987 33179 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33483 34301 gene locus_tag LOCUS_14970 33483 34301 CDS product DUF1217 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974461.1 protein_id gnl|my_center|LOCUS_14970 34338 35762 gene locus_tag LOCUS_14980 gene fliI 34338 35762 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 protein_id gnl|my_center|LOCUS_14980 35772 36209 gene locus_tag LOCUS_14990 35772 36209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 36390 37076 gene locus_tag LOCUS_15000 36390 37076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088592.1 protein_id gnl|my_center|LOCUS_15000 37099 38190 gene locus_tag LOCUS_15010 37099 38190 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389596.1 protein_id gnl|my_center|LOCUS_15010 38265 39137 gene locus_tag LOCUS_15020 gene motA 38265 39137 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721884.1 protein_id gnl|my_center|LOCUS_15020 39608 39801 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40051 41169 gene locus_tag LOCUS_15030 40051 41169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 41209 41964 gene locus_tag LOCUS_15040 41209 41964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 43532 42153 gene locus_tag LOCUS_15050 43532 42153 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530120.1 protein_id gnl|my_center|LOCUS_15050 44823 43726 gene locus_tag LOCUS_15060 44823 43726 CDS product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 protein_id gnl|my_center|LOCUS_15060 44803 44991 gene locus_tag LOCUS_15070 44803 44991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 45197 46456 gene locus_tag LOCUS_15080 45197 46456 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192723.1 protein_id gnl|my_center|LOCUS_15080 46446 47618 gene locus_tag LOCUS_15090 46446 47618 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174987973.1 protein_id gnl|my_center|LOCUS_15090 47667 49022 gene locus_tag LOCUS_15100 47667 49022 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088882.1 protein_id gnl|my_center|LOCUS_15100 49144 49611 gene locus_tag LOCUS_15110 49144 49611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 52280 49722 gene locus_tag LOCUS_15120 52280 49722 CDS product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972107.1 protein_id gnl|my_center|LOCUS_15120 52872 52273 gene locus_tag LOCUS_15130 gene pigA 52872 52273 CDS product biliverdin-producing heme oxygenase PigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085321.1 protein_id gnl|my_center|LOCUS_15130 53357 54835 gene locus_tag LOCUS_15140 gene guaB 53357 54835 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387997.1 protein_id gnl|my_center|LOCUS_15140 54845 56158 gene locus_tag LOCUS_15150 54845 56158 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_15150 56382 58232 gene locus_tag LOCUS_15160 56382 58232 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230338.1 protein_id gnl|my_center|LOCUS_15160 58741 58217 gene locus_tag LOCUS_15170 58741 58217 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 protein_id gnl|my_center|LOCUS_15170 58882 59601 gene locus_tag LOCUS_15180 58882 59601 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_15180 59700 59865 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 61123 59927 gene locus_tag LOCUS_15190 61123 59927 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_15190 61583 61125 gene locus_tag LOCUS_15200 gene greA 61583 61125 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 protein_id gnl|my_center|LOCUS_15200 64997 61743 gene locus_tag LOCUS_15210 gene carB 64997 61743 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390636.1 protein_id gnl|my_center|LOCUS_15210 66514 65105 gene locus_tag LOCUS_15220 gene carA 66514 65105 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 protein_id gnl|my_center|LOCUS_15220 66693 67148 gene locus_tag LOCUS_15230 66693 67148 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090104.1 protein_id gnl|my_center|LOCUS_15230 67201 69030 gene locus_tag LOCUS_15240 gene dnaG 67201 69030 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390633.1 protein_id gnl|my_center|LOCUS_15240 69182 71158 gene locus_tag LOCUS_15250 69182 71158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 71214 71729 gene locus_tag LOCUS_15260 71214 71729 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 protein_id gnl|my_center|LOCUS_15260 71885 72352 gene locus_tag LOCUS_15270 gene rpsF 71885 72352 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919541.1 protein_id gnl|my_center|LOCUS_15270 72359 72634 gene locus_tag LOCUS_15280 gene rpsR 72359 72634 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615089.1 protein_id gnl|my_center|LOCUS_15280 72646 73245 gene locus_tag LOCUS_15290 gene rplI 72646 73245 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379733.1 protein_id gnl|my_center|LOCUS_15290 73474 74568 gene locus_tag LOCUS_15300 73474 74568 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171076.1 protein_id gnl|my_center|LOCUS_15300 75507 74632 gene locus_tag LOCUS_15310 gene rsmA 75507 74632 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974958.1 protein_id gnl|my_center|LOCUS_15310 76828 75476 gene locus_tag LOCUS_15320 76828 75476 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103188.1 protein_id gnl|my_center|LOCUS_15320 79242 76909 gene locus_tag LOCUS_15330 gene lptD 79242 76909 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388193.1 protein_id gnl|my_center|LOCUS_15330 80358 79243 gene locus_tag LOCUS_15340 gene lptG 80358 79243 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 protein_id gnl|my_center|LOCUS_15340 81522 80374 gene locus_tag LOCUS_15350 81522 80374 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596741.1 protein_id gnl|my_center|LOCUS_15350 82509 81682 gene locus_tag LOCUS_15360 82509 81682 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971787.1 protein_id gnl|my_center|LOCUS_15360 84304 82628 gene locus_tag LOCUS_15370 84304 82628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 86122 84713 gene locus_tag LOCUS_15380 gene cysG 86122 84713 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_15380 86374 88164 gene locus_tag LOCUS_15390 86374 88164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192713.1 protein_id gnl|my_center|LOCUS_15390 88161 88850 gene locus_tag LOCUS_15400 88161 88850 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930006.1 protein_id gnl|my_center|LOCUS_15400 89224 88931 gene locus_tag LOCUS_15410 gene minE 89224 88931 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314830.1 protein_id gnl|my_center|LOCUS_15410 90036 89221 gene locus_tag LOCUS_15420 gene minD 90036 89221 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976171.1 protein_id gnl|my_center|LOCUS_15420 90881 90189 gene locus_tag LOCUS_15430 gene minC 90881 90189 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086984.1 protein_id gnl|my_center|LOCUS_15430 91111 91722 gene locus_tag LOCUS_15440 91111 91722 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_15440 91740 92945 gene locus_tag LOCUS_15450 91740 92945 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968760.1 protein_id gnl|my_center|LOCUS_15450 93905 92952 gene locus_tag LOCUS_15460 gene rsmI 93905 92952 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918033.1 protein_id gnl|my_center|LOCUS_15460 94052 95287 gene locus_tag LOCUS_15470 94052 95287 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626639.1 protein_id gnl|my_center|LOCUS_15470 96594 95389 gene locus_tag LOCUS_15480 96594 95389 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531653.1 protein_id gnl|my_center|LOCUS_15480 96575 96802 gene locus_tag LOCUS_15490 96575 96802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 97288 97548 gene locus_tag LOCUS_15500 97288 97548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 97884 98786 gene locus_tag LOCUS_15510 97884 98786 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729997.1 protein_id gnl|my_center|LOCUS_15510 98887 100839 gene locus_tag LOCUS_15520 98887 100839 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113160.1 protein_id gnl|my_center|LOCUS_15520 101532 100858 gene locus_tag LOCUS_15530 101532 100858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 101717 102163 gene locus_tag LOCUS_15540 101717 102163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 102217 102948 gene locus_tag LOCUS_15550 102217 102948 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_15550 103988 102987 gene locus_tag LOCUS_15560 gene trpS 103988 102987 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391282.1 protein_id gnl|my_center|LOCUS_15560 104489 104013 gene locus_tag LOCUS_15570 gene cycA 104489 104013 CDS product cytochrome C-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228671.1 protein_id gnl|my_center|LOCUS_15570 104989 104498 gene locus_tag LOCUS_15580 104989 104498 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640591.1 protein_id gnl|my_center|LOCUS_15580 106276 105035 gene locus_tag LOCUS_15590 106276 105035 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918018.1 protein_id gnl|my_center|LOCUS_15590 107602 106388 gene locus_tag LOCUS_15600 gene rlmN 107602 106388 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 protein_id gnl|my_center|LOCUS_15600 108352 107744 gene locus_tag LOCUS_15610 108352 107744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 109216 108479 gene locus_tag LOCUS_15620 109216 108479 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_15620 <110067 109219 gene locus_tag LOCUS_15630 <110067 109219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028175335.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence11 240 408 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 736 1023 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2929 2645 gene locus_tag LOCUS_15640 2929 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 4385 3201 gene locus_tag LOCUS_15650 4385 3201 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035961988.1 protein_id gnl|my_center|LOCUS_15650 4556 4481 gene locus_tag LOCUS_t00250 4556 4481 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4991 4635 gene locus_tag LOCUS_15660 4991 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 5051 5326 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5364 6146 gene locus_tag LOCUS_15670 5364 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 6391 7293 gene locus_tag LOCUS_15680 gene rpoH 6391 7293 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_15680 8757 7468 gene locus_tag LOCUS_15690 8757 7468 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 protein_id gnl|my_center|LOCUS_15690 9993 8842 gene locus_tag LOCUS_15700 9993 8842 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388860.1 protein_id gnl|my_center|LOCUS_15700 11243 10071 gene locus_tag LOCUS_15710 11243 10071 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_15710 11391 11308 gene locus_tag LOCUS_t00260 11391 11308 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12401 11466 gene locus_tag LOCUS_15720 gene argC 12401 11466 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_15720 12499 13293 gene locus_tag LOCUS_15730 gene mazG 12499 13293 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_15730 14217 13378 gene locus_tag LOCUS_15740 14217 13378 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930668.1 protein_id gnl|my_center|LOCUS_15740 15641 14331 gene locus_tag LOCUS_15750 gene hflX 15641 14331 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389375.1 protein_id gnl|my_center|LOCUS_15750 15889 15638 gene locus_tag LOCUS_15760 gene hfq 15889 15638 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389374.1 protein_id gnl|my_center|LOCUS_15760 17439 16048 gene locus_tag LOCUS_15770 17439 16048 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_15770 19696 17429 gene locus_tag LOCUS_15780 19696 17429 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_15780 21138 19693 gene locus_tag LOCUS_15790 gene ntrC 21138 19693 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_15790 22312 21203 gene locus_tag LOCUS_15800 22312 21203 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531493.1 protein_id gnl|my_center|LOCUS_15800 23370 22324 gene locus_tag LOCUS_15810 gene dusB 23370 22324 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014411626.1 protein_id gnl|my_center|LOCUS_15810 24621 23617 gene locus_tag LOCUS_15820 24621 23617 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_15820 25066 24990 gene locus_tag LOCUS_t00270 25066 24990 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25411 25106 gene locus_tag LOCUS_15830 25411 25106 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_15830 25509 25433 gene locus_tag LOCUS_t00280 25509 25433 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26052 25567 gene locus_tag LOCUS_15840 gene gpt 26052 25567 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938365.1 protein_id gnl|my_center|LOCUS_15840 26397 26654 gene locus_tag LOCUS_15850 26397 26654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 26789 27442 gene locus_tag LOCUS_15860 gene upp 26789 27442 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729095.1 protein_id gnl|my_center|LOCUS_15860 28017 27505 gene locus_tag LOCUS_15870 28017 27505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 28276 28884 gene locus_tag LOCUS_15880 28276 28884 CDS product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121577.1 protein_id gnl|my_center|LOCUS_15880 29640 30188 gene locus_tag LOCUS_15890 29640 30188 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062653665.1 protein_id gnl|my_center|LOCUS_15890 30352 31092 gene locus_tag LOCUS_15900 30352 31092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 32004 31915 gene locus_tag LOCUS_t00290 32004 31915 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32162 32728 gene locus_tag LOCUS_15910 gene efp 32162 32728 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388832.1 protein_id gnl|my_center|LOCUS_15910 32764 33597 gene locus_tag LOCUS_15920 32764 33597 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_15920 34783 33719 gene locus_tag LOCUS_15930 34783 33719 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971709.1 protein_id gnl|my_center|LOCUS_15930 35010 38015 gene locus_tag LOCUS_15940 35010 38015 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013078549.1 protein_id gnl|my_center|LOCUS_15940 38350 38147 gene locus_tag LOCUS_15950 38350 38147 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720550.1 protein_id gnl|my_center|LOCUS_15950 39147 38479 gene locus_tag LOCUS_15960 39147 38479 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_15960 39466 39651 gene locus_tag LOCUS_15970 39466 39651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 39707 41347 gene locus_tag LOCUS_15980 gene groL 39707 41347 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387923.1 protein_id gnl|my_center|LOCUS_15980 42330 41476 gene locus_tag LOCUS_15990 gene cysE 42330 41476 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_15990 43621 42371 gene locus_tag LOCUS_16000 43621 42371 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_16000 43843 44181 gene locus_tag LOCUS_16010 gene glnK 43843 44181 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_16010 44323 44670 gene locus_tag LOCUS_16020 44323 44670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 44791 45597 gene locus_tag LOCUS_16030 44791 45597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 45618 47033 gene locus_tag LOCUS_16040 45618 47033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 47191 48585 gene locus_tag LOCUS_16050 47191 48585 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388884.1 protein_id gnl|my_center|LOCUS_16050 49792 48662 gene locus_tag LOCUS_16060 49792 48662 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256280.1 protein_id gnl|my_center|LOCUS_16060 49891 50784 gene locus_tag LOCUS_16070 49891 50784 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388364.1 protein_id gnl|my_center|LOCUS_16070 51373 51888 gene locus_tag LOCUS_16080 51373 51888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084161.1 protein_id gnl|my_center|LOCUS_16080 53050 52217 gene locus_tag LOCUS_16090 53050 52217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 54125 53163 gene locus_tag LOCUS_16100 gene pip 54125 53163 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204007.1 protein_id gnl|my_center|LOCUS_16100 55295 54336 gene locus_tag LOCUS_16110 55295 54336 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338319.1 protein_id gnl|my_center|LOCUS_16110 55412 57670 gene locus_tag LOCUS_16120 55412 57670 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972445.1 protein_id gnl|my_center|LOCUS_16120 58105 57746 gene locus_tag LOCUS_16130 gene yajC 58105 57746 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384153.1 protein_id gnl|my_center|LOCUS_16130 58275 59153 gene locus_tag LOCUS_16140 58275 59153 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 protein_id gnl|my_center|LOCUS_16140 59196 59690 gene locus_tag LOCUS_16150 59196 59690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 59806 60909 gene locus_tag LOCUS_16160 59806 60909 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141920.1 protein_id gnl|my_center|LOCUS_16160 60902 61876 gene locus_tag LOCUS_16170 60902 61876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 62576 61974 gene locus_tag LOCUS_16180 62576 61974 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_16180 63047 64249 gene locus_tag LOCUS_16190 63047 64249 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241461.1 protein_id gnl|my_center|LOCUS_16190 64431 64904 gene locus_tag LOCUS_16200 gene apaG 64431 64904 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388023.1 protein_id gnl|my_center|LOCUS_16200 64942 65556 gene locus_tag LOCUS_16210 gene folE 64942 65556 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388024.1 protein_id gnl|my_center|LOCUS_16210 66358 65696 gene locus_tag LOCUS_16220 66358 65696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 67011 66427 gene locus_tag LOCUS_16230 67011 66427 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207538.1 protein_id gnl|my_center|LOCUS_16230 67558 67004 gene locus_tag LOCUS_16240 gene moaB 67558 67004 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388021.1 protein_id gnl|my_center|LOCUS_16240 67694 69211 gene locus_tag LOCUS_16250 67694 69211 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266835.1 protein_id gnl|my_center|LOCUS_16250 71882 69195 gene locus_tag LOCUS_16260 71882 69195 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063890.1 protein_id gnl|my_center|LOCUS_16260 73027 71879 gene locus_tag LOCUS_16270 73027 71879 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063891.1 protein_id gnl|my_center|LOCUS_16270 73327 75411 gene locus_tag LOCUS_16280 73327 75411 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113160.1 protein_id gnl|my_center|LOCUS_16280 75411 75617 gene locus_tag LOCUS_16290 75411 75617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 75633 76595 gene locus_tag LOCUS_16300 75633 76595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 76707 77531 gene locus_tag LOCUS_16310 76707 77531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 77720 81058 gene locus_tag LOCUS_16320 77720 81058 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521877.1 protein_id gnl|my_center|LOCUS_16320 81203 81442 gene locus_tag LOCUS_16330 81203 81442 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920053.1 protein_id gnl|my_center|LOCUS_16330 81518 82807 gene locus_tag LOCUS_16340 81518 82807 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266171.1 protein_id gnl|my_center|LOCUS_16340 83123 84250 gene locus_tag LOCUS_16350 83123 84250 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154617.1 protein_id gnl|my_center|LOCUS_16350 87142 84548 gene locus_tag LOCUS_16360 87142 84548 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 protein_id gnl|my_center|LOCUS_16360 88313 87258 gene locus_tag LOCUS_16370 88313 87258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 88853 88371 gene locus_tag LOCUS_16380 gene ribH 88853 88371 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918773.1 protein_id gnl|my_center|LOCUS_16380 90221 88884 gene locus_tag LOCUS_16390 90221 88884 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918772.1 protein_id gnl|my_center|LOCUS_16390 90808 90206 gene locus_tag LOCUS_16400 90808 90206 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918771.1 protein_id gnl|my_center|LOCUS_16400 91899 90793 gene locus_tag LOCUS_16410 gene ribD 91899 90793 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918770.1 protein_id gnl|my_center|LOCUS_16410 94658 92253 gene locus_tag LOCUS_16420 94658 92253 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771478.1 protein_id gnl|my_center|LOCUS_16420 94931 96178 gene locus_tag LOCUS_16430 94931 96178 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599371.1 protein_id gnl|my_center|LOCUS_16430 96178 96987 gene locus_tag LOCUS_16440 96178 96987 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388115.1 protein_id gnl|my_center|LOCUS_16440 96994 97695 gene locus_tag LOCUS_16450 gene petA 96994 97695 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707597.1 protein_id gnl|my_center|LOCUS_16450 98298 97705 gene locus_tag LOCUS_16460 98298 97705 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919545.1 protein_id gnl|my_center|LOCUS_16460 98536 99093 gene locus_tag LOCUS_16470 98536 99093 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179442.1 protein_id gnl|my_center|LOCUS_16470 100022 99201 gene locus_tag LOCUS_16480 100022 99201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 100543 102414 gene locus_tag LOCUS_16490 100543 102414 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921450.1 protein_id gnl|my_center|LOCUS_16490 102416 103414 gene locus_tag LOCUS_16500 102416 103414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence12 1138 158 gene locus_tag LOCUS_16510 1138 158 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088661.1 protein_id gnl|my_center|LOCUS_16510 1731 1225 gene locus_tag LOCUS_16520 1731 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2424 1750 gene locus_tag LOCUS_16530 gene gloC 2424 1750 CDS product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109455.1 protein_id gnl|my_center|LOCUS_16530 3079 2666 gene locus_tag LOCUS_16540 3079 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 3284 4351 gene locus_tag LOCUS_16550 3284 4351 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_16550 4359 5039 gene locus_tag LOCUS_16560 4359 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 5086 5436 gene locus_tag LOCUS_16570 5086 5436 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705113.1 protein_id gnl|my_center|LOCUS_16570 5755 6528 gene locus_tag LOCUS_16580 5755 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 9891 6961 gene locus_tag LOCUS_16590 gene gcvP 9891 6961 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967189.1 protein_id gnl|my_center|LOCUS_16590 10423 10058 gene locus_tag LOCUS_16600 gene gcvH 10423 10058 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529528.1 protein_id gnl|my_center|LOCUS_16600 11568 10495 gene locus_tag LOCUS_16610 gene gcvT 11568 10495 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921497.1 protein_id gnl|my_center|LOCUS_16610 12818 11946 gene locus_tag LOCUS_16620 gene speE 12818 11946 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389381.1 protein_id gnl|my_center|LOCUS_16620 13382 12918 gene locus_tag LOCUS_16630 13382 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 15934 13538 gene locus_tag LOCUS_16640 15934 13538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 16148 16318 gene locus_tag LOCUS_16650 16148 16318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 16474 17400 gene locus_tag LOCUS_16660 16474 17400 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966458.1 protein_id gnl|my_center|LOCUS_16660 17625 17550 gene locus_tag LOCUS_t00300 17625 17550 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18345 17851 gene locus_tag LOCUS_16670 18345 17851 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389495.1 protein_id gnl|my_center|LOCUS_16670 18924 18391 gene locus_tag LOCUS_16680 gene coaD 18924 18391 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389496.1 protein_id gnl|my_center|LOCUS_16680 21665 18921 gene locus_tag LOCUS_16690 gene gyrA 21665 18921 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087464.1 protein_id gnl|my_center|LOCUS_16690 22005 22190 gene locus_tag LOCUS_16700 22005 22190 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417846.1 protein_id gnl|my_center|LOCUS_16700 23710 22292 gene locus_tag LOCUS_16710 23710 22292 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_16710 26079 23770 gene locus_tag LOCUS_16720 26079 23770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 24795 24946 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26137 26403 gene locus_tag LOCUS_16730 26137 26403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 26644 26375 gene locus_tag LOCUS_16740 gene rpsO 26644 26375 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391531.1 protein_id gnl|my_center|LOCUS_16740 27586 26669 gene locus_tag LOCUS_16750 gene truB 27586 26669 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391530.1 protein_id gnl|my_center|LOCUS_16750 27844 29013 gene locus_tag LOCUS_16760 27844 29013 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626382.1 protein_id gnl|my_center|LOCUS_16760 29017 29811 gene locus_tag LOCUS_16770 29017 29811 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390199.1 protein_id gnl|my_center|LOCUS_16770 29818 30774 gene locus_tag LOCUS_16780 29818 30774 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390200.1 protein_id gnl|my_center|LOCUS_16780 30771 31361 gene locus_tag LOCUS_16790 30771 31361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 32750 31404 gene locus_tag LOCUS_16800 32750 31404 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268208.1 protein_id gnl|my_center|LOCUS_16800 33947 32808 gene locus_tag LOCUS_16810 33947 32808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 37272 34177 gene locus_tag LOCUS_16820 37272 34177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 39102 37303 gene locus_tag LOCUS_16830 39102 37303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 40596 39151 gene locus_tag LOCUS_16840 40596 39151 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_16840 42867 40600 gene locus_tag LOCUS_16850 42867 40600 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_16850 43507 43007 gene locus_tag LOCUS_16860 43507 43007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 43506 47021 gene locus_tag LOCUS_16870 gene metH 43506 47021 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389284.1 protein_id gnl|my_center|LOCUS_16870 47100 48800 gene locus_tag LOCUS_16880 47100 48800 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930276.1 protein_id gnl|my_center|LOCUS_16880 48950 49234 gene locus_tag LOCUS_16890 48950 49234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 49276 49800 gene locus_tag LOCUS_16900 49276 49800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 49848 51326 gene locus_tag LOCUS_16910 gene purF 49848 51326 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388163.1 protein_id gnl|my_center|LOCUS_16910 52168 51470 gene locus_tag LOCUS_16920 52168 51470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 53883 52174 gene locus_tag LOCUS_16930 53883 52174 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940385.1 protein_id gnl|my_center|LOCUS_16930 55373 53880 gene locus_tag LOCUS_16940 55373 53880 CDS product PqiA/YebS family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820402.1 protein_id gnl|my_center|LOCUS_16940 55545 55620 gene locus_tag LOCUS_t00310 55545 55620 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 57523 55823 gene locus_tag LOCUS_16950 57523 55823 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532166.1 protein_id gnl|my_center|LOCUS_16950 58275 57520 gene locus_tag LOCUS_16960 58275 57520 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_16960 58804 58301 gene locus_tag LOCUS_16970 58804 58301 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532841.1 protein_id gnl|my_center|LOCUS_16970 59428 58829 gene locus_tag LOCUS_16980 59428 58829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 59685 59461 gene locus_tag LOCUS_16990 59685 59461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 60487 59738 gene locus_tag LOCUS_17000 60487 59738 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390994.1 protein_id gnl|my_center|LOCUS_17000 60849 60550 gene locus_tag LOCUS_17010 60849 60550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 61907 60969 gene locus_tag LOCUS_17020 61907 60969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 63153 61909 gene locus_tag LOCUS_17030 gene mtaB 63153 61909 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 protein_id gnl|my_center|LOCUS_17030 63965 63150 gene locus_tag LOCUS_17040 gene dapF 63965 63150 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921513.1 protein_id gnl|my_center|LOCUS_17040 64440 64039 gene locus_tag LOCUS_17050 64440 64039 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339147.1 protein_id gnl|my_center|LOCUS_17050 64597 66504 gene locus_tag LOCUS_17060 64597 66504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 66619 68586 gene locus_tag LOCUS_17070 66619 68586 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391806.1 protein_id gnl|my_center|LOCUS_17070 68349 68472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69446 68700 gene locus_tag LOCUS_17080 69446 68700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 69601 71187 gene locus_tag LOCUS_17090 69601 71187 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532536.1 protein_id gnl|my_center|LOCUS_17090 71213 71716 gene locus_tag LOCUS_17100 71213 71716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 72411 71815 gene locus_tag LOCUS_17110 72411 71815 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261778.1 protein_id gnl|my_center|LOCUS_17110 72791 72597 gene locus_tag LOCUS_17120 72791 72597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 73936 73247 gene locus_tag LOCUS_17130 73936 73247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 74563 74090 gene locus_tag LOCUS_17140 gene ruvX 74563 74090 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390926.1 protein_id gnl|my_center|LOCUS_17140 74645 74932 gene locus_tag LOCUS_17150 gene gatC 74645 74932 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719430.1 protein_id gnl|my_center|LOCUS_17150 74934 76421 gene locus_tag LOCUS_17160 gene gatA 74934 76421 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390924.1 protein_id gnl|my_center|LOCUS_17160 76418 77872 gene locus_tag LOCUS_17170 gene gatB 76418 77872 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390923.1 protein_id gnl|my_center|LOCUS_17170 77989 78080 gene locus_tag LOCUS_t00320 77989 78080 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78640 78410 gene locus_tag LOCUS_17180 78640 78410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 79104 78637 gene locus_tag LOCUS_17190 79104 78637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 79339 79118 gene locus_tag LOCUS_17200 79339 79118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 81490 79661 gene locus_tag LOCUS_17210 81490 79661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 81855 81490 gene locus_tag LOCUS_17220 81855 81490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 83328 82291 gene locus_tag LOCUS_17230 83328 82291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 84617 83505 gene locus_tag LOCUS_17240 84617 83505 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463475.1 protein_id gnl|my_center|LOCUS_17240 85372 84977 gene locus_tag LOCUS_17250 85372 84977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 85790 85326 gene locus_tag LOCUS_17260 85790 85326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 86476 85787 gene locus_tag LOCUS_17270 86476 85787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 89285 86778 gene locus_tag LOCUS_17280 89285 86778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 89620 89282 gene locus_tag LOCUS_17290 89620 89282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 90024 89758 gene locus_tag LOCUS_17300 90024 89758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 90275 90036 gene locus_tag LOCUS_17310 90275 90036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 91555 91307 gene locus_tag LOCUS_17320 91555 91307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 91811 91548 gene locus_tag LOCUS_17330 91811 91548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 92074 91808 gene locus_tag LOCUS_17340 92074 91808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 92292 92071 gene locus_tag LOCUS_17350 92292 92071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 92528 92289 gene locus_tag LOCUS_17360 92528 92289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 92813 93085 gene locus_tag LOCUS_17370 92813 93085 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387924.1 protein_id gnl|my_center|LOCUS_17370 94361 93243 gene locus_tag LOCUS_17380 94361 93243 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943079.1 protein_id gnl|my_center|LOCUS_17380 94613 95491 gene locus_tag LOCUS_17390 94613 95491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 96094 96330 gene locus_tag LOCUS_17400 96094 96330 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090956.1 protein_id gnl|my_center|LOCUS_17400 96334 97797 gene locus_tag LOCUS_17410 96334 97797 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_17410 99068 97926 gene locus_tag LOCUS_17420 99068 97926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 99231 99551 gene locus_tag LOCUS_17430 99231 99551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 99858 100052 gene locus_tag LOCUS_17440 99858 100052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 101169 100540 gene locus_tag LOCUS_17450 101169 100540 CDS product phage baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098033.1 protein_id gnl|my_center|LOCUS_17450 101963 101166 gene locus_tag LOCUS_17460 101963 101166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098034.1 protein_id gnl|my_center|LOCUS_17460 103515 102088 gene locus_tag LOCUS_17470 103515 102088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence13 511 1053 gene locus_tag LOCUS_17480 511 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 2130 1645 gene locus_tag LOCUS_17490 gene rpsI 2130 1645 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_17490 2612 2136 gene locus_tag LOCUS_17500 gene rplM 2612 2136 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312738.1 protein_id gnl|my_center|LOCUS_17500 2832 4181 gene locus_tag LOCUS_17510 2832 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5107 4397 gene locus_tag LOCUS_17520 gene phoU 5107 4397 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_17520 5952 5125 gene locus_tag LOCUS_17530 gene pstB 5952 5125 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083914.1 protein_id gnl|my_center|LOCUS_17530 6833 5949 gene locus_tag LOCUS_17540 gene pstA 6833 5949 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_17540 7819 6833 gene locus_tag LOCUS_17550 gene pstC 7819 6833 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 protein_id gnl|my_center|LOCUS_17550 8113 9981 gene locus_tag LOCUS_17560 gene ilvD 8113 9981 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887775.1 protein_id gnl|my_center|LOCUS_17560 10419 10171 gene locus_tag LOCUS_17570 10419 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 11399 10704 gene locus_tag LOCUS_17580 11399 10704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 13321 12251 gene locus_tag LOCUS_17590 13321 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 14873 13308 gene locus_tag LOCUS_17600 14873 13308 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_17600 16175 14970 gene locus_tag LOCUS_17610 16175 14970 CDS product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268737.1 protein_id gnl|my_center|LOCUS_17610 16354 17481 gene locus_tag LOCUS_17620 16354 17481 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392735.1 protein_id gnl|my_center|LOCUS_17620 17828 17553 gene locus_tag LOCUS_17630 17828 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 18119 18931 gene locus_tag LOCUS_17640 18119 18931 CDS product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528557.1 protein_id gnl|my_center|LOCUS_17640 18922 19668 gene locus_tag LOCUS_17650 18922 19668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 19649 20320 gene locus_tag LOCUS_17660 19649 20320 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528559.1 protein_id gnl|my_center|LOCUS_17660 21325 20417 gene locus_tag LOCUS_17670 gene thyX 21325 20417 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_17670 21610 21440 gene locus_tag LOCUS_17680 21610 21440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 21855 21562 gene locus_tag LOCUS_17690 21855 21562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 21740 22276 gene locus_tag LOCUS_17700 21740 22276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 22435 22220 gene locus_tag LOCUS_17710 22435 22220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 22827 23366 gene locus_tag LOCUS_17720 22827 23366 CDS product ClpXP protease specificity-enhancing factor SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089258.1 protein_id gnl|my_center|LOCUS_17720 23417 25072 gene locus_tag LOCUS_17730 23417 25072 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_17730 25131 25523 gene locus_tag LOCUS_17740 25131 25523 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729391.1 protein_id gnl|my_center|LOCUS_17740 27166 25592 gene locus_tag LOCUS_17750 27166 25592 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037352.1 protein_id gnl|my_center|LOCUS_17750 28891 27632 gene locus_tag LOCUS_17760 28891 27632 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972918.1 protein_id gnl|my_center|LOCUS_17760 30057 28921 gene locus_tag LOCUS_17770 gene alr 30057 28921 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972917.1 protein_id gnl|my_center|LOCUS_17770 30195 30647 gene locus_tag LOCUS_17780 30195 30647 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168297222.1 protein_id gnl|my_center|LOCUS_17780 31134 30790 gene locus_tag LOCUS_17790 31134 30790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 33962 31254 gene locus_tag LOCUS_17800 gene infB 33962 31254 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626661.1 protein_id gnl|my_center|LOCUS_17800 34612 33959 gene locus_tag LOCUS_17810 34612 33959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 36174 34642 gene locus_tag LOCUS_17820 gene nusA 36174 34642 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_17820 36789 36205 gene locus_tag LOCUS_17830 gene rimP 36789 36205 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391525.1 protein_id gnl|my_center|LOCUS_17830 37016 37603 gene locus_tag LOCUS_17840 37016 37603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 37600 38880 gene locus_tag LOCUS_17850 37600 38880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 38892 39854 gene locus_tag LOCUS_17860 38892 39854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 40915 40016 gene locus_tag LOCUS_17870 40915 40016 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393262.1 protein_id gnl|my_center|LOCUS_17870 42705 41152 gene locus_tag LOCUS_17880 42705 41152 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_17880 43448 42702 gene locus_tag LOCUS_17890 43448 42702 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925341.1 protein_id gnl|my_center|LOCUS_17890 46251 43531 gene locus_tag LOCUS_17900 gene acnA 46251 43531 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391258.1 protein_id gnl|my_center|LOCUS_17900 46440 46297 gene locus_tag LOCUS_17910 46440 46297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 46467 47204 gene locus_tag LOCUS_17920 gene ccmA 46467 47204 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387801.1 protein_id gnl|my_center|LOCUS_17920 47201 47869 gene locus_tag LOCUS_17930 gene ccmB 47201 47869 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_17930 48975 47929 gene locus_tag LOCUS_17940 48975 47929 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532104.1 protein_id gnl|my_center|LOCUS_17940 49330 49536 gene locus_tag LOCUS_17950 49330 49536 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389667.1 protein_id gnl|my_center|LOCUS_17950 50348 49629 gene locus_tag LOCUS_17960 50348 49629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 51663 50533 gene locus_tag LOCUS_17970 51663 50533 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440409.1 protein_id gnl|my_center|LOCUS_17970 52128 53117 gene locus_tag LOCUS_17980 52128 53117 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090209.1 protein_id gnl|my_center|LOCUS_17980 53904 53284 gene locus_tag LOCUS_17990 53904 53284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 54184 54621 gene locus_tag LOCUS_18000 gene aroQ 54184 54621 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_18000 54618 55082 gene locus_tag LOCUS_18010 54618 55082 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390187.1 protein_id gnl|my_center|LOCUS_18010 55082 56425 gene locus_tag LOCUS_18020 gene accC 55082 56425 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971547.1 protein_id gnl|my_center|LOCUS_18020 56585 57364 gene locus_tag LOCUS_18030 56585 57364 CDS product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206670.1 protein_id gnl|my_center|LOCUS_18030 58927 57437 gene locus_tag LOCUS_18040 58927 57437 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896962.1 protein_id gnl|my_center|LOCUS_18040 59353 61203 gene locus_tag LOCUS_18050 gene thiC 59353 61203 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243935.1 protein_id gnl|my_center|LOCUS_18050 61832 63775 gene locus_tag LOCUS_18060 61832 63775 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031470.1 protein_id gnl|my_center|LOCUS_18060 64057 63854 gene locus_tag LOCUS_18070 64057 63854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 64547 65251 gene locus_tag LOCUS_18080 64547 65251 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920046.1 protein_id gnl|my_center|LOCUS_18080 65325 66107 gene locus_tag LOCUS_18090 65325 66107 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112848.1 protein_id gnl|my_center|LOCUS_18090 66458 66192 gene locus_tag LOCUS_18100 66458 66192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 66357 66842 gene locus_tag LOCUS_18110 gene bfr 66357 66842 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188572.1 protein_id gnl|my_center|LOCUS_18110 67254 66892 gene locus_tag LOCUS_18120 67254 66892 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968490.1 protein_id gnl|my_center|LOCUS_18120 67492 67674 gene locus_tag LOCUS_18130 67492 67674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 67679 68728 gene locus_tag LOCUS_18140 gene mdtN 67679 68728 CDS product multidrug transporter subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210376.1 protein_id gnl|my_center|LOCUS_18140 68709 70493 gene locus_tag LOCUS_18150 68709 70493 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210377.1 protein_id gnl|my_center|LOCUS_18150 70594 72105 gene locus_tag LOCUS_18160 70594 72105 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694565.1 protein_id gnl|my_center|LOCUS_18160 72683 72111 gene locus_tag LOCUS_18170 72683 72111 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918270.1 protein_id gnl|my_center|LOCUS_18170 73265 72738 gene locus_tag LOCUS_18180 73265 72738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 73985 76831 gene locus_tag LOCUS_18190 73985 76831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 76898 78664 gene locus_tag LOCUS_18200 76898 78664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 79395 79195 gene locus_tag LOCUS_18210 79395 79195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence14 306 773 gene locus_tag LOCUS_18220 306 773 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263922.1 protein_id gnl|my_center|LOCUS_18220 798 3026 gene locus_tag LOCUS_18230 798 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3378 4211 gene locus_tag LOCUS_18240 3378 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18240 4242 5660 gene locus_tag LOCUS_18250 4242 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18250 5931 6233 gene locus_tag LOCUS_18260 5931 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 6230 7849 gene locus_tag LOCUS_18270 6230 7849 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390068.1 protein_id gnl|my_center|LOCUS_18270 8988 7963 gene locus_tag LOCUS_18280 8988 7963 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109991.1 protein_id gnl|my_center|LOCUS_18280 9051 9545 gene locus_tag LOCUS_18290 gene rutF 9051 9545 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028096.1 protein_id gnl|my_center|LOCUS_18290 9577 9711 gene locus_tag LOCUS_18300 9577 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 10523 9729 gene locus_tag LOCUS_18310 10523 9729 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200770.1 protein_id gnl|my_center|LOCUS_18310 11295 10516 gene locus_tag LOCUS_18320 11295 10516 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522663.1 protein_id gnl|my_center|LOCUS_18320 12200 11325 gene locus_tag LOCUS_18330 12200 11325 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526233.1 protein_id gnl|my_center|LOCUS_18330 12361 12915 gene locus_tag LOCUS_18340 12361 12915 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425978.1 protein_id gnl|my_center|LOCUS_18340 12996 13568 gene locus_tag LOCUS_18350 12996 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 14481 13816 gene locus_tag LOCUS_18360 14481 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 14793 15887 gene locus_tag LOCUS_18370 gene mtnA 14793 15887 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_18370 16125 16619 gene locus_tag LOCUS_18380 gene ybaK 16125 16619 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067704.1 protein_id gnl|my_center|LOCUS_18380 16785 17672 gene locus_tag LOCUS_18390 16785 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 18301 18431 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18528 18980 gene locus_tag LOCUS_18400 18528 18980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 19248 20303 gene locus_tag LOCUS_18410 gene rffG 19248 20303 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 protein_id gnl|my_center|LOCUS_18410 20303 21208 gene locus_tag LOCUS_18420 gene rfbA 20303 21208 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_18420 22302 21289 gene locus_tag LOCUS_18430 22302 21289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 24096 22492 gene locus_tag LOCUS_18440 gene guaA 24096 22492 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388108.1 protein_id gnl|my_center|LOCUS_18440 24325 24768 gene locus_tag LOCUS_18450 24325 24768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 24842 24918 gene locus_tag LOCUS_t00330 24842 24918 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25050 25496 gene locus_tag LOCUS_18460 25050 25496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 25711 26331 gene locus_tag LOCUS_18470 25711 26331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 26355 27992 gene locus_tag LOCUS_18480 26355 27992 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198666.1 protein_id gnl|my_center|LOCUS_18480 27985 29445 gene locus_tag LOCUS_18490 27985 29445 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847132.1 protein_id gnl|my_center|LOCUS_18490 30427 29474 gene locus_tag LOCUS_18500 gene panS 30427 29474 CDS product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 protein_id gnl|my_center|LOCUS_18500 30686 31054 gene locus_tag LOCUS_18510 30686 31054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 31141 32703 gene locus_tag LOCUS_18520 31141 32703 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275161.1 protein_id gnl|my_center|LOCUS_18520 33424 32741 gene locus_tag LOCUS_18530 33424 32741 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112849.1 protein_id gnl|my_center|LOCUS_18530 33750 33586 gene locus_tag LOCUS_18540 33750 33586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 34638 33889 gene locus_tag LOCUS_18550 34638 33889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 36333 34756 gene locus_tag LOCUS_18560 gene purH 36333 34756 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391402.1 protein_id gnl|my_center|LOCUS_18560 37140 36427 gene locus_tag LOCUS_18570 gene trmB 37140 36427 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 protein_id gnl|my_center|LOCUS_18570 38349 37162 gene locus_tag LOCUS_18580 gene metK 38349 37162 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 protein_id gnl|my_center|LOCUS_18580 39417 38623 gene locus_tag LOCUS_18590 gene dapB 39417 38623 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387915.1 protein_id gnl|my_center|LOCUS_18590 40617 39457 gene locus_tag LOCUS_18600 gene dnaJ 40617 39457 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626618.1 protein_id gnl|my_center|LOCUS_18600 42675 40771 gene locus_tag LOCUS_18610 gene dnaK 42675 40771 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391302.1 protein_id gnl|my_center|LOCUS_18610 43474 42872 gene locus_tag LOCUS_18620 gene grpE 43474 42872 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026613481.1 protein_id gnl|my_center|LOCUS_18620 43665 44378 gene locus_tag LOCUS_18630 43665 44378 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_18630 44387 46153 gene locus_tag LOCUS_18640 44387 46153 CDS product stimulus-sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_18640 46556 46179 gene locus_tag LOCUS_18650 46556 46179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 46802 47770 gene locus_tag LOCUS_18660 gene rapZ 46802 47770 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470669.1 protein_id gnl|my_center|LOCUS_18660 47973 49241 gene locus_tag LOCUS_18670 47973 49241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 50418 49390 gene locus_tag LOCUS_18680 50418 49390 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_18680 50836 52485 gene locus_tag LOCUS_18690 50836 52485 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275403.1 protein_id gnl|my_center|LOCUS_18690 53110 52493 gene locus_tag LOCUS_18700 53110 52493 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_18700 53267 54163 gene locus_tag LOCUS_18710 53267 54163 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789758.1 protein_id gnl|my_center|LOCUS_18710 54175 54660 gene locus_tag LOCUS_18720 54175 54660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 57132 54778 gene locus_tag LOCUS_18730 gene clpA 57132 54778 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_18730 57701 57321 gene locus_tag LOCUS_18740 gene clpS 57701 57321 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440419.1 protein_id gnl|my_center|LOCUS_18740 58161 59150 gene locus_tag LOCUS_18750 58161 59150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 59349 60149 gene locus_tag LOCUS_18760 gene map 59349 60149 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388491.1 protein_id gnl|my_center|LOCUS_18760 60156 61973 gene locus_tag LOCUS_18770 gene ggt 60156 61973 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266573.1 protein_id gnl|my_center|LOCUS_18770 61980 62513 gene locus_tag LOCUS_18780 61980 62513 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971034.1 protein_id gnl|my_center|LOCUS_18780 62527 62695 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 63977 62928 gene locus_tag LOCUS_18790 63977 62928 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087160.1 protein_id gnl|my_center|LOCUS_18790 64103 65047 gene locus_tag LOCUS_18800 gene epmA 64103 65047 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338254.1 protein_id gnl|my_center|LOCUS_18800 65131 65547 gene locus_tag LOCUS_18810 65131 65547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 65605 66423 gene locus_tag LOCUS_18820 65605 66423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 67259 66810 gene locus_tag LOCUS_18830 67259 66810 CDS product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175227.1 protein_id gnl|my_center|LOCUS_18830 68010 67396 gene locus_tag LOCUS_18840 gene thiE 68010 67396 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 protein_id gnl|my_center|LOCUS_18840 68965 68051 gene locus_tag LOCUS_18850 68965 68051 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_18850 69494 69018 gene locus_tag LOCUS_18860 69494 69018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 69554 69820 gene locus_tag LOCUS_18870 69554 69820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 69824 70192 gene locus_tag LOCUS_18880 69824 70192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 70315 70902 gene locus_tag LOCUS_18890 70315 70902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 70927 71742 gene locus_tag LOCUS_18900 70927 71742 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388840.1 protein_id gnl|my_center|LOCUS_18900 72771 71899 gene locus_tag LOCUS_18910 72771 71899 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388273.1 protein_id gnl|my_center|LOCUS_18910 73916 72771 gene locus_tag LOCUS_18920 73916 72771 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_18920 74015 74632 gene locus_tag LOCUS_18930 74015 74632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 74734 75819 gene locus_tag LOCUS_18940 gene dinB 74734 75819 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083683.1 protein_id gnl|my_center|LOCUS_18940 76082 76786 gene locus_tag LOCUS_18950 76082 76786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18950 76731 77591 gene locus_tag LOCUS_18960 76731 77591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18960 78321 77845 gene locus_tag LOCUS_18970 78321 77845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence15 583 233 gene locus_tag LOCUS_18980 583 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 899 705 gene locus_tag LOCUS_18990 899 705 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917997.1 protein_id gnl|my_center|LOCUS_18990 1632 922 gene locus_tag LOCUS_19000 1632 922 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_19000 2592 1636 gene locus_tag LOCUS_19010 gene trxA 2592 1636 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 protein_id gnl|my_center|LOCUS_19010 2826 5720 gene locus_tag LOCUS_19020 gene uvrA 2826 5720 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_19020 5722 6546 gene locus_tag LOCUS_19030 5722 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 6659 7942 gene locus_tag LOCUS_19040 6659 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225442.1 protein_id gnl|my_center|LOCUS_19040 9655 8198 gene locus_tag LOCUS_19050 9655 8198 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398431.1 protein_id gnl|my_center|LOCUS_19050 9939 11174 gene locus_tag LOCUS_19060 9939 11174 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100975.1 protein_id gnl|my_center|LOCUS_19060 11324 11887 gene locus_tag LOCUS_19070 11324 11887 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528064.1 protein_id gnl|my_center|LOCUS_19070 11986 12567 gene locus_tag LOCUS_19080 11986 12567 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816247.1 protein_id gnl|my_center|LOCUS_19080 12564 13271 gene locus_tag LOCUS_19090 12564 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 13281 13754 gene locus_tag LOCUS_19100 13281 13754 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917947.1 protein_id gnl|my_center|LOCUS_19100 13813 14706 gene locus_tag LOCUS_19110 13813 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 16057 14774 gene locus_tag LOCUS_19120 gene purD 16057 14774 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388404.1 protein_id gnl|my_center|LOCUS_19120 16108 17568 gene locus_tag LOCUS_19130 gene xseA 16108 17568 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387920.1 protein_id gnl|my_center|LOCUS_19130 17678 18025 gene locus_tag LOCUS_19140 17678 18025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 18132 18218 gene locus_tag LOCUS_t00340 18132 18218 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18253 19431 gene locus_tag LOCUS_19150 18253 19431 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_19150 19680 21668 gene locus_tag LOCUS_19160 19680 21668 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_19160 21769 22575 gene locus_tag LOCUS_19170 21769 22575 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731602.1 protein_id gnl|my_center|LOCUS_19170 23222 22830 gene locus_tag LOCUS_19180 23222 22830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 23571 24593 gene locus_tag LOCUS_19190 23571 24593 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388951.1 protein_id gnl|my_center|LOCUS_19190 24736 25209 gene locus_tag LOCUS_19200 24736 25209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 25212 25628 gene locus_tag LOCUS_19210 gene sdhD 25212 25628 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531168.1 protein_id gnl|my_center|LOCUS_19210 25726 27537 gene locus_tag LOCUS_19220 gene sdhA 25726 27537 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388959.1 protein_id gnl|my_center|LOCUS_19220 27574 28356 gene locus_tag LOCUS_19230 27574 28356 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972458.1 protein_id gnl|my_center|LOCUS_19230 28824 29321 gene locus_tag LOCUS_19240 28824 29321 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969303.1 protein_id gnl|my_center|LOCUS_19240 29559 30221 gene locus_tag LOCUS_19250 29559 30221 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_19250 31937 30714 gene locus_tag LOCUS_19260 31937 30714 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337524.1 protein_id gnl|my_center|LOCUS_19260 32959 31937 gene locus_tag LOCUS_19270 gene gap 32959 31937 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314726.1 protein_id gnl|my_center|LOCUS_19270 34980 32995 gene locus_tag LOCUS_19280 gene tkt 34980 32995 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388353.1 protein_id gnl|my_center|LOCUS_19280 35193 35675 gene locus_tag LOCUS_19290 35193 35675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 35780 37045 gene locus_tag LOCUS_19300 gene hemA 35780 37045 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919232.1 protein_id gnl|my_center|LOCUS_19300 37971 37195 gene locus_tag LOCUS_19310 37971 37195 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958530.1 protein_id gnl|my_center|LOCUS_19310 38150 39592 gene locus_tag LOCUS_19320 38150 39592 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390177.1 protein_id gnl|my_center|LOCUS_19320 39877 40908 gene locus_tag LOCUS_19330 gene recA 39877 40908 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_19330 41871 41356 gene locus_tag LOCUS_19340 41871 41356 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967890.1 protein_id gnl|my_center|LOCUS_19340 41968 42327 gene locus_tag LOCUS_19350 41968 42327 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389703.1 protein_id gnl|my_center|LOCUS_19350 42409 43968 gene locus_tag LOCUS_19360 42409 43968 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921572.1 protein_id gnl|my_center|LOCUS_19360 43956 46112 gene locus_tag LOCUS_19370 gene mdoH 43956 46112 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038607.1 protein_id gnl|my_center|LOCUS_19370 46412 47281 gene locus_tag LOCUS_19380 46412 47281 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_19380 47466 47619 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48160 47702 gene locus_tag LOCUS_19390 48160 47702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 48471 50732 gene locus_tag LOCUS_19400 48471 50732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 49823 49967 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 50837 51160 gene locus_tag LOCUS_19410 50837 51160 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309920.1 protein_id gnl|my_center|LOCUS_19410 51217 51813 gene locus_tag LOCUS_19420 gene recR 51217 51813 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533410.1 protein_id gnl|my_center|LOCUS_19420 51856 52656 gene locus_tag LOCUS_19430 51856 52656 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_19430 52658 53071 gene locus_tag LOCUS_19440 52658 53071 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_19440 53506 53177 gene locus_tag LOCUS_19450 53506 53177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 53484 53708 gene locus_tag LOCUS_19460 53484 53708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 53739 55115 gene locus_tag LOCUS_19470 gene aroA 53739 55115 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388048.1 protein_id gnl|my_center|LOCUS_19470 55112 55753 gene locus_tag LOCUS_19480 55112 55753 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339438.1 protein_id gnl|my_center|LOCUS_19480 56061 57773 gene locus_tag LOCUS_19490 gene rpsA 56061 57773 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388046.1 protein_id gnl|my_center|LOCUS_19490 58199 57927 gene locus_tag LOCUS_19500 58199 57927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 58147 59331 gene locus_tag LOCUS_19510 58147 59331 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267915.1 protein_id gnl|my_center|LOCUS_19510 60573 59344 gene locus_tag LOCUS_19520 gene mtnK 60573 59344 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087665.1 protein_id gnl|my_center|LOCUS_19520 61337 60738 gene locus_tag LOCUS_19530 gene rdgB 61337 60738 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391387.1 protein_id gnl|my_center|LOCUS_19530 62065 61334 gene locus_tag LOCUS_19540 gene rph 62065 61334 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918041.1 protein_id gnl|my_center|LOCUS_19540 62156 63226 gene locus_tag LOCUS_19550 gene hrcA 62156 63226 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391389.1 protein_id gnl|my_center|LOCUS_19550 63305 66040 gene locus_tag LOCUS_19560 63305 66040 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_19560 66252 67223 gene locus_tag LOCUS_19570 gene prfB 66252 67223 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919740.1 protein_id gnl|my_center|LOCUS_19570 67907 68147 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 68226 68549 gene locus_tag LOCUS_19580 68226 68549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence16 3647 1122 gene locus_tag LOCUS_19590 3647 1122 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771478.1 protein_id gnl|my_center|LOCUS_19590 4910 3672 gene locus_tag LOCUS_19600 4910 3672 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958319.1 protein_id gnl|my_center|LOCUS_19600 5387 4956 gene locus_tag LOCUS_19610 5387 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 5956 5543 gene locus_tag LOCUS_19620 5956 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 6643 6068 gene locus_tag LOCUS_19630 6643 6068 CDS product DUF2612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181756.1 protein_id gnl|my_center|LOCUS_19630 7893 6643 gene locus_tag LOCUS_19640 7893 6643 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098032.1 protein_id gnl|my_center|LOCUS_19640 8239 7880 gene locus_tag LOCUS_19650 8239 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 8495 8247 gene locus_tag LOCUS_19660 8495 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 8415 10532 gene locus_tag LOCUS_19670 8415 10532 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389110.1 protein_id gnl|my_center|LOCUS_19670 11216 10560 gene locus_tag LOCUS_19680 11216 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 11422 11578 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12728 11730 gene locus_tag LOCUS_19690 12728 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098034.1 protein_id gnl|my_center|LOCUS_19690 13045 12725 gene locus_tag LOCUS_19700 13045 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 13809 13042 gene locus_tag LOCUS_19710 13809 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 15109 13877 gene locus_tag LOCUS_19720 15109 13877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 15755 15297 gene locus_tag LOCUS_19730 15755 15297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098039.1 protein_id gnl|my_center|LOCUS_19730 16201 15764 gene locus_tag LOCUS_19740 16201 15764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 17361 16204 gene locus_tag LOCUS_19750 17361 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 18053 17358 gene locus_tag LOCUS_19760 18053 17358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 18379 17990 gene locus_tag LOCUS_19770 18379 17990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 18777 18376 gene locus_tag LOCUS_19780 18777 18376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 18853 19093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20086 19766 gene locus_tag LOCUS_19790 20086 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098045.1 protein_id gnl|my_center|LOCUS_19790 21398 20361 gene locus_tag LOCUS_19800 21398 20361 CDS product DUF2184 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098046.1 protein_id gnl|my_center|LOCUS_19800 21898 21395 gene locus_tag LOCUS_19810 21898 21395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131489475.1 protein_id gnl|my_center|LOCUS_19810 23524 21902 gene locus_tag LOCUS_19820 23524 21902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 25274 23970 gene locus_tag LOCUS_19830 25274 23970 CDS product DUF1073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098050.1 protein_id gnl|my_center|LOCUS_19830 25678 26220 gene locus_tag LOCUS_19840 25678 26220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 26600 26316 gene locus_tag LOCUS_19850 26600 26316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 26875 27972 gene locus_tag LOCUS_19860 26875 27972 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153436966.1 protein_id gnl|my_center|LOCUS_19860 29684 28086 gene locus_tag LOCUS_19870 29684 28086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 29913 29632 gene locus_tag LOCUS_19880 29913 29632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 30477 31781 gene locus_tag LOCUS_19890 30477 31781 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207156.1 protein_id gnl|my_center|LOCUS_19890 33064 31892 gene locus_tag LOCUS_19900 33064 31892 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038314.1 protein_id gnl|my_center|LOCUS_19900 33515 35872 gene locus_tag LOCUS_19910 33515 35872 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_19910 36477 35896 gene locus_tag LOCUS_19920 36477 35896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 37146 36484 gene locus_tag LOCUS_19930 37146 36484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 38165 37149 gene locus_tag LOCUS_19940 38165 37149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 38539 38162 gene locus_tag LOCUS_19950 38539 38162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 39388 40140 gene locus_tag LOCUS_19960 39388 40140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 40810 40157 gene locus_tag LOCUS_19970 40810 40157 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387809.1 protein_id gnl|my_center|LOCUS_19970 40967 41266 gene locus_tag LOCUS_19980 40967 41266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 41816 41643 gene locus_tag LOCUS_19990 41816 41643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 41794 44223 gene locus_tag LOCUS_20000 41794 44223 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114848.1 protein_id gnl|my_center|LOCUS_20000 44567 44358 gene locus_tag LOCUS_20010 44567 44358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 44464 45693 gene locus_tag LOCUS_20020 44464 45693 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 protein_id gnl|my_center|LOCUS_20020 45690 46331 gene locus_tag LOCUS_20030 45690 46331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 46982 46476 gene locus_tag LOCUS_20040 46982 46476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20040 47673 47293 gene locus_tag LOCUS_20050 47673 47293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 48017 47670 gene locus_tag LOCUS_20060 48017 47670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 48173 48745 gene locus_tag LOCUS_20070 gene pncA 48173 48745 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338913.1 protein_id gnl|my_center|LOCUS_20070 48804 49580 gene locus_tag LOCUS_20080 48804 49580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 49601 51853 gene locus_tag LOCUS_20090 gene dcp 49601 51853 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275152.1 protein_id gnl|my_center|LOCUS_20090 51822 52016 gene locus_tag LOCUS_20100 51822 52016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 52104 52261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52579 52821 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53353 53524 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 53817 55181 gene locus_tag LOCUS_20110 53817 55181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 55320 55499 gene locus_tag LOCUS_20120 55320 55499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 56131 55505 gene locus_tag LOCUS_20130 56131 55505 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905027.1 protein_id gnl|my_center|LOCUS_20130 56558 57556 gene locus_tag LOCUS_20140 56558 57556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 57680 58342 gene locus_tag LOCUS_20150 57680 58342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 60151 58382 gene locus_tag LOCUS_20160 60151 58382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 60534 60151 gene locus_tag LOCUS_20170 60534 60151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 61271 60852 gene locus_tag LOCUS_20180 61271 60852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 61567 66459 gene locus_tag LOCUS_20190 61567 66459 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102960.1 protein_id gnl|my_center|LOCUS_20190 67586 66465 gene locus_tag LOCUS_20200 67586 66465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence17 1725 94 gene locus_tag LOCUS_20210 1725 94 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942354.1 protein_id gnl|my_center|LOCUS_20210 1898 1813 gene locus_tag LOCUS_t00350 1898 1813 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2689 1988 gene locus_tag LOCUS_20220 2689 1988 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_20220 3254 2793 gene locus_tag LOCUS_20230 3254 2793 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300228.1 protein_id gnl|my_center|LOCUS_20230 3729 3283 gene locus_tag LOCUS_20240 3729 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 4816 3746 gene locus_tag LOCUS_20250 4816 3746 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101898.1 protein_id gnl|my_center|LOCUS_20250 5983 4862 gene locus_tag LOCUS_20260 5983 4862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339273.1 protein_id gnl|my_center|LOCUS_20260 6054 6356 gene locus_tag LOCUS_20270 6054 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 6396 6821 gene locus_tag LOCUS_20280 6396 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 6969 7466 gene locus_tag LOCUS_20290 6969 7466 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966268.1 protein_id gnl|my_center|LOCUS_20290 7486 7680 gene locus_tag LOCUS_20300 7486 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 7710 8621 gene locus_tag LOCUS_20310 7710 8621 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112442.1 protein_id gnl|my_center|LOCUS_20310 8687 10159 gene locus_tag LOCUS_20320 8687 10159 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946399.1 protein_id gnl|my_center|LOCUS_20320 11082 10570 gene locus_tag LOCUS_20330 11082 10570 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038378.1 protein_id gnl|my_center|LOCUS_20330 11518 11084 gene locus_tag LOCUS_20340 11518 11084 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038379.1 protein_id gnl|my_center|LOCUS_20340 13116 11518 gene locus_tag LOCUS_20350 13116 11518 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920634.1 protein_id gnl|my_center|LOCUS_20350 14183 13479 gene locus_tag LOCUS_20360 14183 13479 CDS product purine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387822.1 protein_id gnl|my_center|LOCUS_20360 16157 14187 gene locus_tag LOCUS_20370 gene shc 16157 14187 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 protein_id gnl|my_center|LOCUS_20370 17513 16215 gene locus_tag LOCUS_20380 gene hpnE 17513 16215 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085787.1 protein_id gnl|my_center|LOCUS_20380 18429 17539 gene locus_tag LOCUS_20390 gene hpnD 18429 17539 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085786.1 protein_id gnl|my_center|LOCUS_20390 19363 18503 gene locus_tag LOCUS_20400 gene hpnC 19363 18503 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387826.1 protein_id gnl|my_center|LOCUS_20400 19553 19888 gene locus_tag LOCUS_20410 19553 19888 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112957.1 protein_id gnl|my_center|LOCUS_20410 21180 19960 gene locus_tag LOCUS_20420 21180 19960 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012165757.1 protein_id gnl|my_center|LOCUS_20420 22195 21200 gene locus_tag LOCUS_20430 22195 21200 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_20430 22405 23466 gene locus_tag LOCUS_20440 22405 23466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 23473 24402 gene locus_tag LOCUS_20450 23473 24402 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_20450 25429 24761 gene locus_tag LOCUS_20460 25429 24761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 26849 25899 gene locus_tag LOCUS_20470 26849 25899 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_20470 27063 27605 gene locus_tag LOCUS_20480 27063 27605 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844498.1 protein_id gnl|my_center|LOCUS_20480 27917 28447 gene locus_tag LOCUS_20490 27917 28447 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_20490 28729 28653 gene locus_tag LOCUS_t00360 28729 28653 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 29589 28981 gene locus_tag LOCUS_20500 29589 28981 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206572.1 protein_id gnl|my_center|LOCUS_20500 30508 29666 gene locus_tag LOCUS_20510 30508 29666 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 protein_id gnl|my_center|LOCUS_20510 31252 30725 gene locus_tag LOCUS_20520 gene ppa 31252 30725 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881004.1 protein_id gnl|my_center|LOCUS_20520 31405 31480 gene locus_tag LOCUS_t00370 31405 31480 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31540 33219 gene locus_tag LOCUS_20530 gene ettA 31540 33219 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_20530 33350 33853 gene locus_tag LOCUS_20540 33350 33853 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925883.1 protein_id gnl|my_center|LOCUS_20540 34639 34016 gene locus_tag LOCUS_20550 34639 34016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 35516 34647 gene locus_tag LOCUS_20560 35516 34647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 36628 35801 gene locus_tag LOCUS_20570 36628 35801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 36999 36778 gene locus_tag LOCUS_20580 36999 36778 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719290.1 protein_id gnl|my_center|LOCUS_20580 38093 36996 gene locus_tag LOCUS_20590 gene queG 38093 36996 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_20590 39330 38170 gene locus_tag LOCUS_20600 gene tgt 39330 38170 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388033.1 protein_id gnl|my_center|LOCUS_20600 40412 39327 gene locus_tag LOCUS_20610 gene queA 40412 39327 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388034.1 protein_id gnl|my_center|LOCUS_20610 40626 40844 gene locus_tag LOCUS_20620 40626 40844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 40872 41357 gene locus_tag LOCUS_20630 40872 41357 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704792.1 protein_id gnl|my_center|LOCUS_20630 42482 41451 gene locus_tag LOCUS_20640 42482 41451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 44019 43270 gene locus_tag LOCUS_20650 44019 43270 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887613.1 protein_id gnl|my_center|LOCUS_20650 44924 44016 gene locus_tag LOCUS_20660 gene folD 44924 44016 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640180.1 protein_id gnl|my_center|LOCUS_20660 44805 45089 gene locus_tag LOCUS_20670 44805 45089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 46281 45133 gene locus_tag LOCUS_20680 46281 45133 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626386.1 protein_id gnl|my_center|LOCUS_20680 46771 46307 gene locus_tag LOCUS_20690 46771 46307 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_20690 48347 46821 gene locus_tag LOCUS_20700 48347 46821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 48565 48933 gene locus_tag LOCUS_20710 48565 48933 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087052.1 protein_id gnl|my_center|LOCUS_20710 49035 49598 gene locus_tag LOCUS_20720 gene mlaD 49035 49598 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 protein_id gnl|my_center|LOCUS_20720 49637 49855 gene locus_tag LOCUS_20730 49637 49855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214913.1 protein_id gnl|my_center|LOCUS_20730 49852 50457 gene locus_tag LOCUS_20740 49852 50457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 50589 51371 gene locus_tag LOCUS_20750 gene otsB 50589 51371 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533988.1 protein_id gnl|my_center|LOCUS_20750 51375 52721 gene locus_tag LOCUS_20760 gene otsA 51375 52721 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967126.1 protein_id gnl|my_center|LOCUS_20760 52718 53233 gene locus_tag LOCUS_20770 52718 53233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 53706 53230 gene locus_tag LOCUS_20780 53706 53230 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528320.1 protein_id gnl|my_center|LOCUS_20780 53888 54871 gene locus_tag LOCUS_20790 53888 54871 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082273.1 protein_id gnl|my_center|LOCUS_20790 55012 55461 gene locus_tag LOCUS_20800 55012 55461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 55567 57831 gene locus_tag LOCUS_20810 gene uvrB 55567 57831 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470604.1 protein_id gnl|my_center|LOCUS_20810 58892 57846 gene locus_tag LOCUS_20820 gene ydiK 58892 57846 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011416681.1 protein_id gnl|my_center|LOCUS_20820 59135 61126 gene locus_tag LOCUS_20830 59135 61126 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390407.1 protein_id gnl|my_center|LOCUS_20830 61333 61878 gene locus_tag LOCUS_20840 61333 61878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 62035 64728 gene locus_tag LOCUS_20850 62035 64728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 65592 64816 gene locus_tag LOCUS_20860 65592 64816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 66998 65589 gene locus_tag LOCUS_20870 66998 65589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence18 170 351 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 664 924 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1650 1243 gene locus_tag LOCUS_20880 1650 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2027 3844 gene locus_tag LOCUS_20890 2027 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3828 5834 gene locus_tag LOCUS_20900 3828 5834 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268496.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20900 5881 6474 gene locus_tag LOCUS_20910 gene hslV 5881 6474 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528351.1 protein_id gnl|my_center|LOCUS_20910 6489 7802 gene locus_tag LOCUS_20920 gene hslU 6489 7802 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391347.1 protein_id gnl|my_center|LOCUS_20920 7802 8245 gene locus_tag LOCUS_20930 7802 8245 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 protein_id gnl|my_center|LOCUS_20930 11054 8730 gene locus_tag LOCUS_20940 11054 8730 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538095.1 protein_id gnl|my_center|LOCUS_20940 11523 11047 gene locus_tag LOCUS_20950 11523 11047 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_20950 12872 11544 gene locus_tag LOCUS_20960 12872 11544 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114259.1 protein_id gnl|my_center|LOCUS_20960 13573 13725 gene locus_tag LOCUS_20970 13573 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 15033 13987 gene locus_tag LOCUS_20980 15033 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 17162 15030 gene locus_tag LOCUS_20990 17162 15030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 18860 17388 gene locus_tag LOCUS_21000 18860 17388 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762615.1 protein_id gnl|my_center|LOCUS_21000 19345 19548 gene locus_tag LOCUS_21010 gene rpmI 19345 19548 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006201248.1 protein_id gnl|my_center|LOCUS_21010 19563 19922 gene locus_tag LOCUS_21020 gene rplT 19563 19922 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528310.1 protein_id gnl|my_center|LOCUS_21020 20123 21193 gene locus_tag LOCUS_21030 gene pheS 20123 21193 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391270.1 protein_id gnl|my_center|LOCUS_21030 21197 23656 gene locus_tag LOCUS_21040 gene pheT 21197 23656 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083531.1 protein_id gnl|my_center|LOCUS_21040 23707 24759 gene locus_tag LOCUS_21050 gene pstS 23707 24759 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407468.1 protein_id gnl|my_center|LOCUS_21050 26843 25173 gene locus_tag LOCUS_21060 26843 25173 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895659.1 protein_id gnl|my_center|LOCUS_21060 28828 27101 gene locus_tag LOCUS_21070 28828 27101 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390027.1 protein_id gnl|my_center|LOCUS_21070 29009 28839 gene locus_tag LOCUS_21080 29009 28839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 30566 29121 gene locus_tag LOCUS_21090 gene fumC 30566 29121 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990844.1 protein_id gnl|my_center|LOCUS_21090 30918 33578 gene locus_tag LOCUS_21100 30918 33578 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720592.1 protein_id gnl|my_center|LOCUS_21100 33532 33696 gene locus_tag LOCUS_21110 33532 33696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 34413 33862 gene locus_tag LOCUS_21120 34413 33862 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172340.1 protein_id gnl|my_center|LOCUS_21120 34734 35351 gene locus_tag LOCUS_21130 gene rpsD 34734 35351 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388459.1 protein_id gnl|my_center|LOCUS_21130 35460 37007 gene locus_tag LOCUS_21140 35460 37007 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086821.1 protein_id gnl|my_center|LOCUS_21140 37432 37571 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38824 37613 gene locus_tag LOCUS_21150 38824 37613 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972739.1 protein_id gnl|my_center|LOCUS_21150 40141 38828 gene locus_tag LOCUS_21160 40141 38828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 41595 40291 gene locus_tag LOCUS_21170 41595 40291 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047157.1 protein_id gnl|my_center|LOCUS_21170 41652 42452 gene locus_tag LOCUS_21180 41652 42452 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705592.1 protein_id gnl|my_center|LOCUS_21180 43581 42550 gene locus_tag LOCUS_21190 43581 42550 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705074.1 protein_id gnl|my_center|LOCUS_21190 45460 43676 gene locus_tag LOCUS_21200 45460 43676 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919399.1 protein_id gnl|my_center|LOCUS_21200 46507 45593 gene locus_tag LOCUS_21210 46507 45593 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390493.1 protein_id gnl|my_center|LOCUS_21210 48739 46514 gene locus_tag LOCUS_21220 48739 46514 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 protein_id gnl|my_center|LOCUS_21220 49082 49780 gene locus_tag LOCUS_21230 49082 49780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 49834 50559 gene locus_tag LOCUS_21240 49834 50559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 51779 50619 gene locus_tag LOCUS_21250 51779 50619 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388806.1 protein_id gnl|my_center|LOCUS_21250 52315 51776 gene locus_tag LOCUS_21260 gene purE 52315 51776 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529209.1 protein_id gnl|my_center|LOCUS_21260 52555 52349 gene locus_tag LOCUS_21270 52555 52349 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_21270 52782 52946 gene locus_tag LOCUS_21280 52782 52946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 53666 53064 gene locus_tag LOCUS_21290 53666 53064 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_21290 54393 53884 gene locus_tag LOCUS_21300 54393 53884 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974316.1 protein_id gnl|my_center|LOCUS_21300 54815 54588 gene locus_tag LOCUS_21310 gene rpmE 54815 54588 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388827.1 protein_id gnl|my_center|LOCUS_21310 55094 55552 gene locus_tag LOCUS_21320 gene mscL 55094 55552 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258546.1 protein_id gnl|my_center|LOCUS_21320 55624 56004 gene locus_tag LOCUS_21330 55624 56004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 57373 56438 gene locus_tag LOCUS_21340 57373 56438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21340 58946 57387 gene locus_tag LOCUS_21350 58946 57387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21350 59262 60242 gene locus_tag LOCUS_21360 59262 60242 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_21360 60446 62380 gene locus_tag LOCUS_21370 60446 62380 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923295.1 protein_id gnl|my_center|LOCUS_21370 62445 63461 gene locus_tag LOCUS_21380 62445 63461 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599080.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence19 1252 3312 gene locus_tag LOCUS_21390 1252 3312 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_21390 3312 4163 gene locus_tag LOCUS_21400 3312 4163 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 protein_id gnl|my_center|LOCUS_21400 4160 5167 gene locus_tag LOCUS_21410 4160 5167 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_21410 5164 5922 gene locus_tag LOCUS_21420 5164 5922 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_21420 6854 5931 gene locus_tag LOCUS_21430 6854 5931 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143729.1 protein_id gnl|my_center|LOCUS_21430 6974 8611 gene locus_tag LOCUS_21440 6974 8611 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114761.1 protein_id gnl|my_center|LOCUS_21440 8628 9704 gene locus_tag LOCUS_21450 8628 9704 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114760.1 protein_id gnl|my_center|LOCUS_21450 9673 11232 gene locus_tag LOCUS_21460 9673 11232 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_21460 11242 11976 gene locus_tag LOCUS_21470 11242 11976 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086661.1 protein_id gnl|my_center|LOCUS_21470 13195 12116 gene locus_tag LOCUS_21480 13195 12116 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_21480 14540 13227 gene locus_tag LOCUS_21490 14540 13227 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152046209.1 protein_id gnl|my_center|LOCUS_21490 14857 15621 gene locus_tag LOCUS_21500 14857 15621 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190781.1 protein_id gnl|my_center|LOCUS_21500 15709 16542 gene locus_tag LOCUS_21510 15709 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984979.1 protein_id gnl|my_center|LOCUS_21510 16600 17709 gene locus_tag LOCUS_21520 16600 17709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525081.1 protein_id gnl|my_center|LOCUS_21520 17717 17941 gene locus_tag LOCUS_21530 17717 17941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 19425 17953 gene locus_tag LOCUS_21540 19425 17953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 20239 19451 gene locus_tag LOCUS_21550 20239 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 20518 21234 gene locus_tag LOCUS_21560 20518 21234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339526.1 protein_id gnl|my_center|LOCUS_21560 23483 21261 gene locus_tag LOCUS_21570 23483 21261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 24549 23809 gene locus_tag LOCUS_21580 24549 23809 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 protein_id gnl|my_center|LOCUS_21580 25601 24561 gene locus_tag LOCUS_21590 25601 24561 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827578.1 protein_id gnl|my_center|LOCUS_21590 26466 25621 gene locus_tag LOCUS_21600 26466 25621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 28861 26525 gene locus_tag LOCUS_21610 28861 26525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 29888 29109 gene locus_tag LOCUS_21620 29888 29109 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874280.1 protein_id gnl|my_center|LOCUS_21620 31482 29878 gene locus_tag LOCUS_21630 31482 29878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 32456 31482 gene locus_tag LOCUS_21640 32456 31482 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626196.1 protein_id gnl|my_center|LOCUS_21640 32556 32380 gene locus_tag LOCUS_21650 32556 32380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 32873 33745 gene locus_tag LOCUS_21660 32873 33745 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532649.1 protein_id gnl|my_center|LOCUS_21660 33770 34711 gene locus_tag LOCUS_21670 33770 34711 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_21670 34748 36001 gene locus_tag LOCUS_21680 34748 36001 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_21680 37010 36114 gene locus_tag LOCUS_21690 37010 36114 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347707.1 protein_id gnl|my_center|LOCUS_21690 37119 38087 gene locus_tag LOCUS_21700 37119 38087 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064421.1 protein_id gnl|my_center|LOCUS_21700 38251 38907 gene locus_tag LOCUS_21710 38251 38907 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083903.1 protein_id gnl|my_center|LOCUS_21710 40315 38858 gene locus_tag LOCUS_21720 40315 38858 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206510.1 protein_id gnl|my_center|LOCUS_21720 40448 41848 gene locus_tag LOCUS_21730 gene hydA 40448 41848 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099919.1 protein_id gnl|my_center|LOCUS_21730 42886 41843 gene locus_tag LOCUS_21740 42886 41843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 43148 45547 gene locus_tag LOCUS_21750 43148 45547 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640416.1 protein_id gnl|my_center|LOCUS_21750 45718 47082 gene locus_tag LOCUS_21760 45718 47082 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530893.1 protein_id gnl|my_center|LOCUS_21760 47095 48363 gene locus_tag LOCUS_21770 gene preA 47095 48363 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530894.1 protein_id gnl|my_center|LOCUS_21770 48402 49676 gene locus_tag LOCUS_21780 48402 49676 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085703.1 protein_id gnl|my_center|LOCUS_21780 49750 51087 gene locus_tag LOCUS_21790 49750 51087 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 protein_id gnl|my_center|LOCUS_21790 51137 51529 gene locus_tag LOCUS_21800 51137 51529 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398711.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence20 214 548 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 939 787 gene locus_tag LOCUS_21810 939 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 1687 1989 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2619 2796 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2839 3117 gene locus_tag LOCUS_21820 2839 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 3470 3592 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3668 4153 gene locus_tag LOCUS_21830 3668 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 4418 4622 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4629 4871 gene locus_tag LOCUS_21840 4629 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 4947 5156 gene locus_tag LOCUS_21850 4947 5156 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531022.1 protein_id gnl|my_center|LOCUS_21850 5644 5207 gene locus_tag LOCUS_21860 5644 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 5740 6002 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7563 6559 gene locus_tag LOCUS_21870 7563 6559 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031646.1 protein_id gnl|my_center|LOCUS_21870 8305 7688 gene locus_tag LOCUS_21880 8305 7688 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_21880 8602 8393 gene locus_tag LOCUS_21890 8602 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 10076 8574 gene locus_tag LOCUS_21900 10076 8574 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262039.1 protein_id gnl|my_center|LOCUS_21900 10331 11263 gene locus_tag LOCUS_21910 10331 11263 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388403.1 protein_id gnl|my_center|LOCUS_21910 11270 11875 gene locus_tag LOCUS_21920 11270 11875 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776019.1 protein_id gnl|my_center|LOCUS_21920 12358 13572 gene locus_tag LOCUS_21930 12358 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 14943 13660 gene locus_tag LOCUS_21940 gene gabT 14943 13660 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 protein_id gnl|my_center|LOCUS_21940 16073 15117 gene locus_tag LOCUS_21950 gene ampR 16073 15117 CDS product LysR family transcriptional regulator AmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038155.1 protein_id gnl|my_center|LOCUS_21950 16229 16783 gene locus_tag LOCUS_21960 16229 16783 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140266.1 protein_id gnl|my_center|LOCUS_21960 16986 18293 gene locus_tag LOCUS_21970 16986 18293 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397312.1 protein_id gnl|my_center|LOCUS_21970 18475 18858 gene locus_tag LOCUS_21980 18475 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 20577 18931 gene locus_tag LOCUS_21990 20577 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 21114 20908 gene locus_tag LOCUS_22000 21114 20908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22000 21989 21108 gene locus_tag LOCUS_22010 21989 21108 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626297.1 protein_id gnl|my_center|LOCUS_22010 23850 22054 gene locus_tag LOCUS_22020 gene aspS 23850 22054 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_22020 23830 24009 gene locus_tag LOCUS_22030 23830 24009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 25020 23974 gene locus_tag LOCUS_22040 25020 23974 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105702.1 protein_id gnl|my_center|LOCUS_22040 25217 25828 gene locus_tag LOCUS_22050 25217 25828 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391493.1 protein_id gnl|my_center|LOCUS_22050 25924 26505 gene locus_tag LOCUS_22060 gene pth 25924 26505 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090174.1 protein_id gnl|my_center|LOCUS_22060 26505 27599 gene locus_tag LOCUS_22070 gene ychF 26505 27599 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391495.1 protein_id gnl|my_center|LOCUS_22070 27653 28951 gene locus_tag LOCUS_22080 27653 28951 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388993.1 protein_id gnl|my_center|LOCUS_22080 28972 29625 gene locus_tag LOCUS_22090 28972 29625 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388992.1 protein_id gnl|my_center|LOCUS_22090 29751 30173 gene locus_tag LOCUS_22100 29751 30173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 30236 30691 gene locus_tag LOCUS_22110 gene rlmH 30236 30691 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338553.1 protein_id gnl|my_center|LOCUS_22110 31265 30957 gene locus_tag LOCUS_22120 31265 30957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 32309 31374 gene locus_tag LOCUS_22130 32309 31374 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568594.1 protein_id gnl|my_center|LOCUS_22130 32419 33210 gene locus_tag LOCUS_22140 gene budA 32419 33210 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705051.1 protein_id gnl|my_center|LOCUS_22140 33763 34506 gene locus_tag LOCUS_22150 33763 34506 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_22150 34503 35897 gene locus_tag LOCUS_22160 34503 35897 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_22160 35894 36481 gene locus_tag LOCUS_22170 35894 36481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 37653 36580 gene locus_tag LOCUS_22180 37653 36580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 39092 37830 gene locus_tag LOCUS_22190 gene murA 39092 37830 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390681.1 protein_id gnl|my_center|LOCUS_22190 39656 39102 gene locus_tag LOCUS_22200 gene dcd 39656 39102 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381535.1 protein_id gnl|my_center|LOCUS_22200 39865 39647 gene locus_tag LOCUS_22210 39865 39647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 41777 40017 gene locus_tag LOCUS_22220 41777 40017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 41914 42162 gene locus_tag LOCUS_22230 41914 42162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 43071 42199 gene locus_tag LOCUS_22240 gene hpnK 43071 42199 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552372.1 protein_id gnl|my_center|LOCUS_22240 44549 43125 gene locus_tag LOCUS_22250 gene hpnJ 44549 43125 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_22250 45818 44655 gene locus_tag LOCUS_22260 gene hpnI 45818 44655 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197829.1 protein_id gnl|my_center|LOCUS_22260 46554 45895 gene locus_tag LOCUS_22270 46554 45895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 <47180 46551 gene locus_tag LOCUS_22280 <47180 46551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919929.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence21 606 82 gene locus_tag LOCUS_22290 606 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 914 609 gene locus_tag LOCUS_22300 914 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 1667 915 gene locus_tag LOCUS_22310 1667 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 1790 2326 gene locus_tag LOCUS_22320 1790 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2806 2666 gene locus_tag LOCUS_22330 2806 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 3297 2818 gene locus_tag LOCUS_22340 3297 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 4438 4163 gene locus_tag LOCUS_22350 4438 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22350 5201 4401 gene locus_tag LOCUS_22360 5201 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22360 6385 5855 gene locus_tag LOCUS_22370 6385 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 8811 7276 gene locus_tag LOCUS_22380 8811 7276 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065178.1 protein_id gnl|my_center|LOCUS_22380 11202 9070 gene locus_tag LOCUS_22390 11202 9070 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926958.1 protein_id gnl|my_center|LOCUS_22390 14192 11982 gene locus_tag LOCUS_22400 14192 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 14735 15241 gene locus_tag LOCUS_22410 gene mntR 14735 15241 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504117.1 protein_id gnl|my_center|LOCUS_22410 16022 15372 gene locus_tag LOCUS_22420 16022 15372 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028480.1 protein_id gnl|my_center|LOCUS_22420 17198 16215 gene locus_tag LOCUS_22430 17198 16215 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390710.1 protein_id gnl|my_center|LOCUS_22430 17534 17349 gene locus_tag LOCUS_22440 17534 17349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 17448 18710 gene locus_tag LOCUS_22450 17448 18710 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934974.1 protein_id gnl|my_center|LOCUS_22450 18952 19368 gene locus_tag LOCUS_22460 18952 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 19512 20132 gene locus_tag LOCUS_22470 gene mobA 19512 20132 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531703.1 protein_id gnl|my_center|LOCUS_22470 20125 20922 gene locus_tag LOCUS_22480 gene fdhD 20125 20922 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 protein_id gnl|my_center|LOCUS_22480 22762 21017 gene locus_tag LOCUS_22490 gene oprP 22762 21017 CDS product outer membrane porin OprP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119678.1 protein_id gnl|my_center|LOCUS_22490 23936 22926 gene locus_tag LOCUS_22500 gene pstS 23936 22926 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867146.1 protein_id gnl|my_center|LOCUS_22500 25351 24050 gene locus_tag LOCUS_22510 25351 24050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 26083 25388 gene locus_tag LOCUS_22520 gene phoB 26083 25388 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_22520 26349 26570 gene locus_tag LOCUS_22530 26349 26570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 28042 26753 gene locus_tag LOCUS_22540 28042 26753 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 protein_id gnl|my_center|LOCUS_22540 29321 28125 gene locus_tag LOCUS_22550 29321 28125 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388860.1 protein_id gnl|my_center|LOCUS_22550 30821 29358 gene locus_tag LOCUS_22560 30821 29358 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089633.1 protein_id gnl|my_center|LOCUS_22560 32111 30855 gene locus_tag LOCUS_22570 32111 30855 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387848.1 protein_id gnl|my_center|LOCUS_22570 32960 32121 gene locus_tag LOCUS_22580 gene trpA 32960 32121 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921372.1 protein_id gnl|my_center|LOCUS_22580 34213 32957 gene locus_tag LOCUS_22590 gene trpB 34213 32957 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391174.1 protein_id gnl|my_center|LOCUS_22590 34475 35218 gene locus_tag LOCUS_22600 34475 35218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 35211 35663 gene locus_tag LOCUS_22610 35211 35663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 35665 36183 gene locus_tag LOCUS_22620 35665 36183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 36506 37801 gene locus_tag LOCUS_22630 gene rho 36506 37801 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391366.1 protein_id gnl|my_center|LOCUS_22630 38152 37886 gene locus_tag LOCUS_22640 38152 37886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 38316 38807 gene locus_tag LOCUS_22650 38316 38807 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_22650 38804 39655 gene locus_tag LOCUS_22660 38804 39655 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_22660 39691 41331 gene locus_tag LOCUS_22670 gene lnt 39691 41331 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_22670 41422 41919 gene locus_tag LOCUS_22680 41422 41919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence22 401 685 gene locus_tag LOCUS_22690 401 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22690 784 1686 gene locus_tag LOCUS_22700 784 1686 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088296.1 protein_id gnl|my_center|LOCUS_22700 1804 2586 gene locus_tag LOCUS_22710 1804 2586 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246274.1 protein_id gnl|my_center|LOCUS_22710 2604 3350 gene locus_tag LOCUS_22720 2604 3350 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_22720 3684 4055 gene locus_tag LOCUS_22730 3684 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22730 4359 4886 gene locus_tag LOCUS_22740 4359 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22740 4958 5353 gene locus_tag LOCUS_22750 4958 5353 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_22750 5615 6439 gene locus_tag LOCUS_22760 5615 6439 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213364411.1 protein_id gnl|my_center|LOCUS_22760 6474 6776 gene locus_tag LOCUS_22770 6474 6776 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525618.1 protein_id gnl|my_center|LOCUS_22770 6760 7104 gene locus_tag LOCUS_22780 6760 7104 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_22780 7101 8807 gene locus_tag LOCUS_22790 gene ureC 7101 8807 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329296.1 protein_id gnl|my_center|LOCUS_22790 9280 9437 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9538 10245 gene locus_tag LOCUS_22800 9538 10245 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035255866.1 protein_id gnl|my_center|LOCUS_22800 10242 10856 gene locus_tag LOCUS_22810 gene ureG 10242 10856 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084276.1 protein_id gnl|my_center|LOCUS_22810 11001 12200 gene locus_tag LOCUS_22820 gene extI 11001 12200 CDS product selenite/tellurite reduction operon porin ExtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943570.1 protein_id gnl|my_center|LOCUS_22820 12266 12709 gene locus_tag LOCUS_22830 12266 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 13600 12713 gene locus_tag LOCUS_22840 13600 12713 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244002.1 protein_id gnl|my_center|LOCUS_22840 16923 13597 gene locus_tag LOCUS_22850 16923 13597 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083787.1 protein_id gnl|my_center|LOCUS_22850 17064 18404 gene locus_tag LOCUS_22860 gene urtA 17064 18404 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531849.1 protein_id gnl|my_center|LOCUS_22860 18397 19998 gene locus_tag LOCUS_22870 gene urtB 18397 19998 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084266.1 protein_id gnl|my_center|LOCUS_22870 19995 21134 gene locus_tag LOCUS_22880 gene urtC 19995 21134 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969813.1 protein_id gnl|my_center|LOCUS_22880 21131 21871 gene locus_tag LOCUS_22890 gene urtD 21131 21871 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084268.1 protein_id gnl|my_center|LOCUS_22890 21907 22602 gene locus_tag LOCUS_22900 gene urtE 21907 22602 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972304.1 protein_id gnl|my_center|LOCUS_22900 22643 23659 gene locus_tag LOCUS_22910 22643 23659 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000269.1 protein_id gnl|my_center|LOCUS_22910 24056 23709 gene locus_tag LOCUS_22920 24056 23709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 24281 26659 gene locus_tag LOCUS_22930 gene copA1 24281 26659 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence23 144 575 gene locus_tag LOCUS_22940 144 575 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764810.1 protein_id gnl|my_center|LOCUS_22940 3094 587 gene locus_tag LOCUS_22950 3094 587 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036288.1 protein_id gnl|my_center|LOCUS_22950 3509 3168 gene locus_tag LOCUS_22960 3509 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 3641 4189 gene locus_tag LOCUS_22970 gene mobB 3641 4189 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812685.1 protein_id gnl|my_center|LOCUS_22970 5202 4162 gene locus_tag LOCUS_22980 5202 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 6396 5476 gene locus_tag LOCUS_22990 gene fdhE 6396 5476 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368963.1 protein_id gnl|my_center|LOCUS_22990 7046 6393 gene locus_tag LOCUS_23000 gene fdnI 7046 6393 CDS product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705520.1 protein_id gnl|my_center|LOCUS_23000 7975 7049 gene locus_tag LOCUS_23010 gene fdxH 7975 7049 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817434.1 protein_id gnl|my_center|LOCUS_23010 11031 7981 gene locus_tag LOCUS_23020 gene fdnG 11031 7981 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830448.1 protein_id gnl|my_center|LOCUS_23020 11428 12399 gene locus_tag LOCUS_23030 11428 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 14057 12468 gene locus_tag LOCUS_23040 14057 12468 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090863.1 protein_id gnl|my_center|LOCUS_23040 14400 15827 gene locus_tag LOCUS_23050 14400 15827 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_23050 16554 15910 gene locus_tag LOCUS_23060 gene grxB 16554 15910 CDS product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 protein_id gnl|my_center|LOCUS_23060 16791 18416 gene locus_tag LOCUS_23070 16791 18416 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_23070 19642 18437 gene locus_tag LOCUS_23080 19642 18437 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191662.1 protein_id gnl|my_center|LOCUS_23080 20863 19745 gene locus_tag LOCUS_23090 20863 19745 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035548.1 protein_id gnl|my_center|LOCUS_23090 21092 21769 gene locus_tag LOCUS_23100 21092 21769 CDS product ribonuclease T2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545887.1 protein_id gnl|my_center|LOCUS_23100 22443 21799 gene locus_tag LOCUS_23110 22443 21799 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114764.1 protein_id gnl|my_center|LOCUS_23110 23306 22515 gene locus_tag LOCUS_23120 23306 22515 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387998.1 protein_id gnl|my_center|LOCUS_23120 24427 23303 gene locus_tag LOCUS_23130 24427 23303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 24620 24693 gene locus_tag LOCUS_t00380 24620 24693 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 25026 24835 gene locus_tag LOCUS_23140 25026 24835 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085193.1 protein_id gnl|my_center|LOCUS_23140 25526 26968 gene locus_tag LOCUS_23150 25526 26968 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 protein_id gnl|my_center|LOCUS_23150 27972 27079 gene locus_tag LOCUS_23160 27972 27079 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920323.1 protein_id gnl|my_center|LOCUS_23160 28083 28325 gene locus_tag LOCUS_23170 gene tusA 28083 28325 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_23170 28427 28657 gene locus_tag LOCUS_23180 28427 28657 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919931.1 protein_id gnl|my_center|LOCUS_23180 28665 29597 gene locus_tag LOCUS_23190 28665 29597 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence24 1093 1019 gene locus_tag LOCUS_t00390 1093 1019 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1328 1146 gene locus_tag LOCUS_23200 1328 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1283 3331 gene locus_tag LOCUS_23210 1283 3331 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087318.1 protein_id gnl|my_center|LOCUS_23210 3426 4034 gene locus_tag LOCUS_23220 gene hisB 3426 4034 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_23220 4167 4829 gene locus_tag LOCUS_23230 gene hisH 4167 4829 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242309.1 protein_id gnl|my_center|LOCUS_23230 4829 6166 gene locus_tag LOCUS_23240 4829 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 6166 6954 gene locus_tag LOCUS_23250 gene hisF 6166 6954 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391341.1 protein_id gnl|my_center|LOCUS_23250 6951 7463 gene locus_tag LOCUS_23260 6951 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 7463 7837 gene locus_tag LOCUS_23270 7463 7837 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_23270 7881 8471 gene locus_tag LOCUS_23280 7881 8471 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556057.1 protein_id gnl|my_center|LOCUS_23280 8476 9681 gene locus_tag LOCUS_23290 gene ubiM 8476 9681 CDS product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037777.1 protein_id gnl|my_center|LOCUS_23290 10561 10046 gene locus_tag LOCUS_23300 10561 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 11204 11129 gene locus_tag LOCUS_t00400 11204 11129 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12203 11271 gene locus_tag LOCUS_23310 12203 11271 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_23310 13002 12205 gene locus_tag LOCUS_23320 13002 12205 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_23320 13564 12989 gene locus_tag LOCUS_23330 gene rsmG 13564 12989 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178639.1 protein_id gnl|my_center|LOCUS_23330 15450 13582 gene locus_tag LOCUS_23340 gene mnmG 15450 13582 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067409.1 protein_id gnl|my_center|LOCUS_23340 16794 15472 gene locus_tag LOCUS_23350 gene mnmE 16794 15472 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391371.1 protein_id gnl|my_center|LOCUS_23350 16966 17514 gene locus_tag LOCUS_23360 16966 17514 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391368.1 protein_id gnl|my_center|LOCUS_23360 19620 17548 gene locus_tag LOCUS_23370 19620 17548 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037954.1 protein_id gnl|my_center|LOCUS_23370 20067 20312 gene locus_tag LOCUS_23380 20067 20312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 20323 20535 gene locus_tag LOCUS_23390 20323 20535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 21068 20992 gene locus_tag LOCUS_t00410 21068 20992 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21746 21159 gene locus_tag LOCUS_23400 21746 21159 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388110.1 protein_id gnl|my_center|LOCUS_23400 23013 21808 gene locus_tag LOCUS_23410 23013 21808 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185668.1 protein_id gnl|my_center|LOCUS_23410 23150 23725 gene locus_tag LOCUS_23420 23150 23725 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005374107.1 protein_id gnl|my_center|LOCUS_23420 24245 23793 gene locus_tag LOCUS_23430 gene hemJ 24245 23793 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338807.1 protein_id gnl|my_center|LOCUS_23430 24943 24248 gene locus_tag LOCUS_23440 24943 24248 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338579.1 protein_id gnl|my_center|LOCUS_23440 26022 24943 gene locus_tag LOCUS_23450 gene hemE 26022 24943 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085186.1 protein_id gnl|my_center|LOCUS_23450 26391 27023 gene locus_tag LOCUS_23460 26391 27023 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391361.1 protein_id gnl|my_center|LOCUS_23460 27108 27183 gene locus_tag LOCUS_t00420 27108 27183 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27335 28576 gene locus_tag LOCUS_23470 27335 28576 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence25 590 1705 gene locus_tag LOCUS_23480 gene hpnH 590 1705 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187762.1 protein_id gnl|my_center|LOCUS_23480 1981 3279 gene locus_tag LOCUS_23490 1981 3279 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969382.1 protein_id gnl|my_center|LOCUS_23490 4767 3688 gene locus_tag LOCUS_23500 4767 3688 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329210.1 protein_id gnl|my_center|LOCUS_23500 6221 4749 gene locus_tag LOCUS_23510 6221 4749 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_23510 6516 7436 gene locus_tag LOCUS_23520 6516 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 7491 8570 gene locus_tag LOCUS_23530 7491 8570 CDS product putative zinc-binding peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967100.1 protein_id gnl|my_center|LOCUS_23530 10439 8652 gene locus_tag LOCUS_23540 10439 8652 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_23540 11675 10800 gene locus_tag LOCUS_23550 11675 10800 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968997.1 protein_id gnl|my_center|LOCUS_23550 11881 13674 gene locus_tag LOCUS_23560 11881 13674 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 protein_id gnl|my_center|LOCUS_23560 13674 14597 gene locus_tag LOCUS_23570 13674 14597 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388016.1 protein_id gnl|my_center|LOCUS_23570 14698 15096 gene locus_tag LOCUS_23580 14698 15096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 15176 15382 gene locus_tag LOCUS_23590 15176 15382 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531022.1 protein_id gnl|my_center|LOCUS_23590 15904 18360 gene locus_tag LOCUS_23600 15904 18360 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973588.1 protein_id gnl|my_center|LOCUS_23600 18431 19321 gene locus_tag LOCUS_23610 18431 19321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 19446 20399 gene locus_tag LOCUS_23620 19446 20399 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329123.1 protein_id gnl|my_center|LOCUS_23620 22330 20438 gene locus_tag LOCUS_23630 22330 20438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence26 393 2657 gene locus_tag LOCUS_23640 393 2657 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_23640 2647 4041 gene locus_tag LOCUS_23650 2647 4041 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_23650 4108 4392 gene locus_tag LOCUS_23660 gene hfq 4108 4392 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389374.1 protein_id gnl|my_center|LOCUS_23660 4373 5689 gene locus_tag LOCUS_23670 gene hflX 4373 5689 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389375.1 protein_id gnl|my_center|LOCUS_23670 5893 6798 gene locus_tag LOCUS_23680 5893 6798 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_23680 7512 6880 gene locus_tag LOCUS_23690 7512 6880 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153584.1 protein_id gnl|my_center|LOCUS_23690 10241 7635 gene locus_tag LOCUS_23700 gene clpB 10241 7635 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084221.1 protein_id gnl|my_center|LOCUS_23700 11134 10526 gene locus_tag LOCUS_23710 11134 10526 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384144.1 protein_id gnl|my_center|LOCUS_23710 11409 12143 gene locus_tag LOCUS_23720 11409 12143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 13042 12167 gene locus_tag LOCUS_23730 13042 12167 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_23730 13224 13862 gene locus_tag LOCUS_23740 13224 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 13936 14892 gene locus_tag LOCUS_23750 gene msrP 13936 14892 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401748.1 protein_id gnl|my_center|LOCUS_23750 14895 15515 gene locus_tag LOCUS_23760 gene msrQ 14895 15515 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252723.1 protein_id gnl|my_center|LOCUS_23760 17036 15597 gene locus_tag LOCUS_23770 17036 15597 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993982.1 protein_id gnl|my_center|LOCUS_23770 17188 18366 gene locus_tag LOCUS_23780 gene lpxB 17188 18366 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence27 337 1641 gene locus_tag LOCUS_23790 gene fliM 337 1641 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390467.1 protein_id gnl|my_center|LOCUS_23790 1613 2305 gene locus_tag LOCUS_23800 1613 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2822 2415 gene locus_tag LOCUS_23810 gene flgC 2822 2415 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313019.1 protein_id gnl|my_center|LOCUS_23810 2997 3270 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3625 4416 gene locus_tag LOCUS_23820 3625 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 6987 4423 gene locus_tag LOCUS_23830 6987 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 7527 7279 gene locus_tag LOCUS_23840 7527 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 7735 8535 gene locus_tag LOCUS_23850 7735 8535 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_23850 8696 9031 gene locus_tag LOCUS_23860 8696 9031 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089612.1 protein_id gnl|my_center|LOCUS_23860 9041 9316 gene locus_tag LOCUS_23870 gene fliQ 9041 9316 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_23870 9472 9311 gene locus_tag LOCUS_23880 9472 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 9435 10157 gene locus_tag LOCUS_23890 gene fliR 9435 10157 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088554.1 protein_id gnl|my_center|LOCUS_23890 10173 11252 gene locus_tag LOCUS_23900 gene flhB 10173 11252 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390448.1 protein_id gnl|my_center|LOCUS_23900 11496 12950 gene locus_tag LOCUS_23910 gene flgE 11496 12950 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626400.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence28 1312 1491 gene locus_tag LOCUS_23920 1312 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 1531 2277 gene locus_tag LOCUS_23930 1531 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2267 2560 gene locus_tag LOCUS_23940 2267 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3249 3512 gene locus_tag LOCUS_23950 3249 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 5526 3592 gene locus_tag LOCUS_23960 5526 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 7289 5655 gene locus_tag LOCUS_23970 7289 5655 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919439.1 protein_id gnl|my_center|LOCUS_23970 10122 7324 gene locus_tag LOCUS_23980 10122 7324 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035995.1 protein_id gnl|my_center|LOCUS_23980 10468 11058 gene locus_tag LOCUS_23990 10468 11058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 11163 12122 gene locus_tag LOCUS_24000 11163 12122 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973258.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence29 1650 343 gene locus_tag LOCUS_24010 1650 343 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266325.1 protein_id gnl|my_center|LOCUS_24010 3348 1669 gene locus_tag LOCUS_24020 gene ggt 3348 1669 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814321.1 protein_id gnl|my_center|LOCUS_24020 4369 4558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4591 5856 gene locus_tag LOCUS_24030 4591 5856 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532883.1 protein_id gnl|my_center|LOCUS_24030 6008 8521 gene locus_tag LOCUS_24040 6008 8521 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771478.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence30 854 1510 gene locus_tag LOCUS_24050 854 1510 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039589.1 protein_id gnl|my_center|LOCUS_24050 1545 2387 gene locus_tag LOCUS_24060 1545 2387 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 protein_id gnl|my_center|LOCUS_24060 3809 2397 gene locus_tag LOCUS_24070 gene pccR 3809 2397 CDS product propionyl-CoA assimilation transcriptional regulator PccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719339.1 protein_id gnl|my_center|LOCUS_24070 3939 5501 gene locus_tag LOCUS_24080 3939 5501 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104208.1 protein_id gnl|my_center|LOCUS_24080 5544 6710 gene locus_tag LOCUS_24090 gene prpC 5544 6710 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285927.1 protein_id gnl|my_center|LOCUS_24090 6707 7645 gene locus_tag LOCUS_24100 gene prpB 6707 7645 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390073.1 protein_id gnl|my_center|LOCUS_24100 7695 9692 gene locus_tag LOCUS_24110 gene acs 7695 9692 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921410.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence31 896 1354 gene locus_tag LOCUS_24120 896 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2555 1419 gene locus_tag LOCUS_24130 2555 1419 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419406.1 protein_id gnl|my_center|LOCUS_24130 2897 3463 gene locus_tag LOCUS_24140 2897 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 4775 3525 gene locus_tag LOCUS_24150 4775 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 5123 4788 gene locus_tag LOCUS_24160 5123 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 6818 5208 gene locus_tag LOCUS_24170 6818 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 7063 7842 gene locus_tag LOCUS_24180 7063 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180